<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="methods-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.125074.1</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Method Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>Development of liquid culture media mimicking the conditions of sinuses and lungs in cystic fibrosis and health</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 1; peer review: 1 approved, 1 approved with reservations]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Ruhluel</surname>
                        <given-names>Dilem</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0001-8867-2925</uri>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>O'Brien</surname>
                        <given-names>Siobhan</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <uri content-type="orcid">https://orcid.org/0000-0003-2741-6172</uri>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Fothergill</surname>
                        <given-names>Joanne L</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="corresp" rid="c2">b</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Neill</surname>
                        <given-names>Daniel R</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-7911-8153</uri>
                    <xref ref-type="corresp" rid="c3">c</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>University of Liverpool, Institute of Infection, Veterinary and Ecological Sciences,, Liverpool, L69 7BE, UK</aff>
                <aff id="a2">
                    <label>2</label>Department of Microbiology, Moyne Institute of Preventive Medicine, Trinity College, Dublin, 2, Ireland</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:d.ruhluel@liverpool.ac.uk">d.ruhluel@liverpool.ac.uk</email>
                </corresp>
                <corresp id="c2">
                    <label>b</label>
                    <email xlink:href="mailto:jofoth@liverpool.ac.uk">jofoth@liverpool.ac.uk</email>
                </corresp>
                <corresp id="c3">
                    <label>c</label>
                    <email xlink:href="mailto:drn26@liverpool.ac.uk">drn26@liverpool.ac.uk</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>7</day>
                <month>9</month>
                <year>2022</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2022</year>
            </pub-date>
            <volume>11</volume>
            <elocation-id>1007</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>26</day>
                    <month>8</month>
                    <year>2022</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2022 Ruhluel D et al.</copyright-statement>
                <copyright-year>2022</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/11-1007/pdf"/>
            <abstract>
                <p>The respiratory tract is a compartmentalised and heterogenous environment. The nasopharynx and sinuses of the upper airways have distinct properties from the lungs and these differences may shape bacterial adaptation and evolution. Upper airway niches act as early colonisation sites for respiratory bacterial pathogens, including those, such as 
                    <italic toggle="yes">Pseudomonas aeruginosa</italic>, that can go on to establish chronic infection of the lungs in people with cystic fibrosis (CF). Despite the importance of upper airway environments in facilitating early adaptation to host environments, currently available 
                    <italic toggle="yes">in vitro</italic> models for study of respiratory infection in CF focus exclusively on the lungs. Furthermore, animal models, widely used to bridge the gap between 
                    <italic toggle="yes">in vitro</italic> systems and the clinical scenario, do not allow the upper and lower airways to be studied in isolation. We have developed a suite of culture media reproducing key features of the upper and lower airways, for the study of bacterial adaptation and evolution in different respiratory environments. For both upper and lower airway-mimicking media, we have developed formulations that reflect airway conditions in health and those that reflect the altered environment of the CF respiratory tract. Here, we describe the development and validation of these media and their use for study of genetic and phenotypic adaptations in 
                    <italic toggle="yes">P. aeruginosa</italic> during growth under upper or lower airway conditions in health and in CF.</p>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>Cystic Fibrosis (CF)</kwd>
                <kwd>sinuses</kwd>
                <kwd>lungs</kwd>
                <kwd>in vitro models</kwd>
                <kwd>3Rs</kwd>
            </kwd-group>
            <funding-group>
                <award-group id="fund-1" xlink:href="http://dx.doi.org/10.13039/100000897">
                    <funding-source>Cystic Fibrosis Foundation</funding-source>
                    <award-id>SRC022</award-id>
                </award-group>
                <award-group id="fund-2" xlink:href="http://dx.doi.org/10.13039/501100010757">
                    <funding-source>National Centre for the Replacement Refinement and Reduction of Animals in Research</funding-source>
                    <award-id>NC/S001700/1</award-id>
                </award-group>
                <award-group id="fund-3" xlink:href="http://dx.doi.org/10.13039/501100000292">
                    <funding-source>Cystic Fibrosis Trust</funding-source>
                    <award-id>SRC022</award-id>
                </award-group>
                <funding-statement>This work is supported by an NC3Rs PhD studentship grant (NC/S001700/1), awarded to DN and JF. JF and DN acknowledge grant support for the Strategic Research Centre (SRC) &#x201c;An evidence-based preclinical framework for the development of antimicrobial therapeutics in cystic fibrosis&#x201d; (PIPE-CF; Project No. SRC 022) from the UK Cystic Fibrosis Trust and CF Foundation (US).</funding-statement>
            </funding-group>
        </article-meta>
    </front>
    <body>
        <sec>
            <title/>
            <p>
                <boxed-text id="B1" orientation="portrait" position="float">
                    <label>Research highlights</label>
                    <p>
                        <bold>Scientific benefit(s):</bold>
                    </p>
                    <p>Allows:
                        <list list-type="bullet">
                            <list-item>
                                <label>&#x2022;</label>
                                <p>Study of bacterial pathogenicity in infection relevant conditions of compartmentalised airway niches</p>
                            </list-item>
                            <list-item>
                                <label>&#x2022;</label>
                                <p>Study of bacterial host adaptation in cystic fibrosis (CF) and other respiratory diseases</p>
                            </list-item>
                        </list>
                    </p>
                    <p>
                        <bold>3Rs benefit(s):</bold>
                    </p>
                    <p>
                        <list list-type="bullet">
                            <list-item>
                                <label>&#x2022;</label>
                                <p>Reduces the need for vertebrates in respiratory microbiology by providing a pre-screening platform for bacterial pathogenicity and host-pathogen interaction related research questions</p>
                            </list-item>
                        </list>
                    </p>
                    <p>
                        <bold>Practical benefit(s):</bold>
                    </p>
                    <p>
                        <list list-type="bullet">
                            <list-item>
                                <label>&#x2022;</label>
                                <p>Inexpensive, simple to operate, no training required</p>
                            </list-item>
                            <list-item>
                                <label>&#x2022;</label>
                                <p>Chemically defined and easy to manipulate the content of the media to study different research questions, with several respiratory pathogens</p>
                            </list-item>
                        </list>
                    </p>
                    <p>
                        <bold>Current applications:</bold>
                    </p>
                    <p>
                        <list list-type="bullet">
                            <list-item>
                                <label>&#x2022;</label>
                                <p>Suitable for studying phenotypes including bacterial growth, antimicrobial resistance, biofilm formation,</p>
                            </list-item>
                            <list-item>
                                <label>&#x2022;</label>
                                <p>Suitable for studying bacterial gene expression in health and CF under relevant host stresses</p>
                            </list-item>
                        </list>
                    </p>
                    <p>
                        <bold>Potential applications:</bold>
                    </p>
                    <p>Offers a platform for:
                        <list list-type="bullet">
                            <list-item>
                                <label>&#x2022;</label>
                                <p>Studying long term evolution of bacteria in health and infection relevant media</p>
                            </list-item>
                            <list-item>
                                <label>&#x2022;</label>
                                <p>Studying different pathogen combinations and how they affect virulence and resistance</p>
                            </list-item>
                            <list-item>
                                <label>&#x2022;</label>
                                <p>Combining with cell or tissue-based models to fully capture the chemical and cellular characteristics of different airway niches in the lab environment</p>
                            </list-item>
                            <list-item>
                                <label>&#x2022;</label>
                                <p>Assessing efficacy of drugs and therapeutics under relevant conditions</p>
                            </list-item>
                        </list>
                    </p>
                </boxed-text>
            </p>
        </sec>
        <sec id="sec2" sec-type="intro">
            <title>Introduction</title>
            <p>Cystic Fibrosis (CF) is an autosomal recessive genetic disorder caused by mutations in the cystic fibrosis transmembrane conductance regulator (
                <italic toggle="yes">CFTR</italic>) gene, located on the long arm of chromosome 7.
                <sup>
                    <xref ref-type="bibr" rid="ref1">1</xref>
                </sup> CFTR protein functions as an apical ion channel.
                <sup>
                    <xref ref-type="bibr" rid="ref1">1</xref>
                </sup> CF has a range of severities, with airway disease being the main cause of morbidity and mortality.
                <sup>
                    <xref ref-type="bibr" rid="ref1">1</xref>
                </sup> Defects in CFTR affect its ion transporting functions, leading to accumulation of sticky mucus on epithelial surfaces in affected organs, including the lungs, sinuses, pancreas, gastrointestinal tract, sweat glands and reproductive tract.
                <sup>
                    <xref ref-type="bibr" rid="ref1">1</xref>
                </sup>
            </p>
            <p>The warm, humid and nutrient rich environment of CF airways supports growth of various bacteria. 
                <italic toggle="yes">Pseudomonas aeruginosa</italic> is one of the most commonly isolated bacterial pathogens of the airways of people with CF (PwCF).
                <sup>
                    <xref ref-type="bibr" rid="ref2">2</xref>
                </sup> 
                <italic toggle="yes">P. aeruginosa</italic> is a Gram-negative aerobic/facultative anaerobic bacterium found in high abundance in external environments.
                <sup>
                    <xref ref-type="bibr" rid="ref2">2</xref>
                </sup> 
                <italic toggle="yes">P. aeruginosa</italic> colonization and infection of the airways is a significant contributor to morbidity and mortality in PwCF.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>
                </sup> When 
                <italic toggle="yes">P. aeruginosa</italic> enters into the airways from an environmental source, it not only must adapt to the changes in nutritional and physiochemical status associated with the airway environment, but also to stresses exerted from intense antimicrobial pressure and the actions of immune responses, competition from resident microbiota and viscous mucus-related osmotic stresses.
                <sup>
                    <xref ref-type="bibr" rid="ref2">2</xref>
                </sup> All of these factors influence the adaptation and evolution of 
                <italic toggle="yes">P. aeruginosa</italic> within respiratory niches.
                <sup>
                    <xref ref-type="bibr" rid="ref2">2</xref>
                </sup>
            </p>
            <p>
                <italic toggle="yes">P. aeruginosa</italic> has a &gt;6 Mb
                <sup>
                    <xref ref-type="bibr" rid="ref4">4</xref>
                </sup> plastic genome that facilitates rapid adaptation to environmental stimuli.
                <sup>
                    <xref ref-type="bibr" rid="ref5">5</xref>
                </sup> Environmental versatility is achieved through the action of regulatory systems, which collectively make up ~8% of the 
                <italic toggle="yes">P. aeruginosa</italic> genome.
                <sup>
                    <xref ref-type="bibr" rid="ref6">6</xref>
                </sup> Transition from colonization to acute infection and subsequent biofilm-associated chronic infection takes place as a result of changes in these regulatory systems that are key for controlling the expression of virulence factors in response to host environmental cues.
                <sup>
                    <xref ref-type="bibr" rid="ref7">7</xref>
                </sup>
            </p>
            <p>The upper respiratory tract (and particularly the paranasal sinuses) has been suggested to be a protective niche for environmentally-acquired 
                <italic toggle="yes">P. aeruginosa</italic> during early infection. Colonisation of this environment is thought to precede chronic lung infection.
                <sup>
                    <xref ref-type="bibr" rid="ref8">8</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref9">9</xref>
                </sup> 
                <italic toggle="yes">P. aeruginosa</italic> has been identified in sinusitis samples and a high level of similarity has been observed between paranasal and lung isolates.
                <sup>
                    <xref ref-type="bibr" rid="ref10">10</xref>
                </sup> The presence of a low number of immune cells and reduced exposure to antibiotics in the upper airways, relative to lungs, provides a transitional niche within which the bacteria can adapt to host conditions before establishing chronic lung infection. Early infection of lungs with environmental 
                <italic toggle="yes">P. aeruginosa</italic> may be cleared by a combination of host inflammatory responses and antibiotic treatment, but the persistence of the pathogen within the upper airways offers opportunity for later downward reseeding of a host-adapted bacterial population. Armbuster 
                <italic toggle="yes">et al.</italic> documented the role of the sinuses in 
                <italic toggle="yes">P. aeruginosa</italic> within-host adaptation in 106 adult CF patients. They found that the sinuses harboured isolates with pathoadaptive characteristics that were previously seen in isolates from sputum and that have been associated with persistence in the CF lung.
                <sup>
                    <xref ref-type="bibr" rid="ref11">11</xref>
                </sup> The continuous cycle of bacterial clearance from lungs and recolonization from sinuses may form an important part of the intermittent colonization stage that precedes chronic lung infection.
                <sup>
                    <xref ref-type="bibr" rid="ref12">12</xref>
                </sup>
            </p>
            <p>This proposed route to lung infection was recapitulated in a mouse natural inhalation infection model with 
                <italic toggle="yes">P. aeruginosa</italic>, where persistence of bacteria in the upper airways was observed over the course of 28 days of infection. Initial colonisation of lungs was cleared within two weeks of infection
                <italic toggle="yes">,</italic> in the absence of antibiotic treatment, but 
                <italic toggle="yes">P. aeruginosa</italic> was isolated from sinuses throughout infection and reappeared in the lungs of all mice at day 28 post-infection, suggesting that long-term upper airway persistence may allow bacterial migration and reseeding to the lower airways.
                <sup>
                    <xref ref-type="bibr" rid="ref8">8</xref>
                </sup> In later studies, this within-host adaptation was linked to loss-of-function mutations in the two component regulatory system gene 
                <italic toggle="yes">pmrB,</italic> thought to have been acquired during upper airway infection.
                <sup>
                    <xref ref-type="bibr" rid="ref13">13</xref>
                </sup> Isolates carrying 
                <italic toggle="yes">pmrB</italic> mutations, recovered from the murine airways, showed enhanced potential for establishment and maintenance of lung infection that was linked to increased resistance to lysozyme and increased attachment to host surfaces. Similar loss-of-function mutations were identified in 
                <italic toggle="yes">pmrB</italic> in clinical isolates from CF. As the experiments undertaken in mice did not involve antibiotic treatment, the selective pressure for the observed changes was hypothesised to be the result of the action of host-derived antimicrobials.
                <sup>
                    <xref ref-type="bibr" rid="ref13">13</xref>
                </sup>
            </p>
            <p>Other pathoadaptive characteristics of strains from chronic infections have been identified and include overproduction of alginate, reduction in growth rate, loss of motility, decreased susceptibility to antimicrobials and diversification in colony morphology.
                <sup>
                    <xref ref-type="bibr" rid="ref14">14</xref>
                </sup>
                <sup>&#x2013;</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref16">16</xref>
                </sup> Changes in colony morphologies, towards a so-called &#x2018;wrinkly&#x2019; phenotype, were indicated to be the result of redox-drive adaptations to maximize oxygen accessibility in biofilm by increasing the surface area exposed to air.
                <sup>
                    <xref ref-type="bibr" rid="ref17">17</xref>
                </sup> A slow growing phenotype has also been suggested to be a common characteristic of long term CF airway colonization and is thought to develop as a result of continuous activation of stress responses driven by exposure to cells and molecules of the immune system.
                <sup>
                    <xref ref-type="bibr" rid="ref18">18</xref>
                </sup>
            </p>
            <p>The respiratory tract is a heterogenous, compartmentalised environment, with the biological, chemical and physical properties of each niche shaping 
                <italic toggle="yes">P. aeruginosa</italic> adaptive evolution in different ways. A range of 
                <italic toggle="yes">in vitro</italic> and 
                <italic toggle="yes">in vivo</italic> models are available for the study of respiratory infection in CF. The most basic of these involve 
                <italic toggle="yes">in vitro</italic> culture in nutrient rich laboratory media that readily supports bacterial growth. These models are often a poor reflection of the airway environment, as they contain sugars and proteins at concentrations that are not physiologically relevant and they lack important host-derived factors that exert stress on pathogens or that are recognised by microbial environmental sensing systems. These limitations encouraged the development of chemically-defined liquid culture media that better reflect the conditions of the CF airways. Artificial sputum media (ASM), synthetic cystic fibrosis media (SCFM) and their derivatives
                <sup>
                    <xref ref-type="bibr" rid="ref19">19</xref>
                </sup>
                <sup>&#x2013;</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref21">21</xref>
                </sup> capture important chemical aspects of the CF airway environment, including extracellular DNA (eDNA), amino acids and mucins.
                <sup>
                    <xref ref-type="bibr" rid="ref20">20</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref21">21</xref>
                </sup> These media support infection-relevant biofilm formation and have been of significant value to the research community. Furthermore, they can be combined with host tissue to provide a physical scaffold for biofilm formation.
                <sup>
                    <xref ref-type="bibr" rid="ref22">22</xref>
                </sup> However, these models still lack key molecules of the lung, including host-derived antimicrobials,
                <sup>
                    <xref ref-type="bibr" rid="ref23">23</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref24">24</xref>
                </sup> polyamines
                <sup>
                    <xref ref-type="bibr" rid="ref25">25</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref26">26</xref>
                </sup> and a number of factors associated with CF comorbidities, including glucose, which is elevated in lungs in CF-related diabetes compared to healthy individuals,
                <sup>
                    <xref ref-type="bibr" rid="ref27">27</xref>
                </sup> and bile salts, which can be inhaled into lungs during CF-associated gastro-oesophageal reflux.
                <sup>
                    <xref ref-type="bibr" rid="ref28">28</xref>
                </sup>
            </p>
            <p>Most currently available 
                <italic toggle="yes">in vitro</italic> and 
                <italic toggle="yes">in vivo</italic> models focus on capturing conditions of the lung environment and therefore do not reflect the heterogeneity of the airways and are unsuitable for studying early infection processes that may take place in the sinuses.
                <sup>
                    <xref ref-type="bibr" rid="ref21">21</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref29">29</xref>
                </sup> Whilst 
                <italic toggle="yes">in vivo</italic> infection models &#x2013; most often performed in mice or rats - allow for a more holistic view of infection processes,
                <sup>
                    <xref ref-type="bibr" rid="ref30">30</xref>
                </sup> they are costly, hard to maintain and there are important differences in host-derived antimicrobial structure and function between rodents and man.
                <sup>
                    <xref ref-type="bibr" rid="ref31">31</xref>
                </sup> Furthermore, CF rodent models don&#x2019;t reproduce the disease phenotypes and severity of human CF.
                <sup>
                    <xref ref-type="bibr" rid="ref30">30</xref>
                </sup> In particular, they poorly replicate the severe pathology of CF lung disease, with the major disease phenotype instead manifesting in the gastrointestinal tract.
                <sup>
                    <xref ref-type="bibr" rid="ref32">32</xref>
                </sup> The generation of gut-corrected CFTR transgenic mice has addressed this issue, but establishing chronic lung infection in these mice remains a challenge.
                <sup>
                    <xref ref-type="bibr" rid="ref32">32</xref>
                </sup> Embedding bacteria within agarose beads and instilling these into the trachea of mice allows for establishment of long-term infection,
                <sup>
                    <xref ref-type="bibr" rid="ref33">33</xref>
                </sup> albeit by an artificial route that requires surgical procedures and which is hard to standardise. Natural inhalation of CF-adapted 
                <italic toggle="yes">P. aeruginosa</italic> suspended in saline offers an alternative that recapitulates the sinus to lung infection route and allows for long-term infection studies,
                <sup>
                    <xref ref-type="bibr" rid="ref8">8</xref>
                </sup> but this model has other drawbacks, including a relatively low density of infection in lungs. Study of major pathophysiological CF characteristics, such as chronic respiratory infection, inflammation, and mucus plugging, have been hampered by the limitations of existing 
                <italic toggle="yes">in vivo</italic> models.
                <sup>
                    <xref ref-type="bibr" rid="ref32">32</xref>
                </sup>
            </p>
            <p>According to Home Office Report from 2021, 3.06 million procedures were performed involving living animals for scientific purposes.
                <sup>
                    <xref ref-type="bibr" rid="ref34">34</xref>
                </sup> More than half of these procedures were carried out in mice (54%) and 51% of overall procedures were for basic research while 27% was for applied research including human infectious disorders.
                <sup>
                    <xref ref-type="bibr" rid="ref34">34</xref>
                </sup> Moreover, in the field of respiratory microbiology, 10,540 publications report the use of mice for infection (Pubmed search &#x201c;respiratory infection mouse&#x201d; 2015-2022), more than half of these being for bacterial infections (6,274). Development of well-characterised respiratory mimicking media would offer opportunities for both replacement and reduction in such studies.</p>
            <p>With the aim of understanding the applicability of available 
                <italic toggle="yes">in vivo</italic> and 
                <italic toggle="yes">in vitro</italic> models to study human infections, Cornforth et al developed a computational framework that uses transcriptomic data from 
                <italic toggle="yes">P. aeruginosa</italic> grown under different environmental conditions and benchmarks it against the gene expression patterns observed in clinical CF sputum samples. This approach has been used to assess the clinical relevance of 
                <italic toggle="yes">in vitro</italic> and 
                <italic toggle="yes">in vivo</italic> models, with results suggesting that 
                <italic toggle="yes">in vitro</italic> models are as good as or better than mouse lung infection models at mimicking the 
                <italic toggle="yes">P. aeruginosa</italic> transcriptome in human CF sputum.
                <sup>
                    <xref ref-type="bibr" rid="ref35">35</xref>
                </sup>
            </p>
            <p>Given the limitations of the available animal models for study of CF infection and bacterial within-host adaptation, we sought to develop novel culture media that mimics the conditions of compartmentalised airway regions. To enable study of early infection processes taking place in the upper airways, we designed sinus-mimicking media reflective of conditions in health or in CF (healthy sinus media [HSM] and CF sinus media [CFSM]). In parallel, we developed media reflective of the lungs in health or CF (healthy lung media [HLM] and CF lung media [CFLM]). The developed CF media will be of use for the study of CF pathogens under infection-relevant conditions, whilst the healthy media equivalents can be used for study of airway infection in other contexts, such as non-CF bronchiectasis, community-acquired or ventilator-acquired pneumonia, that occur without the underlying altered environment that is specific to CF. Many of the differences between airway niches and between health and CF that we aim to capture have been described previously, including in O
                <sub>2</sub>/CO
                <sub>2</sub> levels, temperature,
                <sup>
                    <xref ref-type="bibr" rid="ref36">36</xref>
                </sup> lysozyme,
                <sup>
                    <xref ref-type="bibr" rid="ref23">23</xref>
                </sup> lactoferrin,
                <sup>
                    <xref ref-type="bibr" rid="ref23">23</xref>
                </sup> polyamines,
                <sup>
                    <xref ref-type="bibr" rid="ref25">25</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref26">26</xref>
                </sup> mucins,
                <sup>
                    <xref ref-type="bibr" rid="ref37">37</xref>
                </sup> amino acids, carbon source content
                <sup>
                    <xref ref-type="bibr" rid="ref21">21</xref>
                </sup> and salt concentrations.
                <sup>
                    <xref ref-type="bibr" rid="ref38">38</xref>
                </sup> These media were designed to be cheap, accessible and readily modifiable, according to the research question being asked. Development of validated culture media that are more relevant than using nutrient broth and more cost effective and ethical than animal models can offer a platform to understand bacterial within-host adaptation, to use for isolate virulence or antimicrobial susceptibility testing, for efficacy testing of new therapeutics, or for study of bacterial growth, gene expression and biofilm formation under relevant environmental conditions.</p>
        </sec>
        <sec id="sec3" sec-type="methods">
            <title>Methods</title>
            <sec id="sec4">
                <title>Method for media development</title>
                <p>
                    <bold>Microbial strains, base media and culture conditions</bold>
                </p>
                <p>All 
                    <italic toggle="yes">P. aeruginosa</italic> isolates used in this work are shown in 
                    <xref ref-type="table" rid="T2">Table 1</xref>. Bacteria were routinely streaked onto Tryptone Soy Agar (TSA) (Sigma-Aldrich) from bead stocks and restreaked every other day to maintain a fresh stock or from bead stocks, as required. After 18 hours of growth on agar, overnight cultures were prepared in 5ml Lysogeny Broth (LB) (Neogene) at 37&#x00b0;C and incubated for 18 hrs at 180 rpm. M9 medium (1 litre) was prepared by mixing 700 ml M9 salts (15 g/l KH
                    <sub>2</sub>PO
                    <sub>4</sub>, 64 g/l Na
                    <sub>2</sub>HPO
                    <sub>4</sub>, 2.5 g/l NaCl, 5.0 g/l NH
                    <sub>4</sub>Cl) (Sigma-Aldrich) (autoclaved), 2 ml MgSO
                    <sub>4</sub> (autoclaved) (Sigma-Aldrich) and 20 ml 20% glycerol (Sigma-Aldrich) (filter-sterilized), in order. Sterilized water was then used to make up the volume to 1 L.</p>
                <table-wrap id="T2" orientation="portrait" position="float">
                    <label>Table 1. </label>
                    <caption>
                        <title>Bacterial strains used in this study.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Strain</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Description</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Origin</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">PAO1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Widely used laboratory reference strain</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Spontaneous chloramphenicol-resistant mutant of original PAO strain isolated from a wound in Melbourne, Australia
                                    <sup>
                                        <xref ref-type="bibr" rid="ref63">63</xref>
                                    </sup>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">LESB65</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Liverpool Epidemic Strain B65</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CF chronic infection isolate of a transmissible strain from United Kingdom
                                    <sup>
                                        <xref ref-type="bibr" rid="ref64">64</xref>
                                    </sup>
                                </td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <p>
                    <bold>Single chemical growth rate assays</bold>
                </p>
                <p>Each chemical under consideration for inclusion in the respiratory tract-mimicking media was first assessed by supplementation individually into M9 media at &#x2018;low&#x2019;, &#x2018;ideal&#x2019; or &#x2018;high&#x2019; concentrations. Ideal concentrations represent those estimated to most closely reflect the physiological concentration found in each niche, in either health or disease. The relevance of the final list of chemicals included in the final media, in the context of bacterial adaptation to airway environments, is summarised in 
                    <xref ref-type="table" rid="T3">Table 2</xref>. The tested concentration ranges were determined by reference to the literature or from experimental measurement of metabolites (
                    <xref ref-type="table" rid="T4">Table 3</xref>). Low and high concentration values were set at 2-fold below and above the ideal concentration of each chemical. Growth rates of PAO1 and LESB65 were assessed in M9 media supplemented with each chemical, using a microplate reader (Varioskan
                    <sup>&#x00ae;</sup> LUX, Thermo Scientific) (Underlying data Figures 1-4). 2 &#x03bc;l of bacteria from overnight cultures were added to 198 &#x03bc;l of M9 media supplemented with the appropriate chemical. The bacteria were then incubated in sterile 96-well plates (U-bottom) (Greiner) for 20 hours and the growth rates assessed at OD
                    <sub>600nm</sub> at 10 minutes intervals. Incubation conditions were 37&#x00b0;C/5% CO
                    <sub>2</sub> for lung conditions and 34&#x00b0;C/0% CO
                    <sub>2</sub> for sinus conditions. Three biological replicates were performed, per bacterial isolate, per condition. A single working concentration to be used in the final pooled media was then chosen for each chemical, per condition and growth rate assays were performed again with the chosen concentration before the chemicals were combined into a single pooled media. The &#x2018;ideal&#x2019; concentration was chosen for the final media unless found to cause complete inhibition of bacterial growth.</p>
                <table-wrap id="T3" orientation="portrait" position="float">
                    <label>Table 2. </label>
                    <caption>
                        <title>Chemicals included in the media and their importance in shaping the bacterial adaptation in airways.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Chemicals</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Importance in the airways</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Host-derived antimicrobials
                                    <break/>
                                    <p>
                                        <list list-type="bullet">
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Lysozyme</p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Lactoferrin</p>
                                            </list-item>
                                        </list>
                                    </p>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <p>
                                        <list list-type="bullet">
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>The effectiveness of lysozyme reduces in biofilms and in the chronically infected lung, due to electrostatic sequestration of the enzyme by infection-associated anionic biopolymers
                                                    <sup>
                                                        <xref ref-type="bibr" rid="ref33">33</xref>
                                                    </sup>
                                                    <sup>,</sup>
                                                    <sup>
                                                        <xref ref-type="bibr" rid="ref34">34</xref>
                                                    </sup>
                                                </p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>
                                                    <italic toggle="yes">Pseudomonas aeruginosa</italic> acquire mutations leading to resistance against lysosomal killing in the lung.
                                                    <sup>
                                                        <xref ref-type="bibr" rid="ref10">10</xref>
                                                    </sup>
                                                </p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>In CF, activity of lactoferrin can be inhibited by causing partial cleavage via high concentration of cathepsin (neutrophil elastase) and Pseudomonas elastase secretions.
                                                    <sup>
                                                        <xref ref-type="bibr" rid="ref65">65</xref>
                                                    </sup>
                                                </p>
                                            </list-item>
                                        </list>
                                    </p>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Polyamines
                                    <break/>
                                    <p>
                                        <list list-type="bullet">
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Spermidine</p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Spermine</p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Putrescine</p>
                                            </list-item>
                                        </list>
                                    </p>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <p>
                                        <list list-type="bullet">
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>
                                                    <italic toggle="yes">P. aeruginosa</italic> utilizes host-derived polyamines to facilitate antimicrobial tolerance.
                                                    <sup>
                                                        <xref ref-type="bibr" rid="ref25">25</xref>
                                                    </sup>
                                                </p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Spermidine was shown to readily coat the surface of PmrB
                                                    <italic toggle="yes">-</italic>deficient 
                                                    <italic toggle="yes">P. aeruginosa</italic>, protecting 
                                                    <italic toggle="yes">P.aeruginosa</italic> from antibiotics and oxidative stress and leading to increase in biofilm formation.
                                                    <sup>
                                                        <xref ref-type="bibr" rid="ref25">25</xref>
                                                    </sup>
                                                </p>
                                            </list-item>
                                        </list>
                                    </p>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Mucin</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <p>
                                        <list list-type="bullet">
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>The abnormal mucin glycosylation in CF promotes bacterial adhesion and infection, via increased exposure of specific glycan receptors.
                                                    <sup>
                                                        <xref ref-type="bibr" rid="ref66">66</xref>
                                                    </sup>
                                                </p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>
                                                    <italic toggle="yes">P. aeruginosa</italic> can break down and utilize mucin glycans as monosaccharides.
                                                    <sup>
                                                        <xref ref-type="bibr" rid="ref67">67</xref>
                                                    </sup>
                                                </p>
                                            </list-item>
                                        </list>
                                    </p>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">eDNA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <p>
                                        <list list-type="bullet">
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Necrosis products of neutrophils and component of extracellular polymeric substance (EPS) in biofilms.</p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Presence of neutrophils in infection leads to increased biofilm formation as result of formation of eDNA-actin polymers.
                                                    <sup>
                                                        <xref ref-type="bibr" rid="ref68">68</xref>
                                                    </sup>
                                                </p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Bacterial eDNA can also be secreted by 
                                                    <italic toggle="yes">P. aeruginosa</italic> to aid biofilm formation.
                                                    <sup>
                                                        <xref ref-type="bibr" rid="ref69">69</xref>
                                                    </sup>
                                                </p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>eDNA can shield 
                                                    <italic toggle="yes">P. aeruginosa</italic> biofilms against aminoglycosides and protect them from antimicrobial attack.
                                                    <sup>
                                                        <xref ref-type="bibr" rid="ref69">69</xref>
                                                    </sup>
                                                </p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Presence of eDNA leads to formation of cation gradients and inducible antibiotic resistance in CF airways.
                                                    <sup>
                                                        <xref ref-type="bibr" rid="ref70">70</xref>
                                                    </sup>
                                                </p>
                                            </list-item>
                                        </list>
                                    </p>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Amino acids</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <p>
                                        <list list-type="bullet">
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Bacteria exoproducts or derived from the host.</p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>
                                                    <italic toggle="yes">P. aeruginosa</italic> secretes exoproteases to generate more utilisable nutritional substrates to support its growth.
                                                    <sup>
                                                        <xref ref-type="bibr" rid="ref71">71</xref>
                                                    </sup>
                                                </p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Increased amino-acid content in the airways of CF patients plays a significant role in the selection and maintenance of nutritionally deficient 
                                                    <italic toggle="yes">P. aeruginosa.</italic>
                                                    <sup>
                                                        <xref ref-type="bibr" rid="ref71">71</xref>
                                                    </sup>
                                                </p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>In the presence of amino acids, 
                                                    <italic toggle="yes">P. aeruginosa</italic> quorum sensing activity and exopolysaccharide formation increases.
                                                    <sup>
                                                        <xref ref-type="bibr" rid="ref72">72</xref>
                                                    </sup>
                                                </p>
                                            </list-item>
                                        </list>
                                    </p>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Serum Albumin</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <p>
                                        <list list-type="bullet">
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Binding of albumin can promote bacterial survival at the epithelial cell surface.
                                                    <sup>
                                                        <xref ref-type="bibr" rid="ref53">53</xref>
                                                    </sup>
                                                </p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Albumin influences formation of 
