Research Article
De novo genetic variation revealed in somatic sectors of single Arabidopsis plants [v1; ref status: indexed, http://f1000r.es/kw]
Marianne T Hopkins1, Aaron M Khalid1, Pei-Chun Chang1, Karen C Vanderhoek1, Dulcie Lai2, Meghan D Doerr1, Susan J Lolle1
Author affiliations
Grant information
Views 4365
Download as XML

Abstract

Concern over the tremendous loss of genetic diversity among many of our most important crops has prompted major efforts to preserve seed stocks derived from cultivated species and their wild relatives. Arabidopsis thaliana propagates mainly by self-fertilizing, and therefore, like many crop plants, theoretically has a limited potential for producing genetically diverse offspring. Despite this, inbreeding has persisted in Arabidopsis for over a million years suggesting that some underlying adaptive mechanism buffers the deleterious consequences of this reproductive strategy. Using presence-absence molecular markers we demonstrate that single Arabidopsis plants can have multiple genotypes. Sequence analyses reveal single nucleotide changes, loss of sequences and, surprisingly, acquisition of unique genomic insertions. Estimates based on quantitative analyses suggest that these genetically discordant sectors are very small but can have a complex genetic makeup. In ruling out more trivial explanations for these data, our findings raise the possibility that intrinsic drivers of genetic variation are responsible for the targeted sequence changes we detect. Given the evolutionary advantage afforded to populations with greater genetic diversity, we hypothesize that organisms that primarily self-fertilize or propagate clonally counteract the genetic cost of such reproductive strategies by leveraging a cryptic reserve of extra-genomic information.

Introduction

Plants live in ever changing environments and must adapt using strategies that fundamentally differ from those employed by animals. Developmental plasticity is at the core of those strategies allowing plants to modify their growth and the organs they produce in response to different environmental signals. This type of open-ended modular development enhances survival because damaged or diseased units can readily be discarded without compromising viability. Furthermore, because plants are constrained to sessile life styles, a modular growth habit affords greater versatility allowing phenotypic and genetic variation between modules to be used to the plant’s advantage, aiding adaption to pathogen life cycles1 or to longer-term environmental perturbations such as climate change. As a consequence of this profound developmental versatility, even individuals composed of cell populations derived from different plant species are viable and can coordinate the growth and development of chimeric organs2. In an elegant paper published in 1981, Whitham and Slobodchikoff3 proposed that mosaicism offers a unique adaptive advantage for plants by allowing introduction of genetic variants into the gene pool either through vegetative propagation or through sexual reproduction. They further propose that mutations arising somatically have a greater probability of being incorporated into the gene pool than mutations that arise in the gametes3 precisely because germ line cells are derived from somatic tissues that arise late in the developmental history of the plant4,5.

The relatively frequent occurrence of mosaics among various plant species has been extensively utilized in the development of novel ornamentals and for the selection and maintenance of desirable traits in many cultivated crops. Any desirable cultivars that have arisen in this manner have been maintained through vegetative propagation and, to date, are responsible for a significant fraction of agriculturally important perennial plants. On the other hand, desirable traits in many important annual crops, such as rice, soybean, maize and wheat, have been introduced through classical genetic manipulations using directed breeding strategies. Once generated, annuals with good agronomic performance are usually maintained by inbreeding.

In recent years, concern has grown over the presumed loss of genetic diversity resulting from the application of modern horticultural and breeding practices. Therefore, the benefit of excellent performance may come with a significant cost6,7. However, recent and surprising results suggest that even highly inbred species harbor unanticipated sources of intrinsic genetic variation. For example, highly inbred soybean cultivars have been shown to manifest significant phenotypic and genetic variation in the absence of sexual manipulation810. Such high intrinsic genetic variation has also been demonstrated for a number of other crop plants11.

In the natural world, inbreeding occurs in many highly successful flowering plant species including wild relatives of Arabidopsis thaliana12. Therefore, in nature species that are highly inbred have persisted despite their predicted reduction in genetic diversity. Why would such inbreeding strategies be successful and what are the implications from an adaptive perspective? One possibility put forward by Barrett13 is that such populations are very successful in their particular niches and benefit from producing large numbers of genetically identical offspring. Nevertheless, selection should favor plant species that can co-evolve on time scales reflecting particular environmental challenges such as fluctuations and variations in pathogen populations. In keeping with this view, it has been shown that sequence variation in 20 diverse strains of Arabidopsis is highly non-random. In gene families mediating biotic interactions, such as those implicated in pathogen defense, variation far exceeds that seen in families involved in basic biological processes14.

The underlying mechanisms driving phenotypic variation in highly inbred lines, whether domesticated or wild, have often been inferred and have had limited experimental verification. Nevertheless, relatively simple molecular approaches have provided insight into some of the genomic events coinciding with visible changes in phenotype. In flax, for example, molecular assays have demonstrated that heritable phenotypic changes induced by environmental shifts are accompanied by reproducible changes in genomic DNA including changes in total DNA content, non-random changes in DNA sequences or sequence rearrangements1518. In soybean, reproducible non-random DNA sequence changes induced by in vitro culturing of root explants have also been demonstrated using restriction fragment length polymorphic markers19. Genomic changes manifesting similar hallmarks of biased sequence alterations have also been described for banana20 and in rice hybrids21.

