<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.53214.1</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>Discrimination of the SARS&#x2013;CoV-2 strains using of&#x00a0;coloured&#x00a0;s-LASCA-imaging of GB-speckles,&#x00a0;developed&#x00a0;for&#x00a0;the&#x00a0;gene&#x00a0;&#x201c;S&#x201d;&#x00a0;nucleotide sequences</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 1; peer review: 1 approved with reservations]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Ulianova</surname>
                        <given-names>Onega</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Saltykov</surname>
                        <given-names>Yury</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Ulyanov</surname>
                        <given-names>Sergey</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Software</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Zaytsev</surname>
                        <given-names>Sergey</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Ulyanov</surname>
                        <given-names>Alexander</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Software</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Feodorova</surname>
                        <given-names>Valentina</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-3827-407X</uri>
                    <xref ref-type="corresp" rid="c2">b</xref>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Department of Medical Physics, Saratov State University, Saratov, Saratov, 410012, Russian Federation</aff>
                <aff id="a2">
                    <label>2</label>Laboratory for Molecular Biology and NanoBioTechnology, Federal Research Center for Virology and Microbiology, Branch in Saratov, Saratov, Saratov, 410076, Russian Federation</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:prof.sergey.ulyanov@outlook.com">prof.sergey.ulyanov@outlook.com</email>
                </corresp>
                <corresp id="c2">
                    <label>b</label>
                    <email xlink:href="mailto:feodorovav@mail.ru">feodorovav@mail.ru</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>25</day>
                <month>6</month>
                <year>2021</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2021</year>
            </pub-date>
            <volume>10</volume>
            <elocation-id>503</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>16</day>
                    <month>6</month>
                    <year>2021</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2021 Ulianova O et al.</copyright-statement>
                <copyright-year>2021</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/10-503/pdf"/>
            <abstract>
                <p>Background</p>
                <p> A recent bioinformatics technique involves changing nucleotide sequences into 2D speckles. This technique produces speckles called GB-speckles (Gene Based speckles). All classical strategies of speckle-optics, namely speckle-interferometry, subtraction of speckle-images as well as speckle-correlometry have been inferred for processing of GB-speckles. This indicates the considerable improvement in the present tools of bioinformatics.</p>
                <p> Methods </p>
                <p> Colour s-LASCA imaging of virtual laser GB-speckles, a new method of high discrimination and typing of pathogenic viruses, has been developed. This method has been adapted to the detecting of natural mutations in nucleotide sequences, related to the spike glycoprotein (coding the gene &#x00ab;S&#x00bb;) of SARS&#x2013;CoV-2 gene as the molecular target. </p>
                <p> Results </p>
                <p> The rate of the colouring images of virtual laser GB-speckles generated by s-LASCA can be described by the specific value of R. If the nucleotide sequences compared utilizing this approach the relevant images are completely identical, then the three components of the resulting colour image will be identical, and therefore the value of R will be equal to zero. However, if there are at least minimal differences in the matched nucleotide sequences, then the value of R will be positive. </p>
                <p> Conclusion </p>
                <p> The high effectiveness of an application of the colour images of GB-speckles that were generated by s-LASCA- has been demonstrated for discrimination between different variants of the SARS&#x2013;CoV-2 spike glycoprotein gene.</p>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>LASCA</kwd>
                <kwd>SARS&#x2013;CoV-2</kwd>
                <kwd>GB-speckles</kwd>
                <kwd>gene</kwd>
            </kwd-group>
            <funding-group>
                <award-group id="fund-1" xlink:href="http://dx.doi.org/10.13039/501100002261">
                    <funding-source>Russian Foundation for Basic Research</funding-source>
                    <award-id>20-04-60349</award-id>
                </award-group>
                <funding-statement>The reported study was funded by RFBR, project number 20-04-60349.  </funding-statement>
                <funding-statement>
                    <italic>The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.</italic>
                </funding-statement>
            </funding-group>
        </article-meta>
    </front>
    <body>
        <sec id="sec1" sec-type="intro">
            <title>Introduction</title>
            <p>As it is well known, if laser light diffracts on random objects, then laser speckles are formed.
                <sup>
                    <xref ref-type="bibr" rid="ref1">1</xref>-
                    <xref ref-type="bibr" rid="ref3">3</xref>
                </sup> Recently, the possibility of transforming a nucleotide sequence into a pattern of 2D speckles had been demonstrated.
                <sup>
                    <xref ref-type="bibr" rid="ref4">4</xref>-
                    <xref ref-type="bibr" rid="ref9">9</xref>
                </sup> This new type of speckle pattern has been called &#x201c;GB-speckles&#x201d; (gene-based speckles).
                <sup>
                    <xref ref-type="bibr" rid="ref5">5</xref>,
                    <xref ref-type="bibr" rid="ref7">7</xref>,
                    <xref ref-type="bibr" rid="ref9">9</xref>
                </sup> Changes within in the structure of the GB-speckles can reflect even negligible changes in the nucleotide sequence, caused by inartificial mutations. This allows detection of single-nucleotide polymorphisms (SNP) using virtual GB-speckles with outstanding precision. In addition, it offers unlimited potential of improving the diagnosis&#x2019; accuracy by increasing the Fourier transform area.
                <sup>
                    <xref ref-type="bibr" rid="ref10">10</xref>
                </sup>
            </p>
            <p>Essential advancement in the area of GB-speckles has been reported in previous years. According to previously published reports,
                <sup>
                    <xref ref-type="bibr" rid="ref4">4</xref>-
                    <xref ref-type="bibr" rid="ref9">9</xref>,
                    <xref ref-type="bibr" rid="ref11">11</xref>
                </sup> implementation of speckle-optics methods, like speckle-interferometry and subtraction of speckle-images as well as speckle-correlometry for processing of GB-speckles, provides considerable progress in the current bioinformatics toolbox. This can become crucial to significantly improve existing routine methods of laboratory diagnostics of infectious diseases. GB-speckles as a technique opens the door to the new horizons in digital biology.
                <sup>
                    <xref ref-type="bibr" rid="ref12">12</xref>,
                    <xref ref-type="bibr" rid="ref13">13</xref>
                </sup>
            </p>
            <p>Recently, model GB-speckle patterns of nucleotide sequences of the 
                <italic toggle="yes">omp1</italic> genes for two different of 
                <italic toggle="yes">Chlamydia</italic> spp., such as 
                <italic toggle="yes">Chlamydia trachomatis</italic> and 
                <italic toggle="yes">Chlamydia psittaci</italic> of at least six genovars (D, E, F, G, J and K) have been composed.
                <sup>
                    <xref ref-type="bibr" rid="ref4">4</xref>,
                    <xref ref-type="bibr" rid="ref5">5</xref>
                </sup> Probability density functions and correlation properties of spatial intensity fluctuations for the relevant GB-speckle patterns have been studied.
                <sup>
                    <xref ref-type="bibr" rid="ref5">5</xref>-
                    <xref ref-type="bibr" rid="ref7">7</xref>
                </sup> As it has been shown in previous studies,
                <sup>
                    <xref ref-type="bibr" rid="ref4">4</xref>-
                    <xref ref-type="bibr" rid="ref7">7</xref>,
                    <xref ref-type="bibr" rid="ref9">9</xref>
                </sup> the presence of inartificial mutations in analysed strains, including single SNP cases, can be easily defined using methods of speckle-optics.
                <sup>
                    <xref ref-type="bibr" rid="ref4">4</xref>-
                    <xref ref-type="bibr" rid="ref7">7</xref>,
                    <xref ref-type="bibr" rid="ref9">9</xref>
                </sup> More recently, the encoding algorithm&#x2019;s optimization for nucleotide sequences of 
                <italic toggle="yes">C. trachomatis</italic> into two-dimensional GB-speckle pattern had been carried out;
                <sup>
                    <xref ref-type="bibr" rid="ref4">4</xref>,
                    <xref ref-type="bibr" rid="ref6">6</xref>
                </sup> and speckle-interferometric technique may give rise the ultra-fast optical processors of DNA sequences.
                <sup>
                    <xref ref-type="bibr" rid="ref4">4</xref>
                </sup> This is ensured by the development of the exclusive system of interferential fringes which are generated by the model interference pattern led by the existence of any type of mutations. Additionally, the method of virtual phase-shifting speckle-interferometry was reported to be efficacious
                <sup>
                    <xref ref-type="bibr" rid="ref11">11</xref>
                </sup> to investigate of polymorphism of the 
                <italic toggle="yes">C. trachomatis omp1</italic> gene. This approach allowed the detection of the 
                <italic toggle="yes">C. trachomatis omp1</italic> gene with SNPs, including both a single SNP and a combination of several SNPs in the bacterial strains with genetic mutations (11 known subtypes in total) had been developed.
                <sup>
                    <xref ref-type="bibr" rid="ref6">6</xref>
                </sup>
            </p>
            <p>The format of GB-speckles had been successfully applied to transform the nucleotide sequences of the genes expressing the serine proteases, the well-known Omptin family proteins within the 
                <italic toggle="yes">Enterobacteriaceae.</italic> These proteins have been found on the surface of several bacterial agents causing different enteric infections, such as salmonellosis, shigelosis, yersiniosis, and escherichiosis.
                <sup>
                    <xref ref-type="bibr" rid="ref7">7</xref>
                </sup> Further, the phase and the relevant two-dimensional distributions of the intensity of GB-speckles in various strains of viral pathogens, namely of lumpy skin disease virus of cattle, LSDV, and also for sheep-pox virus, SPPV have been obtained.
                <sup>
                    <xref ref-type="bibr" rid="ref8">8</xref>