                                                    <italic toggle="yes">P. aeruginosa</italic> virulence factors. Serum albumin shown to play a critical role in 
                                                    <italic toggle="yes">P. aeruginosa</italic> virulence during early phases of infection by enhancing the expression of iron-controlled genes.
                                                    <sup>
                                                        <xref ref-type="bibr" rid="ref73">73</xref>
                                                    </sup>
                                                </p>
                                            </list-item>
                                        </list>
                                    </p>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Biometals
                                    <break/>
                                    <p>
                                        <list list-type="bullet">
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Calcium Chloride (CaCl
                                                    <sub>2</sub>)</p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Magnesium Chloride (MgCl
                                                    <sub>2</sub>)</p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Iron Chloride (FeCl
                                                    <sub>2</sub>)</p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Copper Chloride (CuCl
                                                    <sub>2</sub>)</p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Zinc Chloride (ZnCl
                                                    <sub>2</sub>)</p>
                                            </list-item>
                                        </list>
                                    </p>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <p>
                                        <list list-type="bullet">
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Iron and zinc aid bacterial growth and are essential nutrients for bacteria
                                                    <sup>
                                                        <xref ref-type="bibr" rid="ref56">56</xref>
                                                    </sup>
                                                </p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Magnesium has been proposed to have a role in maintaining established biofilms
                                                    <sup>
                                                        <xref ref-type="bibr" rid="ref56">56</xref>
                                                    </sup>
                                                </p>
                                            </list-item>
                                        </list>
                                    </p>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Carbohydrate sources
                                    <break/>
                                    <p>
                                        <list list-type="bullet">
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Sialic acid</p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Galactose</p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>N-acetyl glucosamine</p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Glucose</p>
                                            </list-item>
                                        </list>
                                    </p>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <p>
                                        <list list-type="bullet">
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Products of mucin degradation in CF airways, act as nutrient sources.
                                                    <sup>
                                                        <xref ref-type="bibr" rid="ref54">54</xref>
                                                    </sup>
                                                </p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Glucose elevated in lungs in CF-associated diabetes.
                                                    <sup>
                                                        <xref ref-type="bibr" rid="ref40">40</xref>
                                                    </sup>
                                                </p>
                                            </list-item>
                                        </list>
                                    </p>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Salts
                                    <break/>
                                    <p>
                                        <list list-type="bullet">
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Sodium Chloride</p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Bile salts</p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Succinate</p>
                                            </list-item>
                                        </list>
                                    </p>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <p>
                                        <list list-type="bullet">
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>High concentrations of sodium chloride in the airway surface liquid (ASL) inhibit the activity of antimicrobial factors giving higher chance for bacterial persistence.
                                                    <sup>
                                                        <xref ref-type="bibr" rid="ref74">74</xref>
                                                    </sup>
                                                </p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Long term bile exposure shown to cause emergence of adaptive 
                                                    <italic toggle="yes">P. aeruginosa</italic> variants that are ecologically competitive sub-populations.
                                                    <sup>
                                                        <xref ref-type="bibr" rid="ref75">75</xref>
                                                    </sup>
                                                </p>
                                            </list-item>
                                            <list-item>
                                                <label>&#x2022;</label>
                                                <p>Succinate-exposed 
                                                    <italic toggle="yes">P. aeruginosa</italic> showed increase in glucose metabolism and utilization of trehalose and acetate, production of EPS and enabled tolerance to oxidant stress
                                                    <sup>
                                                        <xref ref-type="bibr" rid="ref76">76</xref>
                                                    </sup>
                                                </p>
                                            </list-item>
                                        </list>
                                    </p>
                                </td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <table-wrap id="T4" orientation="portrait" position="float">
                    <label>Table 3. </label>
                    <caption>
                        <title>Concentration of each chemical to be used in the final media.</title>
                        <p>Amino acid concentration sources: healthy
                            <sup>
                                <xref ref-type="bibr" rid="ref77">77</xref>
                            </sup>: CF
                            <sup>
                                <xref ref-type="bibr" rid="ref21">21</xref>
                            </sup>: (x: chemical not present).</p>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Chemicals</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Healthy sinuses</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">CF sinuses</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Healthy lungs</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">CF lungs</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Lysozyme</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">8 &#x03bc;g/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref23">23</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">24 &#x03bc;g/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref23">23</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">8 &#x03bc;g/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref23">23</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">48 &#x03bc;g/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref23">23</xref>
                                    </sup>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Lactoferrin</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.5 &#x03bc;g/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref23">23</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">50 &#x03bc;g/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref23">23</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.5 &#x03bc;g/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref23">23</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">50 &#x03bc;g/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref23">23</xref>
                                    </sup>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Spermidine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">200 ng/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref25">25</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">325 ng/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref25">25</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">250 ng/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref25">25</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">350 ng/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref25">25</xref>
                                    </sup>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Spermine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">32.5 &#x03bc;g/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref26">26</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">346 &#x03bc;g/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref26">26</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">44.5 &#x03bc;g/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref26">26</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">346 &#x03bc;g/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref26">26</xref>
                                    </sup>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Putrescine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">616 &#x03bc;g/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref26">26</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">616 &#x03bc;g/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref26">26</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">616 &#x03bc;g/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref26">26</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">616 &#x03bc;g/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref26">26</xref>
                                    </sup>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Mucin</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1.2 mg/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref37">37</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">5 mg/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref29">29</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1.2 mg/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref37">37</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">5 mg/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref29">29</xref>
                                    </sup>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">eDNA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.96 mg/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref78">78</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">4 mg/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref29">29</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.96 mg/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref78">78</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">4 mg/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref29">29</xref>
                                    </sup>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Albumin</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.5 mg/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref54">54</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">7 mg/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref54">54</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1.5 mg/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref54">54</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">7 mg/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref54">54</xref>
                                    </sup>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CaCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">45 mg/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref56">56</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">100 mg/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref56">56</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">45 mg/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref56">56</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">100 mg/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref56">56</xref>
                                    </sup>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">MgCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">8 mg/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref56">56</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">30 mg/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref56">56</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">8 mg/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref56">56</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">30 mg/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref56">56</xref>
                                    </sup>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">FeCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">887 &#x03bc;g/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref56">56</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">5.95 mg/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref56">56</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">887 &#x03bc;g/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref56">56</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">5.95 mg/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref56">56</xref>
                                    </sup>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CuCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">106 &#x03bc;g/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref56">56</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">173 &#x03bc;g/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref56">56</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">106 &#x03bc;g/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref56">56</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">173 &#x03bc;g/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref56">56</xref>
                                    </sup>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">ZnCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">390 &#x03bc;g/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref56">56</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1285 &#x03bc;g/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref56">56</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">390 &#x03bc;g/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref56">56</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1285 &#x03bc;g/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref56">56</xref>
                                    </sup>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">NaCl</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1 mg/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref38">38</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6.3 mg/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref38">38</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1 mg/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref38">38</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6.3 mg/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref38">38</xref>
                                    </sup>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Sialic acid</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3.23 &#x03bc;g/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref79">79</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6.46 &#x03bc;g/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref79">79</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3.23 &#x03bc;g/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref79">79</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6.46 &#x03bc;g/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref79">79</xref>
                                    </sup>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Bile</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">X</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">X</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">X</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.3 mg/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref80">80</xref>
                                    </sup>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">N-acetyl glucosamine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1.28 mg/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref54">54</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">4.42 mg/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref54">54</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1.28 mg/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref54">54</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">4.42 mg/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref54">54</xref>
                                    </sup>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Glucose</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">X baseline glucose (20%) from M9 media components</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">250 mg/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref40">40</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">X baseline glucose (20%) from M9 media components</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">250 mg/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref40">40</xref>
                                    </sup>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Succinate</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.295 mg/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref76">76</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2.95 mg/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref76">76</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.295 mg/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref76">76</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2.95 mg/ml
                                    <sup>
                                        <xref ref-type="bibr" rid="ref76">76</xref>
                                    </sup>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Galactose</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6.27 &#x03bc;g/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref79">79</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">7 &#x03bc;g/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref79">79</xref>
                                    </sup>
                                    <sup>
                                        <xref ref-type="bibr" rid="ref79">79</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6.27 &#x03bc;g/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref79">79</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">7 &#x03bc;g/l
                                    <sup>
                                        <xref ref-type="bibr" rid="ref79">79</xref>
                                    </sup>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">L-Methionine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.3 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">90 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.3 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">90 mg/l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">L-Phenylalanine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.8 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">90 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.8 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">90 mg/l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">L-Proline</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1.3 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">200 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1.3 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">200 mg/l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">L-Serine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1.8 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">150 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1.8 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">150 mg/l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">L-Threonine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">15 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">120 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">15 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">120 mg/l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">L-Tryptophan</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.16 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.16 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2 mg/l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">L-Valine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1.6 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">130 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1.6 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">130 mg/l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">L-Ornithine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">X</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">90 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">X</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">90 mg/l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">L-Tyrosine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.73 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">140 mg/L</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.73 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">140 mg/L</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">L(+)-Asparagine monohydrate</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.35 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">X</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.35 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">X</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">L-Alanine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">160 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">160 mg/l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">L-Arginine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">37 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">50 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">37 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">50 mg/l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">L(+)-Aspartic acid</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">110 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">110 mg/l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">L-Cysteine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.28 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">24.2 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.28 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">24.2 mg/l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">L-Glutamine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.5 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">220 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.5 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">220 mg/l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">L-Glycine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2.7 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">90 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2.7 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">90 mg/l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">L-Histidine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.5 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">77.5 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.5 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">77.5 mg/l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">L-Isoleucine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">140 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">140 mg/l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">L-Leucine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">210 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">210 mg/l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">L-Lysine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2.2 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">310 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2.2 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">310 mg/l</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
            </sec>
            <sec id="sec5">
                <title>Preparation of the pooled media</title>
                <p>Media synonyms:</p>
                <p>Healthy sinus media (HSM),</p>
                <p>Healthy lung media (HLM),</p>
                <p>CF sinus media (CFSM),</p>
                <p>CF lung media (CFLM).</p>
                <p>Media components were pooled together at concentrations given in 
                    <xref ref-type="table" rid="T4">Table 3</xref>, yielding four different respiratory media: Healthy sinus media (HSM), healthy lung media (HLM), CF sinus media (CFSM) and CF lung media (CFLM). Briefly, eDNA and mucin solutions were prepared separately in distilled water by constant stirring overnight at 4 &#x00b0;C. Next day, the solutions were autoclaved at 121 &#x00b0;C. Other components of the media were prepared in a single solution by firstly adding the M9 media components (water, 20% glucose and 1M MgSO
                    <sub>4</sub>). Stock solutions of all the media components except glucose, succinate, N-acetyl glucosamine (Glc-NAc), bile, NaCl, albumin and amino acids were prepared and added to the media in solution form. Aforementioned chemicals were then added in powder form, slowly, under constant stirring at room temperature. Once all the components were fully mixed, the solution was sterilized by filtration using Vacuubrand ME 2 diaphragm vacuum pump and Millipore Steritop filter units with a pore and neck size of 0.22 &#x03bc;m. Sterile eDNA and mucin was then added to the filtered media and the pH of media was adjusted to 6.8-6.9 using sodium hydroxide (NaOH) (Sigma-Aldrich). The volume of the solution was brought to 1 litre by the addition of autoclaved distilled water. The media was then aliquoted to 50ml falcon tubes and stored at -80&#x00b0;C until further use.</p>
            </sec>
            <sec id="sec6">
                <title>Salinity adjustments</title>
                <p>M9 media was prepared without the addition of M9 salts because exogenous salts were added in the form of NaCl and bile salts, as defined in 
                    <xref ref-type="table" rid="T4">Table 3</xref>. Salinity of the media was adjusted according to the salinity of ASM (2%) (measured in this study) for CF media. Salinity of healthy media was kept lower than CF media. Briefly, 1ml of media (ASM, HSM, HLM, CFSM, CFLM) was deposited to the surface of refractometer (V-RESOURCING) after it was calibrated with sterile water. Salinity of CF media was adjusted to 2%, salinity of healthy media was kept less than 2% as CF airways is known to have higher salt content than healthy airways, although salinity in health is not well defined.</p>
            </sec>
            <sec id="sec7">
                <title>Viscosity measurements</title>
                <p>Viscosity of media was measured before and after allowing bacteria to form biofilms for three days, to mimic chronic infection. Viscosity measurements (mPa.s) were performed using a rheometer (Anton-Paar) with cone plate (Serial number: 44806). 50-100 1/s range was used for all sterile media and healthy media during infection, and 0.01-1000 1/s range was used for CF media during infection. Changes in media viscosity was observed under each shear rate point.</p>
            </sec>
            <sec id="sec8">
                <title>Media stability</title>
                <p>Stability of developed media was tested over a 30-day period by performing crystal violet stain assays (as described below) using media stored at 4&#x00b0;C for 30 days. This experiment was designed to determine whether media would continue to support biofilm formation after prolonged storage.</p>
            </sec>
            <sec id="sec9">
                <title>Growth curves of PAO1 and LESB65 in the developed media</title>
                <p>Colony forming unit (CFU) assays were performed to observe the growth of PAO1 and LESB65 in the pooled media. Bacterial cultures grown in LB for 18 hours were centrifuged for 12 minutes at 3220rcf at room temperature. After the LB suspension was removed, bacterial pellets were resuspended in 5 ml of sterile phosphate buffer saline (PBS) (Sigma-Aldrich). The suspension was homogenized by vortexing and bacterial optical density was adjusted to OD 0.05-0.06 in PBS using an optical spectrometer (HANNA instruments). 50 ul of this suspension was then added to 4950 ul HSM, HLM, CFSM or CFLM and cultures were incubated under niche-appropriate conditions: sinus media at 34&#x00b0;C with no CO2, lung media at 37&#x00b0;C with 5% CO
                    <sub>2</sub>. Anaerobic jars were used to increase the CO
                    <sub>2</sub> concentration for lung conditions. CFU was measured at pre-determined time intervals by serial-dilution onto agar. Briefly, 10-fold serial dilutions were prepared in 96 well microplates (Greiner U-bottom) using PBS as the diluent. 20 ul of bacterial dilution was then plated to TSA plates covering the dilutions from 10
                    <sup>-2</sup> to 10
                    <sup>-9</sup>. The plates were air dried and then incubated at 37&#x00b0;C until the colonies were clearly visible (18 hours for PAO1 and 24 hours for LESB65).</p>
            </sec>
            <sec id="sec10">
                <title>Biofilm formation in the developed media</title>
                <p>
                    <bold>Measurement of attached biofilm biomass by crystal violet staining</bold>
                </p>
                <p>Starting from an overnight liquid culture in LB (incubated for 18 hours), bacterial cultures were diluted 1:100 in the developed media, or in LB, or M9, two widely used laboratory bacterial culture media. To minimise edge-effect, non-perimeter wells of U-bottomed polystyrene 96-well microtiter plate (Greiner U-bottomed) were inoculated with 180 &#x03bc;l of these dilutions and perimeter wells were used as a negative control (sterile medium). Following 3 days of growth at 37&#x00b0;C, the supernatant (containing non-adhered cells) was removed from each well and plates were rinsed using 200 &#x03bc;l sterile PBS, twice. Subsequently, 200 &#x03bc;l of Crystal Violet (CV) was added to non-perimeter wells and plates were incubated at room temperature for minimum 20 minutes. After 20 minutes, the excess CV was removed by washing the plates under running tap water. Finally, bound CV was released by addition of 200 &#x03bc;l of 95-100% ethanol (Sigma-Aldrich) to the wells with bacteria. After incubating with ethanol for 30 minutes, the absorbance was measured at 600 nm using a BMG plate reader. 95-100% ethanol was used as a blank.</p>
                <p>
                    <bold>Measurement of cell viability and free-floating biofilm formation by resazurin assays</bold>
                </p>
                <p>Overnight cultures of PAO1 and LESB65 were diluted in LB to an OD 600 of 0.05 (&#x00b1;0.01). These cultures were then further diluted in the developed media (1:100) to a total volume of 10ml in glass universal tubes. Free floating biofilm formation in respiratory tract-mimicking media was compared to that observed in LB and M9. Diluted developed media cultures were incubated under conditions appropriate for each respiratory niche, as described above. Cultures were incubated for 3 days while shaking at 75 rpm. Three glass universal tubes containing bacteria-free respiratory media, LB or M9 were used as a negative control. After the incubation, biofilms were disrupted using 250 &#x03bc;l of 100 mg/ml cellulase (diluted in 0.05 M citrate buffer [9.6 g/l Citrate.H
                    <sub>2</sub>O (VWR)] in water and pH to 4.6 with NaOH) and further incubated under aerobic conditions at 37 &#x00b0;C, while shaking at 150 rpm for 1 h. After 30 minutes incubation, biofilms were further disrupted by manual pipetting to ensure complete disruption of biofilms. A portion of disrupted biofilms were then transferred to 96-well plates (Greiner U-bottomed) and to determine the metabolic activity of the bacterial cells released from the disrupted biofilms, 10 &#x03bc;l of 0.02 % (v/v) resazurin (Sigma-Aldrich) (diluted in distilled water) was added to each well of the 96-well plates and incubated for 1-2 hours at niche specific temperature, while shaking at 150 rpm. Following incubation with resazurin, the fluorescence of each well was measured using an excitation wavelength of 540 nm and an emission wavelength of 590 nm in a Fluostar Omega microplate reader and the MARS Data Analysis Software.</p>
            </sec>
            <sec id="sec11">
                <title>RNA extraction and cDNA synthesis</title>
                <p>The bacteria were grown in 5ml of each developed media or LB until early stationary phase (12 hrs for PAO1 and 20 hrs for LESB65 in the developed media, and 6hrs for PAO1 and 18hrs for LESB65 in LB). To extract RNA, TRI reagent (ZYMO Research) was added and mixtures were incubated for 5&#x2013;10&#x2009;min at room temperature. Bacteria were harvested by centrifugation for 30&#x2009;min at 13,000 rpm and 4&#x2009;&#x00b0;C. Supernatant was removed and bacterial pellets were used for subsequent RNA isolation or stored at &#x2212;80&#x2009;&#x00b0;C. RNA from bacterial cultures was isolated using the Direct Zol RNA Microprep kit (ZYMO Research: R2061) according to the manufacturer&#x2019;s instructions. DNase digestion treatment was performed using DNAse 1 (ZYMO Research) as per the manufacturer&#x2019;s protocol. Isolation was performed in an RNase-free environment using RNase-free consumables and reagents. Purified RNA was eluted with RNase-free water (ZYMO Research). Quantification of RNA was performed by measuring the absorbance at 260&#x2009;nm wavelength using the NanoDrop8000&#x2009;UV&#x2013;vis Spectrophotometer (Thermo Scientific). and purity of RNA was analysed by determination of the 260/280&#x2009;nm ratio. Nuclease free water (Invitrogen) was used as a blank. The 260/280&#x2009;nm ratio obtained for all samples was between 1.8 and 2.0.</p>
                <p>First-strand cDNA synthesis was performed using the iScript cDNA synthesis kit (BIO-RAD: 1708891) according to the manufacturer&#x2019;s instructions in an RNase-free environment using RNase-free consumables and reagents. For each sample, 2.5&#x2009;ng RNA was added and incubated in a thermocycler (Applied Biosystem) under the following protocol: 5&#x2009;min at 25&#x2009;&#x00b0;C, 30&#x2009;min at 42&#x2009;&#x00b0;C and then 5&#x2009;min at 85&#x2009;&#x00b0;C. The cDNA was then stored at &#x2212;20&#x2009;&#x00b0;C until further use.</p>
            </sec>
            <sec id="sec12">
                <title>Quantitative real-time PCR (qPCR) and gene expression analysis</title>
                <p>cDNA was used for quantitative real-time PCR (qPCR) in duplicate reactions using the GoTaq
                    <sup>&#x00ae;</sup> qPCR Master Mix (Promega: A6001) as per the manufacturer&#x2019;s instructions. Each reaction contained 2&#x2009;&#x03bc;l of cDNA (or nuclease free water for the no template control) and 0.2&#x2009;&#x03bc;M of forward and reverse primers (Eurofins). Primer sequences are provided in 
                    <xref ref-type="table" rid="T5">Table 4</xref>. qPCR was performed using the BioRad CFX Connect Real Time PCR System (BIORAD) using MicroAmp&#x2122; Optical 96-Well Reaction Plate (Applied Biosystem) under the following conditions; 2&#x2009;min at 95&#x2009;&#x00b0;C followed by 40 cycles of 15&#x2009;sec at 95&#x2009;&#x00b0;C and 1&#x2009;min at 60&#x2009;&#x00b0;C.</p>
                <table-wrap id="T5" orientation="portrait" position="float">
                    <label>Table 4. </label>
                    <caption>
                        <title>Primer sequences used in the qPCR experiments for PAO1 and LESB65.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <tbody>
                            <tr>
                                <td align="left" colspan="2" rowspan="1" valign="top">
                                    <bold>PAO1</bold>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">algU Forward primer</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAGGAACAGGATCAGCAACT</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">algU Reverse primer</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CGCACGATCAATCCCAGTAT</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">mexB Forward primer</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GTTCCTGGTGATGTACCTGTT</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">mexB Reverse primer</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GTTCCTGGTGATGTACCTGTT</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">PA2911 Forward primer</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AGCAACAACTCGCCCTATAC</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">PA2911 Reverse primer</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CGAGCGGCTTTCGAAGTA</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">PA2382 Forward primer</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TACACCCTGTCGACCATGA</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">PA2382 Reverse primer</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GCATCACGTAGAGCTGGAAC</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">rpoD Forward primer</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GGGCGAAGAAAGGAAATGGT</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">rpoD Reverse primer</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAGGTGGCGTAGGTGCAGA</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="2" rowspan="1" valign="top">
                                    <bold>LESB65</bold>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">algU Forward primer</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAGGAACAGGATCAGCAACT</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">algU Reverse primer</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CGCACGATCAATCCCAGTAT</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">mexB Forward primer</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CGATCCATGAGGTAGTGAAGAC</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">mexB Reverse primer</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GTTCTGCAGGAACAGGTACA</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">PA2911 Forward primer</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AGCAACAACTCGCCCTATAC</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">PA2911 Reverse primer</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CGAGCGGCTTTCGAAGTA</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">PA2382 Forward primer</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CCGTTCCTCTTCCACTACATC</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">PA2382 Reverse primer</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TCAGCTCGGACATGTTCTTC</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">rpoD Forward primer</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Same rpoD primers with PAO1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">rpoD Reverse primer</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Same rpoD primers with PAO1</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <p>Each qPCR was performed with three biological replicates and in duplicate on each run. Gene 
                    <italic toggle="yes">rpoD</italic>, encoding sigma factor RpoD, was used as a reference gene. cDNA obtained from cultures grown in LB was used as a control. Analysis of relative gene expression in each developed media and SCFM2 versus (vs) LB was performed using the 2
                    <sup>&#x2212;&#x0394;&#x0394;Ct</sup> relative quantification method as described previously.
                    <sup>
                        <xref ref-type="bibr" rid="ref39">39</xref>
                    </sup>
                </p>
            </sec>
            <sec id="sec13">
                <title>Long term culturing of PAO1 in developed media</title>
                <p>PAO1 was cultured in the developed media for forty days, sub-cultured to fresh media every 2 days and plated on Tryptone Congo red/Coomassie blue Agar (TCCA) prepared by mixing 20 mg/L Coomassie blue (Sigma-Aldrich), 40 mg/L Congo red (Sigma-Aldrich), 10 g/L Tryptone (Sigma-Aldrich) and 12 g/L Bacto agar (Fisher-Scientific) in distilled water and autoclaving at 121&#x00b0;C for 15 minutes. 100 &#x03bc;l of bacterial cultures were spread on to the plates in serial dilutions (10
                    <sup>-4</sup>, 10
                    <sup>-6</sup>) every ten days. Plates were incubated at 37&#x00b0;C for 24 hours and for a further 48 hours at room temperature to allow the colonies to uptake the two dyes in the media.</p>
            </sec>
            <sec id="sec14">
                <title>Statistical analysis</title>
                <p>All assays were carried out at least three times independently. Statistical significance was evaluated using One-way ANOVA (*p&lt;0.05, **p&lt;0.01, ***p&lt;0.001, **** p&lt;0.0001). All statistical analysis was done using Graphpad Prism versions 8 and 9 (similar analysis could be performed in Microsoft Excel as a free to use alternative). For single chemical growth rate assays, R studio version 3.6.2 and GrowthCurver (version 0.3.1) was used to plot the area under the curve (AUC_e) values.</p>
            </sec>
            <sec id="sec15">
                <title>Protocol for media preparation</title>
                <p>Here we describe, step-by step, the procedure used to prepare 1L of each of the four developed media. Reagents and equipment used in this study are listed in 
                    <xref ref-type="table" rid="T17">Table 16</xref>.</p>
                <p>
                    <bold>Preparation of the base (same for both CF media)</bold>
                    <list list-type="order">
                        <list-item>
                            <label>1.</label>
                            <p>In a 1 litre Duran bottle, add 300 ml distilled water, 20 ml 20% glucose and 2 ml 1 M MgSO
                                <sub>4</sub>.</p>
                        </list-item>
                    </list>
                </p>
                <p>
                    <bold>Preparation of CF sinus media</bold>
                    <list list-type="order">
                        <list-item>
                            <label>1.</label>
                            <p>Add 4.8 g eDNA in 300 ml water under continuous stirring with a magnetic stirrer at room temperature. Add the eDNA very slowly as it can form clumps in the water.</p>
                        </list-item>
                        <list-item>
                            <label>2.</label>
                            <p>Add 6 g mucin from porcine stomach (Type II) in 150 ml water under continuous stirring with a magnetic stirrer at room temperature. Add mucin powder slowly to water to prevent the formation of clumps. eDNA and mucin can be stirred overnight at 4&#x00b0;C to fully dissolve the powder.</p>
                        </list-item>
                        <list-item>
                            <label>3.</label>
                            <p>Once the eDNA and mucin solutions are fully dissolved, autoclave at 121&#x00b0;C for 15 minutes to sterilise.</p>
                        </list-item>
                        <list-item>
                            <label>4.</label>
                            <p>Prepare stocks of lysozyme, lactoferrin, spermidine, spermine, putrescine, CaCl
                                <sub>2</sub>, MgCl
                                <sub>2</sub>, FeCl
                                <sub>2</sub>, CuCl
                                <sub>2</sub>, ZnCl
                                <sub>2</sub>, sialic acid and galactose in the concentrations given in 
                                <xref ref-type="table" rid="T6">Table 5</xref> for CF sinuses by dissolving each powder in deionised water.</p>
                        </list-item>
                        <list-item>
                            <label>5.</label>
                            <p>Under constant stirring with magnetic stirrer, from the stocks prepared, add the amounts of each chemical to the base media as given in 
                                <xref ref-type="table" rid="T7">Table 6</xref>.</p>
                        </list-item>
                        <list-item>
                            <label>6.</label>