In the work described by Roth et al.19 soybean root explants were shown to repeatedly give rise to particular alleles that were absent in the donor plants but had previously been found and characterized in other varieties of cultivated soybean. To account for the appearance of these particular allelic variants the authors proposed that these organisms had evolved "internal generators of genetic variation" that mediated genome changes through some type of recombination process. In 2005, Lolle and colleagues22 described a genome-wide phenomenon in Arabidopsis hothead (hth) mutants that was very reminiscent of that described by Roth et al19. Based on the nature and genome-wide locations of the sequence changes detected, it was proposed that a template-directed process mediated these changes and that these cryptic but stable extra-genomic templates themselves had persisted since at least the grandparental generation. Not surprisingly, this proposal met with considerable skepticism and numerous alternative explanations for these data have since been published2328.

In this study we have employed presence-absence molecular markers to test for non-Mendelian inheritance and found that Arabidopsis plants can inherit novel insertion sequences that were absent in their immediate parents. Furthermore, we show that discordant DNA-based marker profiles can be found between tissues isolated from different parts of an individual plant. These experiments demonstrate that individual plants spontaneously produce somatic sectors and are genetic mosaics. Since genetic variation can occur in the same plant in the absence of sexual reproduction, we propose that these novel insertion sequences must originate from cryptic reserves intrinsic to the host plant itself. The data presented support the original contention that a previously unknown template-directed mechanism exists22 and raise the encouraging possibility that other inbreeding species, including crop plants, may also harbor a cryptic reserve of genetic variation.

Methods

Plant material and growth conditions

All genetic stocks of Arabidopsis thaliana used for these experiments have been described previously29. Arabidopsis seeds derived from these stocks were sown onto moistened potting mix (1:1 mixture of LC1:LG3 Sungro Sunshine potting mixes, Sungro Horticulture, Seba Beach, AB) and vernalized at 4°C for 2–5 days. Plants were maintained in growth chambers (Econoair AC60, Ecological Chambers Inc., Winnipeg, MB; GC8-VH/GCB-B, Environmental Growth Chambers, Chagrin Falls, Ohio; Conviron PGW36/E15, Controlled Environments Ltd., Winnipeg, MB) and illuminated with a mixture of incandescent and fluorescent lights (140 – 170μmol m-2 sec-1 at pot level) with a 24-hour photoperiod. Growth chambers were maintained at 20 ± 4°C at 40 – 60% relative humidity. Plants were grown in flats or in 3- or 6-inch pots and watered as needed. Seeds used for seedling root-shoot comparison were surface sterilized using bleach and plated on agar medium containing half strength MS basal salts (Sigma, St. Louis, USA). Seedlings were harvested approximately 5 days post-germination. Hybrid lines were generated between Landsberg and Columbia accessions by manual pollination and all crosses were done reciprocally. F2 seed was obtained from self-fertilized F1 plants. Individual F2 plants were reared in plastic tubes (Johnston Industrial Plastics, Ontario, Canada) and F3 seed collected from each F2 plant individually. Tissue samples were collected from individual F2 and F3 plants, and genotypic profiles were determined using insertion-deletion polymorphic molecular markers (see Figure 1).

78518a2f-74cf-4e0a-b4cc-618118db3438_figure1.gif

Figure 1. Haploid representation of the 5 Arabidopsis chromosomes indicating the relative locations of the 16 insertion-deletion polymorphic markers used in this study.

Nine of the markers are intergenic (*). Marker names reflect clone designations. The size of the insertion sequence is indicated in base pairs (bp). The relative location of HOTHEAD (HTH) is shown at the bottom of chromosome 1.

Out-crossing experiments

Experimental set ups were replicated twice and the net out-crossing frequencies determined. Herbicide-resistant transgenic Arabidopsis pollen donors previously transformed with the pCB302 mini binary vector only30 and mutant test plants were grown in a 1:1 ratio and arranged in randomized positions (www.random.org). Out-crossing frequencies were also compared to plants under the same conditions but reared within plastic tubes. Progeny were sprayed with glufosinate (40 micrograms ml-1 active ingredient: WipeOut, Nu-Gro IP Inc., Ontario) to test for herbicide resistance and resistant plants tested for segregation of hth mutant progeny plants.

DNA extraction and molecular genotyping

For DNA extraction, rosette or cauline leaf tissue was collected and DNA extracted according to the method of Edwards et al31. Samples not processed immediately were stored at -20°C. Sixteen sets of DNA oligonucleotide primers were designed to amplify approximately 150–300bp genomic regions by polymerase chain reactions (PCR), each containing one 45–94bp marker which is present in the Columbia but absent in the Landsberg accession (Table 1). PCR amplicon products were size separated by agarose gel electrophoresis.

