<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.73561.1</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>Effect of cogon grass root ethanol extract on fatty acid binding protein 4 and oxidative stress markers in a sepsis mouse model</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 1; peer review: 1 approved with reservations]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Putri</surname>
                        <given-names>Mirasari</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0003-0520-1373</uri>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Rastiarsa</surname>
                        <given-names>Bening Mauliddina</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Djajanagara</surname>
                        <given-names>Raden Aliya T. M.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <xref ref-type="aff" rid="a3">3</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Ramli</surname>
                        <given-names>Ghaliby Ardhia</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <xref ref-type="aff" rid="a3">3</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Anggraeni</surname>
                        <given-names>Neni</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <uri content-type="orcid">https://orcid.org/0000-0003-2712-5631</uri>
                    <xref ref-type="aff" rid="a4">4</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Sutadipura</surname>
                        <given-names>Nugraha</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Atik</surname>
                        <given-names>Nur</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a5">5</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Syamsunarno</surname>
                        <given-names>Mas Rizky A. A.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a5">5</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Department of Biochemistry, Nutrition and Biomolecular, Faculty of medicine. Universitas Islam Bandung, Bandung, West-Java, 40616, Indonesia</aff>
                <aff id="a2">
                    <label>2</label>Faculty of Medicine, Universitas Padjadjaran, Sumedang, West Java, 45363, Indonesia</aff>
                <aff id="a3">
                    <label>3</label>Faculty of Medicine, Universitas Islam Bandung, Bandung, West-Java, 40616, Indonesia</aff>
                <aff id="a4">
                    <label>4</label>Medical Laboratorium Technologist, Bakti Asih School of Analyst, Bandung, West-Java, 40192, Indonesia</aff>
                <aff id="a5">
                    <label>5</label>Department of Biomedicine Sciences, Faculty of Medicine, Universitas Padjadjaran, West Java, 45363, Indonesia</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:rizky@unpad.ac.id">rizky@unpad.ac.id</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>16</day>
                <month>11</month>
                <year>2021</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2021</year>
            </pub-date>
            <volume>10</volume>
            <elocation-id>1161</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>28</day>
                    <month>10</month>
                    <year>2021</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2021 Putri M et al.</copyright-statement>
                <copyright-year>2021</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/10-1161/pdf"/>
            <abstract>
                <p>
                    <bold>Background:</bold> Sepsis causes several immunological and metabolic alterations that induce oxidative stress. The modulation of fatty acid-binding protein 4 (FABP4) has been shown to worsen this condition. Extract of cogon grass root (ECGR) contains flavonoids and isoeugenol compounds that exhibit anti-inflammatory and antioxidant properties. This study aimed to assess the effects of ECGR on FABP4 and oxidative stress&#x2013;related factors in a sepsis mouse model.</p>
                <p>
                    <bold>Methods:</bold> Twenty-nine male mice (
                    <italic toggle="yes">Mus musculus</italic>) of the 
                    <italic toggle="yes">Deutsche Denken Yoken</italic> strain were divided into four groups: group 1, control; group 2, mice treated with 10 &#x03bc;L/kg body weight (BW) lipopolysaccharide (LPS); and groups 3 and 4, mice pre-treated with 90 and 115 mg/kg BW, respectively, and then treated with 10 &#x03bc;L/kg BW LPS for 14 d. Blood, liver, lymph, and cardiac tissue samples were collected and subjected to histological and complete blood examinations. Antioxidant activity, FABP4 levels, and immune system-associated biomarker levels were also measured.</p>
                <p>
                    <bold>Results:</bold> Significant increases in platelet levels (p = 0.03), cardiomyocyte counts (p =0.004), and hepatocyte counts (p = 0.0004) were observed in group 4 compared with those in group 2. Conversely, compared with those in group 2, there were significant decreases in TNF-&#x03b1; expression in group 3 (p = 0.004), white pulp length and width in group 4 (p = 0.001), FABP4 levels in groups 3 and 4 (p = 0.015 and p = 0.012, respectively), lymphocyte counts in group 4 (p = 0.009), and monocyte counts (p = 0.000) and polymorphonuclear cell counts in the livers (p = 0.000) and hearts (p = 0.000) of groups 3 and 4. Gpx3 activity was significantly higher in group 3 than in group 1 (p = 0.04).</p>
                <p>
                    <bold>Conclusions:</bold> Cogon grass root may aid in the development of herbal medicines and specific treatments for sepsis.</p>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>Cogon grass</kwd>
                <kwd>FABP4</kwd>
                <kwd>sepsis</kwd>
                <kwd>oxidative stress</kwd>
                <kwd>inflammation</kwd>
            </kwd-group>
            <funding-group>
                <award-group id="fund-1">
                    <funding-source>Ministry of Education, Culture, Research, and Technology of Indonesia.</funding-source>
                    <award-id>1287/UN.6.3.1/LT/2020</award-id>
                </award-group>
                <funding-statement>The study was supported by the Ministry of Education, Culture, Research, and Technology of Indonesia.</funding-statement>
                <funding-statement>
                    <italic>The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.</italic>
                </funding-statement>
            </funding-group>
        </article-meta>
    </front>
    <body>
        <sec id="sec1" sec-type="intro">
            <title>Introduction</title>
            <p>Sepsis significantly contributes to morbidity, mortality, and healthcare expenditure worldwide, with approximately 20 million cases of sepsis occurring each year.
                <sup>
                    <xref ref-type="bibr" rid="ref1">1</xref>
                </sup> According to the 2015 International Multicenter Prevalence Study on Sepsis (IMPRESS STUDY), Asia has the highest global sepsis morbidity rate.
                <sup>
                    <xref ref-type="bibr" rid="ref2">2</xref>
                </sup> Sepsis is a life-threatening condition characterized by unregulated systemic inflammation and oxidative responses to infection that can cause organ damage.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>
                </sup> Sepsis involves several molecular mechanisms of inflammation and cell damage, including the release of cytokines, eicosanoids, and free radicals.
                <sup>
                    <xref ref-type="bibr" rid="ref4">4</xref>
                </sup> Specifically, free radicals may mediate cell damage and contribute to the development of liver, spleen, and heart failure,
                <sup>
                    <xref ref-type="bibr" rid="ref5">5</xref>
                </sup>
                <sup>&#x2013;</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref7">7</xref>
                </sup> resulting in multiple organ failure (MOF) and mortality.
                <sup>
                    <xref ref-type="bibr" rid="ref8">8</xref>
                </sup> In mammals, glutathione peroxidase (GPx) and superoxide dismutase (SOD) are the main antioxidants that protect cells from damage caused by free radicals through synergistic action.
                <sup>
                    <xref ref-type="bibr" rid="ref9">9</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref10">10</xref>
                </sup>
            </p>
            <p>In addition to the immunologic response and oxidative stress, various metabolic alterations also occur in sepsis. Serious infections cause increased lipolysis of adipose tissue, allowing free fatty acids (FFAs) to be used for triglyceride synthesis in the liver.
                <sup>
                    <xref ref-type="bibr" rid="ref11">11</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref12">12</xref>
                </sup> This phenomenon aligns with the high levels of triglycerides and FFAs found in patients in sepsis, which are associated with reduced hepatic fatty acid oxidation.
                <sup>
                    <xref ref-type="bibr" rid="ref12">12</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref13">13</xref>
                </sup> Specifically, cytosolic fatty acid-binding protein 4 (FABP4, or adipocyte protein 2) is a lipid chaperone that regulates lipid transport in adipocytes and macrophages.
                <sup>
                    <xref ref-type="bibr" rid="ref14">14</xref>
                </sup> Recent studies have found that FABP4 increases the severity of inflammation-related diseases by elevating the expression of cytokines, such as TNF-&#x03b1;, IL-1, IL-6, and monocyte chemo-attractant protein 1 (MCP 1).
                <sup>
                    <xref ref-type="bibr" rid="ref15">15</xref>
                </sup> In contrast, deletion of the 
                <italic toggle="yes">FABP4</italic> gene protects against the inflammatory activity of macrophages and adipocytes. Furthermore, inhibition of FABP4 through pharmacological intervention was found to mitigate LPS-induced tissue damage and improve the survival rate in mice.
                <sup>
                    <xref ref-type="bibr" rid="ref16">16</xref>
                </sup> Previous studies have shown that systemic infection jeopardizes the liver by damaging parenchymal cells. In response to the FABP4-induced release of proinflammatory cytokines, especially TNF-&#x03b1;, Kupffer cells in the liver produce IL-6.
                <sup>
                    <xref ref-type="bibr" rid="ref17">17</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref18">18</xref>
                </sup>
            </p>
            <p>The pathophysiology of sepsis can be studied in a sepsis mouse model injected with bacterial lipopolysaccharide (LPS).
                <sup>
                    <xref ref-type="bibr" rid="ref19">19</xref>
                </sup> LPS is the main endotoxin component of the membrane of gram-negative bacteria. It activates macrophages by triggering the toll-like receptor 4 (TLR4) signaling pathway within Kupffer cells and inducing inflammatory cytokine release.
                <sup>
                    <xref ref-type="bibr" rid="ref20">20</xref>
                </sup> LPS play a vital role in acute and chronic inflammation,
                <sup>
                    <xref ref-type="bibr" rid="ref21">21</xref>
                </sup> including that caused by gram-negative bacteria in sepsis.
                <sup>
                    <xref ref-type="bibr" rid="ref19">19</xref>
                </sup>
            </p>
            <p>
                <italic toggle="yes">Imperata cylindrica</italic> (L.), commonly known as cogon grass, is used to treat multiple conditions, such as fever, hepatitis, dysentery, diarrhea, hepatitis, typhus muscle pain, cancer, and hypertension.
                <sup>
                    <xref ref-type="bibr" rid="ref22">22</xref>
                </sup>
                <sup>&#x2013;</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref24">24</xref>
                </sup> Phytochemical screening has shown that extract of cogon grass root (ECGR) contains potent antioxidants, including isoeugenin, tannins, saponins, flavonoids, terpenoids, and alkaloids.
                <sup>
                    <xref ref-type="bibr" rid="ref24">24</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref25">25</xref>
                </sup> Specifically, isoeugenin demonstrates potent antioxidant activity through nitrite oxide (NO) scavenging, significantly inhibiting the expression of inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), and proinflammatory mRNA, which play essential roles in sepsis.
                <sup>
                    <xref ref-type="bibr" rid="ref26">26</xref>
                </sup> However, the use of cogon grass root for the treatment of sepsis has not been explored. Therefore, this study aimed to investigate the effect of ECGR on a mouse model of sepsis. We hypothesized that ECGR would ameliorate sepsis by reducing inflammatory responses and oxidative damage via antioxidant activity.</p>
        </sec>
        <sec id="sec2" sec-type="methods">
            <title>Methods</title>
            <sec id="sec3">
                <title>Ethical consideration</title>
                <p>Ethical clearance was granted by the Research Ethics Committee of Universitas Padjadjaran, Bandung, Indonesia (approval number: 921/UN6.KEP/EC/2019).</p>
            </sec>
            <sec id="sec4">
                <title>ECGR</title>
                <p>Cogon grass was obtained from Solo, Central Java, Indonesia, and its authenticity was tested by the Bandung Institute of Technology. The roots of the cogon grass were separated, washed with water, and dried for two weeks. The roots were then macerated, filtered, and extracted. The extract was filtered and separated from the solvent using a vacuum rotary evaporator R220 pro (BUCHI Indonesia, Tangerang, Indonesia). The ECGR was then diluted in 0.5% carboxymethylcellulose (CMC) (Merck, U.S.A) and administered at a dose of either 90 or 115 mg/kg body weight (BW), as in our previous study.
                    <sup>
                        <xref ref-type="bibr" rid="ref27">27</xref>
                    </sup>
                </p>
            </sec>
            <sec id="sec5">
                <title>Model and research design</title>
                <p>Male mice (
                    <italic toggle="yes">Mus musculus sp.</italic>) of the 
                    <italic toggle="yes">Deutsche Denken Yoken</italic> strain (8&#x2013;10 weeks of age, 30&#x2013;35 g body weight) were provided by the Biofarma Company (Bandung, Indonesia). All efforts were made to relieve any pain and distress of the animals by strictly following the procedures. The mice were acclimatized for seven days in the laboratory. They were then kept in cages at the animal laboratory of Universitas Padjadjaran at a controlled room temperature and on a 12 hours light/12 hours dark cycle. The mice were provided regular food, drinking water ad libitum, observed daily to confirm lack of behavior, and weighed every three days. This study was conducted following the ARRIVE Essential 2.0 checklist for pre-clinical animal studies.</p>
                <p>A randomized post-test control group design was used. Determination of the number of samples for each treatment group was determined using the Frederer formula. The mice were divided into the following four experimental groups (5&#x2013;8 mice per group; 29 mice total): group 1 (control), mice treated with CMC 0.5% (the solvent of ECGR); group 2, mice treated with CMC 0.5% + 10 &#x03bc;L/kg BW LPS; group 3, mice treated with 10 &#x03bc;L/kg BW LPS + 90 mg/kg BW ECGR; and group 4, mice treated with 10 &#x03bc;L/kg BW LPS + 115 mg/kg BW ECGR.</p>
                <p>Briefly, groups 1 and 2 were treated with 0.5% CMC, while groups 3 and 4 were treated with ECGR in 0.5% CMC at doses of 90 and 115 mg/kg BW, respectively, for two weeks. The mice were weighed every 3 days to determine the effects of ECGR on body weight. The ECGR solutions were administered daily for two weeks, between 3 and 5 pm.
                    <sup>
                        <xref ref-type="bibr" rid="ref27">27</xref>
                    </sup> After two weeks, groups 2, 3, and 4 were injected intraperitoneally with LPS (10 &#x03bc;L//kg BW; Sigma-Aldrich, St. Louis, MO) diluted in 50 &#x03bc;L PBS, as in previous studies.
                    <sup>
                        <xref ref-type="bibr" rid="ref28">28</xref>
                    </sup> At 8 hours after injection, the mice were euthanized by cervical dislocation, and portions of their livers, spleens, and hearts were snap-frozen in liquid nitrogen and stored at &#x2212;80  &#x00b0;C until further use. The remaining liver, spleen, and heart tissues were processed for histological examination.</p>
            </sec>
            <sec id="sec6">
                <title>Measurement of blood parameters</title>
                <p>Blood was collected from the inferior vena cava. A complete blood count profile (CBCP) was drawn automatically using the CLIA Waived Hematology Analyzer Sysmex XW-100 (Sysmex America, Lincolnshire, U.S.A). Serum was separated by centrifugation at 1,500 &#x00d7; 
                    <italic toggle="yes">g</italic> for 15 minutes at 4 &#x00b0;C, and the lysates were stored at &#x2212;80  &#x00b0;C until further examination.</p>
            </sec>
            <sec id="sec7">
                <title>Histological analysis of the livers, hearts and spleen</title>
                <p>Liver, spleen, and heart tissues were prepared for histopathological evaluation using the Kiernan method.
                    <sup>
                        <xref ref-type="bibr" rid="ref29">29</xref>