                            <p>Add 35 &#x03bc;l of neat spermidine solution (9.296 g/l) to the base media.</p>
                        </list-item>
                        <list-item>
                            <label>7.</label>
                            <p>Weigh the amounts of L-amino acids given in 
                                <xref ref-type="table" rid="T4">Table 3</xref> and add one by one to the media under constant stirring. Exceptions are L-cysteine and L-tyrosine. Dissolve L-cysteine in 2.95 ml of 0.5 M potassium hydroxide (M
                                <sub>r</sub> 56.11 g/mol) and L-tyrosine in 2.95 ml sterile water, separately before adding them to the base media. (Amino acid concentrations are same for both CF sinuses and CF lung media.)</p>
                        </list-item>
                        <list-item>
                            <label>8.</label>
                            <p>Weigh 7 g of albumin, 6.3 g of NaCl, 4.4 g of N-acetyl glucosamine, 250 mg of glucose and 2.95 g of succinate and add to the media one at a time. Wait for each chemical to dissolve completely before adding the next one. Succinate can take time to dissolve in water. Incubate the succinate at 37 &#x00b0;C while shaking at 180 rpm for 10-15 minutes to quicken dissolving.</p>
                        </list-item>
                        <list-item>
                            <label>9.</label>
                            <p>Sterilise the media by filtration using a Vacuubrand ME 2 diaphragm vacuum pump and Millipore Steritop filter units with a pore and neck size of 0.22 &#x03bc;m.</p>
                        </list-item>
                        <list-item>
                            <label>10.</label>
                            <p>Under sterile conditions, add 250 ml of autoclaved eDNA and 125 ml of autoclaved mucin to the mixture.</p>
                        </list-item>
                        <list-item>
                            <label>11.</label>
                            <p>Adjust pH to 6.8-6.9 with 5 M NaOH and bring the volume to 1 litre with sterile water.</p>
                        </list-item>
                        <list-item>
                            <label>12.</label>
                            <p>Filtered media should be stored at 4 &#x00b0;C for further use. Using fresh media is recommended, however it can be kept under these conditions for a maximum of three weeks. For freshness, the media can be aliquoted and stored at -80&#x00b0;C (suitable for longer term use).</p>
                        </list-item>
                    </list>
                </p>
                <table-wrap id="T6" orientation="portrait" position="float">
                    <label>Table 5. </label>
                    <caption>
                        <title>Preparation of chemical stocks for CF sinuses media.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="4" rowspan="1" valign="top">Chemical stock preparation for CF sinuses media</th>
                            </tr>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Chemical</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Stock concentration (mg/ml)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Amount of powder to weigh to form the stock solution (mg)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Volume of water to dissolve the powder in (ml)</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Lysozyme</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">24</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">24</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Lactoferrin</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">50</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">50</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Spermine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Putrescine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">200</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">200</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CaCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">250</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">250</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">MgCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">100</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">100</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">FeCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CuCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">ZnCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2.6</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2.6</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Sialic acid</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Galactose</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <table-wrap id="T7" orientation="portrait" position="float">
                    <label>Table 6. </label>
                    <caption>
                        <title>Volume of each chemical to add into the base media for 1liter CFSLM.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="4" rowspan="1" valign="top">CF sinuses media</th>
                            </tr>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Chemical</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Stock concentration</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Concentration desired in the media</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Amount to add from the stock</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Lysozyme</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">24 &#x03bc;g/ml</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">24 ml</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Lactoferrin</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">50 &#x03bc;g/ml</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">50 ml</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Spermine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">346 &#x03bc;g/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">346 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Putrescine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">200</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">616 &#x03bc;g/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CaCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">250</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">100 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">400 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">MgCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">100</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">30 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">300 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">FeCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">5.95 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">5.95 ml</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CuCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">173 &#x03bc;g/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">173 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">ZnCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2.6</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1285 &#x03bc;g/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">494 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Sialic acid</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6.46 &#x03bc;g/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6.46 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Galactose</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">7 &#x03bc;g/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">7 &#x03bc;l</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <p>
                    <bold>Preparation of CF lung media</bold>
                    <list list-type="order">
                        <list-item>
                            <label>1.</label>
                            <p>Follow steps 1-3 of CFSM protocol for eDNA and mucin stock solution preparation.</p>
                        </list-item>
                        <list-item>
                            <label>2.</label>
                            <p>Prepare stocks of lysozyme, lactoferrin, spermidine, spermine, putrescine, CaCl
                                <sub>2</sub>, MgCl
                                <sub>2</sub>, FeCl
                                <sub>2</sub>, CuCl
                                <sub>2</sub>, ZnCl
                                <sub>2</sub>, sialic acid and galactose in the concentrations given in 
                                <xref ref-type="table" rid="T8">Table 7</xref> for CF lungs by dissolving each powder in deionised water.</p>
                        </list-item>
                        <list-item>
                            <label>3.</label>
                            <p>Under constant stirring with magnetic stirrer, from the stocks prepared, add the amounts of each chemical to the base media as given in 
                                <xref ref-type="table" rid="T9">Table 8</xref>.</p>
                        </list-item>
                        <list-item>
                            <label>4.</label>
                            <p>Add 37.6 &#x03bc;l of neat spermidine solution (9.296 g/L) to the base media.</p>
                        </list-item>
                        <list-item>
                            <label>5.</label>
                            <p>Add amino acids in the same way as for preparation of CF sinuses media (See 
                                <xref ref-type="table" rid="T4">Table 3</xref>).</p>
                        </list-item>
                        <list-item>
                            <label>6.</label>
                            <p>Add 7 g albumin, 6.3 g NaCl, 4.4 g of N-acetyl glucosamine, 250 mg of glucose, 2.95 g of succinate, 300 mg bile salts, one at a time.</p>
                        </list-item>
                        <list-item>
                            <label>7.</label>
                            <p>Sterilise the media in the same way to CF sinuses media (see above protocol).</p>
                        </list-item>
                        <list-item>
                            <label>8.</label>
                            <p>Under sterile conditions, add 250 ml of autoclaved eDNA and 125 ml of autoclaved mucin to the mixture.</p>
                        </list-item>
                        <list-item>
                            <label>9.</label>
                            <p>Adjust pH to 6.8-6.9 with 5M NaOH and bring the volume to 1 litre with sterile water.</p>
                        </list-item>
                        <list-item>
                            <label>10.</label>
                            <p>Filtered media should be stored at 4 &#x00b0;C for further use. Using fresh media is recommended, however it can be kept under these conditions for a maximum of three weeks. For freshness, the media can be aliquoted and stored at -80&#x00b0;C (suitable for longer term use).</p>
                        </list-item>
                    </list>
                </p>
                <table-wrap id="T8" orientation="portrait" position="float">
                    <label>Table 7. </label>
                    <caption>
                        <title>Preparation of chemical stocks for CF lungs media.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="4" rowspan="1" valign="top">Chemical stock preparation for CF lungs media</th>
                            </tr>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Chemical</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Stock concentration (mg/ml)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Amount of powder to weigh to form the stock solution (mg)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Volume of water to dissolve the powder in (ml)</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Lysozyme</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">48</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">48</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Lactoferrin</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">50</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">50</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Spermine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Putrescine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">200</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">200</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CaCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">250</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">250</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">MgCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">100</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">100</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">FeCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CuCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">ZnCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2.6</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2.6</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Sialic acid</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Galactose</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <table-wrap id="T9" orientation="portrait" position="float">
                    <label>Table 8. </label>
                    <caption>
                        <title>Volumes of each chemical to add into the base media for 1liter CFLM.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="4" rowspan="1" valign="top">CF lungs media</th>
                            </tr>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Chemical</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Stock concentration (mg/ml)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Concentration desired in the media</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Amount to add from the stock</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Lysozyme</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">48 &#x03bc;g/ml</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">48 ml</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Lactoferrin</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">50 &#x03bc;g/ml</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">50 ml</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Spermine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">346 &#x03bc;g/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">346 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Putrescine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">200</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">616 &#x03bc;g/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CaCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">250</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">100 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">400 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">MgCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">100</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">30 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">300 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">FeCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">5.95 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">5.95 ml</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CuCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">173 &#x03bc;g/L</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">173 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">ZnCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2.6</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1285 &#x03bc;g/L</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">494 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Sialic acid</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6.46 &#x03bc;g/L</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6.4 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Galactose</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">7 &#x03bc;g/L</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">7 &#x03bc;l</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <p>
                    <bold>Healthy sinuses media</bold>
                </p>
                <p>
                    <bold>Preparation of the base media (Same for both healthy media)</bold>
                    <list list-type="order">
                        <list-item>
                            <label>1.</label>
                            <p>In a 1 litre Duran bottle, add 250 ml distilled water, 20 ml 20% glucose and 2 ml 1 M MgSO
                                <sub>4</sub>.</p>
                        </list-item>
                    </list>
                </p>
                <p>
                    <bold>Preparation of healthy sinuses media</bold>
                    <list list-type="order">
                        <list-item>
                            <label>1.</label>
                            <p>Add 1 g eDNA in 500 ml water under continuous stirring with a magnetic stirrer at room temperature. Add the eDNA very slowly as it can form clumps in the water.</p>
                        </list-item>
                        <list-item>
                            <label>2.</label>
                            <p>Add 1.4 g mucin from porcine stomach (Type II) in 140 ml water under continuous stirring with a magnetic stirrer at room temperature. Add mucin powder slowly to water to prevent the formation of clumps. eDNA and mucin can be stirred overnight at 4 &#x00b0;C to fully dissolve the powder.</p>
                        </list-item>
                        <list-item>
                            <label>3.</label>
                            <p>Prepare stocks of lysozyme, lactoferrin, spermidine, spermine, putrescine, CaCl
                                <sub>2</sub>, MgCl
                                <sub>2</sub>, FeCl
                                <sub>2</sub>, CuCl
                                <sub>2</sub>, ZnCl
                                <sub>2</sub>, sialic acid and galactose in the concentrations given in 
                                <xref ref-type="table" rid="T10">Table 9</xref> for healthy sinuses by dissolving each powder in deionised water.</p>
                        </list-item>
                        <list-item>
                            <label>4.</label>
                            <p>Under constant stirring with magnetic stirrer, from the stocks prepared, add the amounts of each chemical to the base media as given in 
                                <xref ref-type="table" rid="T11">Table 10</xref>.</p>
                        </list-item>
                        <list-item>
                            <label>5.</label>
                            <p>Add 21.5 &#x03bc;l of neat spermidine solution (9.296 g/l) to the base media.</p>
                        </list-item>
                        <list-item>
                            <label>6.</label>
                            <p>Add amino acids in the same way as for preparation of the CF media, see
                                <italic toggle="yes"> </italic>
                                <xref ref-type="table" rid="T4">Table 3</xref>
                                <italic toggle="yes">.</italic>
                            </p>
                        </list-item>
                        <list-item>
                            <label>7.</label>
                            <p>Add 500 mg albumin, 1g NaCl, 1.28 g of N-acetyl glucosamine, one at a time.</p>
                        </list-item>
                        <list-item>
                            <label>8.</label>
                            <p>Sterilise the media in the same way as for CF sinuses media (see above protocol)</p>
                        </list-item>
                        <list-item>
                            <label>9.</label>
                            <p>Under sterile conditions, add 480 ml of autoclaved eDNA and 120 ml of autoclaved mucin to the mixture.</p>
                        </list-item>
                        <list-item>
                            <label>10.</label>
                            <p>Adjust pH to 6.8-6.9 with 5 M NaOH and bring the volume to 1 litre with sterile water.</p>
                        </list-item>
                        <list-item>
                            <label>11.</label>
                            <p>Filtered media should be stored at 4 &#x00b0;C for further use. Using fresh media is recommended, however it can be kept under these conditions for a maximum of three weeks. For freshness, the media can be aliquoted and stored at -80 &#x00b0;C (suitable for longer term use).</p>
                        </list-item>
                    </list>
                </p>
                <table-wrap id="T10" orientation="portrait" position="float">
                    <label>Table 9. </label>
                    <caption>
                        <title>Preparation of chemical stocks for healthy sinuses media.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="4" rowspan="1" valign="top">Chemical stock preparation for healthy sinuses media</th>
                            </tr>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Chemical</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Stock concentration (mg/ml)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Amount of powder to weigh to form the stock solution (mg)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Volume of water to dissolve the powder in (ml)</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Lysozyme</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">8</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">8</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Lactoferrin</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Spermine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Putrescine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">200</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">200</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CaCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">250</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">250</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">MgCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">100</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">100</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">FeCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">5.95</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">5.95</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CuCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">ZnCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2.6</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2.6</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Sialic acid</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Galactose</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Succinate</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">80</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">320</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">4</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <table-wrap id="T11" orientation="portrait" position="float">
                    <label>Table 10. </label>
                    <caption>
                        <title>Volumes of each chemical to add into the base media for 1 litre HSLM.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="4" rowspan="1" valign="top">Healthy sinuses media</th>
                            </tr>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Chemical</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Stock concentration (mg/ml)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Concentration desired in the media</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Amount to add from the stock</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Lysozyme</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">8 &#x03bc;g/ml</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">8 ml</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Lactoferrin</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.5 &#x03bc;g/ml</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">500 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Spermine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">32.5 &#x03bc;g/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">32.5 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Putrescine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">200</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">616 &#x03bc;g/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CaCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">250</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">45 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">180 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">MgCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">100</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">8 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">80 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">FeCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">887 &#x03bc;g/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">887 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CuCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">106 &#x03bc;g/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">106 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">ZnCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2.6</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">390 &#x03bc;g/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">150 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Sialic acid</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3.23 &#x03bc;g/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3.23 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Galactose</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6.27 &#x03bc;g/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6.27 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Succinate</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">80</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.295 mg/ml</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3.6 ml</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <p>
                    <bold>Healthy lungs media</bold>
                </p>
                <p>
                    <bold>Preparation of healthy lungs media</bold>
                    <list list-type="order">
                        <list-item>
                            <label>1.</label>
                            <p>Follow steps 1-3 of HSM protocol for eDNA and mucin stock solution preparation.</p>
                        </list-item>
                        <list-item>
                            <label>2.</label>
                            <p>Prepare stocks of lysozyme, lactoferrin, spermidine, spermine, putrescine, CaCl
                                <sub>2</sub>, MgCl
                                <sub>2</sub>, FeCl
                                <sub>2</sub>, CuCl
                                <sub>2</sub>, ZnCl
                                <sub>2</sub>, sialic acid and galactose in the concentrations given in 
                                <xref ref-type="table" rid="T12">Table 11</xref> for healthy lungs by dissolving each powder in deionised water.</p>
                        </list-item>
                        <list-item>
                            <label>3.</label>
                            <p>Under constant stirring with magnetic stirrer, from the stocks prepared, add the amounts of each chemical to the base media as given in 
                                <xref ref-type="table" rid="T13">Table 12</xref>.</p>
                        </list-item>
                        <list-item>
                            <label>4.</label>
                            <p>Add 26.8 &#x03bc;l of neat spermidine solution (9.296 g/l) to the base media.</p>
                        </list-item>
                        <list-item>
                            <label>5.</label>
                            <p>Add amino acids in the same way of preparation of the CF media, see 
                                <xref ref-type="table" rid="T4">Table 3</xref> for concentrations.</p>
                        </list-item>
                        <list-item>
                            <label>6.</label>
                            <p>Add 1.5 g albumin, 1 g NaCl, 1.28 g of N-acetyl glucosamine, one at a time.</p>
                        </list-item>
                        <list-item>
                            <label>7.</label>
                            <p>Sterilise the media in the same way to CF sinuses media (see protocol for CF sinuses)</p>
                        </list-item>
                        <list-item>
                            <label>8.</label>
                            <p>Under sterile conditions, add 480 ml of autoclaved eDNA and 120 ml of autoclaved mucin to the mixture.</p>
                        </list-item>
                        <list-item>
                            <label>9.</label>
                            <p>Adjust pH to 6.8-6.9 with 5 M NaOH and bring the volume to 1 litre with sterile water.</p>
                        </list-item>
                        <list-item>
                            <label>10.</label>
                            <p>Filtered media should be stored at 4 &#x00b0;C for further use. Using fresh media is recommended, however it can be kept under these conditions for a maximum of three weeks. For freshness, the media can be aliquoted and stored at -80 &#x00b0;C (suitable for longer term use).</p>
                        </list-item>
                    </list>
                </p>
                <table-wrap id="T12" orientation="portrait" position="float">
                    <label>Table 11. </label>
                    <caption>
                        <title>Preparation of chemical stocks for healthy lungs media.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="4" rowspan="1" valign="top">Chemical stock preparation for healthy lungs media</th>
                            </tr>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Chemical</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Stock concentration (mg/ml)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Amount of powder to weigh to form the stock solution (mg)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Volume of water to dissolve the powder in (ml)</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Lysozyme</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">8</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">8</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Lactoferrin</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Spermine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Putrescine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">200</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">200</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CaCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">250</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">250</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">MgCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">100</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">100</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">FeCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">5.95</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">5.95</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CuCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">ZnCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2.6</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2.6</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Sialic acid</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Galactose</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Succinate</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">80</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">320</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">4</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <table-wrap id="T13" orientation="portrait" position="float">
                    <label>Table 12. </label>
                    <caption>
                        <title>Volumes of each chemical to add into the base media for 1liter HLM.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="4" rowspan="1" valign="top">Healthy lungs media</th>
                            </tr>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Chemical</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Stock concentration (mg/ml)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Concentration desired in the media</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Amount to add from the stock</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Lysozyme</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">8 &#x03bc;g/ml</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">8 ml</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Lactoferrin</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.5 &#x03bc;g/ml</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">500 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Spermine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">44.5 &#x03bc;g/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">44.5 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Putrescine</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">200</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">616 &#x03bc;g/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CaCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">250</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">45 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">180 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">MgCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">100</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">8 mg/l</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">80 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">FeCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">887 &#x03bc;g/L</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">887 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CuCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">106 &#x03bc;g/L</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">106 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">ZnCl
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2.6</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">390 &#x03bc;g/L</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">150 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Sialic acid</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3.23 &#x03bc;g/L</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3.23 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Galactose</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6.27 &#x03bc;g/L</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6.27 &#x03bc;l</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Succinate</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">80</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.295 mg/ml</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3.6 ml</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <p>
                    <bold>Incubation conditions for the media</bold>
                </p>
                <p>Incubation conditions differ between lung- and sinus media. The incubation conditions for each media are given in 
                    <xref ref-type="table" rid="T14">Table 13</xref>. Conditions of 5% CO
                    <sub>2</sub> can be achieved by incubating the media in GasPak Jars with candles, using Campygen packs or microaerobic incubators</p>
                <table-wrap id="T14" orientation="portrait" position="float">
                    <label>Table 13. </label>
                    <caption>
                        <title>Incubation conditions for each developed media.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top"/>
                                <th align="left" colspan="1" rowspan="1" valign="top">Health sinuses</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Healthy lungs</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">CF sinuses</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">CF lungs</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Temperature</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">34 &#x00b0;C</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">37 &#x00b0;C</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">34 &#x00b0;C</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">37 &#x00b0;C</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">pH</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6.8</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6.8</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6.8</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6.8</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CO
                                    <sub>2</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Trace</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">~5%</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Trace</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">~5%</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <p>
                    <bold>Notes on handling of media components and media preparation</bold>
                    <list list-type="bullet">
                        <list-item>
                            <label>&#x2022;</label>
                            <p>Break bovine serum albumin into smaller pieces before adding to media, as it can take time to fully dissolve.</p>
                        </list-item>
                        <list-item>
                            <label>&#x2022;</label>
                            <p>Add eDNA and mucin to minimise clumping. Make sure that each addition is dissolved before adding more.</p>
                        </list-item>
                        <list-item>
                            <label>&#x2022;</label>
                            <p>Succinic acid may not fully dissolve in water immediately. Leave it at 37 &#x00b0;C for 30 minutes if needed.</p>
                        </list-item>
                        <list-item>
                            <label>&#x2022;</label>
                            <p>Polyamines should be handled in a fume hood due to toxicity at high concentrations. Read supplier instructions carefully.</p>
                        </list-item>
                        <list-item>
                            <label>&#x2022;</label>
                            <p>If a sterile pH probe cannot be used, we recommend aliquoting a small volume of media (2 ml) before each measurement, to maintain media sterility. Discard the aliquoted media after taking a measurement.</p>
                        </list-item>
                        <list-item>
                            <label>&#x2022;</label>
                            <p>As CF media is rich in chemicals, it is advised to use more than one filter unit, to prevent saturation.</p>
                        </list-item>
                    </list>
                </p>
            </sec>
        </sec>
        <sec id="sec16" sec-type="results">
            <title>Results</title>
            <sec id="sec17">
                <title>Media development</title>
                <p>
                    <bold>Testing the effect of individual chemicals on bacterial growth</bold>
                </p>
                <p>For each chemical under consideration for inclusion in respiratory-mimicking media, the effect on 
                    <italic toggle="yes">P. aeruginosa</italic> growth was determined at three different concentrations. Experiments were performed over 20 hours of growth for PAO1 and LESB65, using M9 media as a base to support minimal bacterial growth (Underlying data Figures 1-4). PAO1 was chosen as a non-CF laboratory reference strain, to act as a comparator to the CF-adapted strain LESB65. Chosen concentrations of all chemicals were higher in CF conditions vs health conditions. Most chemicals were included in both health and CF conditions, with the exception of bile salts and glucose, which were only tested in CF conditions. Airway glucose is significantly elevated in CF related diabetes and bile in the lower airways is associated with CF, as a co-morbidity of gastroesophageal reflux disease.
                    <sup>
                        <xref ref-type="bibr" rid="ref28">28</xref>
                    </sup>
                    <sup>,</sup>
                    <sup>
                        <xref ref-type="bibr" rid="ref40">40</xref>
                    </sup>
                </p>
                <p>Results from these experiments showed that, when used individually, most of the tested chemicals enhanced growth of both PAO1 and LESB65 (Underlying data Figures 1-4). The highest concentrations of bile salts, succinate and extracellular DNA (eDNA) used in CF conditions were toxic to bacteria (Underlying data Figures 1-4 (CF lung and CF sinus graphs)). The antimicrobial activity of lysozyme and lactoferrin was also observed to be both niche and concentration dependent, potentially due to decreased antimicrobial activity in lower temperatures, charge interference at high concentrations or induction of bacterial defence mechanism.</p>
            </sec>
            <sec id="sec18">
                <title>Validation of pooled media use for phenotypic assays</title>
                <p>
                    <bold>PAO1 and LESB65 can be maintained in respiratory-mimicking media for at least three days</bold>
                </p>
                <p>Next, the chosen concentration of each chemical was used to prepare pooled media. Growth of PAO1 and LESB65 was determined in the respiratory media, by CFU determination over 72 hours (
                    <xref ref-type="fig" rid="f1">Figure 1</xref>). Data from these experiments show that viable PAO1 and LESB65 populations were maintained in all media for at least three days, with mid exponential growth of bacteria occurring at ~1&#x00d7;10
                    <sup>8</sup> CFU/ml (
                    <xref ref-type="fig" rid="f1">Figure 1</xref>), similar to the findings of Palmer 
                    <italic toggle="yes">et al.</italic> for growth of 
                    <italic toggle="yes">P. aeruginosa</italic> in CF sputum.
                    <sup>
                        <xref ref-type="bibr" rid="ref21">21</xref>
                    </sup> PAO1 was able to grow to a higher density in CF sinus and lung media than in either of the equivalent conditions in health. In addition, PAO1 grew faster than LESB65 in all media and reached early stationary phase after 12-14 hours of growth, whilst LESB65 reached stationary phase only after 24 hours of growth in each media. Although LESB65 reached a similar density in all four media, CFU began to decrease in healthy sinus and lung media after 34 hours.</p>
                <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                    <label>Figure 1. </label>
                    <caption>
                        <title>Continuous growth of PAO1 and LESB65 in respiratory media for 72 hrs.</title>
                        <p>Media were generated using M9 supplemented with the ideal concentrations of all the chemicals shown in tables in media preparation protocol section. These concentrations differed between sinuses and lung and between health and CF, generating four different media: Healthy sinus media (HSM), CF sinus media (CFSM), healthy lung media (HLM) and CF lung media (CFLM). CFU counts are made by taking a sample from bacterial culture grown in each developed media, every 2 hours, for 72 hours. Data shows mean of 3 biological replicates per time point, error bars show standard deviation.</p>
                    </caption>
                    <graphic id="gr1" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/137340/f54ffa63-aac0-49b7-9745-18ccf4e63ad2_figure1.gif"/>
                </fig>
            </sec>
            <sec id="sec19">
                <title>Surface attached biofilm formation is niche and strain specific in sinus and lung media</title>
                <p>Both attached and free-floating biofilm structures are thought to contribute to success of 
                    <italic toggle="yes">P. aeruginosa</italic> in the CF airways. Mature biofilms are commonly observed as free floating structures in mucus, whereas surface attached biofilms are suggested to dominate the early stages of infection, as physical contact of bacteria and epithelium is necessary as an initial survival strategy.
                    <sup>
                        <xref ref-type="bibr" rid="ref41">41</xref>
                    </sup>
                    <sup>,</sup>
                    <sup>
                        <xref ref-type="bibr" rid="ref42">42</xref>
                    </sup> Crystal violet (CV) staining assays showed that there are niche, disease state and strain specific influences on biofilm formation (
                    <xref ref-type="fig" rid="f2">Figure 2</xref>). PAO1 formed attached biofilms more readily than LESB65 in all airway niches and conditions. This may be due to the differences in growth rate of PAO1 and LESB65. In particular, PAO1 was able to form significantly more attached biofilm in sinus media compared to lung media. No statistically significant differences in biofilm formation were observed with LESB65 between healthy airway niches, but biofilm formed more readily in CF sinus media than in CF lung media. These results further highlight the importance of studying different airway niches and conditions in isolation. The media were compared with two widely-used laboratory media (LB and M9), and attached biofilm formation was shown to form most readily in LB.</p>
                <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                    <label>Figure 2. </label>
                    <caption>
                        <title>Attached biofilm biomass of PAO1 and LESB65 in respiratory-mimicking media, LB and M9.</title>