Table 1. List of primer pairs used for PCR-based molecular genotyping.

Expected amplicon product sizes for the Columbia and Landsberg accessions are shown in adjacent columns.

Insertion-deletion
Marker
Primer pairs Columbia product
size in base pairs
Landsberg product
size in base pairs
F12K11ccatatcttggagttggcaga
tgtcttcaggaacacaacca
166121
F5J5tgaagatttcgtggaagcaa
ctcatggatgcctaataccg
275200
F6D8ctccgtcttccagagtttga
ttcgggtgattagtacggaaa
211107
F15H11atttgcggctgaaagacaag
tgagtgtgtcatgagtgtttgttt
229153
F23M2taaagttgttggccgaggag
tcggagatacccgagctaaa
231163
T14G11cctatgtgtcaagagagatttcca
tttgttccatttataagcgtttctc
286213
T6A23aacaccaagtcaactgtttttgtt
tcaaaataaacacccccaact
241180
T11I18ccccaattcgaaatgtaagg
cgctccttgacagttttcct
203129
MSA6ctggggtgttctcacaggat
cgttggaggtggtcttaggt
199145
T6H20tgcattggtttctctgcttg
gggaaacctccatactcgaa
231154
F4C21tggttagggttctggtcagg
agtggctcatcgttcgagat
195113
F16J13gaagcatgttttgtgtatcttgc
ccgcatctccacatttcatt
224144
F8D20caccagacggtgatgaagag
cattcgcgcatttattgttg
202117
F2P16aaaatggtttaccacatggaca
tcccaaatcaattcaaggaaa
223175
MNJ8catggatcaaagatgatctcca
ttcgcttttcgtgtttctga
184133
MGI19tgcacatgacttcaacagaaaa
atgtgggtgggtgttgattt
203156

Isolation, cloning and sequencing of PCR products

Portions of genomic DNA were PCR amplified and sequenced directly or products cloned into standard pGEM TA vectors (Promega). Amplified or cloned PCR products were sequenced at the Centre for Applied Genomics (http://www.tcag.ca/, Toronto, Ontario). Sequence alignments were generated using CLC Sequence Viewer 6.4 software (CLC bioA/S; www.clcbio.com).

qPCR Methods

Quantitative PCR was performed on a Bio-Rad Real-Time thermal cycler CFX96 attached to a computer running CFX Manager. SsoFast EvaGreen Supermix (Bio-Rad) was used according to manufacturer’s instructions. A series of primers either flanking or internal to the insertion sequences were used to generate control and experimental amplicons. The positive control was a PCR product amplified from the Columbia accession, spanning the indel sequence of interest by ~700–900bp. The positive control was gel purified and used to generate a standard curve for conversion of C(t) value to copy number of the insertion sequence and the external reference sequence. External reference primers immediately flanked the indel markers. Insertion sequences were detected using one external reference primer paired with a primer homologous to sequences within the insertion itself. Primer sequences and amplicon product sizes are listed in Table 2. The colors indicated in the first column (insertion-deletion marker) correspond to the colors used for the qPCR-generated bar graphs.

Table 2. List of primer sets used for qPCR analyses.

Primer positions, left and right primer sequences and expected amplicon sizes are indicated for each marker. Colors correspond to those used in Figure 5B and Figure 6B.

Insertion-deletion Marker Primer Position Left primer sequence Right primer sequence Product size in
base pairs
F6D8Positive controlctgaccagcaaattctcaaggtgagcaggtgaaacagatgg766
External referenceaagtttaaaacgaaaactttataaaatacctttcgtgttcgtggttttca214
Within insertionaaacaagtgcatgttgcgtttcgtgttcgtggttttca266
F15H11Positive controlctccactaactcccgttattccgaacaatcgggccacatatag701
External referencetttcgtcacttttcaaaactaacgtgtgtgtgtgtgtgtgtgctc151
Within insertiontgatgattttggattgaacgtcgtgtgtgtgtgtgtgtgtgctc201
T14G11Positive controlgagttgtgttccagggcctatttgttgtgcgaattcattg897
External referencecacaaaaattaaggaataataaatgttctctttgttccatttataagcgtttctc143
Within insertionttgtcccattttatttgatgtttgtttgttccatttataagcgtttctc176
T6H20Positive Controltttcctgtttgggatctgagtcaggagatagtccaccatgc839
External referencetgggcttaccctgttcatggaggcagagaaaccaatgcattttca151
Within insertiontgggcttaccctgttcatggagccagaaaccgagtctctaagatttca259
MGI19Positive controlatatgcttgtcagtgagggaaggaattcgacaggagcgtgaag800
External referencegaacaatttgtggaaaaatggaacctagtttcatgtgcatatatgtc181
Within insertiongaacaatttgtggaaaaatggaatgacatgtactcaccgcaatg212