                    </sup> Briefly, they were fixed in 4% paraformaldehyde, embedded in paraffin, and stained with hematoxylin and eosin (H&amp;E) according to the Harris method.
                    <sup>
                        <xref ref-type="bibr" rid="ref30">30</xref>
                    </sup>
                </p>
            </sec>
            <sec id="sec8">
                <title>GPx3 activity assay</title>
                <p>GPx3 activity was measured using a commercial kit Randox-Backpack RS 505 (RANDOX Laboratories Ltd, Antrim, U.K), following the method described by Paglia and Valentine (1967).
                    <sup>
                        <xref ref-type="bibr" rid="ref31">31</xref>
                    </sup> Briefly, Glutathione Peroxidase (GPx) catalyses the oxidation of Glutathione (GSH) by Cumene Hydroperoxide. In the presence of Glutathione Reductase (GR) and NADPH the oxidised Glutathione (GSSG) is immediately converted to the reduced form with a concomitant oxidation of NADPH to NADP+. The decrease in absorbance at 340 nm is measured.</p>
            </sec>
            <sec id="sec9">
                <title>FABP4 measurement</title>
                <p>FABP4 levels in the samples were measured using commercial enzyme-linked immunosorbent assay (ELISA) kits Mouse FABP4 ELISA Kit, catalog number EM1506 (Fine Biotech, Wuhan, China) according to the manufacturer's protocol.</p>
            </sec>
            <sec id="sec10">
                <title>RNA isolation and reverse transcription (RT)&#x2013;PCR</title>
                <p>Total RNA was isolated from the organs using TRIzol&#x2122; Reagent catalog number 15596026 (Invitrogen, Massachusetts, US). DNA synthesis was performed using ReverTra AceTM qPCR RT Master Mix with gDNA Remover product number FSQ-301 (Toyobo, Osaka, Japan) according to the manufacturer's protocol. Quantitative real-time RT-PCR was performed using the SensiFAST&#x2122; SYBR 
                    <sup>&#x00ae;</sup> No-ROX Kit product number BIO-98020 (Bioline, United Kingdom) according to the manufacturer's instructions and used Rotor-Gene Q quantitative real-time PCR machine (Qiagen, USA). The first step of Quantitative real-time RT-PCR was polymerase activation for one cycle at 95 &#x00b0;C for two minutes, then denaturation prosses at 95 &#x00b0;C for five seconds and annealing at 60 &#x00b0;C for 30 seconds. The denaturation and annealing process took 40 cycles. The PCR was performed using mGAPDH as a housekeeping gene and the primers from Integrated DNA Technologies, USA. The gene-specific primers for the cDNA used in this study are listed in 
                    <xref ref-type="table" rid="T1">Table 1</xref>.</p>
                <table-wrap id="T1" orientation="portrait" position="float">
                    <label>Table 1. </label>
                    <caption>
                        <title>Primers for quantitative real-time PCR.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Gen</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Forward</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Reverse</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">mIL-1&#x03b2;</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">5&#x2032;-AACCTGCTGGTGTGTGACGTTC</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">5&#x2032;-CAGCACGAGCTTTTTTGTTGT</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">mIL-10</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">5&#x2032;-ATGCAGGACTTTAAGGGTTACTTGGGT-3&#x2032;</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">5&#x2032;-ATTTCGGAGAGAGGTACAAACGAGGTTT-3&#x2032;</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">mIL6</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">5&#x2032;-CCTCTGGTCTTCTGGAGTACC-3&#x2032;</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">5&#x2032;-ACTCCTTCTGTGACTCCAGC-3&#x2032;</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">Mgapdh</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">AGCCCCCAGTCTGTATCCTT</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">TCCACCACCCTGTTGCTGTA</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">mSOD1</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">5&#x2032;-TGC GTG CTG AAG GGC GAC-3&#x2032;</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">5&#x2032;-GTC CTG ACA ACA CAA CCT GGT TC-3</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">MSOD2</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">5&#x2032;-GGA GCA AGG TCG CTT ACA GA-3&#x2032;</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">5&#x2032;-GTG CTC CCA CAC GTC AAT C-3&#x2032;</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">mTNF-&#x03b1;</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">5&#x2032;-TGAGGTCAATCTGCCCAAGT-3&#x2032;</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">5&#x2032;-CTGAGCCATAATCCCCTTTCTA-3&#x2032;</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
            </sec>
            <sec id="sec11">
                <title>Statistical analysis</title>
                <p>Statistical analyses were performed using the GraphPad Prism version 7.0a for Mac (GraphPad Software, Inc. CA, 92037 USA). Normally distributed data are represented as the mean &#x00b1; SD and skewed data as the median &#x00b1; interquartile range (IQR). Normality was assessed using the Shapiro-Wilk test. The p-values were calculated using analysis of variance (ANOVA) with Tukey&#x2019;s post hoc test for normal distributions and the Kruskal-Wallis test with Dunn&#x2019;s post hoc test for skewed distributions. Differences were considered statistically significant at p &lt; 0.05 (for two-tailed p-values).</p>
            </sec>
        </sec>
        <sec id="sec12" sec-type="results">
            <title>Results</title>
            <p>In the blood profiles, platelet levels were significantly lower in group 2 (LPS treatment only) than in group 1 (control) (417.6 &#x00d7; 10
                <sup>3</sup> vs. 732.60 &#x00d7; 10
                <sup>3</sup> cells/&#x03bc;L, p &lt; 0.01). Additionally, platelet levels were significantly higher in group 4 (115 mg/kg ECGR) than in group 2 (550.3 &#x00d7; 10
                <sup>3</sup> vs 417.6 &#x00d7; 10
                <sup>3</sup> cells/&#x03bc;L, p &lt; 0.05; 
                <xref ref-type="fig" rid="f1">Figure 1</xref>). Conversely, LPS induced a substantial increase in the lymphocyte and monocyte counts in group 2 compared with those in the control (lymphocytes: 4.13 &#x00d7; 10
                <sup>3</sup> vs. 2.26 &#x00d7; 10
                <sup>3</sup> cells/&#x03bc;L, p &lt; 0.05; monocytes: 0.84 &#x00d7; 10
                <sup>3</sup> vs. 0.37 &#x00d7; 10
                <sup>3</sup> cells/&#x03bc;L, p &lt; 0.05). In addition, a significant decrease in the lymphocyte count was observed in group 4 compared with that in group 2 (2.26 &#x00d7; 10
                <sup>3</sup> vs. 4.13 &#x00d7; 10
                <sup>3</sup> cells/&#x03bc;L, p &lt; 0.05). Furthermore, significant decreases in the monocyte count were observed in groups 3 and 4 compared with that in group 2 (0.43 &#x00d7; 10
                <sup>3</sup> and 0.29 &#x00d7; 10
                <sup>3</sup>, respectively, vs. 0.84 &#x00d7; 10
                <sup>3</sup> cells/&#x03bc;L, p &lt; 0.05). Finally, a significant increase in the leukocyte count was observed in group 2 compared with that in group 1 (6.19 &#x00d7; 10
                <sup>3</sup> vs. 3.05 &#x00d7; 10
                <sup>3</sup> cells/&#x03bc;L, p &lt; 0.05). However, no significant difference in the leukocyte count was observed between the treatment groups (
                <xref ref-type="fig" rid="f1">Figure 1</xref>).</p>
            <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                <label>Figure 1. </label>
                <caption>
                    <title>ECGR pre-treatment increased platelet levels and decreased lymphocyte and monocyte levels in a sepsis mouse model.</title>
                    <p>Group 1, control; group 2, mice stimulated with LPS; groups 3 and 4, mice treated with 90 and 115 mg/kg BW ECGR, respectively, and stimulated with LPS. Data are represented as the mean &#x00b1; SD, n = 5&#x2013;8 per group. One-way ANOVA with Tukey's post hoc test and the Kruskal-Wallis test with Dunn's post hoc test were performed for normal and skewed data, respectively. *p &lt; 0.05, significant; **p &lt; 0.01, very significant.</p>
                </caption>
                <graphic id="gr1" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/77221/4fbc37b9-68f8-4daf-b250-2814dff1da4e_figure1.gif"/>
            </fig>
            <p>Group 2 exhibited a significantly decreased percentage of packed cell volume (PCV) compared with that in the control (0.15% vs. 0.26%, 
                <xref ref-type="fig" rid="f2">Figure 2</xref>). Additionally, group 4 also showed a decreased PCV percentage compared with that in group 2, although the difference was not statistically significant.</p>
            <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                <label>Figure 2. </label>
                <caption>
                    <title>LPS decreased PCV in a sepsis mouse model.</title>
                    <p>Group 1, control; group 2, mice stimulated with LPS; groups 3 and 4, mice treated with 90 and 115 mg/kg BW ECGR, respectively, and stimulated with LPS. Data are represented as the mean &#x00b1; SD, n = 5&#x2013;8 per group. One-way ANOVA with Tukey's post hoc test and the Kruskal-Wallis test with Dunn's post hoc test were performed for normal and skewed data, respectively. *p &lt; 0.05, significant; **p &lt; 0.01, very significant. Abbreviations: PCV, packed cell volume; MPV, mean platelet volume; PDW, platelet distribution width; MCV, mean corpuscular volume; MCH, mean corpuscular hemoglobin; MCHC, mean corpuscular hemoglobin concentration.</p>
                </caption>
                <graphic id="gr2" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/77221/4fbc37b9-68f8-4daf-b250-2814dff1da4e_figure2.gif"/>
            </fig>
            <p>The typical architectural structures of the liver, heart, and spleen tissues were observed in group 1. Additionally, neither necrosis or apoptosis were observed, and the hepatic sinusoids and heart vessels were not dilated. In group 2, abnormalities in the architectural structures of the three organs were observed. Several areas of necrosis, cellular swelling, vessel dilation, and inflammatory cell infiltration, especially that of PMNs, were observed. In contrast, fewer areas of necrosis and cellular swelling were observed in the treatment groups (groups 3 and 4). In addition, the treatment groups demonstrated reduced PMN infiltration (
                <xref ref-type="fig" rid="f3">Figure 3</xref>).</p>
            <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                <label>Figure 3. </label>
                <caption>
                    <title>Effect of ECGR on the histological characteristics of the liver, heart, and spleen of a sepsis mouse model.</title>
                    <p>Group 1, control; group 2, mice stimulated with LPS; groups 3 and 4, mice treated with 90 and 115 mg/kg BW ECGR, respectively, and stimulated with LPS. Abbreviations: Nc, necrotic area of hepatocyte; Ap, apoptotic hepatocytes; SD, sinusoidal dilatation; PMN, polymorphonuclear cell; NS, normal sinusoid; NH, normal hepatocyte; NM, necrotic area of the myocardium; VD, vascular dilatation; NC, normal cardiomyocyte; LN, lymph node; WP, white pulp; RP, red pulp.</p>
                </caption>
                <graphic id="gr3" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/77221/4fbc37b9-68f8-4daf-b250-2814dff1da4e_figure3.gif"/>
            </fig>
            <p>ECGR significantly affected the numbers of PMN cells and hepatocytes in the liver tissues. In the mice treated with only LPS (group 2), an increase in the number of PMN cells and significant decrease in that of hepatocytes were observed. Conversely, a decrease in the number of PMN cells and significant increase in that of hepatocytes were observed in the groups treated with ECGR (groups 3 and 4; 
                <xref ref-type="fig" rid="f4">Figure 4</xref>).</p>
            <fig fig-type="figure" id="f4" orientation="portrait" position="float">
                <label>Figure 4. </label>
                <caption>
                    <title>Effect of ECGR on the histological quantification of the liver, heart, and spleen of a sepsis mouse model.</title>
                    <p>Group 1, control; group 2, mice stimulated with LPS; groups 3 and 4, mice treated with 90 and 115 mg/kg BW ECGR, respectively, and stimulated with LPS. Data are represented as the mean &#x00b1; SD, n = 5&#x2013;8 per group. One-way ANOVA with Tukey's post hoc test and the Kruskal-Wallis test with Dunn's post hoc test were used for normal and skewed data, respectively. *p &lt; 0.05, significant; **p &lt; 0.01, very significant; ***p &lt; 0.001, extremely significant.</p>
                </caption>
                <graphic id="gr4" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/77221/4fbc37b9-68f8-4daf-b250-2814dff1da4e_figure4.gif"/>
            </fig>
            <p>Similar conditions were observed in the heart, with significant differences in cardiomyocyte numbers in groups 1 and 4 compared with those in group 2 (277.3 and 251.6 vs. 212.5 cells; p &lt; 0.01). There was also increased dilatation in the length and width of the white pulp lymph vasculature in the group treated with LPS compared with that in the control group, although the difference was not statistically significant. In contrast, there was a significant difference in length (p &lt; 0.05) and width (p &lt; 0.01) between groups 2 and 4 (
                <xref ref-type="fig" rid="f4">Figure 4</xref>).</p>
            <p>The GPx activity of the mice in group 3 was significantly higher than that in group 1 (585.9 vs. 876.5 U/L), p &lt; 0.05; 
                <xref ref-type="fig" rid="f5">Figure 5</xref>). We also found that the LPS-treated groups developed significantly higher FABP4 expression than the control (27.69 vs. 3.98 pg/mL, p &lt; 0.01; 
                <xref ref-type="fig" rid="f6">Figure 6</xref>). Compared with that in group 2, FABP4 expression was suppressed in groups 3 and 4 (the ECGR treatment groups) (27.69 vs. 5.19 and 6.55 pg/mL, p &lt; 0.05).</p>
            <fig fig-type="figure" id="f5" orientation="portrait" position="float">
                <label>Figure 5. </label>
                <caption>
                    <title>Effect of ECGR on GPx3 activity.</title>
                    <p>Group 1, control; group 2, mice stimulated with LPS; groups 3 and 4, mice treated with 90 and 115 mg/kg BW ECGR, respectively, and stimulated with LPS. Data were analyzed via the Kruskal-Wallis test with Dunn's post hoc test. *p &lt; 0.05, significant.</p>
                </caption>
                <graphic id="gr5" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/77221/4fbc37b9-68f8-4daf-b250-2814dff1da4e_figure5.gif"/>
            </fig>
            <fig fig-type="figure" id="f6" orientation="portrait" position="float">
                <label>Figure 6. </label>
                <caption>
                    <title>Suppression of FABP4 expression in an LPS-induced sepsis mouse model pre-treated with ECGR.</title>
                    <p>Group 1, control; group 2, mice stimulated with LPS; groups 3 and 4, mice treated with 90 and 115 mg/kg BW ECGR, respectively, and stimulated with LPS. Data were analyzed via the Kruskal-Wallis test with Dunn's post hoc test. *p &lt; 0.05, significant.</p>
                </caption>
                <graphic id="gr6" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/77221/4fbc37b9-68f8-4daf-b250-2814dff1da4e_figure6.gif"/>
            </fig>
            <p>We also observed a significant increase in the expression of TNF-&#x03b1; and IL-6 in group 2 compared with that in the control group (p &lt; 0.05). However, a significant decrease in TNF-&#x03b1; expression was observed in group 3 compared with that in group 2 (p &lt; 0.05). Decreased expression of IL-6 and IL-1&#x03b2; was also observed in group 4, although the differences were not statistically significant. No significant differences in the expression of SOD1 and SOD2 were observed among the groups (
                <xref ref-type="fig" rid="f7">Figure 7</xref>).</p>
            <fig fig-type="figure" id="f7" orientation="portrait" position="float">
                <label>Figure 7. </label>
                <caption>
                    <title>Effect of ECGR on the expression of several genes associated with inflammation and antioxidant properties.</title>
                    <p>Group 1, control; group 2, mice stimulated with LPS; groups 3 and 4, mice treated with 90 and 115 mg/kg BW of ECGR, respectively, and stimulated with LPS. Data are represented as the mean &#x00b1; SD, n = 5&#x2013;8 per group. One-way ANOVA with Tukey's post hoc test and the Kruskal-Wallis test with Dunn's post hoc test were performed for normal and skewed data, respectively. *p &lt; 0.05, significant; **p &lt; 0.01, very significant.</p>
                </caption>
                <graphic id="gr7" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/77221/4fbc37b9-68f8-4daf-b250-2814dff1da4e_figure7.gif"/>
            </fig>
        </sec>
        <sec id="sec13" sec-type="discussion">
            <title>Discussion</title>
            <p>Overall, ECGR treatment provoked robust increases in platelet levels, GPx3 activity, hepatocyte numbers, and cardiomyocyte numbers. Treatment also induced decreases in lymphocyte numbers, monocyte numbers, TNF-&#x03b1; levels, and FABP4 levels. Furthermore, the expression of other related septic proinflammatory cytokines, including IL-6 and IL-1&#x03b2;, was also decreased by ECGR.</p>
            <p>Sepsis is a systemic response that endangers the body, causing organ hypofunction and even death.
