The human pancreatic cell line Panc-1 was purchased from ATCC (Manassas, VA, RRID:CVCL_0480). The cells were cultured in DMEM media (Millipore Sigma, Burlington, MA, USA), supplemented with 10% fetal bovine serum (Thermo Fisher Scientific, Waltham, MA, USA) at 37 °C in a humidified 5% CO ₂ incubator.

Proteins from cells were extracted with RIPA lysis and extraction buffer (Thermo Fisher, Waltham, MA) supplemented with Complete Inhibitor Cocktail (Roche Applied Science, Indianapolis, IN). 20 μg of the protein from cell lysate was loaded per lane on SDS-PAGE gel and subjected to Western blotting according to our procedure published previously. ¹³ Antibodies against GAPDH (1:5000 dilution) and anti-cyclin D1 (1: 500 dilution) were purchased from Cell Signaling Technology (Danvers, MA).

Panc-1 cells plated at 40–50% density were grown to ~75% confluency overnight as described above. The next day, cells were treated with 50-60 pmols of three CPE siRNAs custom synthesized by Invitrogen, (Carlsbad, CA) which target both CPE-WT and CPE-ΔN mRNAs:

siCPE Seq1#: GAU UUG UCC GAG ACC UUC AAG GUA A;

siCPE Seq2#: UUA CCU UGA AGG UCU CGG ACA AAU C;

siCPE Seq3#: GAU CCU GAG AGU UCC GAA CGU UUA A,

or scrambled siRNA, which is a non-targeting 20-25nt siRNA (Santa Cruz Biotechnology, Dallas, TX), using Lipofectamine RNAiMAX transfection reagent (Invitrogen, Carlsbad, CA) according to manufacturers’ protocol. After 24h incubation, the cells were dissociated by trypsinization, cell count were obtained, and seeded in various plates for cell invasion, cell migration, colony formation assay, and cell proliferation assays.

Panc-1 cells were treated for 48h with siRNA. RNA was then extracted from the cells using the RNeasy Mini Kit (Qiagen, Germantown, MD). First-strand cDNA was synthesized with 200 ng of total RNA using the SensiFAST cDNA Synthesis Kit (Bioline Reagents Ltd, United Kingdom) for assay of CPE expression. Quantitative PCR was performed using 1μl first strand cDNA and SYBR Green Master Mix (Invitrogen) under the conditions of 95 °C for 15 s, annealing at 62 °C for 60 s, extension at 72 °C for 30 s for 40 cycles, and a final extension at 72 °C for 10 min. 18 s rRNA was used as a normalizing control. Primer sequences were: for amplifying CPE (generic), fwd: 5′- CCATCTCCGTGGAAGGAATA and rev: 5′-CTT ACA GCC TCA GCT CCA GG; 18S RNA, fwd: 5′-CTCTTAGCTGAGTGTCCCGC and rev: 5′-CTGATCGTCTTCGAACCTCC.

Panc-1 cells treated with siRNA for 24 h were seeded in a 96-well plate at a density of 2000 cells/well in 200μl media and incubated for four to five days. MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay was performed daily from day one to four. 25 μl of MTT reagent (5 mg/ml) (Sigma-Aldrich, St. Louis, MO) added to each well were then incubated in a CO ₂ incubator at 37°C for 4 h. The supernatant was then removed and DMSO (150 μl) was added to each well. Absorbance value at 490 nm was then measured in a microplate reader (BioTek, Winooski, VT) after 5 min. Experiments were performed in five different wells for each condition. Two independent experiments were performed on separate days.

Panc-1 cells treated with CPE siRNA or scrambled siRNA were trypsinized and single cell suspensions were obtained. Viable cells, (2000/well) were seeded in a 6-well plate and cultured for 15-21 days. Culture medium was changed every five days. Cells were then gently washed twice with PBS and fixed in 100% methanol, before staining with 1% crystal violet solution for 10 minutes. Excess stain was removed by washing with PBS. The number of colonies containing at least 50 cells were counted with Image J software from the images captured under a light microscope. The experiment was repeated three times and each experiment was done in triplicates.