Results

Mutant hth plants are susceptible to higher rates of out-crossing

Homozygous hth mutant Arabidopsis plants were previously shown to give rise to wild type (wt) progeny at relatively high frequencies22,29. Although an intrinsic mechanism was proposed22, cross-pollination with neighboring plants was subsequently put forward as the more likely explanation for the appearance of these wt revertant offspring26,27. To test the susceptibility of hth plants to out-crossing under our growth conditions, experiments were conducted using a pollen donor harboring a dominant gene conferring resistance to the herbicide glufosinate. Herbicide-resistant transgenic lines were grown together with hth and eceriferum-10 (cer-10)32 floral fusion mutants and wt Landsberg plants. These analyses confirmed that the majority of hth mutant plants did not cross-pollinate. However, when cross-pollination was detected, frequencies varied considerably between individual hth mutant plants. Mutants with floral fusion phenotypes were predisposed to higher pollen capture than wild type plants (0.02–0.43% for hth-4, 8 and 10 mutants, 0.89% for cer10 mutants, 0.01% for wt plants). In addition, factors such as donor-recipient proximity, the severity of the floral fusion phenotype, growth chamber airflow patterns and plant handling influenced the propensity to cross-pollinate. Nevertheless, growing hth mutant F2 plants in the complete absence of HTH pollen donors did not eliminate wt progeny from F3 progeny pools and, on average, 1.53% of F3 progeny were phenotypically wt for HTH despite being derived from self-fertilized homozygous F2 hth mutant parent plants (2/133 hth-4, 2/131 hth-8 and 2/127 hth-10 gave rise to wt F3 progeny). Under our laboratory conditions, out-crossing could not be completely eliminated within hth mutant populations if mutants were grown together with wt plants, even if every hth mutant plant was shielded in transparent plastic tubes.

While conducting segregation analyses and scoring offspring for herbicide resistance, a single hth mutant plant with a large phenotypically wt floral sector was identified (Figure 2). Sampling of shoot tissues confirmed that phenotype corresponded to genotype and that both mutant hth-4 and wt HTH alleles could be detected in tissue derived from this large wt sector (Figure 2B).

78518a2f-74cf-4e0a-b4cc-618118db3438_figure2.gif

Figure 2. Molecular analysis of a mutant hth-4 plant showing a large wt sector.

(A) Two mutant branches (white boxes) flank a phenotypically wt flower branch (magenta box). Examples of normal wt (HTH/HTH) and mutant (hth/hth) flowers are shown on the right. (B) DNA was extracted from tissue samples and allele-specific PCR-based molecular markers used to determine genotype. The wt branch scored as heterozygous (hth-4/HTH-4), while mutant branches scored as homozygous for the hth-4 allele.

The identification of this sectored individual provided the first phenotypic evidence that hth plants were capable of producing somatic sectors. This finding suggested that perhaps some of the wt revertants originally found among hth mutant progeny might have arisen from genetically heterozygous sectors on the parent plant22. Since well over 300,000 mutant plants were screened in the course of our out-crossing experiments and only one plant with a very large phenotypically wt sector found such as that shown in Figure 2B, we reasoned that if sectoring does occur, the vast majority of sectors would be too small to result in a visible phenotype. This possibility prompted us to test whether novel genotypes could be detected in tissue samples obtained from single hth plants.

Single plants can have multiple genotypes

For these experiments we chose to focus exclusively on molecular markers consisting of genomic DNA sequence tracts between 45–94 nucleotides in length that are either present or absent in the Columbia and Landsberg Arabidopsis accessions (insertion-deletion polymorphic markers or indels; Figure 1). In choosing to use indel markers we reasoned that deletions would be recalcitrant to enzyme repair or modification and therefore would help differentiate between enzyme-based mechanisms such as the one put forth by Comai and Cartwright24 and a template-directed mechanism like the one previously proposed22. Hybrid lines were constructed between Columbia and Landsberg accessions and descendants used as experimental material. For all of the indel markers used in this study, Columbia is homozygous for the insertion.

Initially, F3 seed progeny derived from hybrid F2 parent lines with known indel marker profiles were screened to test whether or not these markers were stable. All F2 parent plants were reared in plastic tubes. When marker profiles were compared between hth-4 parent plants and their F3 adult offspring, 2.16% [6/277] deviated from the expected profile. This frequency is approximately 5 times higher than baseline rates (0.02–0.43%) seen in outcrossing experiments described above. When F3 progeny were assayed as seedlings, similar frequencies were seen, with 2.5% [15/600] of the F3 seedlings showing discordant marker profiles. Altogether 600 seedlings were tested using a total of 30 seedlings per F2 plant (eleven hth-4, five hth-7, two hth-8 and two hth-10 F2 plants). Of the 15 F3 seedlings that tested positive for at least one non-parental marker, 7 had acquired insertions.

To test whether the observed genetic discordance between parent and offspring was due to sectoring, multiple tissue samples were collected from individual adult plants and indel marker profiles compared between these different samples. Molecular analyses confirmed that some tissue samples taken from individual hth mutant plants had novel marker profiles. For the plant shown in Figure 3A, seven out of eight samples scored as expected and were homozygous for the Landsberg deletion marker, however, one sample produced two amplicon products, one of which co-migrated with the Landsberg deletion allele and a larger amplicon that co-migrated with Columbia insertion allele.