                <sup>
                    <xref ref-type="bibr" rid="ref32">32</xref>
                </sup> The pathogenesis of sepsis is complex due to the involvement of various immune components. In experimental animals, LPS treatment causes the same pathophysiological changes as sepsis in humans.
                <sup>
                    <xref ref-type="bibr" rid="ref33">33</xref>
                </sup> This is due to the presence of LPS-binding protein (LBP) in the blood and extracellular fluid, which binds to lipid A (the bioactive part of LPS) and carries LPS to cluster of differentiation 14 (CD14) in monocytes, macrophages, and neutrophils.
                <sup>
                    <xref ref-type="bibr" rid="ref34">34</xref>
                </sup> The interaction between the LBP-LPS complex and the CD14 receptor allows LPS to bind to TLR4, signaling the cell nucleus to stimulate the production and release of inflammatory mediators.
                <sup>
                    <xref ref-type="bibr" rid="ref35">35</xref>
                </sup> These inflammatory mediators activate the endothelium, causing increased expression of adhesion molecules, such as selectin-E, intracellular adhesion molecule-1 (ICAM-1), and vascular cell adhesion molecule-1 (VCAM-1), which serve as ligands for leukocyte integrins. The proinflammatory cytokines also enhance the proliferation and differentiation of naive T lymphocytes into effector T lymphocytes. In addition, TNF-&#x03b1; and IL-1 increase the secretion of chemokines, such as CXCL1 and CCL2, which bind to neutrophils and monocytes, respectively. This increases the affinity of leukocyte integrins for their ligands and enhances leukocyte migration.
                <sup>
                    <xref ref-type="bibr" rid="ref35">35</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref36">36</xref>
                </sup>
            </p>
            <p>In this study, leukocyte, monocyte, and lymphocyte counts were observed to be significantly increased in the group treated with LPS alone (group 2) compared with those in the control (group 1; 
                <xref ref-type="fig" rid="f1">Figure 1</xref>). However, no significant differences were observed between these cell counts in the treatment groups (groups 3 and 4) and those in group 2. Increased PMN cell counts were also observed in group 2 via histopathological quantification (
                <xref ref-type="fig" rid="f3">Figures 3</xref>, 
                <xref ref-type="fig" rid="f4">4</xref>). In addition, significant decreases in the lymphocyte and monocyte counts were observed in the treatment groups compared with those in group 2 (
                <xref ref-type="fig" rid="f1">Figure 1</xref>). The PMN cell count in groups 3 and 4 was also decreased compared with that in group 2, as observed in the histopathological analysis (
                <xref ref-type="fig" rid="f4">Figure 4</xref>). These observations were likely due to ECGR treatment.</p>
            <p>Previous studies have found that ECGR contains phenols in the form of flavonoids and isoeugenin.
                <sup>
                    <xref ref-type="bibr" rid="ref25">25</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref26">26</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref37">37</xref>
                </sup> Phytochemical screening has shown that the flavonoid content of cogon grass root is 4.8%.
                <sup>
                    <xref ref-type="bibr" rid="ref37">37</xref>
                </sup> Hyo-Jin An 
                <italic toggle="yes">et al</italic>. also reported the isoeugenin content of cogon grass as approximately 0.268 mg/g dry ECGR.
                <sup>
                    <xref ref-type="bibr" rid="ref26">26</xref>
                </sup>
            </p>
            <p>Flavonoids are known to inhibit inflammatory reactions. Their mechanism may involve the recruitment and regulation of neutrophils through chemokines, IL-8, and leukotriene B4.
                <sup>
                    <xref ref-type="bibr" rid="ref38">38</xref>
                </sup> This mechanism has also been observed in isoeugenol, which specifically decreases the expression of proinflammatory cytokines.
                <sup>
                    <xref ref-type="bibr" rid="ref26">26</xref>
                </sup> This is consistent with our results, which demonstrated significant decreases in TNF-&#x03b1; expression in group 3. IL-6 and IL-1&#x03b2; expression was also decreased in group 4, although not significantly (
                <xref ref-type="fig" rid="f7">Figure 7</xref>). Thus, ECGR demonstrated potential anti-inflammatory activity through the inhibition of lymphocytes, monocytes, and PMN cell infiltration in the livers and hearts of mice with LPS-induced sepsis.</p>
            <p>Proinflammatory cytokines play essential roles in sepsis through several pathways. Specifically, activation of the TLR4 signaling pathway
                <sup>
                    <xref ref-type="bibr" rid="ref21">21</xref>
                </sup> causes plasminogen stimulation and the activation of antithrombin III in the fibrinolysis system. These effects trigger fibrinolysis, causing depletion of fibrinogen substances, induction of disseminated intravascular coagulation, and increased platelet damage.
                <sup>
                    <xref ref-type="bibr" rid="ref39">39</xref>
                </sup> The pathogenesis of sepsis also involves the formation of free radicals. Endotoxins produced during sepsis induce mitochondrial production of reactive oxygen species (ROS), including superoxide, hydrogen peroxide, and hydroxyl.
                <sup>
                    <xref ref-type="bibr" rid="ref33">33</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref40">40</xref>
                </sup> This further stimulates ROS production in endothelial cells, leading to perpetual free radical production. ROS cause macrostructural changes in the mitochondria that ultimately lead to the dysfunction of multiple organs.
                <sup>
                    <xref ref-type="bibr" rid="ref40">40</xref>
                </sup> In addition, ROS production induces damage through the pathological redox cycle, which occurs independently, leading to cell damage and enhanced apoptosis of cardiomyocytes and hepatocytes.
                <sup>
                    <xref ref-type="bibr" rid="ref41">41</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref42">42</xref>
                </sup>
            </p>
            <p>The flavonoids and isoeugenin in ECGR also demonstrate antioxidant properties through the inhibition of NO activity and iNOS, COX-2, and nuclear factor-kappa B (NF-&#x03ba;B) expression. These substances play essential roles in the perpetuation of the pathological redox cycle that damages cells.
                <sup>
                    <xref ref-type="bibr" rid="ref38">38</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref43">43</xref>
                </sup> Thus, the sustained numbers of hepatocytes and cardiomyocytes in the sepsis mouse model may be attributed to the two-week ECGR pre-treatment.
                <sup>
                    <xref ref-type="bibr" rid="ref44">44</xref>
                </sup> In this study, group 4 demonstrated improvement in the liver and heart tissues and increased hepatocyte and cardiomyocyte numbers compared with those in group 2 (
                <xref ref-type="fig" rid="f3">Figures 3</xref>, 
                <xref ref-type="fig" rid="f4">4</xref>).</p>
            <p>Flavonoid antioxidants are considered secondary, exogenous, or non-enzymatic antioxidants. Primary antioxidants, such as SOD, catalase (Cat), and GPx, are produced endogenously. Deficiencies in GPx, which is the first-line defense against oxidative stress, have previously been found to be associated with sepsis.
                <sup>
                    <xref ref-type="bibr" rid="ref45">45</xref>
                </sup> In this study, the GPx3 activity in group 3 was significantly higher than that in group 1 (
                <xref ref-type="fig" rid="f5">Figure 5</xref>). In contrast, no significant differences in the expression of SOD1 and SOD2 were observed among the groups (
                <xref ref-type="fig" rid="f7">Figure 7</xref>).</p>
            <p>Enhanced proinflammatory release and LPS activity in sepsis have been found to cause immunologic and metabolic alterations, especially of lipid metabolism.
                <sup>
                    <xref ref-type="bibr" rid="ref46">46</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref47">47</xref>
                </sup> Higher fatty acid levels in patients with sepsis are associated with increased lipolysis due to reductions in mitochondrial acyl-CoA synthetase (ACS), which aids the synthesis of triglycerides for energy storage. LPS and cytokine release are also associated with lower ACS expression, thereby assisting the mobilization of FAs.
                <sup>
                    <xref ref-type="bibr" rid="ref12">12</xref>
                </sup> A previous study has shown that increased levels of FABP4 are associated with a robust inflammatory response in septic conditions.
                <sup>
                    <xref ref-type="bibr" rid="ref15">15</xref>
                </sup> We observed a remarkable increase in FABP4 levels after LPS induction in group 2. In contrast, the mice pre-treated with ECGR (groups 3 and 4) exhibited decreased FABP4 expression (
                <xref ref-type="fig" rid="f6">Figure 6</xref>). This may be attributed to the ability of FABP4 to modulate the NF-kB pathway, resulting in the expression of inflammasome complexes (e.g., NLR family pyrin domain containing 3 [NLRP3] and pro-IL-1&#x03b2;). In addition, NLRP3 activation is associated with the overproduction of IL-1&#x03b2;, resulting in detrimental effects in sepsis.
                <sup>
                    <xref ref-type="bibr" rid="ref48">48</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref49">49</xref>
                </sup> Inhibition of FABP4 expression through surgical and pharmacological interventions may alleviate LPS-induced tissue damage.
                <sup>
                    <xref ref-type="bibr" rid="ref15">15</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref50">50</xref>
                </sup>
            </p>
            <p>Cogon grass root contains flavonoids that phenotypically demonstrate anti-inflammatory effects. Quercetin and icariin, which are kaempferol derivatives, have been shown to demonstrate prominent inhibition of FABP4 expression.
                <sup>
                    <xref ref-type="bibr" rid="ref51">51</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref52">52</xref>
                </sup> The attenuation of FABP4 in macrophages subsequently inhibits the NF-kB pathway through induction of SIRT3 and diminishes proinflammatory cytokine production.
                <sup>
                    <xref ref-type="bibr" rid="ref50">50</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref53">53</xref>
                </sup> Quercetin also suppresses NF-kB activation and blocks NLRP3 inflammasome activation.
                <sup>
                    <xref ref-type="bibr" rid="ref54">54</xref>
                </sup> These findings suggest that cogon grass root may exhibit direct and indirect inhibitory effects on FABP4 and associated protein complex expression in inflammatory pathways. The limitation of this study was that we did not measure the active substance of ECGR and did not pursue an in vitro study to explore the mechanism of ECGR in sepsis conditions</p>
        </sec>
        <sec id="sec14" sec-type="conclusions">
            <title>Conclusions</title>
            <p>In this study, we established that ECGR played a beneficial role in mitigating severe conditions in a sepsis mouse model. This suggests that cogon grass root may ameliorate sepsis by increasing the platelet level, GPx3 activity, hepatocyte count, and cardiomyocyte count, as well as by reducing the lymphocyte count, monocyte count, TNF-&#x03b1; expression, and FABP4 level. Further understanding of the mechanisms involved in the metabolic and inflammatory effects of cogon grass root is needed. This requires continued exploration of the TLR pathway and other metabolic markers associated with sepsis. Our findings emphasized the potential of cogon grass root as an herbal medicine for sepsis.</p>
        </sec>
        <sec id="sec15">
            <title>Data availability</title>
            <sec id="sec16">
                <title>Underlying data</title>
                <p>Figshare: Data measurement of Sepsis Mice Model with Ethanol Extract of Cogon Grass Root (
                    <italic toggle="yes">Imperata cylindrica L.</italic>) pre-treament, 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.16530654.v8">https://doi.org/10.6084/m9.figshare.16530654.v8</ext-link>.
                    <sup>
                        <xref ref-type="bibr" rid="ref55">55</xref>
                    </sup>
                </p>
                <p>Figshare: Original unedited histopathology image of the liver, heart, and spleen of a sepsis mouse model after pre-treatment with ECGR, 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.16894813.v2">https://doi.org/10.6084/m9.figshare.16894813.v2</ext-link>.
                    <sup>
                        <xref ref-type="bibr" rid="ref56">56</xref>
                    </sup>
                </p>
                <p>This project contains the following underlying data:
                    <list list-type="bullet">
                        <list-item>
                            <label>-</label>
                            <p>Spleen, group 4, 115 mgkg BW ECGR + LPS.jpg</p>
                        </list-item>
                        <list-item>
                            <label>-</label>
                            <p>Spleen, group 3, 90 mgkg BW ECGR + LPS.jpg</p>
                        </list-item>
                        <list-item>
                            <label>-</label>
                            <p>Spleen, group 2, mice stimulated with LPS.jpg</p>
                        </list-item>
                        <list-item>
                            <label>-</label>
                            <p>Spleen, group 1, control.jpg</p>
                        </list-item>
                        <list-item>
                            <label>-</label>
                            <p>Heart, group 4, 115 mgkg BW ECGR + LPS.jpg</p>
                        </list-item>
                        <list-item>
                            <label>-</label>
                            <p>Heart, group 3, 90 mgkg BW ECGR + LPS.jpg</p>
                        </list-item>
                        <list-item>
                            <label>-</label>
                            <p>Heart, group 2, mice stimulated with LPS.jpg</p>
                        </list-item>
                        <list-item>
                            <label>-</label>
                            <p>Heart, group 1, control.jpg</p>
                        </list-item>
                        <list-item>
                            <label>-</label>
                            <p>Liver, groups 4, 115 mgkg BW ECGR + LPS.jpeg</p>
                        </list-item>
                        <list-item>
                            <label>-</label>
                            <p>Liver, groups 3, 90 mgkg BW ECGR + LPS.jpeg</p>
                        </list-item>
                        <list-item>
                            <label>-</label>
                            <p>Liver, group 2, mice stimulated with LPS.jpeg</p>
                        </list-item>
                        <list-item>
                            <label>-</label>
                            <p>Liver, group 1, control.jpeg</p>
                        </list-item>
                    </list>
                </p>
            </sec>
            <sec id="sec17">
                <title>Reporting guidelines</title>
                <p>Figshare: ARRIVE Essential 10 checklist-Effect of cogon grass root ethanol extract on fatty acid binding protein 4 and oxidative stress markers in a sepsis mouse model, 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.16895506.v2">https://doi.org/10.6084/m9.figshare.16895506.v2</ext-link>.
                    <sup>
                        <xref ref-type="bibr" rid="ref57">57</xref>
                    </sup>
                </p>
                <p>Data are available under the terms of the 
                    <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/publicdomain/zero/1.0/">Creative Commons Zero &#x201c;No rights reserved&#x201d; data waiver</ext-link> (CC0 1.0 Public domain dedication).</p>
            </sec>
        </sec>
    </body>
    <back>
        <ack>
            <title>Acknowledgements</title>
            <p>The authors would like to express their gratitude to the staffs of the central laboratory of Universitas Padjadjaran-Bandung and Suhendra Pratama for statistic consultation.</p>
        </ack>
        <ref-list>
            <title>References</title>
            <ref id="ref1">
                <label>1</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Lie</surname>
                            <given-names>KC</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lau</surname>
                            <given-names>C-Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Van Vinh</surname>
                            <given-names>CN</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Utility of SOFA score, management and outcomes of sepsis in Southeast Asia: a multinational multicenter prospective observational study.</article-title>
                    <source>