                        <p>Bacteria were left to form biofilms for 72 hours. Unattached bacteria were removed and washed with PBS to ensure removal of all unattached bacteria. Attached bacteria stained with 0.25% CV and absorbances were measured by using 95-100% ethanol as blank control at OD600. Statistical analysis is made using Graph pad Prism 8.0. Statistical analysis: One-way ANOVA *p&lt;0.05, **p&lt;0.01, ***p&lt;0.001, ****p&lt;0.0001. Each bar graph represents 3 biological replicates (mean), each with 30 technical replicates, n:90, error bars show standard deviation).</p>
                    </caption>
                    <graphic id="gr2" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/137340/f54ffa63-aac0-49b7-9745-18ccf4e63ad2_figure2.gif"/>
                </fig>
            </sec>
            <sec id="sec20">
                <title>Developed media supports free-floating biofilm formation common in CF</title>
                <p>Free-floating biofilm formation, associated with chronic infection, was assessed in respiratory-mimicking media, LB and M9, 
                    <xref ref-type="fig" rid="f3">Figure 3</xref>. Free-floating biofilms formed more readily in LB and M9 than in any of the four respiratory media, for both isolates, suggesting that the respiratory media alter bacterial growth and biofilm formation, compared to standard laboratory media. Biofilms grew well in CF sinus and lung media, and in healthy lung media, but only minimal biofilm was observed in healthy sinus media. PAO1 outperformed LESB65 in the attached biofilm formation assays but not in the free-floating biofilm formation assays. As an airway adapted strain from chronic infection, LESB65 may be more adept at forming free-floating biofilms.</p>
                <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                    <label>Figure 3. </label>
                    <caption>
                        <title>Free-floating biofilm formation in respiratory-mimicking media in comparison to two common laboratory media.</title>
                        <p>Bacteria were left to form biofilms for 72 hours and biofilms were disrupted with cellulase. Cultures were incubated with resazurin dye for 2 hrs. Released fluorescence was measured at 540 nm excitation &#x03bb; and 590 nm emission &#x03bb;. Background fluorescence of each media is corrected by subtraction of the background fluorescence obtained from the wells with media only. Statistical analysis is made using Graph pad Prism 8.0. Statistical analysis: One-way ANOVA *p&lt;0.05, **p&lt;0.01, ***p&lt;0.001, ****p&lt;0.0001. Each bar graph represents 3 biological replicates (mean), each with 30 technical replicates, n:90, error bars show standard deviation).</p>
                    </caption>
                    <graphic id="gr3" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/137340/f54ffa63-aac0-49b7-9745-18ccf4e63ad2_figure3.gif"/>
                </fig>
            </sec>
            <sec id="sec21">
                <title>CF media becomes viscous during infection, reflecting properties of CF sputum</title>
                <p>Viscosity measurements were taken in the four developed media, pre and post biofilm formation (
                    <xref ref-type="fig" rid="f4">Figure 4</xref>). Sterile HSM and HLM media were shown to have Newtonian liquid characteristics with very similar viscosity measurements to water (~1.0 mPa&#x00b7;s viscosity for water, 1.02 mPa&#x00b7;s for HSM and 1.03 mPa&#x00b7;s for HLM) (
                    <xref ref-type="fig" rid="f4">Figure 4A</xref>). Viscosity changed only minimally in healthy media after bacterial growth (1.06 mPa&#x00b7;s for HSM and 1.05 mPa&#x00b7;s for HLM) (
                    <xref ref-type="fig" rid="f4">Figure 4A</xref>). Both CF media were also determined to be Newtonian fluids pre-biofilm formation but had higher viscosity measurements compared to healthy media (1.37 mPa&#x00b7;s for CFSM and 1.27 mPa&#x00b7;s for CFLM) (
                    <xref ref-type="fig" rid="f4">Figure 4A</xref>). When the biofilm was established in CF media, both media became more viscous, as compared to both their sterile controls and compared to post-biofilm formation healthy media. Infected CF media showed clear non-Newtonian fluid characteristics, with shear thinning properties (viscosity decreases as the shear rate increases) (
                    <xref ref-type="fig" rid="f4">Figure 4B</xref>). Viscosity of CFSM media was approximately 16 mPa&#x00b7;s during infection at low shear rate ranges and decreased down to 1.57 mPa&#x00b7;s at the highest shear rate (1000 1/s). CFLM media was the most viscous media during infection, with approximately 2400 mPa&#x00b7;s viscosity at low shear rates, decreasing down to 1.8 mPa&#x00b7;s at 1000 1/s shear rate. These results are in agreement with previous literature, where the viscosity of CF sputum was shown to be higher than healthy controls.
                    <sup>
                        <xref ref-type="bibr" rid="ref43">43</xref>
                    </sup>
                </p>
                <fig fig-type="figure" id="f4" orientation="portrait" position="float">
                    <label>Figure 4. </label>
                    <caption>
                        <title>Viscosity of media before and after bacterial growth.</title>
                        <p>Viscosity of all media before infection and healthy media during infection (A) was measured under shear rate range of 50-100 1/s whereas viscosity of CFSM and CFLM media was measured at 0.01-1000 1/s shear rate range as the viscosity properties of CF media during infection was higher (B). Averages were taken for media with Newtonian fluid characteristics (All media before infection and HSM and HLM media during infection). Data points with open triangle in CFSM during infection displayed high level of uncertainty due to non-Newtonian responses and therefore values below 0.1 (1/s) should be treated with caution. Graphs are showing single viscosity measurement per media under each condition.</p>
                    </caption>
                    <graphic id="gr4" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/137340/f54ffa63-aac0-49b7-9745-18ccf4e63ad2_figure4.gif"/>
                </fig>
            </sec>
            <sec id="sec22">
                <title>Airway mimicking media is stable for at least 30 days at 4&#x00b0;C.</title>
                <p>Biofilm formation of PAO1 was measured over a month in the developed media stored at 4&#x00b0;C to test the stability of the airway mimicking media. Over a 30-day period, there was no significant change in the amount of biofilm formed by PAO1 in any of the four airway mimicking media (
                    <xref ref-type="fig" rid="f5">Figure 5</xref>).</p>
                <fig fig-type="figure" id="f5" orientation="portrait" position="float">
                    <label>Figure 5. </label>
                    <caption>
                        <title>Stability of developed media over 30 days. Media stability was measured by testing biofilm formation of PAO1 in each developed media using CV stain assays.</title>
                        <p>Each timepoint is one biological replicate representing the average of three technical replicates. No statistical significance was found between any of the fresh media vs the later treatments (One-way ANOVA *p&lt;0.05, **p&lt;0.01, ***p&lt;0.001, ****p&lt;0.0001).</p>
                    </caption>
                    <graphic id="gr5" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/137340/f54ffa63-aac0-49b7-9745-18ccf4e63ad2_figure5.gif"/>
                </fig>
            </sec>
            <sec id="sec23">
                <title>Expression of infection-relevant genes in respiratory-mimicking media</title>
                <p>Four 
                    <italic toggle="yes">P. aeruginosa</italic> genes were selected, to determine whether growth in respiratory-mimicking media induced CF infection-relevant gene expression. The major virulence regulator, extracytoplasmic sigma factor 
                    <italic toggle="yes">algU</italic>, and 
                    <italic toggle="yes">mexB</italic> (part of a tripartite multidrug efflux system) genes were selected as they are virulence genes of 
                    <italic toggle="yes">P. aeruginosa</italic> known to contribute to chronic infection.
                    <sup>
                        <xref ref-type="bibr" rid="ref44">44</xref>
                    </sup>
                    <sup>,</sup>
                    <sup>
                        <xref ref-type="bibr" rid="ref45">45</xref>
                    </sup> PA2911 and PA2382 genes were also selected, as expression of these genes in clinical isolates in CF sputum is observed but expression has not previously been captured in 
                    <italic toggle="yes">in vitro</italic> CF models.
                    <sup>
                        <xref ref-type="bibr" rid="ref46">46</xref>
                    </sup> 
                    <italic toggle="yes">algU</italic> is responsible for alginate overproduction, causing mucoidy and contributing to chronic infection in PwCF.
                    <sup>
                        <xref ref-type="bibr" rid="ref44">44</xref>
                    </sup> MexB is responsible for exporting biological metabolites and antimicrobial compounds, playing a crucial role in antimicrobial resistance in the airways.
                    <sup>
                        <xref ref-type="bibr" rid="ref45">45</xref>
                    </sup> PA2911 is predicted to be a Ton-B dependent receptor located in the outer membrane and responsible for sideophore transport.
                    <sup>
                        <xref ref-type="bibr" rid="ref47">47</xref>
                    </sup> PA2382 (
                    <italic toggle="yes">lldA</italic>) is a L-lactate dehydrogenase, important for pyruvate metabolism.
                    <sup>
                        <xref ref-type="bibr" rid="ref48">48</xref>
                    </sup> Results from qPCR studies showed that expression of all four genes were increased in all the airway-mimicking media when compared to expression in LB. Expression of the four genes was also determined in 
                    <italic toggle="yes">P. aeruginosa</italic> (PAO1 and LESB65) grown in SCFM2. Expression of 
                    <italic toggle="yes">algU</italic> and 
                    <italic toggle="yes">mexB</italic> was comparable in airway media and SCFM2, but expression of PA2911 and PA2382 was higher in respiratory-mimicking media than in SCFM2, although did not reach statistical significance, 
                    <xref ref-type="fig" rid="f6">Figure 6</xref>.</p>
                <fig fig-type="figure" id="f6" orientation="portrait" position="float">
                    <label>Figure 6. </label>
                    <caption>
                        <title>Expression of infection-relevant genes in respiratory media LB and SCFM2. Each point represents one biological replicate.</title>
                        <p>Each biological replicate includes the mean of two technical replicates. RNA from bacteria grown in each media was extracted and used to synthesise cDNA. qPCR was performed using the cDNA by primers specific to A and E: algU, B and F: mexB, C and G: PA2911 and D: PA2382 (for which no expression was observed in LESB65 under any conditions). cDNA from LB was used as a negative (no treatment control). Statistical analysis: one-way ANOVA.</p>
                    </caption>
                    <graphic id="gr6" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/137340/f54ffa63-aac0-49b7-9745-18ccf4e63ad2_figure6.gif"/>
                </fig>
            </sec>
            <sec id="sec24">
                <title>Long term culture of PAO1 in respiratory-mimicking media</title>
                <p>
                    <bold>PAO1 growing in respiratory-mimicking media show changes in colony morphology</bold>
                </p>
                <p>PAO1 was grown for a period of 40 days in each of the four media. Every ten days, PAO1 populations cultured under different media conditions were streaked onto TCCA plates to observe colony morphotypes (
                    <xref ref-type="fig" rid="f7">Figure 7</xref>). Only shiny, circular, concave colonies were observed in the starting populations. Wrinkly colonies began to appear in all media conditions over time. These wrinkly structures have been suggested to be the result of redox-driven adaptation that maximizes oxygen accessibility in biofilms, to increase their surface area in oxidant limitation.
                    <sup>
                        <xref ref-type="bibr" rid="ref17">17</xref>
                    </sup> Colony morphotypes in 
                    <xref ref-type="fig" rid="f7">Figure 7D</xref> and 
                    <xref ref-type="fig" rid="f7">E</xref> were visible only after transfer 10 and were unique to CF media (
                    <xref ref-type="table" rid="T15">Table 14</xref>).</p>
                <fig fig-type="figure" id="f7" orientation="portrait" position="float">
                    <label>Figure 7. </label>
                    <caption>
                        <title>Representative colony morphologies observed during PAO1 culture over forty days (
                            <xref ref-type="table" rid="T15">Table 14</xref>).</title>
                        <p>Cultures were streaked onto TCCA plates that contained Congo red and Coomassie blue to check for changes in colony morphologies. The plates were incubated at 37&#x00b0;C overnight and at room temperature for 48 hours before analysis. (B and C: wrinkly morphotypes, A: starting culture, D and E: colonies only observed in CF media.</p>
                    </caption>
                    <graphic id="gr7" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/137340/f54ffa63-aac0-49b7-9745-18ccf4e63ad2_figure7.gif"/>
                </fig>
                <table-wrap id="T15" orientation="portrait" position="float">
                    <label>Table 14. </label>
                    <caption>
                        <title>showing when each morphotype started to appear during long term culturing in each media per population.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Media</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Day 0</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Day 10</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Day 20</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Day 30</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Day 40</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">HSM</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">A</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">A, B, C</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">A, B, C</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">A, B, C</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">A, B, C</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">HLM</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">A</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">A, B, C</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">A, B, C</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">A, B, C</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">A, B, C</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CFSM</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">A</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">A, B, C, E</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">B, C, E, D</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">B, C, D</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">B, C, D</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CFLM</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">A</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">A, B, C</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">A, B, C, E</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">A, B, C, E</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">A, B, C, E</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
            </sec>
        </sec>
        <sec id="sec25" sec-type="discussion">
            <title>Discussion</title>
            <p>Here we describe a simple suite of liquid culture models, designed to reproduce the conditions of upper and lower airway niches in CF and health. Our media have been designed to mimic the key properties of CF and healthy airways and have been validated for studying growth, as well as attached and free-floating biofilm formation of laboratory and CF-associated strains of 
                <italic toggle="yes">P. aeruginosa.</italic> We previously showed that bacteria evolved within upper airways can acquire adaptive mutations conferring resistance to host-derived antimicrobials found in abundance in the lower airways.
                <sup>
                    <xref ref-type="bibr" rid="ref13">13</xref>
                </sup> Therefore, in this work, by inclusion of different host-derived antimicrobials in the media, we aimed to capture an important source of selective pressures acting on bacteria during airway infection. We show that bacteria can be maintained and cultured in these media long term, making them suitable for studying bacterial adaptation to airway environments using experimental evolution approaches in the laboratory. We envisage these media can help reduce the need for use of animals for the purposes of experimental evolution, investigation of host-pathogen interactions and for virulence screening.</p>
            <p>To date, different liquid culture media have been developed with the aim of capturing the conditions of CF sputum. However, these media reflect the properties of lower airway regions. The growing evidence for the importance of the upper airways in shaping bacterial within-host adaptation makes liquid culture media reflecting sinus conditions a useful addition to the CF microbiologist&#x2019;s toolkit. Having bespoke media for individual airway compartments allows airway niches to be studied in isolation, something impossible to do 
                <italic toggle="yes">in vivo.</italic> To our knowledge, there are also no liquid culture media available that have been developed to mimic the conditions of healthy airways. In addition to the CF media, healthy sinus (HSM) and healthy lung (HLM) media will allow the research community to study other aspects of respiratory microbiology, such as bacterial sinusitis, or pneumonia.</p>
            <p>In respiratory microbiology a common experimental approach is to screen panels of bacterial isolates in mouse models to determine virulence.
                <sup>
                    <xref ref-type="bibr" rid="ref49">49</xref>
                </sup>
                <sup>&#x2013;</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref51">51</xref>
                </sup> In one example study, researchers competed different pneumococcal serotypes in a mouse model of pneumococcal nasopharyngeal carriage.
                <sup>
                    <xref ref-type="bibr" rid="ref52">52</xref>
                </sup> The study used &gt;200 mice, but many experiments could have been performed in sinus mimicking media, had it been available, with only the neutrophil-depletion studies necessitating animal usage. Thus, sinus mimicking media could have enabled 60-75% reduction in usage in the study. Carriage protocols are mild-severity, but similar studies to compare virulence in moderate or severe pneumonia models
                <sup>
                    <xref ref-type="bibr" rid="ref49">49</xref>
                </sup> could utilise lung mimicking media.</p>
            <p>The culture media could be used to examine how bacterial communities develop in the face of host pressures, enabling study of biofilm formation in relevant environments. They offer a platform for assessment of bacterial gene expression in response to stress and to assess efficacy of drugs and therapeutics in a system more relevant than pathogen growth in broth, but more cost effective, less labour-intensive and ethical than animal models. The media can also be used as a pre-screening tool, to identify the most phenotypically interesting isolates to take forward into studies in more complex 
                <italic toggle="yes">in vitro</italic> or 
                <italic toggle="yes">in vivo</italic> systems, potentially leading to a significant reduction in the number of animals used to study bacterial pathogenicity in the host environment.</p>
            <p>The developed media were designed to be cost effective for the purposes of long-term experiments (
                <xref ref-type="table" rid="T16">Table 15</xref>)
                <bold>.</bold> The media should also prove readily accessible, as they can be prepared with standard laboratory equipment and without the need for any specialist training. The media can be easily modified to answer different research questions, for example by addition or removal of a metabolite or antimicrobial of interest. The media were also found to remain stable for 4 weeks at 4&#x00b0;C, although we recommend storing in -80&#x00b0;C for continued long term use.</p>
            <table-wrap id="T16" orientation="portrait" position="float">
                <label>Table 15. </label>
                <caption>
                    <title>Costing of each media (per litre).</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="left" colspan="1" rowspan="1" valign="top">Media</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Price per L</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Healthy sinuses</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">&#x00a3;57.5</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Healthy lungs</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">&#x00a3;61.5</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">CF sinuses</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">&#x00a3;214</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">CF lungs</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">&#x00a3;216</td>
                        </tr>
                    </tbody>
                </table>
            </table-wrap>
            <p>At concentrations associated with conditions of the healthy sinuses (Underlying data Figures 1 and 2), PAO1 showed increased growth in the presence of only two of the chemicals (eDNA and FeCl2), relative to the M9-only control. By contrast, at concentrations associated with CF sinuses (Underlying data Figures 1 and 2), significant increases in growth were observed for six of the chemicals (lactoferrin, mucin, eDNA, albumin, amino acids and FeCl2), relative to the M9-only control. Chemicals that induced higher growth rates at one or more of the concentrations tested for healthy and CF sinuses were albumin, eDNA, amino acids, iron, magnesium, copper, zinc and N-acetyl glucosamine (GlcNac). Many of these factors are well known to promote bacterial survival and may act as nutrient sources in these niches.
                <sup>
                    <xref ref-type="bibr" rid="ref21">21</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref53">53</xref>
                </sup>
                <sup>&#x2013;</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref55">55</xref>
                </sup> Iron and zinc are essential metals for bacteria.
                <sup>
                    <xref ref-type="bibr" rid="ref56">56</xref>
                </sup> Bacteria must actively acquire them through high affinity transport mechanisms.
                <sup>
                    <xref ref-type="bibr" rid="ref56">56</xref>
                </sup> In addition to these potential nutrient sources, the host derived antimicrobials lysozyme and lactoferrin were able to partially inhibit the growth of PAO1 at concentrations associated with health, however they did not cause significant growth inhibition at the higher concentrations of CF sinuses.</p>
            <p>Similar to PAO1, increased growth of LESB65 was observed at CF-relevant concentrations for the majority of the chemicals. Growth was higher than the M9 control for at least one tested concentration of albumin, amino acids, mucin, spermine, zinc, lysozyme and lactoferrin. Relative to PAO1, the airway adapted isolate LESB65 appeared better able to grow in the face of high concentrations of host-derived antimicrobials and airway-abundant chemicals such as polyamines.</p>
            <p>One of the key differences between CFSM and CFLM conditions was that the host-derived antimicrobial lactoferrin decreased the growth of PAO1 in CFLM while it increased the growth at all tested concentration in CFSM, where it may be acting as a nutrient source, as it is heavily glycosylated.
                <sup>
                    <xref ref-type="bibr" rid="ref57">57</xref>
                </sup> The enzymatic activity of lactoferrin will not function optimally at 34&#x00b0;C in sinuses media (SLM), nullifying its growth inhibiting activity.</p>
            <p>Lysozyme had no significant positive or negative effect on growth of 
                <italic toggle="yes">P. aeruginosa</italic> in CFLM but, in CFSM, all concentrations stimulated higher rates of growth. This may be a result of lysozyme-dependent changes in bacterial phenotype. Previously, it has also been suggested that the effectiveness of lysozyme is reduced in chronically infected airways due to electrostatic sequestration of the enzyme by anionic biopolymers.
                <sup>
                    <xref ref-type="bibr" rid="ref58">58</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref59">59</xref>
                </sup> Over production of inhibitor of vertebrate lysozyme (ivy) protein may also explain success in lysozyme-rich environments, as 
                <italic toggle="yes">ivy</italic> knockout mutants show growth defects in the presence of lysozyme.
                <sup>
                    <xref ref-type="bibr" rid="ref60">60</xref>
                </sup> eDNA elevated bacterial growth in CFLM while it showed a growth inhibiting effect in HLM, where the concentrations tested were lower, further highlighting the positive effect of the chemically rich CF airways on bacterial survival.</p>
            <p>Growth curves of PAO1 and LESB65 in airway media suggest a doubling time for PAO1 in CF media of 74 minutes (in both CFSM and CFLM), similar to the findings of 
                <italic toggle="yes">Yang et al.</italic> for PAO1 in CF sputum (66 minutes).
                <sup>
                    <xref ref-type="bibr" rid="ref18">18</xref>
                </sup> The doubling time of PAO1 was ~85 minutes in healthy sinus and lung media. Doubling time of LESB65 was ~105 min in CFSM and ~92 minutes in CFL and ~86 minutes in both healthy media. This finding can be supported by the findings of 
                <italic toggle="yes">Yang et al.</italic> who found two to threefold slower generation times in isolates from PwCF patients, compared to a laboratory strain. This observed reduced growth was also seen in other CF isolates, compared to non-CF isolates.
                <sup>
                    <xref ref-type="bibr" rid="ref18">18</xref>
                </sup> One possible explanation for this could be that the slow-growing phenotype develops as result of the stressful conditions associated with continuous exposure to host-derived antimicrobials and other molecules of the immune system. PwCF also undergo intensive antibiotic treatment, which acts as a further stress signal. Chromosomal mutations associated with antibiotic tolerance often also have growth rate-reducing effects.
                <sup>
                    <xref ref-type="bibr" rid="ref61">61</xref>
                </sup>
            </p>
            <p>Results from phenotypic assays show that airway media induce responses 
                <italic toggle="yes">in P. aeruginosa</italic> that differ considerably from common laboratory and currently available liquid culture media (such as SCFM2), as evidenced by differences in attached and free-floating biofilm formation and expression of infection-relevant genes, including those that are highly expressed in CF sputum but poorly expressed in available liquid culture models. SCFM was developed to mimic the nutritional components of CF sputum and contains amino acids, ions, glucose and lactate
                <sup>
                    <xref ref-type="bibr" rid="ref21">21</xref>
                </sup> whereas HSM, HLM, CFSM and CFLM have been developed with the aim of not only capturing nutritional components but also the host derived antimicrobial content of different airway niches as well as stimulators of bacterial signalling systems, such as polyamines and bile salts.</p>
            <p>An obvious limitation of these 
                <italic toggle="yes">in vitro</italic> mimics is that they fail to capture the host cellular characteristics of different airway niches. The presence of immune cells significantly affects the pathophysiology of CF as a result of both the inflammatory processes and the direct effects of immune cells on bacteria.
                <sup>
                    <xref ref-type="bibr" rid="ref62">62</xref>
                </sup> Experiments combining the developed media with cell lines or primary cells (e.g., macrophages, epithelial cells) could provide additional information about host-pathogen interactions within the airways.</p>
        </sec>
        <sec id="sec26" sec-type="conclusion">
            <title>Conclusion</title>
            <p>In summary, we present here a collection of culture media replicating different airway niches in health and CF. Importantly, our study showed that these media can be used to study different phenotypic characteristics of bacteria or study of host-pathogen interactions. We show that the media can be used to study 
                <italic toggle="yes">P. aeruginosa</italic>, a well-known CF pathogen, in health and disease by recapitulating different areas of the respiratory tract. With these compartmentalised airway-mimicking media, we aim to answer questions relating to how each airway niche affects bacterial behaviour and adaptation in CF and non-CF conditions, without the need for invasive whole animal studies for preliminary studies. We hope these media will become a resource for clinical microbiologists, respiratory clinicians, evolutionary biologists, pharmacologists and immunologists, as a tool to understand bacterial physiology, evolution, virulence and resistance to novel therapeutics, and as a means of reducing or replacing animal use.</p>
            <table-wrap id="T17" orientation="portrait" position="float">
                <label>Table 16. </label>
                <caption>
                    <title>Materials and Equipment used in the study and supplier information.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="left" colspan="1" rowspan="1" valign="top">Reagent</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Supplier</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Lactoferrin Human</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (L4040)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Lysozyme Human</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (L1667)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">N-acetyl-glucosamine</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (A8625)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Deoxyribonucleic acid from fish sperm</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (74782)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Mucin from porcine stomach (Type II)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (M2378)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Bovine Serum Albumin</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (A2153)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">N-acetyl-neuraminic acid</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (A0812)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Spermine</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (S3256)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Spermidine</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (S2626)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Putrescine</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (51799)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">CaCl
                                <sub>2</sub>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (C5670)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">MgCl
                                <sub>2</sub>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (M8266)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">CuCl
                                <sub>2</sub>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (203149)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">FeCl
                                <sub>2</sub>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (372870)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">ZnCl
                                <sub>2</sub>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (229997)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Bile Salts</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (B3426)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Succinate</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (S9512)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Glucose</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (G7021)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">NaCl</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (S9625)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Galactose</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (G0750)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">MgSO
                                <sub>4</sub>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (M7506)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">NaOH</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (S5881)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">L-Methionine</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (M9625)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">L-Phenylalanine</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Across Organics (130310250)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">L-Proline</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (P0380)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">L-Serine</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Across Organics (132660250)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">L-Threonine</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Across Organics (138930250)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">L(-)-Tryptophan</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Across Organics (140590250)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">L-Valine</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (V0500)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">L-Ornithine</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (O2375)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">L-Tyrosine</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Across Organics (140641000)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">L(+)-Asparagine monohydrate</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Across Organics (175271000)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">L-Alanine</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Across Organics (102830250)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">L-Arginine</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (A5006)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">L(+)-Aspartic acid</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Across Organics (105041000)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">L-Cysteine</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (168149)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">L-Glutamine</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (G3126)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">L-Glycine</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Across Organics (220911000)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">L-Histidine</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (H8000)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">L-Isoleucine</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (I2752)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">L-Leucine</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (L8000)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">L -Lysine</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (L5501)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">ME 2 diaphragm vacuum pump</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Vacuubrand (696126)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Steritop filters (Pore size: 0.22 &#x03bc;m, Neck size: 45 mm)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">EMD Millipore (SCGPT10RE)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">U-bottomed 96-well microtiter plate</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Greiner 650161</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">pH meter</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">HANNA instruments (HI-2550-02)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Petri dishes</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Greiner (632180)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Parafilm</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Starlab (I3080-1075)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">LB broth</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Neogen (NCM0088A)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">LB agar</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Neogen (NCM0142A)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Phosphate buffer saline</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (P4417)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Muller Hinton Agar</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (70191)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Tryptone Soy agar</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (22091)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Congo red</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (C6277)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Brilliant Blue</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (27815)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Tryptone</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (T7293)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">BD Bacto&#x2122; dehydrate agar</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Fisher Scientific (10455513)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Glass universal tubes</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Fisher Scientific (14863562)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">30ml universal tubes</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Starlab (E1412-3010)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">15ml Falcon tubes</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Greiner (T1943)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">50ml Falcon tubes</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Greiner (T2318)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sputasol</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Thermo-Fisher (SR0233A)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Aspergillus cellulase</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (22178)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Resazurin</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (199303)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Crystal Violet</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma- Aldrich</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Ceftazidime disks</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Mast (CAZ30C)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Ciprofloxacin disks</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Mast (CIP5C)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Doripenem disks</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Mast (DOR10C)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Lexofloxacin disks</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Mast (LEV5C)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Meropenem disks</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Mast (MEM10C)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Cryovial beads</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Pro-lab (16368776)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Direct-zol RNA Microprep kits</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">ZYMO Research (R2061)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">TRI-reagent</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">ZYMO-Research (R2050)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Ultrapure nuclease free distilled water</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Invitrogen (11538646)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">iScript cDNA synthesis kit</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">BIO-RAD (1708891)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Fluostar omega microplate reader</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">BMG-Labtech (SPECTROstar Omega)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">96 well programmable thermocycler</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Applied Biosystem (4375786)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">GoTaq qPCR Master Mix</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Promega (A6001)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Primers</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Eurofins</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">CFX Connect Real Time PCR System.</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">BIO-RAD (1855201)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Microamp Optical 96 well Reaction Plate</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Applied Biosystem (N8010560)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Pseudomonas Selective Agar</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (22470)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Citrate.H
                                <sub>2</sub>O</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">VWR (BDH0288)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Ethanol</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (51976)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Glycerol</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (G5516)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">KH
                                <sub>2</sub>PO
                                <sub>4</sub>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Alrdrich (P0662)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Na
                                <sub>2</sub>HPO
                                <sub>4</sub>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (S9763)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">NH
                                <sub>4</sub>Cl</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich (213330)</td>
                        </tr>
                    </tbody>
                </table>
            </table-wrap>
        </sec>
        <sec id="sec27">
            <title>Data availability</title>
            <sec id="sec28">
                <title>Underlying data</title>
                <p>Figshare: Underlying data for &#x201c;Development of liquid culture media mimicking the conditions of sinuses and lungs in cystic fibrosis and health&#x201d;, 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.20463159.v6">https://doi.org/10.6084/m9.figshare.20463159.v6</ext-link>.
                    <sup>
                        <xref ref-type="bibr" rid="ref81">81</xref>
                    </sup>
                </p>
                <p>This project contains the following underlying data:
                    <list list-type="bullet">
                        <list-item>
                            <label>-</label>
                            <p>Biofilm assay OD values and fluorescent intensity.xlsx</p>
                        </list-item>
                        <list-item>
                            <label>-</label>
                            <p>F1000_qPCR_RawData.xlsx</p>
                        </list-item>
                        <list-item>
                            <label>-</label>
                            <p>Growth CFUs.xlsx</p>
                        </list-item>
                        <list-item>
                            <label>-</label>
                            <p>viscosity supplementary.xlsx</p>
                        </list-item>
                        <list-item>
                            <label>-</label>
                            <p>Colony E fig 7.png</p>
                        </list-item>
                        <list-item>
                            <label>-</label>
                            <p>colony D fig 7.png</p>
                        </list-item>
                        <list-item>
                            <label>-</label>
                            <p>colony C fig 7.png</p>
                        </list-item>
                    </list>
                </p>
                <p>Data are available under the terms of the 
                    <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution 4.0 International license</ext-link> (CC-BY 4.0).</p>
            </sec>
        </sec>
    </body>
    <back>
        <ack>
            <title>Acknowledgements</title>
            <p>We thank Prof Rob Poole and his group at the University of Liverpool for their help on media viscosity measurements and analysis.</p>
        </ack>
        <ref-list>
            <title>References</title>
            <ref id="ref1">
                <label>1</label>
                <mixed-citation publication-type="book">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sheppard</surname>
                            <given-names>MN</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Nicholson</surname>
                            <given-names>AG</given-names>
                        </name>
</person-group>:
                    <source>