78518a2f-74cf-4e0a-b4cc-618118db3438_figure3.gif

Figure 3. Molecular analysis of an adult mutant plant and bisected mutant and wt seedlings.

(A) DNA was extracted from multiple tissue samples and PCR-amplified using F8D20 primers. A novel PCR amplicon product corresponding in size to the insertion allele (C) was detected in hth-7 tissue sample 3 (arrow). (B) Sterile seeds were sown onto petri plates (top left) and 5-day old seedlings cut at the root-shoot junction (illustrated in the top right panel) and genotyped individually. DNA extracted from shoot (S) and root (R) samples derived from individual hth-3 or wt seedlings were PCR-amplified using F12K11 and F4C21 primers, respectively. Samples were loaded in pairs (indicated by horizontal bars). Novel amplicon bands were detected in five seedling samples (arrows) that correspond in size to the insertion allele (C). In one hth-3 sample, both organs (S, R) had a novel band, while a novel amplicon was detected only in the root in a second sample. In three cases, DNA extracted from wt seedlings gave rise to novel bands corresponding in size to the insertion allele (C) (arrows, S). In both cases, the parent plant was homozygous for the deletion allele (L) at the corresponding marker. Heterozygote (H), no DNA control sample (ND).

To test whether sectors could be detected earlier in development, the molecular genotype of shoots and roots of single seedlings grown under sterile conditions were compared to one another. On the assumption that wild type plants would not produce sectors, identical tests were also conducted on wt hybrid lines as negative controls. In the majority of cases, as expected, there was a perfect correspondence between the molecular profiles of root and shoot. However, in some cases, individual seedlings were found to have molecular signatures that differed between the two organ systems (10/44 hth-3; 1/50 hth-4; 9/76 hth-7; Figure 3B). Surprisingly, wt hybrid seedlings also showed novel genotypes when roots and shoots from the same seedling were compared (10/184 wt hybrids; Figure 3B).

Markers are discordant with parental DNA sequences

A subset of amplicon samples were subjected to DNA sequence analyses in order to determine their molecular features. Sequence analyses of DNA clones derived from individuals where the non-parental amplicon co-migrated with the smaller deletion allele showed identity with the Landsberg deletion marker (Figure 4). In two instances, polymorphisms immediately upstream of the deletion were also detected (Figure 4A). As indicated, the Landsberg accession differs from Columbia at these exact three nucleotides. DNA sequence analysis of novel amplicons that co-migrated with the larger insertion allele showed that this seedling shoot had acquired a 54-nucleotide insertion that shares identity with the Columbia reference genome (Figure 4B). This same insertion was absent in the F2 parent plant. These particular seedlings descended from the same wt hybrid parent plant as the F3 progeny whose profiles are shown in Figure 3B.

78518a2f-74cf-4e0a-b4cc-618118db3438_figure4.gif

Figure 4. DNA sequence alignments showing F8D20 and MSA6 indel loci.

(A) The F2 hth-3 parent (F2 hth) shares sequence identity with 2 of 3 DNA clones isolated from this single hth-3 seedling (F3 R2 and F3 S1). DNA sequence data obtained from a root clone (F3 R1) shares identity with the Landsberg sequence (Ler), including 3 flanking sequence polymorphisms (arrows) and a corresponding 85 base-pair deletion. The Columbia reference sequence (Col) is shown on the top line of the alignment. (B) The HTH wt hybrid parent (F2 wt) shares sequence identity with 2 of 3 DNA clones isolated from this single seedling (F3 S2 and F3 R1). DNA sequence data obtained from one shoot clone (F3 S1), however, reveals a 54 base-pair insertion sequence (junctions shown by arrows) and shares identity with the Columbia reference sequence (Col).

Sectors have complex genotypes

To obtain an estimate of sector size, tissue samples were subjected to quantitative assays where the copy number of a genomic reference sequence immediately flanking the marker of interest was compared to the copy number of a sequence internal to that particular insertion marker (Figure 5 and Figure 6). Hybrid plants verified to be homozygous for a deletion at specific indel markers were subjected to the quantitative assays. The quantitative polymerase chain reaction (qPCR) data reveal two remarkable findings. First, the majority of tissue samples collected from individual hth mutant plants tested positive for the presence of at least one insertion marker (Figure 5). In addition, multiple insertion sequences could be detected in many of the tissue samples tested (Figure 5B). In most instances the copy number of any given insertion sequence, relative to the reference, was very low (less than one copy per 1000). Second, wt hybrid plants also showed evidence of sectors with novel genotypes (Figure 6). Only two out of four wt plants tested, however, showed evidence of novel insertions.

78518a2f-74cf-4e0a-b4cc-618118db3438_figure5.gif

Figure 5. Relative genomic copy number of insertion sequences in a hth-7 mutant plant.