Approximately 1 × 10 ⁵ Panc-1cells were plated in the well of culture insert in non-coated 35 mm culture dish (Ibidi, Martinsried, Germany) and allowed to form a monolayer. A ~500 μm wound gap was created when the culture insert was removed, and the cells were immersed in the complete media following manufacturer’s instructions. Images of the wound were captured at time 0, and then at 12, 24, and 36 h after incubation in a CO ₂ incubator at 37°C. Wound closure was evaluated by measuring the areas of the wound at different time points using Image J software. Three experiments were done on separate days and each experiment was done in triplicates.

A 24-well Corning Matrigel invasion chamber (Corning, NY) with 8-micron pores was used for cell invasion assay. 500 μl of cell suspension (1 × 10 ⁵ cells/ml) in serum free media was added to the top chamber. Then 500 μl of FBS supplemented media was added to the lower chamber to serve as a chemoattractant. 24 h. later, cells that did not invade through the pores were carefully removed with a cotton swab. Cells on the lower surface of the membrane were fixed with 100% methanol and stained with 1% crystal violet solution for 10 min. Excess stain was removed with water and images from five different fields/well were captured. Cells were counted with ImageJ software. Experiments were done in triplicates.

The data reported are the mean ± SD (standard deviation) or mean ± SE (standard error) of at least triplicate values (n) in each experiment. Number of independent experiments (N) is stated in the figure legends. Statistical significance was determined by Student’s t-test and p values are indicated as *p < 0.05, **p < 0.01, ***p < 0.001.

Figure 1A shows a schematic of the two forms of CPE: wild type CPE and 40 kD CPE-ΔN expressed by Panc-1 cells reported previously. ¹⁴ Moreover, CPE-WT protein was detected mainly in the secretion medium, while CPE-ΔN was found in the nucleus and cytoplasm of Panc-1 cells. ¹⁴ To evaluate the function of CPE, Panc-1 cells were treated with CPE si-RNA targeting the silencing of expression of both forms of CPE (see materials and methods). Figure 1B shows that treatment of Panc-1 cells with CPE siRNA down-regulated expression of CPE-transcripts by 94.8 ± 2.2%. Down-regulation of CPE with siRNA treatment resulted in significant inhibition of Panc-1 cell proliferation from day two to day four as observed in the MTT cell proliferation assay ( Figure1C). Additionally, CPE siRNA treatment reduced colony formation in Panc-1 cells by 62.8%, versus cells treated with scrambled (scr) siRNA ( Figure 1D and E).

To determine if the inhibition of proliferation of Panc-1 cells is mediated by down-regulation of Cyclin D1, a protein necessary for cell cycle progression, Western blot analysis of Panc-1 cells treated with CPE-siRNA was carried out. Figure 2A and B show that Cyclin D1 expression was significantly inhibited by 32.5% in CPE siRNA treated cells compared to scr siRNA treated cells.

Wound healing assay was carried out to study the effect of down-regulation of CPE expression on migration of Panc-1 cells. Treatment of Panc-1 cells with CPE siRNA significantly inhibited migration of these cells. At the 24-hour time point, the wound healing area of siCPE RNA treated cells was ~ 8-fold larger than scr siRNA treated cells ( Figure 3A and B). In addition, suppression of CPE expression by CPE siRNA inhibited invasion of these cells, as revealed by the matrigel invasion assay. The number of cells which invaded across the matrigel membrane was ~three-fold greater in scr siRNA treated versus CPE siRNA treated cells ( Figure 3C and D).

Harvard Dataverse: Silencing of Carboxypeptidase E expression inhibits proliferation and invasion of Panc-1 pancreatic cancer cells. https://doi.org/10.7910/DVN/TUFG9M. ²¹

This project contains the following underlying data •

Figure 1B. tab (CPE qRT-PCR data in Panc-1 cells treated with CPE siRNA (siCPE) or scrambled siRNA (scr).)