                        <bold>The pathology of cystic fibrosis.</bold> 
                        <italic toggle="yes">Vol. 8, Current Diagnostic Pathology.</italic>
</source>
                    <publisher-name>Churchill Livingstone</publisher-name>;<year>2002</year>;<fpage>50</fpage>&#x2013;<lpage>59</lpage>.</mixed-citation>
            </ref>
            <ref id="ref2">
                <label>2</label>
                <mixed-citation publication-type="book">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Folkesson</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jelsbak</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yang</surname>
                            <given-names>L</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <source>

                        <bold>Adaptation of Pseudomonas aeruginosa to the cystic fibrosis airway: An evolutionary perspective</bold>. 
                        <italic toggle="yes">Vol. 10, Nature Reviews Microbiology.</italic>
</source>
                    <publisher-name>Nature Publishing Group</publisher-name>;<year>2012</year>;<fpage>841</fpage>&#x2013;<lpage>851</lpage>.</mixed-citation>
            </ref>
            <ref id="ref3">
                <label>3</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Bhagirath</surname>
                            <given-names>AY</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Somayajula</surname>
                            <given-names>D</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Cystic fibrosis lung environment and Pseudomonas aeruginosa infection.</article-title>
                    <source>

                        <italic toggle="yes">BMC Pulm. Med.</italic>
</source>
                    <year>2016 Dec 5</year>;<volume>16</volume>(<issue>1</issue>):<fpage>174</fpage>.
                    <pub-id pub-id-type="pmid">27919253</pub-id>
                    <pub-id pub-id-type="doi">10.1186/s12890-016-0339-5</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref4">
                <label>4</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Stover</surname>
                            <given-names>CK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Pham</surname>
                            <given-names>XQ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Erwin</surname>
                            <given-names>AL</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen.</article-title>
                    <source>