                </sup> Additionally, interference patterns for generated the specific superposition in the relevant fields of GB-speckle and the certain difference in their images have been successfully investigated to reveal a minimal discrimination between the initial viral nucleotide sequences.</p>
            <p>A new bioinformatics approach has been proposed very recently:
                <sup>
                    <xref ref-type="bibr" rid="ref14">14</xref>
                </sup> GB-speckles processing 
                <italic toggle="yes">via</italic> an 
                <italic toggle="yes">s-LASCA</italic> technique (from the 
                <underline>s</underline>patial 
                <underline>L</underline>aser 
                <underline>S</underline>peckle 
                <underline>C</underline>ontrast 
                <underline>A</underline>nalysis) application. As it had been demonstrated, it is possible to extend affectability of the proposed approach comparing to current bioinformatics strategies
                <sup>
                    <xref ref-type="bibr" rid="ref15">15</xref>
                </sup> using 
                <italic toggle="yes">s-LASCA</italic> imaging in the GB-speckles&#x2019; processing. It had been shown in Ref. 
                <xref ref-type="bibr" rid="ref16">16</xref>, that the GB-speckles&#x2019; generation combined with 
                <italic toggle="yes">s-LASCA</italic> imaging method are very effective to analyze nucleotide polymorphism in several genes of 
                <italic toggle="yes">C. trachomatis.</italic>
            </p>
            <p>This paper is devoted to development of advantageously new technique: the coloured 
                <italic toggle="yes">s-LASCA</italic> imaging of GB-speckles. Such a technique is an improved version of previously suggested &#x201c;greyscale&#x201d; 
                <italic toggle="yes">s-LASCA</italic> imaging that was recently developed especially for GB-speckles. Nucleotide sequences for some target genes SARS&#x2013;CoV-2 have been successfully processed using coloured 
                <italic toggle="yes">s-LASCA</italic>-imaging. Natural mutations in the comparing genes have been reliably and accurately detected.</p>
        </sec>
        <sec id="sec2" sec-type="methods">
            <title>Methods</title>
            <sec id="sec3">
                <title>Nucleotide sequences under consideration.</title>
                <p>Seven nucleotide sequences of spike glycoprotein of SARS-CoV-2, namely:</p>
                <p>the gene#1. hCoV-19/cat/USA/TX-TAMU-078/2020 (Accession ID: EPI ISL 699509),</p>
                <p>the gene#2. hCoV-19/cat/Russia/RII-LEN-22246S/2021 (Accession ID: EPI ISL 811147),</p>
                <p>the gene#3. hCoV-19/cat/Greece/2K/2020 (Accession ID: EPI ISL 717979),</p>
                <p>the gene#4. hCoV-19/Wuhan/WIV04/2019 (Accession ID: EPI ISL 402124),</p>
                <p>the gene#5. hCoV-19/England/QEUH-B11766/2020 (Accession ID: EPI ISL 642476),</p>
                <p>the gene#6. hCoV19/South Africa/KRISP-EC-K005299/2020 (Accession ID: EPI ISL 678597),</p>
                <p>the gene#7. hCoV-19/Russia/MOS-CRIE-13604226/2020 (Accession ID: EPI ISL 754198).</p>
                <p>have been compared on the base of analysis of GB-speckles. The official reference sequences were taken from the 
                    <ext-link ext-link-type="uri" xlink:href="https://www.gisaid.org/">GISAID database</ext-link>.</p>
                <p>Algorithm for the total conversion of a nucleotide sequence to a colour GB speckle structure, processed by 
                    <italic toggle="yes">s-LASCA</italic> imaging technique</p>
            </sec>
            <sec id="sec4">
                <title>Initial processing of nucleotide sequence</title>
                <p>First, the sequence of the letters derived from the original one-dimensional nucleotide sequence was converted into the sequence of numbers in accordance with the following rule:
                    <sup>
                        <xref ref-type="bibr" rid="ref4">4</xref>
                    </sup>
                    <disp-formula id="e1">
                        <mml:math display="block">
                            <mml:mrow>
                                <mml:mi>A</mml:mi>
                                <mml:mo>&#x2192;</mml:mo>
                                <mml:mn>1</mml:mn>
                                <mml:mo>;</mml:mo>
                                <mml:mtext>&#x2009;</mml:mtext>
                                <mml:mi>C</mml:mi>
                                <mml:mo>&#x2192;</mml:mo>
                                <mml:mn>2</mml:mn>
                                <mml:mo>;</mml:mo>
                                <mml:mtext>&#x2009;</mml:mtext>
                                <mml:mi>G</mml:mi>
                                <mml:mo>&#x2192;</mml:mo>
                                <mml:mn>3</mml:mn>
                                <mml:mo>;</mml:mo>
                                <mml:mtext>&#x2009;</mml:mtext>
                                <mml:mi>T</mml:mi>
                                <mml:mo>&#x2192;</mml:mo>
                                <mml:mn>4.</mml:mn>
                            </mml:mrow>
                        </mml:math>
                        <label>(1)</label>
                    </disp-formula>
                </p>
                <p>It is critical to emphasize that the specific relationship between the letters and numbers in this case is not critical as used earlier;
                    <sup>
                        <xref ref-type="bibr" rid="ref6">6</xref>
                    </sup> thus, other rules could have been applied to the encoding, for instance:
                    <disp-formula id="e2">
                        <mml:math display="block">
                            <mml:mi>C</mml:mi>
                            <mml:mo>&#x2192;</mml:mo>
                            <mml:mn>1</mml:mn>
                            <mml:mo>;</mml:mo>
                            <mml:mtext>&#x2009;</mml:mtext>
                            <mml:mi>G</mml:mi>
                            <mml:mo>&#x2192;</mml:mo>
                            <mml:mn>2</mml:mn>
                            <mml:mo>;</mml:mo>
                            <mml:mtext>&#x2009;</mml:mtext>
                            <mml:mi>T</mml:mi>
                            <mml:mo>&#x2192;</mml:mo>
                            <mml:mn>3</mml:mn>
                            <mml:mo>;</mml:mo>
                            <mml:mtext>&#x2009;</mml:mtext>
                            <mml:mi>A</mml:mi>
                            <mml:mo>&#x2192;</mml:mo>
                            <mml:mn>4.</mml:mn>
                        </mml:math>
                        <label>(2)</label>
                    </disp-formula>or
                    <disp-formula id="e3">
                        <mml:math display="block">
                            <mml:mi>T</mml:mi>
                            <mml:mo>&#x2192;</mml:mo>
                            <mml:mn>1</mml:mn>
                            <mml:mo>;</mml:mo>
                            <mml:mtext>&#x2009;</mml:mtext>
                            <mml:mi>A</mml:mi>
                            <mml:mo>&#x2192;</mml:mo>
                            <mml:mn>2</mml:mn>
                            <mml:mo>;</mml:mo>
                            <mml:mtext>&#x2009;</mml:mtext>
                            <mml:mi>C</mml:mi>
                            <mml:mo>&#x2192;</mml:mo>
                            <mml:mn>3</mml:mn>
                            <mml:mo>;</mml:mo>
                            <mml:mtext>&#x2009;</mml:mtext>
                            <mml:mi>G</mml:mi>
                            <mml:mo>&#x2192;</mml:mo>
                            <mml:mn>4.</mml:mn>
                        </mml:math>
                        <label>(3)</label>
                    </disp-formula>
                </p>
                <p>Next, all possible triad combination are generated. As a result, a complete set of all triads is formed:
                    <disp-formula id="e4">
                        <mml:math display="block">
                            <mml:mrow>
                                <mml:mo>(</mml:mo>
                                <mml:mrow>
                                    <mml:mn>1</mml:mn>
                                    <mml:mtext>&#x2009;</mml:mtext>
                                    <mml:mn>1</mml:mn>
                                    <mml:mtext>&#x2009;</mml:mtext>
                                    <mml:mn>1</mml:mn>
                                </mml:mrow>
                                <mml:mo>)</mml:mo>
                            </mml:mrow>
                            <mml:mo>,</mml:mo>
                            <mml:mtext>&#x2009;</mml:mtext>
                            <mml:mrow>
                                <mml:mo>(</mml:mo>
                                <mml:mrow>
                                    <mml:mn>1</mml:mn>
                                    <mml:mtext>&#x2009;</mml:mtext>
                                    <mml:mn>1</mml:mn>
                                    <mml:mtext>&#x2009;</mml:mtext>
                                    <mml:mn>2</mml:mn>
                                </mml:mrow>
                                <mml:mo>)</mml:mo>
                            </mml:mrow>
                            <mml:mo>,</mml:mo>
                            <mml:mtext>&#x2009;</mml:mtext>
                            <mml:mrow>
                                <mml:mo>(</mml:mo>
                                <mml:mrow>
                                    <mml:mn>1</mml:mn>
                                    <mml:mtext>&#x2009;</mml:mtext>
                                    <mml:mn>1</mml:mn>
                                    <mml:mtext>&#x2009;</mml:mtext>
                                    <mml:mn>3</mml:mn>
                                </mml:mrow>
                                <mml:mo>)</mml:mo>
                            </mml:mrow>
                            <mml:mo>,</mml:mo>
                            <mml:mtext>&#x2009;</mml:mtext>
                            <mml:mrow>
                                <mml:mo>(</mml:mo>
                                <mml:mrow>
                                    <mml:mn>1</mml:mn>
                                    <mml:mtext>&#x2009;</mml:mtext>
                                    <mml:mn>1</mml:mn>
                                    <mml:mtext>&#x2009;</mml:mtext>
                                    <mml:mn>4</mml:mn>
                                </mml:mrow>
                                <mml:mo>)</mml:mo>
                            </mml:mrow>
                            <mml:mo>,</mml:mo>
                            <mml:mtext>&#x2009;</mml:mtext>
                            <mml:mrow>
                                <mml:mo>(</mml:mo>
                                <mml:mrow>
                                    <mml:mn>1</mml:mn>
                                    <mml:mtext>&#x2009;</mml:mtext>
                                    <mml:mn>2</mml:mn>
                                    <mml:mtext>&#x2009;</mml:mtext>
                                    <mml:mn>1</mml:mn>
                                </mml:mrow>
                                <mml:mo>)</mml:mo>
                            </mml:mrow>
                            <mml:mo>,</mml:mo>
                            <mml:mtext>&#x2009;</mml:mtext>
                            <mml:mrow>
                                <mml:mo>(</mml:mo>
                                <mml:mrow>
                                    <mml:mn>1</mml:mn>