(A) DNA was extracted from branches 1–7 of this hth-7 mutant plant and amplified using qPCR or standard PCR reactions. (B) Graphical representation of qPCR results using four different indel markers (F6D8 (red), F15H11 (yellow), T14G11 (blue), and T6H20 (green)). Colored bars show the number of insertion sequences per 1000 copies of the reference sequence (lines indicate standard error of the mean, n=3). All 7 samples showed novel insertion sequences. (C) Standard PCR-amplification using T6H20 primers showed amplicons that corresponded exclusively to the deletion allele (L). Primer positions (arrows) relative to the T6H20 indel (green box) are depicted to the right of the gel image. (D) Pooled amplicon product from T6H20 reference primers demonstrate that this region was amplified equally in all samples, as was the positive control (+). The reference sequence is upstream of the T6H20 insertion marker, as depicted on the right. (E) Quantitative PCR using a primer anchored within the T6H20 indel gave rise to amplicons that corresponded in size to the positive control (+). No product was amplified from sample six. T6H20 indel (green box), Columbia (C), Landsberg (L), heterozygote (H), no DNA control sample (ND).

78518a2f-74cf-4e0a-b4cc-618118db3438_figure6.gif

Figure 6. Relative genomic copy number of insertion sequences in two wild type plants.

(A) DNA was extracted from branches 1–5 of two wt hybrid plants (9B and 10B) and amplified using qPCR. (B) Graphical representation of qPCR results using three different indel markers ((F15H11 (yellow), T14G11 (blue), and MGI19 (pink)). Colored bars show the number of insertion sequences per 1000 copies of the reference sequence (lines indicate standard error of the mean, n=3). Novel insertion sequences could be detected in all 10 samples.

Discussion

By employing classical genetic approaches in conjunction with low and high-resolution molecular methods, we show that one Arabidopsis plant can have multiple genotypes. We have found instances of intra-organismal variation in different genetic backgrounds, in plants reared in different growth chambers, at different developmental stages and under sterile growth conditions. Furthermore, the incidence of sectoring and genetic discordance appears to be in some way conditioned by the hth mutant background as we found a consistently higher frequency of genetic discordance within single hth plants as compared to HTH wt plants. This was also true for shoot and root systems compared between aseptically grown seedlings and for tissue samples taken from adult plants and subjected to qPCR. Of critical importance, in showing that single Arabidopsis plants are genetic mosaics, experimental error due to cross-pollination and seed contamination can be completely discounted. To the best of our knowledge, this is the first report that documents the spontaneous but targeted appearance of unique genomic insertions at multiple discreet loci in single plants.

Only two other cases of spontaneous genomic insertions have been reported in plants that similarly could not be explained by any previously known mechanism. In both cases the insertion was non-random and targeted a specific locus. In the case of flax, the insertion sequence was 5.7 kilobase pairs in size16 while in rice the insertion was comparatively small, being only 34 base pairs in size33. Our data suggest that these reported cases of spontaneous genomic insertion events, like the sequence changes reported here, occur by a process intrinsic to the plant. As before, we propose the possibility that Arabidopsis plants harbor a cryptic store of sequence templates that can overwrite the parentally contributed genomes by a template-directed mechanism22.

If intrinsic drivers of genetic variation exist in inbreeding plant species, have additional incidents of cryptic genetic variation been documented in other systems? We believe that in soybean and cauliflower such events have indeed been reported and presented as cases of enigmatic phenotypic variation8,9,34. In other studies, molecular data have been featured. Again in flax, for example, molecular assays have demonstrated that heritable phenotypic changes induced by environmental shifts are accompanied by reproducible locus-specific copy number changes in genomic DNA1618. In soybean, reproducible non-random changes in restriction length polymorphic markers induced by in vitro35,36 culturing of root explants have also been documented19. Genomic changes manifesting similar hallmarks of biased sequence alterations have also been described in rice21,33 and corn37 hybrids, as well as in Arabidopsis3840.

In long-lived arborescent plants, intra-organism genetic variation has been demonstrated in a variety of systems3,36,41. The fitness benefits have also been validated using models that test whether the production of genetically divergent modules is an effective strategy for achieving adaptive co-evolution with organisms that feed on or infect the plant35,42,43. Models testing fitness benefits of module-level selection show that this is an effective strategy for achieving adaptive co-evolution between long-lived trees and short-lived herbivores when individual tree branches diverge genetically35. Furthermore, this held true across a range of assumptions, even when reproduction was predominantly asexual. However, the fitness benefits were only fully realized for sufficiently long-lived trees that experienced strong selection35. This fitness paradox is not exclusive to plants but also is relevant to organisms outside of the plant kingdom that have remained evolutionarily robust even though reproduction is predominantly asexual43.