                        <italic toggle="yes">Nature.</italic>
</source>
                    <year>2000 Aug 31</year>;<volume>406</volume>(<issue>6799</issue>):<fpage>959</fpage>&#x2013;<lpage>964</lpage>.
                    <pub-id pub-id-type="pmid">10984043</pub-id>
                    <pub-id pub-id-type="doi">10.1038/35023079</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref5">
                <label>5</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Mathee</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Narasimhan</surname>
                            <given-names>G</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Valdes</surname>
                            <given-names>C</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Dynamics of Pseudomonas aeruginosa genome evolution.</article-title>
                    <source>

                        <italic toggle="yes">Proc. Natl. Acad. Sci. U. S. A.</italic>
</source>
                    <year>2008 Feb 26 [cited 2022 Jan 19]</year>;<volume>105</volume>(<issue>8</issue>):<fpage>3100</fpage>&#x2013;<lpage>3105</lpage>.
                    <pub-id pub-id-type="pmid">18287045</pub-id>
                    <pub-id pub-id-type="doi">10.1073/pnas.0711982105</pub-id>
                    <pub-id pub-id-type="pmcid">PMC2268591</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref6">
                <label>6</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Winsor</surname>
                            <given-names>GL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lam</surname>
                            <given-names>DKW</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Fleming</surname>
                            <given-names>L</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Pseudomonas Genome Database: improved comparative analysis and population genomics capability for Pseudomonas genomes.</article-title>
                    <source>