                                    <mml:mtext>&#x2009;</mml:mtext>
                                    <mml:mn>2</mml:mn>
                                    <mml:mtext>&#x2009;</mml:mtext>
                                    <mml:mn>2</mml:mn>
                                </mml:mrow>
                                <mml:mo>)</mml:mo>
                            </mml:mrow>
                            <mml:mo>,</mml:mo>
                            <mml:mtext>&#x2009;</mml:mtext>
                            <mml:mrow>
                                <mml:mo>(</mml:mo>
                                <mml:mrow>
                                    <mml:mn>1</mml:mn>
                                    <mml:mtext>&#x2009;</mml:mtext>
                                    <mml:mn>2</mml:mn>
                                    <mml:mtext>&#x2009;</mml:mtext>
                                    <mml:mn>3</mml:mn>
                                </mml:mrow>
                                <mml:mo>)</mml:mo>
                            </mml:mrow>
                            <mml:mo>,</mml:mo>
                            <mml:mtext>&#x2009;</mml:mtext>
                            <mml:mrow>
                                <mml:mo>(</mml:mo>
                                <mml:mrow>
                                    <mml:mn>1</mml:mn>
                                    <mml:mtext>&#x2009;</mml:mtext>
                                    <mml:mn>2</mml:mn>
                                    <mml:mtext>&#x2009;</mml:mtext>
                                    <mml:mn>4</mml:mn>
                                </mml:mrow>
                                <mml:mo>)</mml:mo>
                            </mml:mrow>
                            <mml:mo>,</mml:mo>
                            <mml:mtext>&#x2009;</mml:mtext>
                            <mml:mrow>
                                <mml:mo>(</mml:mo>
                                <mml:mrow>
                                    <mml:mn>1</mml:mn>
                                    <mml:mtext>&#x2009;</mml:mtext>
                                    <mml:mn>3</mml:mn>
                                    <mml:mtext>&#x2009;</mml:mtext>
                                    <mml:mn>1</mml:mn>
                                </mml:mrow>
                                <mml:mo>)</mml:mo>
                            </mml:mrow>
                            <mml:mo>,</mml:mo>
                            <mml:mtext>&#x2009;</mml:mtext>
                            <mml:mn>...</mml:mn>
                            <mml:mtext>&#x2009;</mml:mtext>
                            <mml:mo>,</mml:mo>
                            <mml:mtext>&#x2009;</mml:mtext>
                            <mml:mrow>
                                <mml:mo>(</mml:mo>
                                <mml:mrow>
                                    <mml:mn>4</mml:mn>
                                    <mml:mtext>&#x2009;</mml:mtext>
                                    <mml:mn>4</mml:mn>
                                    <mml:mtext>&#x2009;</mml:mtext>
                                    <mml:mn>4</mml:mn>
                                </mml:mrow>
                                <mml:mo>)</mml:mo>
                            </mml:mrow>
                            <mml:mo>.</mml:mo>
                        </mml:math>
                        <label>(4)</label>
                    </disp-formula>
                </p>
                <p>The number of all possible combinations of four numbers combined in triads is 64.</p>
                <p>Then, a discrete magnitude, h, is allotted to each triad in accordance with the simple algorithm described previously.
                    <sup>
                        <xref ref-type="bibr" rid="ref4">4</xref>
                    </sup> This algorithm was implemented in Matlab R2015a (
                    <bold>
                        <sans-serif>RRID:SCR_001622</sans-serif>
                    </bold>); an open access alternative is 
                    <ext-link ext-link-type="uri" xlink:href="https://julialang.org/">Julia</ext-link>. The value of h is a positive integer, varying in the range from 1 to 64. In this case, each triad from the original nucleotide sequence is associated with only one h value. So, for example, the combination (1 1 1) conforms to the value h = 1, (1 1 2) corresponds to h = 2, (1 1 3) conforms to h = 3, (1 1 4) conforms to h = 4, (1 2 1) conforms to h = 5, (1 2 2) conforms to h = 6, and so on. Finally, the latest combination (4 4 4) conforms to the value h = 64. Finally, a square matrix H
                    <sub>n,m</sub> was formed by a one-dimensional array h. The physical significance of the shaped matrix H
                    <sub>n,m</sub> is that each of its elements represents the local height of some virtual rough surface corresponding to the local content of the analyzed genetic construction. The resulting virtual rough surfaces could be used to model original speckle structures corresponding to diverse particular nucleotide sequences.</p>
                <p>The two-dimensional speckle patterns that corresponded to each specific sequence was generated with the use the diffraction of a coherent beam with a square cross-section profile on a virtual scattering surface with a microrelief described by the matrix H
                    <sub>n,m</sub>. At each point of the virtual diffuser (in the beam scattering plane), some phase modulation U
                    <sub>n,m</sub> = exp(&#x2212;2&#x03c0;
                    <italic toggle="yes">j</italic> H
                    <sub>n,m</sub>/64) is introduced (
                    <italic toggle="yes">j</italic> is an imaginary unit). The surface is illuminated at the normal incidence of the beam; the phase in the illuminating beam was a constant value.</p>
            </sec>
            <sec id="sec5">
                <title>Generating GB-speckles</title>
                <p>The procedure for transcoding the original nucleotide sequence into a GB-speckle structure using the example of the hCoV-19/cat/USA/TX-TAMU-078/2020|2020-07-29 gene (the gene #1) is shown below.</p>
                <p>The original nucleotide sequence is as follows:</p>
                <p>ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTATTCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCAGCCTTTTCTTATGGACCTTGAAGGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTAATTTAGTGCGTGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGTATTAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTCTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAAATATAATGAAAATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAGCAAAGTGTACGTTGAAATCCTTCACTGTAGAAAAAGGAATCTATCAAACTTCTAACTTTAGAGTCCAACCAACAGAATCTATTGTTAGATTTCCTAATATTACAAACTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCAACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACTAATGTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAAACAAATGTGTCAATTTCAACTTCAATGGTTTAACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTCTGCCTTTCCAACAATTTGGCAGAGACATTGCTGACACTACTGATGCTGTCCGTGATCCACAGACACTTGAGATTCTTGACATTACACCATGTTCTTTTGGTGGTGTCAGTGTTATAACACCAGGAACAAATACTTCTAACCAGGTTGCTGTTCTTTATCAGGGTGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTTACTCCTACTTGGCGTGTTTATTCTACAGGTTCTAATGTTTTTCAAACACGTGCAGGCTGTTTAATAGGGGCTGAACATGTCAACAACTCATATGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATTCTCCTCGGCGGGCACGTAGTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTGGTGCAGAAAATTCAGTTGCTTACTCTAATAACTCTATTGCCATACCCACAAATTTTACTATTAGTGTTACCACAGAAATTCTACCAGTGTCTATGACCAAGACATCAGTAGATTGTACAATGTACATTTGTGGTGATTCAACTGAATGCAGCAATCTTTTGTTGCAATATGGCAGTTTTTGTACACAATTAAACCGTGCTTTAACTGGAATAGCTGTTGAACAAGACAAAAACACCCAAGAAGTTTTTGCACAAGTCAAACAAATTTACAAAACACCACCAATTAAAGATTTTGGTGGTTTTAATTTTTCACAAATATTACCAGATCCATCAAAACCAAGCAAGAGGTCATTTATTGAAGATCTACTTTTCAACAAAGTGACACTTGCAGATGCTGGCTTCATCAAACAATATGGTGATTGCCTTGGTGATATTGCTGCTAGAGACCTCATTTGTGCACAAAAGTTTAACGGCCTTACTGTTTTGCCACCTTTGCTCACAGATGAAATGATTGCTCAATACACTTCTGCACTGTTAGCGGGTACAATCACTTCTGGTTGGACCTTTGGTGCAGGTGCTGCATTACAAATACCATTTGCTATGCAAATGGCTTATAGGTTTAATGGTATTGGAGTTACACAGAATGTTCTCTATGAGAACCAAAAATTGATTGCCAACCAATTTAATAGTGCTATTGGCAAAATTCAAGACTCACTTTCTTCCACAGCAAGTGCACTTGGAAAACTTCAAGATGTGGTCAACCAAAATGCACAAGCTTTAAACACGCTTGTTAAACAACTTAGCTCCAATTTTGGTGCAATTTCAAGTGTTTTAAATGATATCCTTTCACGTCTTGACAAAGTTGAGGCTGAAGTGCAAATTGATAGGTTGATCACAGGCAGACTTCAAAGTTTGCAGACATATGTGACTCAACAATTAATTAGAGCTGCAGAAATCAGAGCTTCTGCTAATCTTGCTGCTACTAAAATGTCAGAGTGTGTACTTGGACAATCAAAAAGAGTTGATTTTTGTGGAAAGGGCTATCATCTTATGTCCTTCCCTCAGTCAGCACCTCATGGTGTAGTCTTCTTGCATGTGACTTATGTCCCTGCACAAGAAAAGAACTTCACAACTGCTCCTGCCATTTGTCATGATGGAAAAGCACACTTTCCTCGTGAAGGTGTCTTTGTTTCAAATGGCACACACTGGTTTGTAACACAAAGGAATTTTTATGAACCACAAATCATTACTACAGACAACACATTTGTGTCTGGTAACTGTGATGTTGTAATAGGAATTGTCAACAACACAGTTTATGATCCTTTGCAACCTGAATTAGACTCATTCAAGGAGGAGTTAGATAAATATTTTAAGAATCATACATCACCAGATGTTGATTTAGGTGACATCTCTGGCATTAATGCTTCAGTTGTAAACATTCAAAAAGAAATTGACCGCCTCAATGAGGTTGCCAAGAATTTAAATGAATCTCTCATCGATCTCCAAGAACTTGGAAAGTATGAGCAGTATATAAAATGGCCATGGTACATTTGGCTAGGTTTTATAGCTGGCTTGATTGCCATAGTAATGGTGACAATTATGCTTTGCTGTATGACCAGTTGCTGTAGTTGTCTCAAGGGCTGTTGTTCTTGTGGATCCTGCTGCAAATTTGATGAAGACGACTCTGAGCCAGTGCTCAAAGGAGTCAAATTACATTACACATAA (5)</p>
                <p>After converting a sequence of letters into a sequence of numbers in accordance with the algorithm described by rule (1) described previously, the nucleotide sequence takes the following form:</p>
                <p>143444344444244344441443221241342424134213434344114244121122131124211441222224321412124114424442121234334344414412224312111344442131422421344441214421124213312443442441224442444422114344124433442214324141214342424333122114334124113133444314112224342241221444114314334344414444324422124313113424112141141131332433144444334124124441314423113122213422241244144344114112324124114344344144111342434311444211444434114314221444443334344414412212111112112111134433143311134313442131344414424134323114114432124444311414342424213224444244143312244311331111213334114442111114244133311444343444113114144314334414444111141414424113212123224144114441343234314242224213334444423324441311221443341314443221141334144112142124133444211124441244324441214131134414443124224334314424424421334433121324334324321324414414343334414244211224133124444241441111414114311114331122144121314324341312434321244312224242421311321113434123443111422442124341311111331142414211124424112444131342211221121311424144344131444224114144121112443432224444334311344444112322122131444321424344414324433112133113131142132112434344324314414424342241414114422321421444422124444113434414331343424224124111441114314242432444124114342414321314421444341144131334314311342131211142324221333211124331113144324314414114414111441221314314444121332432344141324433114424112114244314424113344334334114414114412243414131443444133113424114242111224444313131314144421124311142414213322334132121224434114334344311334444114434412444224441211421414334442211222124114334344334412211221412131341341341244424444311244241214321221321124344434331224111113424124114443344111112111434342114442112442114334441121332121334344244124313424112111113444243224442211211444332131312144324312124124314324342234314221213121244313144244312144121221434424444334334342134344141121221331121114124424112213344324344244414213334344112432121311342224344324144214321314211244124224124433234344414424121334424114344444211121234321332434441141333324311214342112112421414313434312141222144334321334141432324134414213124213124114424224233233321234134341324134211422142144322412124143421244334321311114421344324412424114112424144322141222121114444124144134344122121311144241221343424143122113121421341314434121143412144434334314421124311432132114244443443211414332134444434121211441112234324441124331141324344311211312111112122211311344444321211342111211144412111121221221144111314444334334444114444421211141441221314221421111221132113133421444144311314241244442112111343121244321314324332442142111211414334314432244334314144324324131312242144434321211113444112332244124344443221224443242121314311143144324211412124424321243441323334121142124424334433122444334321334324321441211141221444324143211143324414133444114334144331344121213114344242414313112211111443144322112211444114134324144332111144211312421244424422121321134321244331111244211314343342112211114321211324441112123244344111211244132422114444334321144421134344441114314142244421234244312111344313324311343211144314133443142121332131244211134443213121414343124211211441144131324321311142131324424324114244324324124111143421313434341244331211421111131344314444434331113332414214244143422442224213421321224214334341342442443214343124414342224321211311113112442121124324224322144434214314331111321212444224234311334342444344421114332121212433444341121211133114444414311221211142144124121312112121444343424334112434314344341141331144342112112121344414314224443211224311441312421442113313313441314111414444113114214121421221314344314441334312142424332144114324421344341112144211111311144312232242114313344322113114441114311424242142314242211311244331113414313213414141111433221433412144433241334444141324332443144322141341143343121144143244432434143122134432434134434242113332434434424434331422432432111444314311312312424313221343242111331342111441214412121411 (6)</p>