                        <italic toggle="yes">J Intensive Care.</italic>
</source>
                    <year>2018</year>;<volume>6</volume>:<fpage>9</fpage>.
                    <pub-id pub-id-type="pmid">29468069</pub-id>
                    <pub-id pub-id-type="doi">10.1186/s40560-018-0279-7</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5813360</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref2">
                <label>2</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Rhodes</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Phillips</surname>
                            <given-names>G</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Beale</surname>
                            <given-names>R</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The surviving sepsis campaign bundles and outcome: results from the international multicentre prevalence study on sepsis (the IMPreSS study).</article-title>
                    <source>

                        <italic toggle="yes">Intensive Care Med.</italic>
</source>
                    <year>2015</year>;<volume>41</volume>(<issue>9</issue>):<fpage>1620</fpage>&#x2013;<lpage>1628</lpage>.
                    <pub-id pub-id-type="pmid">26109396</pub-id>
                    <pub-id pub-id-type="doi">10.1007/s00134-015-3906-y</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref3">
                <label>3</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Marik</surname>
                            <given-names>PE</given-names>
                        </name>
</person-group>:
                    <article-title>Don&#x2019;t miss the diagnosis of sepsis!.</article-title>
                    <source>

                        <italic toggle="yes">Crit Care.</italic>
</source>
                    <year>2014 Sep 27</year>;<volume>18</volume>(<issue>5</issue>):<fpage>529</fpage>.
                    <pub-id pub-id-type="pmid">25675360</pub-id>
                    <pub-id pub-id-type="doi">10.1186/s13054-014-0529-6</pub-id>
                    <pub-id pub-id-type="pmcid">PMC4331438</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref4">
                <label>4</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Faix</surname>
                            <given-names>JD</given-names>
                        </name>
</person-group>:
                    <article-title>Biomarkers of sepsis.</article-title>
                    <source>