For a short-lived organism such as Arabidopsis, what adaptive value would within-organism genetic variation have? One possibility is that this heterogeneity offsets the predicted decline in genetic variation that should result from inbreeding. Plant development is open-ended and reiterative, allowing for the continuous output of repetitive units or modules that function to support the growth and reproduction of the individual. When combined with developmental plasticity and the absence of a sequestered germ line, modular development may actually drive plants toward becoming genetically heterogeneous41,4345. As posited by Whitham and Slobodchikoff3, somatic sector formation permits the introduction of genetic variants into the gene pool either through vegetative propagation or through sexual reproduction. As these authors point out, germ line cells are derived from somatic tissues that arise late in the developmental history of the plant and therefore somatic mutations are more likely to introduce genetic variation than mutations that arise in the gametes3,4,46. By expanding the window of tolerance for genetic variation, plants may be afforded a better adaptive strategy given lifestyle constraints. The versatility of modular development combined with tolerance for genetic variation may allow plants to adapt at rates tailored to pathogen life cycles1 or to relatively expanded time scales, such as those affecting climate change. Even though self-fertilization is thought to have evolved approximately one million years ago12, Arabidopsis plants have not suffered the consequential genetic erosion but have continued to thrive.

In addition to benefiting from a natural tendency toward genetic heterogeneity, the plant genome itself is thought to buffer the cost of having limited genetic diversity. In wild relatives of Arabidopsis the genome is thought to be highly dynamic and to respond to changes in environmental conditions or other extrinsic factors42,47. Genome responses include elevated rates of homologous recombination that persist for multiple generations48, changes in copy number49 and modulation of epigenetic gene regulation50. Pervasive genetic buffering46,51 ensures that phenotypes with potentially deleterious consequences are attenuated. In addition to the genome responses listed above, our findings suggest that an intrinsic source of genetic variation can be leveraged to enhance the diversity in genetic output achieved by Arabidopsis plants.

In considering alternate template-dependent mechanisms, such as gene conversion or homologous recombination, none can account for the de novo appearance of unique sequence insertions. Nevertheless, it is possible that the insertion or deletion of small DNA sequence tracts, as described here, could reflect the activity of transposable elements52,53. However, numerous lines of evidence argue against this possibility. For instance, when novel amplicons were detected, they co-migrated with their corresponding insertion or deletion allele and did not show size heterogeneity, as would have been expected for transposon-driven excision or insertion events. Sequence data confirm that deletion events reproducibly eliminate a fixed length of sequence while insertion events reproducibly introduce a fixed sequence tract and both events repeatedly target precise genomic sites. Insertion and deletion events do not appear to produce obvious junction sites with altered nucleotides. Similarly, insertion events introduce sequences that share identity with the Columbia reference genome and do not appear to be chimeric gene or genome fragments. Furthermore, transposable element-mediated events cannot account for the fact that these insertion sequences appear to be generated de novo since no comparable conserved region of homology exists elsewhere in the host genome, as demonstrated by our qPCR data. Lastly, as determined by DNA database searches, none of the indel markers used in this study share significant sequence homology with annotated Arabidopsis transposable elements.

If the genome of an intensely studied model organism such as Arabidopsis is subject to modification by the template-directed mechanism we propose, why has this phenomenon not been described previously? Our research shows that target choice and methodological approach are critical in differentiating these genomic events from other processes that also modify DNA sequences. Based on our findings, the only genomic targets that are truly diagnostic of this phenomenon are deletions. To the best of our knowledge, deletion alleles have been used in genetic studies precisely because they are known to be stable and not to revert but have not been used to study phenomena related to epigenetic inheritance. There is no generalized precedent for genetic instability of deletions and assuming otherwise would go against an established biological paradigm. Polymorphic molecular markers such as single nucleotides, simple sequence repeats, or insertions that are subject to alterations by other processes will not provide sufficient resolution to differentiate mechanism, even though they are also likely targets for this process. In particular, our findings may explain why genome sequencing efforts have failed to register these sequence deviations or, if detected, why they may have been attributed to sequencing error and eliminated during curation. One possibility that immediately emerges from this prediction is that raw sequence data contained in existing genome database archives may already contain evidence of extra-genomic sequence information, revealed by features such as highly biased loci-specific "errors".

Collectively, our genetic and molecular data show that many, and perhaps most, insertion events occur somatically in both seedlings and adult plants. Sectoring may therefore be a constitutive process that takes place throughout development but may be limited such that, at any given time, only a few cells host these genetic changes. Importantly, this may explain why sequence changes seen in revertant hth progeny have rarely been found to affect both alleles. Although sexual transmission of non-parental markers clearly does occur22, the fact that we have not found HTH/HTH progeny among seed-derived offspring suggests that sectors populating the gamete forming lineages are unstable or very rare. The qPCR data are consistent with this supposition. However, it is also possible that mechanistic differences exist between somatic and germ line tissues or that insertion events remain dynamic, limiting sexually transmitted changes to those that stabilize. It is also possible that certain genetic backgrounds condition this process as suggested by the greater number of events detected in hth mutants.