                <p>As a result of diffraction of coherent beam on the phase screen (the virtual heights of the irregularities presented in the table (6)) with a square cross-section is formed GB-speckle-structure of two-dimensional intensity distribution, see 
                    <xref ref-type="fig" rid="f1">Figure 1a</xref>. Two-dimensional phase distribution GB, the speckle structure is shown in 
                    <xref ref-type="fig" rid="f1">Figure 1b</xref>.</p>
                <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                    <label>Figure 1. </label>
                    <caption>
                        <title>GB-speckles: (a) Speckle pattern for 2D intensity distribution, b) Speckle pattern for 2D phase distribution.</title>
                    </caption>
                    <graphic id="gr1" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/56573/c3875cf9-d1f5-479e-9c9c-2c6b99b5810b_figure1.gif"/>
                </fig>
            </sec>
            <sec id="sec6">
                <title>
                    <italic toggle="yes">s-LASCA</italic> imaging of GB-speckles</title>
                <p>
                    <italic toggle="yes">s-LASCA</italic> strategy has been connected for handling of GB-speckles. The strategy of 
                    <italic toggle="yes">s-LASCA</italic> is based on the examination of an individual realization of static speckles.
                    <sup>
                        <xref ref-type="bibr" rid="ref3">3</xref>
                    </sup> In this case, the whole realization of the speckle field is divided into square zones; typically, each counting 5&#x00d7;5 or 7&#x00d7;7 pixels.</p>
                <p>For each zone, the contrast of GB-speckles was calculated using the simplest formula:
                    <disp-formula id="e5">
                        <mml:math display="block">
                            <mml:mrow>
                                <mml:mi>C</mml:mi>
                                <mml:mo>=</mml:mo>
                                <mml:mfrac>
                                    <mml:mrow>
                                        <mml:msub>
                                            <mml:mi>&#x03c3;</mml:mi>
                                            <mml:mi>I</mml:mi>
                                        </mml:msub>
                                    </mml:mrow>
                                    <mml:mrow>
                                        <mml:mrow>
                                            <mml:mo>&#x2329;</mml:mo>
                                            <mml:mi>I</mml:mi>
                                            <mml:mo>&#x232a;</mml:mo>
                                        </mml:mrow>
                                    </mml:mrow>
                                </mml:mfrac>
                            </mml:mrow>
                        </mml:math>
                    </disp-formula>
                </p>
                <p>where 
                    <italic toggle="yes">I</italic> was the varying intensity of GB-speckles, changing from point to point; 
                    <italic toggle="yes">&#x03c3;
                        <sub>I</sub>
                    </italic> was the standard deviation of the intensity of fluctuations. After the contrast 
                    <italic toggle="yes">C</italic> is calculated in each point, 
                    <italic toggle="yes">LASCA</italic> image is developed. Here, the size of subarea for the local contrast calculating was 2&#x00d7;2 pixels. As it has been demonstrated
                    <sup>
                        <xref ref-type="bibr" rid="ref14">14</xref>
                    </sup> this size of subarea is close to optimal.</p>
            </sec>
            <sec id="sec7">
                <title>Coloured GB speckles</title>
                <p>To generate three two-dimensional implementations of GB speckles built for different genetic sequences, it is necessary to construct a colour image, where each colour component (red, green, and blue) has its own GB speckle structure. When all three speckle structures were totally indistinguishable, the colour images look grey-scale. If the colour components differ from each other, then, as a result, colouring will appear in the image.</p>
                <p>In 
                    <xref ref-type="fig" rid="f2">Figure 2a</xref>, the coloured speckle-pattern for intensity distribution is presented (the red component obtained for the nucleotide sequence derived from gene #1, the green component corresponded to the nucleotide sequence of gene #2, and blue component was the relevant to gene #3 nucleotide sequence, respectively).</p>
                <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                    <label>Figure 2. </label>
                    <caption>
                        <title>Coloured GB speckles: a) Coloured speckle-pattern for 2D intensity distribution, b) Coloured speckle-pattern for 2D phase distribution.</title>
                    </caption>
                    <graphic id="gr2" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/56573/c3875cf9-d1f5-479e-9c9c-2c6b99b5810b_figure2.gif"/>
                </fig>
                <p>
                    <xref ref-type="fig" rid="f2">Figure 2a</xref>, demonstrates the differences in the initial nucleotide sequences, a slight staining appears in the colour speckle-pattern structure for a two-dimensional intensity distribution.</p>
                <p>In 
                    <xref ref-type="fig" rid="f2">Figure 2b</xref>, the coloured speckle-pattern for phase distribution is shown for such nucleotide sequences as: (i) the red component for gene #1, greenfor gene #2, blue for gene #3.</p>
                <p>It is quite obvious that in the case under consideration, there is a pronounced colouring over the whole image for the field of GB-speckle.</p>
                <p>Thus, the obtained colour image for the intensity and phase of GB speckles is a reliable diagnostic sign of the presence of polymorphism.</p>
            </sec>
            <sec id="sec8">
                <title>A novel detection technique based on the 
                    <italic toggle="yes">s-LASCA</italic> images with coloured GB-speckles</title>
                <p>Once an 
                    <italic toggle="yes">s-LASCA</italic> image is obtained for each of the three components of the matched genetic sequence, the final colour image can be constructed. An example of such an image is shown in 
                    <xref ref-type="fig" rid="f3">Figure 3a</xref>.</p>
                <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                    <label>Figure 3a. </label>
                    <caption>
                        <title>Coloured 
                            <italic toggle="yes">s-LASCA</italic> images of GB-speckles, generated for three SARS&#x2013;CoV-2 genes (the gene#1, the gene#2 and the gene#3).</title>
                    </caption>
                    <graphic id="gr3" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/56573/c3875cf9-d1f5-479e-9c9c-2c6b99b5810b_figure3a.gif"/>
                </fig>
                <fig fig-type="figure" id="f4" orientation="portrait" position="float">
                    <label>Figure 3b. </label>
                    <caption>
                        <title>Coloured 
                            <italic toggle="yes">s-LASCA</italic> images of GB-speckles, generated for another three SARS&#x2013;CoV-2 genes (the gene#4, the gene#5 and the gene#6).</title>
                    </caption>
                    <graphic id="gr4" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/56573/c3875cf9-d1f5-479e-9c9c-2c6b99b5810b_figure3b.gif"/>
                </fig>
            </sec>
        </sec>
        <sec id="sec9" sec-type="results|discussion">
            <title>Results and discussion</title>
            <p>It is obvious that the image shown in 
                <xref ref-type="fig" rid="f3">Figure 3a</xref> in comparison with the image in 
                <xref ref-type="fig" rid="f2">Figure 2a</xref> has a more pronounced colouring over the entire field of view, but is characterized by a higher contrast. From a quantitative point of view, the degree of colouring can be described by the value
                <disp-formula id="e6">
                    <mml:math display="block">
                        <mml:mi>R</mml:mi>
                        <mml:mo>=</mml:mo>
                        <mml:mfrac>
                            <mml:mn>1</mml:mn>
                            <mml:mrow>
                                <mml:mi>N</mml:mi>
                                <mml:mo>&#x00d7;</mml:mo>
                                <mml:mi>M</mml:mi>
                            </mml:mrow>
                        </mml:mfrac>
                        <mml:munderover>
                            <mml:mo>&#x2211;</mml:mo>
                            <mml:mrow>
                                <mml:mi>i</mml:mi>
                                <mml:mo>=</mml:mo>
                                <mml:mn>1</mml:mn>
                            </mml:mrow>
                            <mml:mrow>
                                <mml:mi>N</mml:mi>
                                <mml:mo>&#x00d7;</mml:mo>
                                <mml:mi>M</mml:mi>
                            </mml:mrow>
                        </mml:munderover>
                        <mml:msqrt>
                            <mml:mrow>
                                <mml:mfrac>
                                    <mml:mn>1</mml:mn>
                                    <mml:mn>3</mml:mn>
                                </mml:mfrac>
                                <mml:mo>&#x00d7;</mml:mo>
                                <mml:mfrac>
                                    <mml:mrow>
                                        <mml:msup>
                                            <mml:mfenced close=")" open="(">
                                                <mml:mrow>
                                                    <mml:msub>
                                                        <mml:mi mathvariant="italic">Ir</mml:mi>
                                                        <mml:mi>i</mml:mi>
                                                    </mml:msub>