                        <italic toggle="yes">Crit Rev Clin Lab Sci.</italic>
</source>
                    <year>2013</year>;<volume>50</volume>(<issue>1</issue>):<fpage>23</fpage>&#x2013;<lpage>36</lpage>.
                    <pub-id pub-id-type="pmid">23480440</pub-id>
                    <pub-id pub-id-type="doi">10.3109/10408363.2013.764490</pub-id>
                    <pub-id pub-id-type="pmcid">PMC3613962</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref5">
                <label>5</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kobashi</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Toshimori</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yamamoto</surname>
                            <given-names>K</given-names>
                        </name>
</person-group>:
                    <article-title>Sepsis-associated liver injury: incidence, classification and the clinical significance.</article-title>
                    <source>

                        <italic toggle="yes">Hepatol Res.</italic>
</source>
                    <year>2013</year>;<volume>43</volume>(<issue>3</issue>):<fpage>255</fpage>&#x2013;<lpage>266</lpage>.
                    <pub-id pub-id-type="pmid">22971102</pub-id>
                    <pub-id pub-id-type="doi">10.1111/j.1872-034X.2012.01069.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref6">
                <label>6</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Lv</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>H</given-names>
                        </name>
</person-group>:
                    <article-title>Pathophysiology of sepsis-induced myocardial dysfunction.</article-title>
                    <source>

                        <italic toggle="yes">Mil Med Res.</italic>
</source>
                    <year>2016</year>;<volume>3</volume>(<issue>1</issue>):<fpage>1</fpage>&#x2013;<lpage>9</lpage>.
                    <pub-id pub-id-type="doi">10.1186/s40779-016-0099-9</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref7">
                <label>7</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Minasyan</surname>
                            <given-names>H</given-names>
                        </name>
</person-group>:
                    <article-title>Sepsis: mechanisms of bacterial injury to the patient.</article-title>
                    <source>

                        <italic toggle="yes">Scand J Trauma Resusc Emerg Med.</italic>
</source>
                    <year>2019</year>;<volume>27</volume>(<issue>1</issue>):<fpage>1</fpage>&#x2013;<lpage>22</lpage>.
                    <pub-id pub-id-type="doi">10.1186/s13049-019-0596-4</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref8">
                <label>8</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Guerreiro</surname>
                            <given-names>MO</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Petronilho</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Andrades</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Plasma superoxide dismutase activity and mortality in patients with septic.</article-title>
                    <source>

                        <italic toggle="yes">J Trauma Acute Care Surg.</italic>
</source>
                    <year>2010</year>;<volume>69</volume>(<issue>6</issue>):<fpage>E102</fpage>&#x2013;<lpage>E106</lpage>.
                    <pub-id pub-id-type="doi">10.1097/TA.0b013e3181dbb289</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref9">
                <label>9</label>
                <mixed-citation publication-type="book">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Whitney</surname>
                            <given-names>E</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rolfes</surname>
                            <given-names>SR</given-names>
                        </name>
</person-group>:
                    <source>

                        <italic toggle="yes">Understanding nutrition.</italic>
</source>
                    <publisher-name>Cengage Learning</publisher-name>;<year>2018</year>.</mixed-citation>
            </ref>
            <ref id="ref10">
                <label>10</label>
                <mixed-citation publication-type="book">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Mahan</surname>
                            <given-names>LK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Escott-Stump</surname>
                            <given-names>S</given-names>
                        </name>
</person-group>:
                    <source>