                        <italic toggle="yes">Nucleic Acids Res.</italic>
</source>
                    <year>2011 Jan [cited 2022 Jan 19]</year>;<volume>39</volume>(<issue>Database issue</issue>):<fpage>D596</fpage>&#x2013;<lpage>D600</lpage>.
                    <pub-id pub-id-type="pmid">20929876</pub-id>
                    <pub-id pub-id-type="doi">10.1093/nar/gkq869</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref7">
                <label>7</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Goodman</surname>
                            <given-names>AL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kulasekara</surname>
                            <given-names>B</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rietsch</surname>
                            <given-names>A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>A signaling network reciprocally regulates genes associated with acute infection and chronic persistence in Pseudomonas aeruginosa.</article-title>
                    <source>

                        <italic toggle="yes">Dev. Cell.</italic>
</source>
                    <year>2004 Nov [cited 2020 Mar 4]</year>;<volume>7</volume>(<issue>5</issue>):<fpage>745</fpage>&#x2013;<lpage>754</lpage>.
                    <pub-id pub-id-type="pmid">15525535</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.devcel.2004.08.020</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref8">
                <label>8</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Fothergill</surname>
                            <given-names>JL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Neill</surname>
                            <given-names>DR</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Loman</surname>
                            <given-names>N</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Pseudomonas aeruginosa adaptation in the nasopharyngeal reservoir leads to migration and persistence in the lungs.</article-title>
                    <source>

                        <italic toggle="yes">Nat. Commun.</italic>
</source>
                    <year>2014 Sep 2</year>;<volume>5</volume>(<issue>1</issue>):<fpage>1</fpage>&#x2013;<lpage>9</lpage>.</mixed-citation>
            </ref>
            <ref id="ref9">
                <label>9</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Johansen</surname>
                            <given-names>HK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Aanaes</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Pressler</surname>
                            <given-names>T</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Colonisation and infection of the paranasal sinuses in cystic fibrosis patients is accompanied by a reduced PMN response.</article-title>
                    <source>

                        <italic toggle="yes">J. Cyst. Fibros.</italic>
</source>
                    <year>2012 Dec [cited 2020 Mar 5]</year>;<volume>11</volume>(<issue>6</issue>):<fpage>525</fpage>&#x2013;<lpage>531</lpage>.
                    <pub-id pub-id-type="pmid">22595452</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.jcf.2012.04.011</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref10">
                <label>10</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ciofu</surname>
                            <given-names>O</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Johansen</surname>
                            <given-names>HK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Aanaes</surname>
                            <given-names>K</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>P. aeruginosa in the paranasal sinuses and transplanted lungs have similar adaptive mutations as isolates from chronically infected CF lungs.</article-title>
                    <source>

                        <italic toggle="yes">J. Cyst. Fibros.</italic>
</source>
                    <year>2013 Dec 1</year>;<volume>12</volume>(<issue>6</issue>):<fpage>729</fpage>&#x2013;<lpage>736</lpage>.
                    <pub-id pub-id-type="pmid">23478131</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.jcf.2013.02.004</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref11">
                <label>11</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Armbruster</surname>
                            <given-names>CR</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Marshall</surname>
                            <given-names>CW</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Melvin</surname>
                            <given-names>JA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Evolution and adaptation of Pseudomonas aeruginosa in the paranasal sinuses of people with cystic fibrosis.</article-title>
                    <source>

                        <italic toggle="yes">bioRxiv.</italic>
</source>
                    <year>2020 Oct 29 [cited 2022 Jun 21]</year>. 2020.10.29.359844.
                    <pub-id pub-id-type="doi">10.1101/2020.10.29.359844v1</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref12">
                <label>12</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hansen</surname>
                            <given-names>SK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rau</surname>
                            <given-names>MH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Johansen</surname>
                            <given-names>HK</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Evolution and diversification of Pseudomonas aeruginosa in the paranasal sinuses of cystic fibrosis children have implications for chronic lung infection.</article-title>
                    <source>

                        <italic toggle="yes">ISME J.</italic>
</source>
                    <year>2012 Jan [cited 2020 Mar 4]</year>;<volume>6</volume>(<issue>1</issue>):<fpage>31</fpage>&#x2013;<lpage>45</lpage>.
                    <pub-id pub-id-type="pmid">21716309</pub-id>
                    <pub-id pub-id-type="doi">10.1038/ismej.2011.83</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref13">
                <label>13</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Bricio-Moreno</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sheridan</surname>
                            <given-names>VH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Goodhead</surname>
                            <given-names>I</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Evolutionary trade-offs associated with loss of PmrB function in host-adapted Pseudomonas aeruginosa.</article-title>
                    <year>[cited 2020 Mar 4]</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://ddbj.nig.ac.jp/DRASearch/sample?acc=ERS2269679">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref14">
                <label>14</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Mahenthiralingam</surname>
                            <given-names>E</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Campbell</surname>
                            <given-names>ME</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Speert</surname>
                            <given-names>DP</given-names>
                        </name>
</person-group>:
                    <article-title>Nonmotility and phagocytic resistance of Pseudomonas aeruginosa isolates from chronically colonized patients with cystic fibrosis.</article-title>
                    <source>

                        <italic toggle="yes">Infect. Immun.</italic>
</source>
                    <year>1994</year>;<volume>62</volume>(<issue>2</issue>):<fpage>596</fpage>&#x2013;<lpage>605</lpage>.
                    <pub-id pub-id-type="pmid">8300217</pub-id>
                    <pub-id pub-id-type="doi">10.1128/iai.62.2.596-605.1994</pub-id>
                    <pub-id pub-id-type="pmcid">PMC186146</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref15">
                <label>15</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hoffman</surname>
                            <given-names>LR</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Richardson</surname>
                            <given-names>AR</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Houston</surname>
                            <given-names>LS</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Nutrient Availability as a Mechanism for Selection of Antibiotic Tolerant Pseudomonas aeruginosa within the CF Airway.</article-title>
                    <source>

                        <italic toggle="yes">PLoS Pathog.</italic>
</source>
                    <year>2010 Jan [cited 2022 Mar 15]</year>;<volume>6</volume>(<issue>1</issue>):<fpage>1000712</fpage>.
                    <pub-id pub-id-type="doi">10.1371/journal.ppat.1000712</pub-id>
                    <pub-id pub-id-type="pmcid">PMC2795201</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref16">
                <label>16</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Winstanley</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>O&#x2019;Brien</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Brockhurst</surname>
                            <given-names>MA</given-names>
                        </name>
</person-group>:
                    <article-title>Pseudomonas aeruginosa Evolutionary Adaptation and Diversification in Cystic Fibrosis Chronic Lung Infections.</article-title>
                    <source>

                        <italic toggle="yes">Trends Microbiol.</italic>
</source>
                    <year>2016 May 1 [cited 2022 Jun 20]</year>;<volume>24</volume>(<issue>5</issue>):<fpage>327</fpage>&#x2013;<lpage>337</lpage>.
                    <pub-id pub-id-type="pmid">26946977</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.tim.2016.01.008</pub-id>
                    <pub-id pub-id-type="pmcid">PMC4854172</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref17">
                <label>17</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>K&#x00e5;hrstr&#x00f6;m</surname>
                            <given-names>CT</given-names>
                        </name>
</person-group>:
                    <article-title>Survival of the wrinkliest.</article-title>
                    <source>

                        <italic toggle="yes">Nat. Rev. Microbiol.</italic>
</source>
                    <year>2013 Jan 28 [cited 2022 Mar 8]</year>;<volume>11</volume>(<issue>3</issue>):<fpage>149</fpage>&#x2013;<lpage>149</lpage>.
                    <pub-id pub-id-type="pmid">23353767</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nrmicro2972</pub-id>
                    <ext-link ext-link-type="uri" xlink:href="https://www.nature.com/articles/nrmicro2972">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref18">
                <label>18</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Yang</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Haagensen</surname>
                            <given-names>JAJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jelsbak</surname>
                            <given-names>L</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>In Situ Growth Rates and Biofilm Development of Pseudomonas aeruginosa Populations in Chronic Lung Infections.</article-title>
                    <source>

                        <italic toggle="yes">J. Bacteriol.</italic>
</source>
                    <year>2008 Apr [cited 2022 Mar 15]</year>;<volume>190</volume>(<issue>8</issue>):<fpage>2767</fpage>&#x2013;<lpage>2776</lpage>. /pmc/articles/PMC2293235/.
                    <pub-id pub-id-type="pmid">18156255</pub-id>
                    <pub-id pub-id-type="doi">10.1128/JB.01581-07</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref19">
                <label>19</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sriramulu</surname>
                            <given-names>DD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>L&#x00fc;nsdorf</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lam</surname>
                            <given-names>JS</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Microcolony formation: A novel biofilm model of Pseudomonas aeruginosa for the cystic fibrosis lung.</article-title>
                    <source>

                        <italic toggle="yes">J. Med. Microbiol.</italic>
</source>
                    <year>2005 Jul 1</year>;<volume>54</volume>(<issue>7</issue>):<fpage>667</fpage>&#x2013;<lpage>676</lpage>.
                    <pub-id pub-id-type="pmid">15947432</pub-id>
                    <pub-id pub-id-type="doi">10.1099/jmm.0.45969-0</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref20">
                <label>20</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Dinesh</surname>
                            <given-names>SD</given-names>
                        </name>
</person-group>:
                    <article-title>Articial Sputum Medium.</article-title>
                    <year>2010 [cited 2021 Dec 26]</year>.
                    <pub-id pub-id-type="doi">10.1038/protex.2010.212</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref21">
                <label>21</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Palmer</surname>
                            <given-names>KL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Aye</surname>
                            <given-names>LM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Whiteley</surname>
                            <given-names>M</given-names>
                        </name>
</person-group>:
                    <article-title>Nutritional cues control Pseudomonas aeruginosa multicellular behavior in cystic fibrosis sputum.</article-title>
                    <source>

                        <italic toggle="yes">J. Bacteriol.</italic>
</source>
                    <year>2007 Nov</year>;<volume>189</volume>(<issue>22</issue>):<fpage>8079</fpage>&#x2013;<lpage>8087</lpage>.
                    <pub-id pub-id-type="pmid">17873029</pub-id>
                    <pub-id pub-id-type="doi">10.1128/JB.01138-07</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref22">
                <label>22</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Harrison</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Muruli</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Higgins</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Development of an ex vivo porcine lung model for studying growth Virulence, And signaling of pseudomonas aeruginosa.</article-title>
                    <source>

                        <italic toggle="yes">Infect. Immun.</italic>
</source>
                    <year>2014 Aug 1</year>;<volume>82</volume>(<issue>8</issue>):<fpage>3312</fpage>&#x2013;<lpage>3323</lpage>.
                    <pub-id pub-id-type="pmid">24866798</pub-id>
                    <pub-id pub-id-type="doi">10.1128/IAI.01554-14</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref23">
                <label>23</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sagel</surname>
                            <given-names>SD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sontag</surname>
                            <given-names>MK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Accurso</surname>
                            <given-names>FJ</given-names>
                        </name>
</person-group>:
                    <article-title>Relationship between antimicrobial proteins and airway inflammation and infection in cystic fibrosis.</article-title>
                    <source>

                        <italic toggle="yes">Pediatr. Pulmonol.</italic>
</source>
                    <year>2009 Apr</year>;<volume>44</volume>(<issue>4</issue>):<fpage>402</fpage>&#x2013;<lpage>409</lpage>.
                    <pub-id pub-id-type="pmid">19283840</pub-id>
                    <pub-id pub-id-type="doi">10.1002/ppul.21028</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref24">
                <label>24</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Thompson</surname>
                            <given-names>AB</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bohling</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Payvandi</surname>
                            <given-names>F</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Lower respiratory tract lactoferrin and lysozyme arise primarily in the airways and are elevated in association with chronic bronchitis - PubMed.</article-title>
                    <source>

                        <italic toggle="yes">J. Lab. Clin. Med.</italic>
</source>
                    <year>1990 [cited 2021 Dec 26]</year>;<volume>115</volume>:<fpage>148</fpage>&#x2013;<lpage>158</lpage>.
                    <pub-id pub-id-type="pmid">2299262</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref25">
                <label>25</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hasan</surname>
                            <given-names>CM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Green</surname>
                            <given-names>AE</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Cox</surname>
                            <given-names>AA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Pseudomonas aeruginosa utilises host-derived polyamines to facilitate antimicrobial tolerance.</article-title>
                    <source>

                        <italic toggle="yes">bioRxiv.</italic>
</source>
                    <year>2021 Dec 16 [cited 2022 Jan 19]</year>. 2021.12.15.472801.
                    <pub-id pub-id-type="doi">10.1101/2021.12.15.472801v1</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref26">
                <label>26</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Grasemann</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Shehnaz</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Enomoto</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>L-Ornithine Derived Polyamines in Cystic Fibrosis Airways. Vij N, editor.</article-title>
                    <source>

                        <italic toggle="yes">PLoS One.</italic>
</source>
                    <year>2012 Oct 5 [cited 2020 Mar 5]</year>;<volume>7</volume>(<issue>10</issue>):<fpage>e46618</fpage>.
                    <pub-id pub-id-type="pmid">23071598</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0046618</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref27">
                <label>27</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Jones</surname>
                            <given-names>GC</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sainsbury</surname>
                            <given-names>CAR</given-names>
                        </name>
</person-group>:
                    <article-title>A Practical Approach to Glucose Abnormalities in Cystic Fibrosis.</article-title>
                    <source>