                                                    <mml:mo>&#x2212;</mml:mo>
                                                    <mml:msub>
                                                        <mml:mi mathvariant="italic">Io</mml:mi>
                                                        <mml:mi>i</mml:mi>
                                                    </mml:msub>
                                                </mml:mrow>
                                            </mml:mfenced>
                                            <mml:mn>2</mml:mn>
                                        </mml:msup>
                                        <mml:mo>+</mml:mo>
                                        <mml:msup>
                                            <mml:mfenced close=")" open="(">
                                                <mml:mrow>
                                                    <mml:msub>
                                                        <mml:mi mathvariant="italic">Ig</mml:mi>
                                                        <mml:mi>i</mml:mi>
                                                    </mml:msub>
                                                    <mml:mo>&#x2212;</mml:mo>
                                                    <mml:msub>
                                                        <mml:mi mathvariant="italic">Io</mml:mi>
                                                        <mml:mi>i</mml:mi>
                                                    </mml:msub>
                                                </mml:mrow>
                                            </mml:mfenced>
                                            <mml:mn>2</mml:mn>
                                        </mml:msup>
                                        <mml:mo>+</mml:mo>
                                        <mml:msup>
                                            <mml:mfenced close=")" open="(">
                                                <mml:mrow>
                                                    <mml:msub>
                                                        <mml:mi mathvariant="italic">Ib</mml:mi>
                                                        <mml:mi>i</mml:mi>
                                                    </mml:msub>
                                                    <mml:mo>&#x2212;</mml:mo>
                                                    <mml:msub>
                                                        <mml:mi mathvariant="italic">Io</mml:mi>
                                                        <mml:mi>i</mml:mi>
                                                    </mml:msub>
                                                </mml:mrow>
                                            </mml:mfenced>
                                            <mml:mn>2</mml:mn>
                                        </mml:msup>
                                    </mml:mrow>
                                    <mml:msup>
                                        <mml:mfenced close=")" open="(">
                                            <mml:msub>
                                                <mml:mi mathvariant="italic">Io</mml:mi>
                                                <mml:mi>i</mml:mi>
                                            </mml:msub>
                                        </mml:mfenced>
                                        <mml:mn>2</mml:mn>
                                    </mml:msup>
                                </mml:mfrac>
                            </mml:mrow>
                        </mml:msqrt>
                    </mml:math>
                </disp-formula>
            </p>
            <p>where 
                <inline-formula>
                    <mml:math display="inline">
                        <mml:msub>
                            <mml:mi mathvariant="italic">Ir</mml:mi>
                            <mml:mi>i</mml:mi>
                        </mml:msub>
                    </mml:math>
                </inline-formula>, 
                <inline-formula>
                    <mml:math display="inline">
                        <mml:msub>
                            <mml:mi mathvariant="italic">Ig</mml:mi>
                            <mml:mi>i</mml:mi>
                        </mml:msub>
                    </mml:math>
                </inline-formula> and 
                <inline-formula>
                    <mml:math display="inline">
                        <mml:msub>
                            <mml:mi mathvariant="italic">Ib</mml:mi>
                            <mml:mi>i</mml:mi>
                        </mml:msub>
                    </mml:math>
                </inline-formula> are values of intensity for the red, green, and blue components in each pixel,
                <disp-formula id="e7">
                    <mml:math display="block">
                        <mml:msub>
                            <mml:mi mathvariant="italic">Io</mml:mi>
                            <mml:mi>i</mml:mi>
                        </mml:msub>
                        <mml:mo>=</mml:mo>
                        <mml:mfrac>
                            <mml:mrow>
                                <mml:msub>
                                    <mml:mi mathvariant="italic">Ir</mml:mi>
                                    <mml:mi>i</mml:mi>
                                </mml:msub>
                                <mml:mo>+</mml:mo>
                                <mml:msub>
                                    <mml:mi mathvariant="italic">Ig</mml:mi>
                                    <mml:mi>i</mml:mi>
                                </mml:msub>
                                <mml:mo>+</mml:mo>
                                <mml:msub>
                                    <mml:mi mathvariant="italic">Ib</mml:mi>
                                    <mml:mi>i</mml:mi>
                                </mml:msub>
                            </mml:mrow>
                            <mml:mn>3</mml:mn>
                        </mml:mfrac>
                    </mml:math>
                </disp-formula>
            </p>
            <p>is the average intensity value in each pixel, 
                <italic toggle="yes">i</italic> is the pixel number, 
                <italic toggle="yes">M</italic> and 
                <italic toggle="yes">N</italic> are the number of rows and columns of the analyzed image, 
                <italic toggle="yes">N</italic> &#x00d7; 
                <italic toggle="yes">M</italic> is the total number of pixels in the image.</p>
            <fig fig-type="figure" id="f5" orientation="portrait" position="float">
                <label>Figure 3c. </label>
                <caption>
                    <title>Coloured 
                        <italic toggle="yes">s-LASCA</italic> images of GB-speckles, generated for more three SARS&#x2013;CoV-2 genes (the gene#5, the gene#6 and the gene#7).</title>
                </caption>
                <graphic id="gr5" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/56573/c3875cf9-d1f5-479e-9c9c-2c6b99b5810b_figure3c.gif"/>
            </fig>
            <p>Obviously, if the nucleotide sequences compared using 
                <italic toggle="yes">s-LASCA</italic> imaging of GB-speckles are completely identical, then the three components of the resulting colour image will be identical, and therefore the value of 
                <italic toggle="yes">R</italic> will be equal to zero. However, if there are at least minimal differences in the compared nucleotide sequences, then the value of 
                <italic toggle="yes">R</italic> will take a positive value. Thus, the value of 
                <italic toggle="yes">R</italic> calculated for the 
                <xref ref-type="fig" rid="f3">Figure 3a</xref> is 0.1 (gene#1, gene#2 and gene#3 are compared).</p>
            <p>In 
                <xref ref-type="fig" rid="f4">Figure 3b</xref>, comparison of new SARS&#x2013;CoV-2 genes: hCoV-19/Wuhan/WIV04/2019|2019-12-30 (gene#4), hCoV-19/England/QEUH-B11766/2020|2020-11-02 (gene#5) and hCoV19/South Africa/KRISP-EC-K005299/2020|2020-11-19 (gene#6) is presented. 
                <italic toggle="yes">R</italic> calculated for 
                <xref ref-type="fig" rid="f4">Figure 3b</xref> equals to 0.596.</p>
            <p>Finally, three SARS&#x2013;CoV-2 genes are reflected in 
                <xref ref-type="fig" rid="f5">Figure 3c</xref> (hCoV-19/England/QEUH-B11766/2020|2020-11-02 (gene#5), hCoV19/South Africa/KRISP-EC-K005299/2020|2020-11-19 (gene#6) and hCoV-19/Russia/MOS-CRIE-13604226/2020|2020-11-09 (gene#7). Again, 
                <italic toggle="yes">R</italic> equals to 0.596 for this case.</p>
            <p>It is important to note that the value of 
                <italic toggle="yes">R</italic> calculated for 
                <xref ref-type="fig" rid="f2">Figure 2a</xref> and 
                <xref ref-type="fig" rid="f2">Figure 2b</xref> (coloured bare GB-speckle) equals to 0.049 and 0.026, respectively. This means that the value of 
                <italic toggle="yes">R</italic> at least in two times higher for GB speckles, processed by 
                <italic toggle="yes">s-LASCA</italic> imaging technique.</p>
            <p>Evidently, 
                <italic toggle="yes">R</italic> is positive for all images in 
                <xref ref-type="fig" rid="f3">Figures 3</xref>; so, 
                <italic toggle="yes">R</italic> is an important diagnostic feature when detecting the presence of SNPs in SARS&#x2013;CoV-2 genes. This is the main result.</p>
        </sec>
        <sec id="sec10" sec-type="conclusion">
            <title>Conclusion</title>
            <p>A fundamentally new bioinformatics technique for reliable detection of single SNPs is proposed. The new method is based on the applying of the 
                <italic toggle="yes">s-LASCA</italic> &#x2018;imaging technique&#x2019; generating original GB-speckles. It is established that even one SNP can be reliably detected. It has been demonstrated that suggested technique is very effective tool for discrimination between different variants of the SARS&#x2013;CoV-2 spike glycoprotein gene.</p>
        </sec>
        <sec id="sec11">
            <title>Data availability</title>
            <sec id="sec12">
                <title>Underlying data</title>
                <p>GISAID Gene: hCoV-19/cat/USA/TX-TAMU-078/2020. Accession number EPI ISL 699509;</p>
                <p>GISAID Gene: hCoV-19/cat/Russia/RII-LEN-22246S/2021. Accession number EPI ISL 811147;</p>
                <p>GISAID Gene: hCoV-19/cat/Greece/2K/2020. Accession number EPI ISL 717979;</p>
                <p>GISAID Gene: hCoV-19/Wuhan/WIV04/2019. Accession number EPI ISL 402124;</p>
                <p>GISAID Gene: hCoV-19/England/QEUH-B11766/2020. Accession number EPI ISL 642476;</p>
                <p>GISAID Gene: hCoV19/South Africa/KRISP-EC-K005299/2020. Accession number EPI ISL 678597;</p>
                <p>GISAID Gene: hCoV-19/Russia/MOS-CRIE-13604226/2020. Accession number EPI ISL 754198.</p>
                <p>Sequences are available after registration at the 
                    <ext-link ext-link-type="uri" xlink:href="https://www.gisaid.org/">GISAID</ext-link> public database.</p>
            </sec>
        </sec>
    </body>
    <back>
        <ref-list>
            <title>References</title>
            <ref id="ref1">
                <label>1</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Dainty</surname>
                            <given-names>C</given-names>
                        </name>
</person-group>:
                    <article-title>Laser speckle and related phenomena.</article-title>
                    <source>