                        <italic toggle="yes">Krause&#x2019;s food &amp; nutrition therapy: Saunders.</italic>
</source>
                    <publisher-loc>St. Louis, Mo</publisher-loc>:
                    <publisher-name>Elsevier</publisher-name>;<year>2008</year>.</mixed-citation>
            </ref>
            <ref id="ref11">
                <label>11</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Syamsunarno</surname>
                            <given-names>MRAA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Iso</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yamaguchi</surname>
                            <given-names>A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Fatty acid binding protein 4 and 5 play a crucial role in thermogenesis under the conditions of fasting and cold stress.</article-title>
                    <source>

                        <italic toggle="yes">PloS One.</italic>
</source>
                    <year>2014</year>;<volume>9</volume>(<issue>3</issue>):<fpage>e90825</fpage>.
                    <pub-id pub-id-type="pmid">24603714</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0090825</pub-id>
                    <pub-id pub-id-type="pmcid">PMC3946242</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref12">
                <label>12</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Khovidhunkit</surname>
                            <given-names>W</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kim</surname>
                            <given-names>M-S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Memon</surname>
                            <given-names>RA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Effects of infection and inflammation on lipid and lipoprotein metabolism: mechanisms and consequences to the host.</article-title>
                    <source>

                        <italic toggle="yes">J Lipid Res.</italic>
</source>
                    <year>2004</year>;<volume>45</volume>(<issue>7</issue>):<fpage>1169</fpage>&#x2013;<lpage>1196</lpage>.
                    <pub-id pub-id-type="pmid">15102878</pub-id>
                    <pub-id pub-id-type="doi">10.1194/jlr.R300019-JLR200</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref13">
                <label>13</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Lee</surname>
                            <given-names>SH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Park</surname>
                            <given-names>MS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Park</surname>
                            <given-names>BH</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Prognostic implications of serum lipid metabolism over time during sepsis.</article-title>
                    <source>

                        <italic toggle="yes">BioMed Res Int.</italic>
</source>
                    <year>2015</year>;<volume>2015</volume>:<fpage>1</fpage>&#x2013;<lpage>8</lpage>.
                    <pub-id pub-id-type="doi">10.1155/2015/789298</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref14">
                <label>14</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Cao</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sekiya</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ertunc</surname>
                            <given-names>ME</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Adipocyte lipid chaperone AP2 is a secreted adipokine regulating hepatic glucose production.</article-title>
                    <source>

                        <italic toggle="yes">Cell Metab.</italic>
</source>
                    <year>2013</year>;<volume>17</volume>(<issue>5</issue>):<fpage>768</fpage>&#x2013;<lpage>778</lpage>.
                    <pub-id pub-id-type="pmid">23663740</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.cmet.2013.04.012</pub-id>
                    <pub-id pub-id-type="pmcid">PMC3755450</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref15">
                <label>15</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hu</surname>
                            <given-names>B</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Gao</surname>
                            <given-names>L</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Hepatic induction of fatty acid binding protein 4 plays a pathogenic role in sepsis in mice.</article-title>
                    <source>

                        <italic toggle="yes">Am J Pathol.</italic>
</source>
                    <year>2017</year>;<volume>187</volume>(<issue>5</issue>):<fpage>1059</fpage>&#x2013;<lpage>1067</lpage>.
                    <pub-id pub-id-type="pmid">28279656</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.ajpath.2017.01.002</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5417005</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref16">
                <label>16</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Furuhashi</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hotamisligil</surname>
                            <given-names>GS</given-names>
                        </name>
</person-group>:
                    <article-title>Fatty acid-binding proteins: role in metabolic diseases and potential as drug targets.</article-title>
                    <source>

                        <italic toggle="yes">Nat Rev Drug Discov.</italic>
</source>
                    <year>2008</year>;<volume>7</volume>(<issue>6</issue>):<fpage>489</fpage>&#x2013;<lpage>503</lpage>.
                    <pub-id pub-id-type="pmid">18511927</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nrd2589</pub-id>
                    <pub-id pub-id-type="pmcid">PMC2821027</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref17">
                <label>17</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Wo&#x017a;nica</surname>
                            <given-names>EA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Inglot</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wo&#x017a;nica</surname>
                            <given-names>RK</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Liver dysfunction in sepsis.</article-title>
                    <source>

                        <italic toggle="yes">Adv Clin Exp Med Off Organ Wroclaw Med Univ.</italic>
</source>
                    <year>2018</year>;<volume>27</volume>(<issue>4</issue>):<fpage>547</fpage>&#x2013;<lpage>552</lpage>, DOI:
                    <pub-id pub-id-type="doi">10.17219/acem/68363</pub-id>
                    <pub-id pub-id-type="pmid">29558045</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref18">
                <label>18</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Nesseler</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Launey</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Aninat</surname>
                            <given-names>C</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Clinical review: the liver in sepsis.</article-title>
                    <source>

                        <italic toggle="yes">Crit Care.</italic>
</source>
                    <year>2012</year>;<volume>16</volume>(<issue>5</issue>):<fpage>235</fpage>&#x2013;<lpage>238</lpage>.
                    <pub-id pub-id-type="doi">10.1186/cc11381</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref19">
                <label>19</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>El Kamouni</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>El Kebbaj</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Andreoletti</surname>
                            <given-names>P</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Protective effect of argan and olive oils against LPS-induced oxidative stress and inflammation in mice livers.</article-title>
                    <source>

                        <italic toggle="yes">Int J Mol Sci.</italic>
</source>
                    <year>2017</year>;<volume>18</volume>(<issue>10</issue>):<fpage>2181</fpage>.</mixed-citation>
            </ref>
            <ref id="ref20">
                <label>20</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Lin</surname>
                            <given-names>M-X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yi</surname>
                            <given-names>Y-X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Fang</surname>
                            <given-names>P-P</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Shikonin protects against D-Galactosamine and lipopolysaccharide-induced acute hepatic injury by inhibiting TLR4 signaling pathway.</article-title>
                    <source>

                        <italic toggle="yes">Oncotarget.</italic>
</source>
                    <year>2017</year>;<volume>8</volume>(<issue>53</issue>):<fpage>91542</fpage>&#x2013;<lpage>91550</lpage>.
                    <pub-id pub-id-type="pmid">29207664</pub-id>
                    <pub-id pub-id-type="doi">10.18632/oncotarget.21070</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5710944</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref21">
                <label>21</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Shi</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Pamer</surname>
                            <given-names>EG</given-names>
                        </name>
</person-group>:
                    <article-title>Monocyte recruitment during infection and inflammation.</article-title>
                    <source>

                        <italic toggle="yes">Nat Rev Immunol.</italic>
</source>
                    <year>2011</year>;<volume>11</volume>(<issue>11</issue>):<fpage>762</fpage>&#x2013;<lpage>774</lpage>.
                    <pub-id pub-id-type="pmid">21984070</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nri3070</pub-id>
                    <pub-id pub-id-type="pmcid">PMC3947780</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref22">
                <label>22</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Roosita</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kusharto</surname>
                            <given-names>CM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sekiyama</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Medicinal plants used by the villagers of a Sundanese community in West Java.</article-title>
                    <source>

                        <italic toggle="yes">Indonesia. J Ethnopharmacol.</italic>
</source>
                    <year>2008</year>;<volume>115</volume>(<issue>1</issue>):<fpage>72</fpage>&#x2013;<lpage>81</lpage>.
                    <pub-id pub-id-type="pmid">17961941</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.jep.2007.09.010</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref23">
                <label>23</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kuete</surname>
                            <given-names>V</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sandjo</surname>
                            <given-names>LP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wiench</surname>
                            <given-names>B</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Cytotoxicity and modes of action of four Cameroonian dietary spices ethno-medically used to treat cancers: Echinops giganteus, Xylopia aethiopica, Imperata cylindrica and Piper capense.</article-title>
                    <source>

                        <italic toggle="yes">J Ethnopharmacol.</italic>
</source>
                    <year>2013</year>;<volume>149</volume>(<issue>1</issue>):<fpage>245</fpage>&#x2013;<lpage>253</lpage>.
                    <pub-id pub-id-type="pmid">23827757</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.jep.2013.06.029</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref24">
                <label>24</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Krishnaiah</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Devi</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bono</surname>
                            <given-names>A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Studies on phytochemical constituents of six Malaysian medicinal plants.</article-title>
                    <source>

                        <italic toggle="yes">J Med Plants Res.</italic>
</source>
                    <year>2009</year>;<volume>3</volume>(<issue>2</issue>):<fpage>067</fpage>&#x2013;<lpage>072</lpage>.</mixed-citation>
            </ref>
            <ref id="ref25">
                <label>25</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Padma</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Parvathy</surname>
                            <given-names>NG</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Renjith</surname>
                            <given-names>V</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Quantitative estimation of tannins, phenols, and antioxidant activity of methanolic extract of Imperata cylindrica.</article-title>
                    <source>

                        <italic toggle="yes">Int J Res Pharm Sci.</italic>
</source>
                    <year>2013</year>;<volume>4</volume>(<issue>1</issue>):<fpage>73</fpage>&#x2013;<lpage>77</lpage>.</mixed-citation>
            </ref>
            <ref id="ref26">
                <label>26</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>An</surname>
                            <given-names>H-J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Nugroho</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Song</surname>
                            <given-names>B-M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Isoeugenin, a novel nitric oxide synthase inhibitor isolated from the rhizomes of Imperata cylindrica.</article-title>
                    <source>

                        <italic toggle="yes">Molecules.</italic>
</source>
                    <year>2015</year>;<volume>20</volume>(<issue>12</issue>):<fpage>21336</fpage>&#x2013;<lpage>21345</lpage>.
                    <pub-id pub-id-type="pmid">26633331</pub-id>
                    <pub-id pub-id-type="doi">10.3390/molecules201219767</pub-id>
                    <pub-id pub-id-type="pmcid">PMC6332495</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref27">
                <label>27</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Anggraeni</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Syamsunarno</surname>
                            <given-names>MRA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mukarromah</surname>
                            <given-names>GR</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Low Serum Cholesterol in Mice Pre-treated with Imperata cylindrica L. after Acute Olive Oil Gavage. KnE.</article-title>
                    <source>