In addition to validating our genetic and molecular data, the qPCR results extend those findings and suggest that the genetic make up of individuals can be surprisingly complex. Our data show that each plant can produce multiple discreet sectors, at many different growing points and each with unique marker profiles. This finding implies that sectoring may be a relatively common occurrence, even in wt genetic backgrounds. Since the adult plants used for these experiments were left largely intact and only a small proportion of the plant sampled, many more sectors may have been present than quantified. As such, it is possible that our current census underestimates the frequency with which these smaller islands of genetic variation arise. Although sectors are more readily detected using qPCR, this method cannot distinguish, for example, between copy number variation within a small cluster of cells versus multiple cells that remain strictly diploid and are clonally related. Similarly, it is not possible to distinguish whether one sector hosts the full complement of genetic sequence changes, whether independent events occur in multiple discreet sectors, or if sectors overlap. Visualization of sectors in living tissue or tissue sections should help distinguish between these possibilities.

In addition to models demonstrating the fitness benefits of module-level selection35, computational models provide surprisingly strong support for an ancestrally based "error-correcting" mechanism such as the one we propose to exist in Arabidopsis plants54. In these constrained-optimization simulations, the evolutionary benefit of "genetic repair" strategies was compared between populations that access repair templates derived either from parents, grandparents or great-grandparents. Interestingly, a grandparent- or great grandparent-based genetic repair strategy is strongly favored over parental repair strategies. Furthermore, simulation results show that using a randomly selected template consistently gave superior results to those achieved using templates from the fittest parent or grandparent. From a biological perspective, such a strategy has considerable merit. Retaining a cache of templates derived from grandparental lineages would guarantee greater allele diversity precisely because the reservoir of allele variants would be deeper and allele redundancy would be less likely to occur. Random selection of templates would be the most parsimonious strategy to affect genome repair, again because it would promote diversity across alleles and between individuals. Since only those individuals that survived in previous generations would contribute to these cached templates, represented alleles would be biased to those that have proven robust under a spectrum of selective pressures.

In summary, the research presented here brings to light five striking findings. First, individual Arabidopsis plants are capable of producing somatic sectors during the course of normal vegetative development. Second, those sectors can have distinct and unique marker profiles and can differ in single nucleotide composition, can acquire small DNA insertions or can experience DNA sequence loss. Third, the de novo appearance of genomic insertions supports our original contention that cryptic sequence templates drive some of these changes22. Fourth, this phenomenon can be detected in wt genetic backgrounds raising the possibility that many Arabidopsis lab strains may be genetic mosaics. Finally, this process is genome-wide, impacting all 5 chromosomes, whether or not the target loci reside within genes or between genes.

Our data expand on the ideas put forth by Whitham and Slobodchikoff3 and suggest that sector formation, even in a short-lived organism like Arabidopsis, may be a normal part of development and, furthermore, that the formation of sectors serves to capture novel genetic variation, irrespective of the source of that variation. Models testing the benefit of within organism genetic heterogeneity suggest that the average fitness of the population increases if some individuals within that population are genetic mosaics35. As our data show, not all individuals in the populations we tested showed evidence of genetically distinct sectors but for those individuals that did, the number of sectors varied greatly. Our findings raise the possibility that inbreeding plants and, perhaps other organisms that predominantly propagate asexually, may sequester cryptic sources of genetic variation that can be harnessed to promote greater genetic diversity.

Current Referee Status:

Referee Responses for Version 1

David Oppenheimer, Department of Botany, University of Florida, Gainesville, FL, USA Approved: 31 January 2013 Ref Report: 31 Jan 2013
In the current manuscript, Lolle and colleagues show that plants can spontaneously produce mosaic sectors, and they show that insertion sequences can arise de-novo. Importantly, growing the hth plants in the absence of pollen donors did not eliminate the appearance
...
Continue reading
I have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Competing Interests: No competing interests were disclosed.
Igor Kovalchuk, University of Lethbridge, Lethbridge, AB, Canada Approved: 31 January 2013 Ref Report: 31 Jan 2013
There is nothing 'wrong' with the paper, although this research is still quite controversial. I would still like to see the mRNA and DNA from hth individual plants to be sequenced and compared. Also, if genetic recombination mechanism is in
...
Continue reading
I have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Competing Interests: No competing interests were disclosed.
Andy Pereira, Departments of Crop, Soil and Environmental Sciences, and Plant Pathology, University of Arkansas, Fayetteville, AR, USA Approved: 30 January 2013 Ref Report: 30 Jan 2013
This paper describes the occurrence of somatic sectors in hth mutant genotypes, with the frequency of rare visible sectors at a specific locus being 1/300,000. However, if there is a selective advantage during development, such sectors might be higher and
...
Continue reading
I have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Competing Interests: No competing interests were disclosed.

Article Comments

Sign in
Please provide your email address and enter the characters you see in the picture below.
Email address not valid, please try again
captcha-code
Code not correct, please try again
Click 'Reset password' and a new password will be emailed to you immediately.
Email info@f1000.com for further assistance.
Server error, please try again.