                        <italic toggle="yes">Topics in Applied Physics</italic>
</source>.<year>1984</year>;<volume>9</volume>.
                    <pub-id pub-id-type="pmid">18213052</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref2">
                <label>2</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Aizu</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Biospeckle method for retinal blood flow analysis: flexible correlation measurements.</article-title>
                    <source>

                        <italic toggle="yes">Optical Diagnostics of Biological Fluids and Advanced Techniques in Analytical Cytology.</italic>
</source>
                    <publisher-name>SPIE Press</publisher-name>;<year>1997</year>;<fpage>91</fpage>&#x2013;<lpage>102</lpage>.</mixed-citation>
            </ref>
            <ref id="ref3">
                <label>3</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Briers</surname>
                            <given-names>JD</given-names>
                        </name>
</person-group>:
                    <article-title>Laser Doppler, speckle and related techniques for blood perfusion mapping and imaging.</article-title>
                    <source>

                        <italic toggle="yes">Physiol Meas.</italic>
</source>
                    <year>2001</year>;<volume>22</volume>:<fpage>R35</fpage>&#x2013;<lpage>R66</lpage>.
                    <pub-id pub-id-type="pmid">11761081</pub-id>
                    <pub-id pub-id-type="doi">10.1088/0967-3334/22/4/201</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref4">
                <label>4</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ulyanov</surname>
                            <given-names>SS</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Using of methods of speckle optics for 
                        <italic toggle="yes">Chlamydia trachomatis</italic> typing.</article-title>
                    <source>