                        <italic toggle="yes">Life Sci.</italic>
</source>
                    <year>2017</year>;<volume>3</volume>:<fpage>460</fpage>&#x2013;<lpage>467</lpage>.
                    <pub-id pub-id-type="doi">10.18502/kls.v3i6.1155</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref28">
                <label>28</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Xia</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Xiong</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Effects of sepsis on the metabolism of sphingomyelin and cholesterol in mice with liver dysfunction.</article-title>
                    <source>

                        <italic toggle="yes">Exp Ther Med.</italic>
</source>
                    <year>2017</year>;<volume>14</volume>(<issue>6</issue>):<fpage>5635</fpage>&#x2013;<lpage>5640</lpage>.
                    <pub-id pub-id-type="pmid">29285103</pub-id>
                    <pub-id pub-id-type="doi">10.3892/etm.2017.5226</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5740706</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref29">
                <label>29</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kiernan</surname>
                            <given-names>JA</given-names>
                        </name>
</person-group>:
                    <article-title>Histological and histochemical methods: theory and practice.</article-title>
                    <source>

                        <italic toggle="yes">Shock.</italic>
</source>
                    <year>1999</year>;<volume>12</volume>(<issue>6</issue>):<fpage>479</fpage>.</mixed-citation>
            </ref>
            <ref id="ref30">
                <label>30</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Bancroft</surname>
                            <given-names>JD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Gamble</surname>
                            <given-names>M</given-names>
                        </name>
</person-group>:
                    <article-title>Theory and practice of histological techniques.</article-title>
                    <source>

                        <italic toggle="yes">Elsevier Health Sciences.</italic>
</source>
                    <year>2008</year>.</mixed-citation>
            </ref>
            <ref id="ref31">
                <label>31</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Paglia</surname>
                            <given-names>DE</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Valentine</surname>
                            <given-names>WN</given-names>
                        </name>
</person-group>:
                    <article-title>Studies on the quantitative and qualitative characterization of erythrocyte glutathione peroxidase.</article-title>
                    <source>

                        <italic toggle="yes">J Lab Clin Med.</italic>
</source>
                    <year>1967</year>;<volume>70</volume>(<issue>1</issue>):<fpage>158</fpage>&#x2013;<lpage>169</lpage>.
                    <pub-id pub-id-type="pmid">6066618</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref32">
                <label>32</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Rhee</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Dantes</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Epstein</surname>
                            <given-names>L</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Incidence and trends of sepsis in US hospitals using clinical vs claims data, 2009-2014.</article-title>
                    <source>

                        <italic toggle="yes">JAMA.</italic>
</source>
                    <year>2017</year>;<volume>318</volume>(<issue>13</issue>):<fpage>1241</fpage>&#x2013;<lpage>1249</lpage>.
                    <pub-id pub-id-type="pmid">28903154</pub-id>
                    <pub-id pub-id-type="doi">10.1001/jama.2017.13836</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5710396</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref33">
                <label>33</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kakihana</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ito</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Nakahara</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Sepsis-induced myocardial dysfunction: pathophysiology and management.</article-title>
                    <source>

                        <italic toggle="yes">J Intensive Care.</italic>
</source>
                    <year>2016</year>;<volume>4</volume>(<issue>1</issue>):<fpage>1</fpage>&#x2013;<lpage>10</lpage>.
                    <pub-id pub-id-type="doi">10.1186/s40560-016-0148-1</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref34">
                <label>34</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Chougule</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Nadkar</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Venkataraman</surname>
                            <given-names>K</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Adipokine interactions promote the pathogenesis of systemic lupus erythematosus.</article-title>
                    <source>

                        <italic toggle="yes">Cytokine.</italic>
</source>
                    <year>2018</year>;<volume>111</volume>:<fpage>20</fpage>&#x2013;<lpage>27</lpage>.
                    <pub-id pub-id-type="pmid">30098476</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.cyto.2018.08.002</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref35">
                <label>35</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sagy</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Al-Qaqaa</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kim</surname>
                            <given-names>P</given-names>
                        </name>
</person-group>:
                    <article-title>Definitions and pathophysiology of sepsis.</article-title>
                    <source>

                        <italic toggle="yes">Curr Probl Pediatr Adolesc Health Care.</italic>
</source>
                    <year>2013</year>;<volume>43</volume>(<issue>10</issue>):<fpage>260</fpage>&#x2013;<lpage>263</lpage>.
                    <pub-id pub-id-type="pmid">24295606</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.cppeds.2013.10.001</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref36">
                <label>36</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Abbas</surname>
                            <given-names>AK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lichtman</surname>
                            <given-names>AH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Pillai</surname>
                            <given-names>S</given-names>
                        </name>
</person-group>:
                    <article-title>Cellular and molecular immunology E-book.</article-title>
                    <source>

                        <italic toggle="yes">Elsevier Health Sciences.</italic>
</source>
                    <year>2014</year>.</mixed-citation>
            </ref>
            <ref id="ref37">
                <label>37</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Seniwaty</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Raihanah</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Nugraheni</surname>
                            <given-names>IK</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Skrining fitokimia dari alang-alang (Imperata cylindrica L. Beauv) dan lidah ular (Hedyotis corymbosa L. Lamk).</article-title>
                    <source>

                        <italic toggle="yes">J Sains Dan Terap Kim.</italic>
</source>
                    <year>2009</year>;<volume>3</volume>(<issue>2</issue>):<fpage>124</fpage>&#x2013;<lpage>133</lpage>.</mixed-citation>
            </ref>
            <ref id="ref38">
                <label>38</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Rathee</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Chaudhary</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rathee</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Mechanism of action of flavonoids as anti-inflammatory agents: a review.</article-title>
                    <source>

                        <italic toggle="yes">Inflamm Allergy-Drug Targets Former Curr Drug Targets-Inflamm AllergyDiscontinued.</italic>
</source>
                    <year>2009</year>;<volume>8</volume>(<issue>3</issue>):<fpage>229</fpage>&#x2013;<lpage>235</lpage>.
                    <pub-id pub-id-type="doi">10.2174/187152809788681029</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref39">
                <label>39</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Guclu</surname>
                            <given-names>E</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Durmaz</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Karabay</surname>
                            <given-names>O</given-names>
                        </name>
</person-group>:
                    <article-title>Effect of severe sepsis on platelet count and their indices.</article-title>
                    <source>

                        <italic toggle="yes">Afr Health Sci.</italic>
</source>
                    <year>2013</year>;<volume>13</volume>(<issue>2</issue>):<fpage>333</fpage>&#x2013;<lpage>338</lpage>.
                    <pub-id pub-id-type="pmid">24235932</pub-id>
                    <pub-id pub-id-type="doi">10.4314/ahs.v13i2.19</pub-id>
                    <pub-id pub-id-type="pmcid">PMC3824485</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref40">
                <label>40</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Tsolaki</surname>
                            <given-names>V</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Makris</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mantzarlis</surname>
                            <given-names>K</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Sepsis-induced cardiomyopathy: oxidative implications in the initiation and resolution of the damage.</article-title>
                    <source>

                        <italic toggle="yes">Oxid Med Cell Longev.</italic>
</source>
                    <year>2017</year>;<volume>2017</volume>:<fpage>1</fpage>&#x2013;<lpage>11</lpage>.
                    <pub-id pub-id-type="doi">10.1155/2017/7393525</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref41">
                <label>41</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kumar</surname>
                            <given-names>V</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Abbas</surname>
                            <given-names>AK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Aster</surname>
                            <given-names>JC</given-names>
                        </name>
</person-group>:
                    <article-title>Robbins basic pathology e-book.</article-title>
                    <source>

                        <italic toggle="yes">Elsevier Health Sciences.</italic>
</source>
                    <year>2017</year>.</mixed-citation>
            </ref>
            <ref id="ref42">
                <label>42</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Abcejo</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Andrejko</surname>
                            <given-names>KM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ochroch</surname>
                            <given-names>EA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Impaired hepatocellular regeneration in murine sepsis is dependent on regulatory protein levels.</article-title>
                    <source>

                        <italic toggle="yes">Shock Augusta Ga.</italic>
</source>
                    <year>2011</year>;<volume>36</volume>(<issue>5</issue>):<fpage>471</fpage>&#x2013;<lpage>477</lpage>.
                    <pub-id pub-id-type="pmid">21937957</pub-id>
                    <pub-id pub-id-type="doi">10.1097/SHK.0b013e31822d60ff</pub-id>
                    <pub-id pub-id-type="pmcid">PMC3196846</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref43">
                <label>43</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Andrades</surname>
                            <given-names>M&#x00c9;</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Morina</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Spasi&#x0107;</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Bench-to-bedside review: sepsis-from the redox point of view.</article-title>
                    <source>

                        <italic toggle="yes">Crit Care.</italic>
</source>
                    <year>2011</year>;<volume>15</volume>(<issue>5</issue>):<fpage>1</fpage>&#x2013;<lpage>12</lpage>.</mixed-citation>
            </ref>
            <ref id="ref44">
                <label>44</label>
                <mixed-citation publication-type="book">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Penny</surname>
                            <given-names>ME</given-names>
                        </name>
</person-group>:
                    <chapter-title>Micronutrients in the treatment of stunting and moderate malnutrition</chapter-title>.
                    <source>

                        <italic toggle="yes">Meeting Micronutrient Requirements for Health and Development.</italic>
</source>
                    <publisher-name>Karger Publishers</publisher-name>;<year>2012</year>; p.<fpage>11</fpage>&#x2013;<lpage>21</lpage>.</mixed-citation>
            </ref>
            <ref id="ref45">
                <label>45</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Lee</surname>
                            <given-names>W-J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Chen</surname>
                            <given-names>Y-L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Chu</surname>
                            <given-names>Y-W</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Comparison of glutathione peroxidase-3 protein expression and enzyme bioactivity in normal subjects and patients with sepsis.</article-title>
                    <source>

                        <italic toggle="yes">Clin Chim Acta.</italic>
</source>
                    <year>2019</year>;<volume>489</volume>:<fpage>177</fpage>&#x2013;<lpage>182</lpage>.
                    <pub-id pub-id-type="doi">10.1016/j.cca.2017.10.031</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref46">
                <label>46</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Deutschman</surname>
                            <given-names>CS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tracey</surname>
                            <given-names>KJ</given-names>
                        </name>
</person-group>:
                    <article-title>Sepsis: current dogma and new perspectives.</article-title>
                    <source>

                        <italic toggle="yes">Immunity.</italic>
</source>
                    <year>2014</year>;<volume>40</volume>(<issue>4</issue>):<fpage>463</fpage>&#x2013;<lpage>475</lpage>.
                    <pub-id pub-id-type="pmid">24745331</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.immuni.2014.04.001</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref47">
                <label>47</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Bermudes</surname>
                            <given-names>ACG</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Carvalho</surname>
                            <given-names>WB</given-names>
                            <prefix>de</prefix>
                        </name>

                        <name name-style="western">
                            <surname>Zamberlan</surname>
                            <given-names>P</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Changes in lipid metabolism in pediatric patients with severe sepsis and septic shock.</article-title>
                    <source>

                        <italic toggle="yes">Nutrition.</italic>
</source>
                    <year>2018</year>;<volume>47</volume>:<fpage>104</fpage>&#x2013;<lpage>109</lpage>.
                    <pub-id pub-id-type="pmid">29429528</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.nut.2017.09.015</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref48">
                <label>48</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>T&#x0151;zs&#x00e9;r</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Benk&#x0151;</surname>
                            <given-names>S</given-names>
                        </name>
</person-group>:
                    <article-title>Natural compounds as regulators of NLRP3 inflammasome-mediated IL-1&#x03b2; production.</article-title>
                    <source>

                        <italic toggle="yes">Mediators Inflamm.</italic>
</source>
                    <year>2016</year>;<volume>2016</volume>:<fpage>1</fpage>&#x2013;<lpage>16</lpage>.
                    <pub-id pub-id-type="doi">10.1155/2016/5460302</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref49">
                <label>49</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hardaway</surname>
                            <given-names>AL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Podgorski</surname>
                            <given-names>I</given-names>
                        </name>
</person-group>:
                    <article-title>IL-1&#x03b2;, RAGE and FABP4: targeting the dynamic trio in metabolic inflammation and related pathologies.</article-title>
                    <source>

                        <italic toggle="yes">Future Med Chem.</italic>
</source>
                    <year>2013</year>;<volume>5</volume>(<issue>10</issue>):<fpage>1089</fpage>&#x2013;<lpage>1108</lpage>.
                    <pub-id pub-id-type="pmid">23795967</pub-id>
                    <pub-id pub-id-type="doi">10.4155/fmc.13.90</pub-id>
                    <pub-id pub-id-type="pmcid">PMC3826552</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref50">
                <label>50</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Steen</surname>
                            <given-names>KA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Xu</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bernlohr</surname>
                            <given-names>DA</given-names>
                        </name>
</person-group>:
                    <article-title>FABP4/aP2 regulates macrophage redox signaling and inflammasome activation via control of UCP2.</article-title>
                    <source>

                        <italic toggle="yes">Mol Cell Biol.</italic>
</source>
                    <year>2017</year>;<volume>37</volume>(<issue>2</issue>):<fpage>e00282</fpage>&#x2013;<lpage>e00216</lpage>.
                    <pub-id pub-id-type="doi">10.1128/MCB.00282-16</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref51">
                <label>51</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Liu</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Xiong</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zhu</surname>
                            <given-names>X</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Icariin improves osteoporosis, inhibits the expression of PPAR&#x03b3;, C/EBP&#x03b1;, FABP4 mRNA, N1ICD and jagged1 proteins, and increases Notch2 mRNA in ovariectomized rats.</article-title>
                    <source>

                        <italic toggle="yes">Exp Ther Med.</italic>
</source>
                    <year>2017</year>;<volume>13</volume>(<issue>4</issue>):<fpage>1360</fpage>&#x2013;<lpage>1368</lpage>.
                    <pub-id pub-id-type="pmid">28413478</pub-id>
                    <pub-id pub-id-type="doi">10.3892/etm.2017.4128</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5377361</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref52">
                <label>52</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Floresta</surname>
                            <given-names>G</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Pistar&#x00e0;</surname>
                            <given-names>V</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Amata</surname>
                            <given-names>E</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Adipocyte fatty acid binding protein 4 (FABP4) inhibitors. A comprehensive systematic review.</article-title>
                    <source>

                        <italic toggle="yes">Eur J Med Chem.</italic>
</source>
                    <year>2017</year>;<volume>138</volume>:<fpage>854</fpage>&#x2013;<lpage>873</lpage>.
                    <pub-id pub-id-type="pmid">28738306</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.ejmech.2017.07.022</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref53">
                <label>53</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Xu</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hertzel</surname>
                            <given-names>AV</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Steen</surname>
                            <given-names>KA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Loss of fatty acid binding protein 4/aP2 reduces macrophage inflammation through activation of SIRT3.</article-title>
                    <source>

                        <italic toggle="yes">Mol Endocrinol.</italic>
</source>
                    <year>2016</year>;<volume>30</volume>(<issue>3</issue>):<fpage>325</fpage>&#x2013;<lpage>334</lpage>.
                    <pub-id pub-id-type="pmid">26789108</pub-id>
                    <pub-id pub-id-type="doi">10.1210/me.2015-1301</pub-id>
                    <pub-id pub-id-type="pmcid">PMC4771695</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref54">
                <label>54</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kerimi</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Williamson</surname>
                            <given-names>G</given-names>
                        </name>
</person-group>:
                    <article-title>At the interface of antioxidant signalling and cellular function: key polyphenol effects.</article-title>
                    <source>

                        <italic toggle="yes">Mol Nutr Food Res.</italic>
</source>
                    <year>2016</year>;<volume>60</volume>(<issue>8</issue>):<fpage>1770</fpage>&#x2013;<lpage>1788</lpage>.
                    <pub-id pub-id-type="pmid">26887821</pub-id>
                    <pub-id pub-id-type="doi">10.1002/mnfr.201500940</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5021119</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref55">
                <label>55</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Putri</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rastiarsa</surname>
                            <given-names>BM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Djajanagara</surname>
                            <given-names>RATM</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Data Measurement of Sepsis Mice Model with Ethanol Extract of Cogon Grass Root (Imperata cylindrica L.) Pre-treament.</article-title>
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>
                    <year>2021</year>.</mixed-citation>
            </ref>
            <ref id="ref56">
                <label>56</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Putri</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rastiarsa</surname>
                            <given-names>BM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Djajanagara</surname>
                            <given-names>RATM</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Original unedited histopathology image of the liver, heart, and spleen of a sepsis mouse model after pre-treatment with ECGR.</article-title>
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>
                    <year>2021</year>.</mixed-citation>
            </ref>
            <ref id="ref57">
                <label>57</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Putri</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rastiarsa</surname>
                            <given-names>BM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Djajanagara</surname>
                            <given-names>RATM</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>ARRIVE Essential 10 checklist-Effect of cogon grass root ethanol extract on fatty acid binding protein 4 and oxidative stress markers in a sepsis mouse model.</article-title>
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>
                    <year>2021</year>.</mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report100358">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.77221.r100358</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Roosita</surname>
                        <given-names>Katrin</given-names>
                    </name>
                    <xref ref-type="aff" rid="r100358a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r100358a1">
                    <label>1</label>Department of Community Nutrition, Faculty of Human Ecology, IPB University, Bogor, Indonesia</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>14</day>
                <month>12</month>
                <year>2021</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2021 Roosita K</copyright-statement>
                <copyright-year>2021</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport100358" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.73561.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>This manuscript has an acceptable scientific standard, but I have concerns about some details, as follows: 
                <list list-type="order">
                    <list-item>
                        <p>How was the antioxidant activity measured/determined?</p>
                    </list-item>
                    <list-item>
                        <p>Please elaborate/explain the parameters of the immune system-associated biomarker levels that were also measured.</p>
                    </list-item>
                    <list-item>
                        <p>This study aimed to assess the&#x00a0;effects&#x00a0;of ECGR on FABP4 and oxidative stress-related factors, meanwhile, the conclusion only mentions that cogon grass root may aid in the development of herbal medicines and specific treatments for sepsis, not specifically addressing the purpose of this study.</p>
                    </list-item>
                    <list-item>
                        <p>It will also be valuable to explain the concentration of flavonoid antioxidants as bioactive compounds, such as Quercetin and icariin if authors have information about these.</p>
                    </list-item>
                </list>
            </p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Partly</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Partly</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Partly</p>
            <p>Reviewer Expertise:</p>
            <p>Nutrigenomic, Nutraceuticals, herbal medicine, stress oxidative and human nutrition.</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
        <sub-article article-type="response" id="comment7642-100358">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Putri</surname>
                            <given-names>Mirasari</given-names>
                        </name>
                        <aff>Universitas Islam Bandung, Indonesia</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>The authors have no conflicts of interest to declare.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>30</day>
                    <month>12</month>
                    <year>2021</year>
                </pub-date>
            </front-stub>
            <body>
                <p>We greatly appreciate the reviewer&#x2019;s time and effort in providing useful feedback and corrections. These are our answers:</p>
                <p> </p>
                <p> 1. How was the antioxidant activity measured/determined?</p>
                <p> </p>
                <p> 
                    <bold>Response:</bold> We measured the antioxidant by measuring the activity of Glutathione peroxidase 3 (GPx3 ) and superoxide dismutase gene expression (SOD). In mammals, GPx and SOD are the main antioxidants that protect cells from damage caused by free radicals through synergistic action. We have revised the abstract (Line 26)</p>
                <p> </p>
                <p> 2. Please elaborate/explain the parameters of the immune system-associated biomarker levels that were also measured.</p>
                <p> </p>
                <p> 
                    <bold>Response:</bold> We measured gene expression of TNF-&#x03b1;, IL-6, and IL-1&#x03b2;, we revised the abstract (Line 27)</p>
                <p> </p>
                <p> 3. This study aimed to assess the effects of ECGR on FABP4 and oxidative stress-related factors, meanwhile, the conclusion only mentions that cogon grass root may aid in the development of herbal medicines and specific treatments for sepsis, not specifically addressing the purpose of this study.</p>
                <p> </p>
                <p> 
                    <bold>Response:</bold> We have revised the conclusion according to the purpose of this study (Line 35)</p>
                <p> </p>
                <p> 4. It will also be valuable to explain the concentration of flavonoid antioxidants as bioactive compounds, such as Quercetin and icariin if authors have information about these.</p>
                <p> </p>
                <p> 
                    <bold>Response:</bold> In our study, we did not isolate the bioactive compounds. Still, we found in other studies that they determined the amount of flavonoid and quercetin concentration. However, No study found icariin in cogon grass extract. This compound is mainly found in horny goat weed (Yin Yang Huo), a Chinese herbal medicine. We added some information about Quercetin (Line 305-307).</p>
            </body>
        </sub-article>
    </sub-article>
</article>