                        <italic toggle="yes">Proc. SPIE.</italic>
</source>
                    <year>2017</year>;<volume>10336</volume>:<fpage>103360D</fpage>.</mixed-citation>
            </ref>
            <ref id="ref5">
                <label>5</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ulyanov</surname>
                            <given-names>SS</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Statistics on gene-based laser speckles with a small number of scatterers: implications for the detection of polymorphism in the 
                        <italic toggle="yes">Chlamydia trachomatis omp1</italic> gene.</article-title>
                    <source>

                        <italic toggle="yes">Laser Physics Letters</italic>
</source>.<year>2018</year>;<volume>15</volume>.
                    <pub-id pub-id-type="doi">10.1088/1612-202X/aaa11c</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref6">
                <label>6</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Feodorova</surname>
                            <given-names>VA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Optimization of algorithm of coding of genetic information of 
                        <italic toggle="yes">Chlamydia.</italic>
                    </article-title>
                    <source>

                        <italic toggle="yes">Proc. SPIE.</italic>
</source>
                    <year>2018</year>;<volume>10716</volume>:<fpage>107160Q</fpage>.
                    <pub-id pub-id-type="doi">10.1117/12.2314640</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref7">
                <label>7</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ulyanov</surname>
                            <given-names>SS</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Study of statistical characteristics of GB-speckles, forming at scattering of light on virtual structures of nucleotide gene sequences of Enterobacteria.</article-title>
                    <source>

                        <italic toggle="yes">Izv. Saratov Univ. (N. S.), Ser. Physics</italic>
</source>.<year>2018</year>;<volume>18</volume>:<fpage>123</fpage>&#x2013;<lpage>137</lpage>.
                    <pub-id pub-id-type="doi">10.18500/1817-3020-2018-18-2-123-137</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref8">
                <label>8</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Saltykov</surname>
                            <given-names>YV</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Analysis of nucleotide sequences of the gene GPCR of the genus Capripoxvirus representatives using speckle interferometry of GB speckles and subtracting their images.</article-title>
                    <source>

                        <italic toggle="yes">Math. mod., comp. and natural exp. in natural sci.</italic>
</source>
                    <year>2020</year>:<fpage>2</fpage>.</mixed-citation>
            </ref>
            <ref id="ref9">
                <label>9</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ulianova</surname>
                            <given-names>OV</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Speckle-interferometry and speckle-correlometry of GB-speckles.</article-title>
                    <source>

                        <italic toggle="yes">Front Biosci (Landmark Ed).</italic>
</source>
                    <year>2019</year>;<volume>24</volume>:<fpage>700</fpage>&#x2013;<lpage>711</lpage>.
                    <pub-id pub-id-type="pmid">30844706</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref10">
                <label>10</label>
                <mixed-citation publication-type="book">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Goodman</surname>
                            <given-names>JW</given-names>
                        </name>
</person-group>:
                    <source>

                        <italic toggle="yes">Introduction to fourier optics</italic>
</source>.
                    <publisher-loc>New York</publisher-loc>:
                    <publisher-name>McGraw Hill Companies</publisher-name>;<year>1988</year>.</mixed-citation>
            </ref>
            <ref id="ref11">
                <label>11</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Feodorova</surname>
                            <given-names>VA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Application of virtual phase-shifting speckle-interferometry for detection of polymorphism in the 
                        <italic toggle="yes">Chlamydia trachomatis omp1</italic> gene.</article-title>
                    <source>

                        <italic toggle="yes">Proc. SPIE.</italic>
</source>
                    <year>2018</year>;<volume>10716</volume>:<fpage>107160M</fpage>.
                    <pub-id pub-id-type="doi">10.1117/12.2314700</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref12">
                <label>12</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sleator</surname>
                            <given-names>RD</given-names>
                        </name>
</person-group>:
                    <article-title>Digital biology. A new era has begun.</article-title>
                    <source>

                        <italic toggle="yes">Bioengineered</italic>
</source>.<year>2012</year>;<volume>3</volume>:<fpage>311</fpage>&#x2013;<lpage>312</lpage>.
                    <pub-id pub-id-type="pmid">23099453</pub-id>
                    <pub-id pub-id-type="doi">10.4161/bioe.22367</pub-id>
                    <pub-id pub-id-type="pmcid">PMC3489704</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref13">
                <label>13</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Freddolino</surname>
                            <given-names>PL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tavazoie</surname>
                            <given-names>S</given-names>
                        </name>
</person-group>:
                    <article-title>The Dawn of Virtual Cell Biology.</article-title>
                    <source>

                        <italic toggle="yes">Cell</italic>
</source>.<year>2012</year>;<volume>150</volume>:<fpage>248</fpage>&#x2013;<lpage>250</lpage>.
                    <pub-id pub-id-type="pmid">22817888</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.cell.2012.07.001</pub-id>
                    <pub-id pub-id-type="pmcid">PMC4430847</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref14">
                <label>14</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ulianova</surname>
                            <given-names>OV</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>
                        <italic toggle="yes">LASCA</italic>-imaging of gene-based speckles: application to detection of the gene polymorphism in a bacterial model.</article-title>
                    <source>

                        <italic toggle="yes">Laser Physics Letters</italic>
</source>.<year>2020</year>;<volume>17</volume>.
                    <pub-id pub-id-type="doi">10.1088/1612-202X/ab8b66</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref15">
                <label>15</label>
                <mixed-citation publication-type="book">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Lesk</surname>
                            <given-names>AM</given-names>
                        </name>
</person-group>:
                    <source>

                        <italic toggle="yes">Introduction to Bioinformatics</italic>
</source>
                    <publisher-name>Oxford University Press</publisher-name>;<year>2002</year>.</mixed-citation>
            </ref>
            <ref id="ref16">
                <label>16</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ulianova</surname>
                            <given-names>OV</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Could 
                        <italic toggle="yes">LASCA</italic>-imaging of GB-speckles be applied for a high discrimination and typing of pathogenic bacteria?</article-title>
                    <source>

                        <italic toggle="yes">PloS one</italic>
</source>.<year>2021</year>;<volume>16</volume>.</mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report88324">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.56573.r88324</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Angelsky</surname>
                        <given-names>Oleg</given-names>
                    </name>
                    <xref ref-type="aff" rid="r88324a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-5463-8961</uri>
                </contrib>
                <aff id="r88324a1">
                    <label>1</label>Department of Correlation Optics, Chernivtsi National University, Chernivtsi, Ukraine</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>16</day>
                <month>7</month>
                <year>2021</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2021 Angelsky O</copyright-statement>
                <copyright-year>2021</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport88324" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.53214.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>The paper is devoted to the investigations of virtual Gene Based speckles for the determination the difference between SARS-Cov-2 spike glycoprotein genes. As it was noted by the authors the given method can use the classical approaches of speckle-optics. But there are some questions:&#x00a0; 
                <list list-type="order">
                    <list-item>
                        <p>Any optical speckle is the result of the interference of waves scattered by inhomogeneities, and to obtain a speckle pattern, the wavelength is decisive. Thus, the question arises about the concrete wavelengths used in the study and their relationships with pseudo inhomogeneities. It would be interesting to know about the coherence of the sources used the modelling.&#x00a0;</p>
                    </list-item>
                    <list-item>
                        <p>Please present an experiment setup, and the results of experimental modelling.</p>
                    </list-item>
                    <list-item>
                        <p>It would be interesting to conduct a complete analysis of the entered parameter R, to represent its physical, biochemical meaning. The virus is constantly mutating, how is it possible to estimate the degree of virus mutation using this parameter.</p>
                    </list-item>
                </list> The paper can be indexed after reworking.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Partly</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Yes</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Partly</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Singular and Correlation Optics</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
        <sub-article article-type="response" id="comment6974-88324">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Feodorova</surname>
                            <given-names>Valentina</given-names>
                        </name>
                        <aff>Federal Research Center for Virology and Microbiology, Branch in Saratov, Russian Federation</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>30</day>
                    <month>7</month>
                    <year>2021</year>
                </pub-date>
            </front-stub>
            <body>
                <p>Reply to the comments of reviewer Prof. Oleg&#x00a0;Angelsky: 
                    <list list-type="bullet">
                        <list-item>
                            <p>
                                <italic>Any optical speckle is the result of the interference of waves scattered by inhomogeneities, and to obtain a speckle pattern, the wavelength is decisive. Thus, the question arises about the concrete wavelengths used in the study and their relationships with pseudo inhomogeneities. It would be interesting to know about the coherence of the sources used the modelling.</italic>&#x00a0;</p>
                        </list-item>
                        <list-item>
                            <p>
                                <bold>Response</bold>: This is really reasonable and very important question.&#x00a0;Fragment below is added to the new version of the text:</p>
                        </list-item>
                    </list> It is assumed that speckles are formed in the far diffraction zone and described in the Fraunhofer approximation. In this case, the expression for the amplitude of the scattered field is the Fourier transform of the field in the diffraction plane, evaluated at frequencies spaces&#x00a0;</p>
                <p> Fx=Xo/( z* &#x03bb;),&#x00a0;&#x00a0;&#x00a0;Fy=Yo/( z* &#x03bb;),&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;(*)&#x00a0;</p>
                <p> where Xo and Yo are the coordinates in the observation plane, z is the distance between the scattering plane and the observation plane,&#x00a0;&#x03bb;&#x00a0;is the wavelength. The illuminating radiation is completely monochromatic, thus,&#x00a0;&#x03bb;&#x00a0;=const.&#x00a0;</p>
                <p> Reference to Goodman, J. W. Introduction to fourier optics.&#x00a0;
                    <italic>McGraw Hill Companies, New York&#x00a0;</italic>(1988).&#x00a0;</p>
                <p> In this situation, the structure of speckles does not depend on the wavelength and z. Only the sizes of GB-speckles depend on these values, the average size of which is determined by the ratio:&#x00a0;</p>
                <p> d~3*z* &#x03bb; /a&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;(**)&#x00a0;</p>
                <p> where a is the size of the illuminated fragment of virtual surface. It is important to emphasize that the ratio&#x00a0;&#x03bb;/a characterizes the diffraction angular divergence of a laser beam in the far field, and the product of this divergence angle by the light traveled distance z is equal to the lateral size of the beam.&#x00a0;</p>
                <p> New reference: M. Francon. La granularite laser (speckle) et ses applications en optique. Masson, Paris, New York, Barcelone, Milan 1978.&#x00a0;</p>
                <p> Thus, it can be seen that the diameter of the undisturbed laser beam (namely, this value is on the right side of the expression (**)) and the average speckle size are approximately equal to each other in any observation plane.&#x00a0;</p>
                <p> In other words, when the parameters z and&#x00a0;&#x03bb;&#x00a0;change, a proportional change in the size of all speckles occurs synchronously. At the same time, the structure of speckle-patterns in all observation planes are completely similar, only their scale changes from plane to plane, but not the shape of the speckles or their location in the speckle pattern.&#x00a0;</p>
                <p> &#x00a0; 
                    <list list-type="bullet">
                        <list-item>
                            <p>
                                <italic>Please present an experiment setup, and the results of experimental modelling.&#x00a0;</italic>
                            </p>
                        </list-item>
                        <list-item>
                            <p>
                                <bold>Response:&#x00a0;</bold>Experimental studies were not carried out in this work, only computer modeling. The scheme for calculating GB speckles during radiation diffraction on a virtual scattering surface is described in detail in the work:&#x00a0; Ulianova OV, et al.: Speckle-interferometry and speckle-correlometry of GB-speckles. Frontiers in Bioscience-Landmark 2019; 24, 700-711.&#x00a0;This fact is mentioned in the new version of this article.&#x00a0;</p>
                        </list-item>
                        <list-item>
                            <p>
                                <italic>It would be interesting to conduct a complete analysis of the entered parameter R, to represent its physical, biochemical meaning. The virus is constantly mutating, how is it possible to estimate the degree of virus mutation using this parameter.&#x00a0;&#x00a0;</italic>
                            </p>
                        </list-item>
                        <list-item>
                            <p>
                                <bold>Response: </bold>The physical meaning of the introduced parameter R is that this parameter characterizes the degree of coloring of the picture (GB-speckle- pattern). The bioinformatic (molecular biology) value of R is that it takes positive values, even in the case of the appearance of a one SNP in the analyzed nucleotide sequences. Thus, the minimum natural mutations of the virus can be determined using the parameter R.&#x00a0;This circumstance is also noted in the Conclusions of new version of this article.&#x00a0;</p>
                        </list-item>
                    </list> &#x200b;&#x200b;&#x200b;&#x200b;&#x200b;The authors are extremely grateful to the respected reviewer, whose critical comments have significantly improved the quality of this article.</p>
            </body>
        </sub-article>
    </sub-article>
</article>