                        <italic toggle="yes">Diabetes Ther.</italic>
</source>
                    <year>2016 Dec 1 [cited 2022 Jan 19]</year>;<volume>7</volume>(<issue>4</issue>):<fpage>611</fpage>&#x2013;<lpage>620</lpage>.
                    <pub-id pub-id-type="pmid">27752941</pub-id>
                    <pub-id pub-id-type="doi">10.1007/s13300-016-0205-8</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5118243</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref28">
                <label>28</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Brodlie</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Aseeri</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lordan</surname>
                            <given-names>JL</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Bile acid aspiration in people with cystic fibrosis before and after lung transplantation.</article-title>
                    <source>

                        <italic toggle="yes">Eur. Respir. J.</italic>
</source>
                    <year>2015</year>;<volume>46</volume>:<fpage>1820</fpage>&#x2013;<lpage>1823</lpage>.
                    <pub-id pub-id-type="pmid">26493787</pub-id>
                    <pub-id pub-id-type="doi">10.1183/13993003.00891-2015</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref29">
                <label>29</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kirchner</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Fothergill</surname>
                            <given-names>JL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wright</surname>
                            <given-names>EA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Use of artificial sputum medium to test antibiotic efficacy against Pseudomonas aeruginosa in conditions more relevant to the cystic fibrosis lung.</article-title>
                    <source>

                        <italic toggle="yes">J. Vis. Exp.</italic>
</source>
                    <year>2012 Jun 5</year>;<volume>64</volume>:<fpage>1</fpage>&#x2013;<lpage>8</lpage>.
                    <pub-id pub-id-type="doi">10.3791/3857</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref30">
                <label>30</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Semaniakou</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Croll</surname>
                            <given-names>RP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Chappe</surname>
                            <given-names>V</given-names>
                        </name>
</person-group>:
                    <article-title>Animal Models in the Pathophysiology of Cystic Fibrosis.</article-title>
                    <source>

                        <italic toggle="yes">Front. Pharmacol.</italic>
</source>
                    <year>2018 [cited 2021 Dec 26]</year>;<volume>9</volume>(<issue>JAN</issue>).
                    <pub-id pub-id-type="doi">10.3389/fphar.2018.01475</pub-id>
                    <pub-id pub-id-type="pmcid">PMC6328443</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref31">
                <label>31</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Mestas</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hughes</surname>
                            <given-names>CCW</given-names>
                        </name>
</person-group>:
                    <article-title>Of Mice and Not Men: Differences between Mouse and Human Immunology.</article-title>
                    <source>

                        <italic toggle="yes">J. Immunol.</italic>
</source>
                    <year>2004 Mar 1 [cited 2022 Jul 3]</year>;<volume>172</volume>(<issue>5</issue>):<fpage>2731</fpage>&#x2013;<lpage>2738</lpage>.
                    <pub-id pub-id-type="doi">10.4049/jimmunol.172.5.2731</pub-id>
                    <ext-link ext-link-type="uri" xlink:href="https://www.jimmunol.org/content/172/5/2731">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref32">
                <label>32</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>McCarron</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Donnelley</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Parsons</surname>
                            <given-names>D</given-names>
                        </name>
</person-group>:
                    <article-title>Airway disease phenotypes in animal models of cystic fibrosis.</article-title>
                    <source>

                        <italic toggle="yes">Respir. Res.</italic>
</source>
                    <year>2018 Apr 2 [cited 2021 Dec 26]</year>;<volume>19</volume>(<issue>1</issue>):<fpage>12</fpage>&#x2013;<lpage>54</lpage>.
                    <pub-id pub-id-type="pmid">29609604</pub-id>
                    <pub-id pub-id-type="doi">10.1186/s12931-018-0750-y</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref33">
                <label>33</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Facchini</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>De Fino</surname>
                            <given-names>I</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Riva</surname>
                            <given-names>C</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice.</article-title>
                    <source>

                        <italic toggle="yes">J. Vis. Exp.</italic>
</source>
                    <year>2014 Mar 17 [cited 2022 Jan 19]</year>;<volume>85</volume>:<fpage>51019</fpage>.
                    <pub-id pub-id-type="doi">10.3791/51019</pub-id>
                    <pub-id pub-id-type="pmcid">PMC4151694</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref34">
                <label>34</label>
                <mixed-citation publication-type="other">
                    <article-title>Annual Statistics of Scientific Procedures on Living Animals, Great Britain, 2021 - GOV.UK.</article-title>
                    <year>[cited 2022 Aug 8]</year>.
                    <ext-link ext-link-type="uri" xlink:href="https://www.gov.uk/government/statistics/statistics-of-scientific-procedures-on-living-animals-great-britain-2021/annual-statistics-of-scientific-procedures-on-living-animals-great-britain-2021">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref35">
                <label>35</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Cornforth</surname>
                            <given-names>DM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Diggle</surname>
                            <given-names>FL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Melvin</surname>
                            <given-names>JA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Quantitative framework for model evaluation in microbiology research using Pseudomonas aeruginosa and cystic fibrosis infection as a test case.</article-title>
                    <source>

                        <italic toggle="yes">MBio.</italic>
</source>
                    <year>2020 Jan 1 [cited 2022 Jun 22]</year>;<volume>11</volume>(<issue>1</issue>).
                    <pub-id pub-id-type="pmid">31937646</pub-id>
                    <pub-id pub-id-type="doi">10.1128/mBio.03042-19</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref36">
                <label>36</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Lindemann</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Leiacker</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rettinger</surname>
                            <given-names>G</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Nasal mucosal temperature during respiration.</article-title>
                    <source>

                        <italic toggle="yes">Clin. Otolaryngol. Allied Sci.</italic>
</source>
                    <year>2002 Jun 1 [cited 2020 Mar 5]</year>;<volume>27</volume>(<issue>3</issue>):<fpage>135</fpage>&#x2013;<lpage>139</lpage>.
                    <pub-id pub-id-type="doi">10.1046/j.1365-2273.2002.00544.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref37">
                <label>37</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Henderson</surname>
                            <given-names>AG</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ehre</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Button</surname>
                            <given-names>B</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Cystic fibrosis airway secretions exhibit mucin hyperconcentration and increased osmotic pressure.</article-title>
                    <source>

                        <italic toggle="yes">J. Clin. Invest.</italic>
</source>
                    <year>2014 Jul 1</year>;<volume>124</volume>(<issue>7</issue>):<fpage>3047</fpage>&#x2013;<lpage>3060</lpage>.
                    <pub-id pub-id-type="pmid">24892808</pub-id>
                    <pub-id pub-id-type="doi">10.1172/JCI73469</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref38">
                <label>38</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Goldman</surname>
                            <given-names>MJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Anderson</surname>
                            <given-names>GM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Stolzenberg</surname>
                            <given-names>ED</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Human &#x03b2;-defensin-1 is a salt-sensitive antibiotic in lung that is inactivated in cystic fibrosis.</article-title>
                    <source>

                        <italic toggle="yes">Cell.</italic>
</source>
                    <year>1997 Feb 21</year>;<volume>88</volume>(<issue>4</issue>):<fpage>553</fpage>&#x2013;<lpage>560</lpage>.
                    <pub-id pub-id-type="pmid">9038346</pub-id>
                    <pub-id pub-id-type="doi">10.1016/S0092-8674(00)81895-4</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref39">
                <label>39</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Pettigrew</surname>
                            <given-names>MM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Marks</surname>
                            <given-names>LR</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kong</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Dynamic changes in the Streptococcus pneumoniae transcriptome during transition from biofilm formation to invasive disease upon influenza A virus infection.</article-title>
                    <source>

                        <italic toggle="yes">Infect. Immun.</italic>
</source>
                    <year>2014 [cited 2021 Dec 26]</year>;<volume>82</volume>(<issue>11</issue>):<fpage>4607</fpage>&#x2013;<lpage>4619</lpage>.
                    <pub-id pub-id-type="pmid">25135685</pub-id>
                    <pub-id pub-id-type="doi">10.1128/IAI.02225-14</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref40">
                <label>40</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Brennan</surname>
                            <given-names>AL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Gyi</surname>
                            <given-names>KM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wood</surname>
                            <given-names>DM</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Airway glucose concentrations and effect on growth of respiratory pathogens in cystic fibrosis.</article-title>
                    <source>

                        <italic toggle="yes">J. Cyst. Fibros.</italic>
</source>
                    <year>2007 Apr 1</year>;<volume>6</volume>(<issue>2</issue>):<fpage>101</fpage>&#x2013;<lpage>109</lpage>.
                    <pub-id pub-id-type="pmid">16844431</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.jcf.2006.03.009</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref41">
                <label>41</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Rabin</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zheng</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Opoku-Temeng</surname>
                            <given-names>C</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Medicinal Chemistry Biofilm formation mechanisms and targets for developing antibiofilm agents.</article-title>
                    <source>

                        <italic toggle="yes">Future Med. Chem.</italic>
</source>
                    <year>2015 [cited 2021 Apr 12]</year>;<volume>7</volume>(<issue>4</issue>):<fpage>493</fpage>&#x2013;<lpage>512</lpage>.
                    <pub-id pub-id-type="pmid">25875875</pub-id>
                    <pub-id pub-id-type="doi">10.4155/fmc.15.6</pub-id>
                    <ext-link ext-link-type="uri" xlink:href="http://www.future-science.com">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref42">
                <label>42</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Bjarnsholt</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jensen</surname>
                            <given-names>P&#x00d8;</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Fiandaca</surname>
                            <given-names>MJ</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Pseudomonas aeruginosa biofilms in the respiratory tract of cystic fibrosis patients.</article-title>
                    <source>

                        <italic toggle="yes">Pediatr. Pulmonol.</italic>
</source>
                    <year>2009 Jun [cited 2021 Apr 12]</year>;<volume>44</volume>(<issue>6</issue>):<fpage>547</fpage>&#x2013;<lpage>558</lpage>.
                    <pub-id pub-id-type="pmid">19418571</pub-id>
                    <pub-id pub-id-type="doi">10.1002/ppul.21011</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref43">
                <label>43</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ghanem</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Roquefort</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ramel</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Apparent yield stress of sputum as a relevant biomarker in cystic fibrosis.</article-title>
                    <source>

                        <italic toggle="yes">Cells.</italic>
</source>
                    <year>2021 Nov 1 [cited 2022 Mar 23]</year>;<volume>10</volume>(<issue>11</issue>):<fpage>3107</fpage>.
                    <pub-id pub-id-type="pmid">34831330</pub-id>
                    <pub-id pub-id-type="doi">10.3390/cells10113107</pub-id>
                    <pub-id pub-id-type="pmcid">PMC8619720</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref44">
                <label>44</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hershberger</surname>
                            <given-names>CD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ye</surname>
                            <given-names>RW</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Parsek</surname>
                            <given-names>MR</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The algT (algU) gene of Pseudomonas aeruginosa, a key regulator involved in alginate biosynthesis, encodes an alternative sigma factor (sigma E).</article-title>
                    <source>

                        <italic toggle="yes">Proc. Natl. Acad. Sci. U. S. A.</italic>
</source>
                    <year>1995 Aug 15 [cited 2022 Mar 15]</year>;<volume>92</volume>(<issue>17</issue>):<fpage>7941</fpage>&#x2013;<lpage>7945</lpage>.
                    <pub-id pub-id-type="pmid">7644517</pub-id>
                    <pub-id pub-id-type="doi">10.1073/pnas.92.17.7941</pub-id>
                    <pub-id pub-id-type="pmcid">PMC41262</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref45">
                <label>45</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>XZ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Nikaido</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Poole</surname>
                            <given-names>K</given-names>
                        </name>
</person-group>:
                    <article-title>Role of mexA-mexB-oprM in antibiotic efflux in Pseudomonas aeruginosa.</article-title>
                    <source>

                        <italic toggle="yes">Antimicrob. Agents Chemother.</italic>
</source>
                    <year>1995 [cited 2022 Mar 15]</year>;<volume>39</volume>(<issue>9</issue>):<fpage>1948</fpage>&#x2013;<lpage>1953</lpage>.
                    <pub-id pub-id-type="pmid">8540696</pub-id>
                    <pub-id pub-id-type="doi">10.1128/AAC.39.9.1948</pub-id>
                    <pub-id pub-id-type="pmcid">PMC162861</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref46">
                <label>46</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Cornforth</surname>
                            <given-names>DM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Dees</surname>
                            <given-names>JL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ibberson</surname>
                            <given-names>CB</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Pseudomonas aeruginosa transcriptome during human infection.</article-title>
                    <source>

                        <italic toggle="yes">Proc. Natl. Acad. Sci. U. S. A.</italic>
</source>
                    <year>2018 May 29 [cited 2022 Mar 15]</year>;<volume>115</volume>(<issue>22</issue>):<fpage>E5125</fpage>&#x2013;<lpage>E5134</lpage>.
                    <pub-id pub-id-type="pmid">29760087</pub-id>
                    <pub-id pub-id-type="doi">10.1073/pnas.1717525115</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5984494</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref47">
                <label>47</label>
                <mixed-citation publication-type="other">
                    <article-title>PA2911 - Probable TonB-dependent receptor - Pseudomonas aeruginosa (strain ATCC 15692/DSM 22644/CIP 104116/JCM 14847/LMG 12228/1C/ PRS 101/PAO1) - PA2911 gene &amp; protein.</article-title>
                    <year>[cited 2022 Mar 15]</year>.
                    <ext-link ext-link-type="uri" xlink:href="https://www.uniprot.org/uniprot/Q9HZT6">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref48">
                <label>48</label>
                <mixed-citation publication-type="other">
                    <article-title>lldA - L-lactate dehydrogenase - Pseudomonas aeruginosa (strain ATCC 15692/DSM 22644/CIP 104116/JCM 14847/LMG 12228/1C/ PRS 101/PAO1) - lldA gene &amp; protein.</article-title>
                    <year>[cited 2022 Mar 15]</year>.
                    <ext-link ext-link-type="uri" xlink:href="https://www.uniprot.org/uniprot/Q9I197">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref49">
                <label>49</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Jonczyk</surname>
                            <given-names>MS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Escudero</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sylvius</surname>
                            <given-names>N</given-names>
                        </name>

                        <etal/>
</person-group>;
                    <article-title>Variation in Inflammatory Response during Pneumococcal Infection Is Influenced by Host-Pathogen Interactions but Associated with Animal Survival.</article-title>
                    <source>

                        <italic toggle="yes">Infect. Immun.</italic>
</source>
                    <year>2016 Apr 1 [cited 2022 Aug 5]</year>;<volume>84</volume>(<issue>4</issue>):<fpage>894</fpage>&#x2013;<lpage>905</lpage>.
                    <pub-id pub-id-type="pmid">26787718</pub-id>
                    <pub-id pub-id-type="doi">10.1128/IAI.01057-15</pub-id>
                    <pub-id pub-id-type="pmcid">PMC4807497</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref50">
                <label>50</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Jander</surname>
                            <given-names>G</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rahme</surname>
                            <given-names>LG</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ausubel</surname>
                            <given-names>FM</given-names>
                        </name>
</person-group>:
                    <article-title>Positive Correlation between Virulence of Pseudomonas aeruginosa Mutants in Mice and Insects.</article-title>
                    <source>

                        <italic toggle="yes">J. Bacteriol.</italic>
</source>
                    <year>2000 Jul [cited 2022 Aug 5]</year>;<volume>182</volume>(<issue>13</issue>):<fpage>3843</fpage>&#x2013;<lpage>3845</lpage>.
                    <pub-id pub-id-type="pmid">10851003</pub-id>
                    <pub-id pub-id-type="doi">10.1128/JB.182.13.3843-3845.2000</pub-id>
                    <pub-id pub-id-type="pmcid">PMC94559</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref51">
                <label>51</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Carter</surname>
                            <given-names>MEK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Fothergill</surname>
                            <given-names>JL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Walshaw</surname>
                            <given-names>MJ</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>A subtype of a Pseudomonas aeruginosa cystic fibrosis epidemic strain exhibits enhanced virulence in a murine model of acute respiratory infection.</article-title>
                    <source>

                        <italic toggle="yes">J. Infect. Dis.</italic>
</source>
                    <year>2010 Sep 15 [cited 2022 Aug 5]</year>;<volume>202</volume>(<issue>6</issue>):<fpage>935</fpage>&#x2013;<lpage>942</lpage>.
                    <pub-id pub-id-type="pmid">20704484</pub-id>
                    <pub-id pub-id-type="doi">10.1086/655781</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref52">
                <label>52</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Trzci&#x0144;ski</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Weinberger</surname>
                            <given-names>DM</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Effect of serotype on pneumococcal competition in a mouse colonization model.</article-title>
                    <source>

                        <italic toggle="yes">MBio.</italic>
</source>
                    <year>2015 [cited 2022 Aug 5]</year>;<volume>6</volume>(<issue>5</issue>):<fpage>e00902</fpage>&#x2013;<lpage>e00915</lpage>.
                    <pub-id pub-id-type="pmid">26374118</pub-id>
                    <pub-id pub-id-type="doi">10.1128/mBio.00902-15</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref53">
                <label>53</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Egesten</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Frick</surname>
                            <given-names>IM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>M&#x00f6;rgelin</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Binding of albumin promotes bacterial survival at the epithelial surface.</article-title>
                    <source>

                        <italic toggle="yes">J. Biol. Chem.</italic>
</source>
                    <year>2011 Jan 28</year>;<volume>286</volume>(<issue>4</issue>):<fpage>2469</fpage>&#x2013;<lpage>2476</lpage>.
                    <pub-id pub-id-type="pmid">21098039</pub-id>
                    <pub-id pub-id-type="doi">10.1074/jbc.M110.148171</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref54">
                <label>54</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Aprianto</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Slager</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Holsappel</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>High-resolution analysis of the pneumococcal transcriptome under a wide range of infection-relevant conditions.</article-title>
                    <source>

                        <italic toggle="yes">Nucleic Acids Res.</italic>
</source>
                    <year>2018 [cited 2020 Mar 5]</year>;<volume>46</volume>(<issue>19</issue>):<fpage>9990</fpage>&#x2013;<lpage>10006</lpage>.
                    <pub-id pub-id-type="pmid">30165663</pub-id>
                    <pub-id pub-id-type="doi">10.1093/nar/gky750</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref55">
                <label>55</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Lewenza</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Johnson</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Charron-Mazenod</surname>
                            <given-names>L</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Extracellular DNA controls expression of Pseudomonas aeruginosa genes involved in nutrient utilization, metal homeostasis, acid pH tolerance, and virulence.</article-title>
                    <source>

                        <italic toggle="yes">bioRxiv.</italic>
</source>
                    <year>2019 Nov 21 [cited 2020 Mar 30]</year>;<fpage>850446</fpage>.
                    <pub-id pub-id-type="doi">10.1101/850446v1.abstract</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref56">
                <label>56</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Smith</surname>
                            <given-names>DJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Anderson</surname>
                            <given-names>GJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bell</surname>
                            <given-names>SC</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Elevated metal concentrations in the CF airway correlate with cellular injury and disease severity.</article-title>
                    <source>

                        <italic toggle="yes">J. Cyst. Fibros.</italic>
</source>
                    <year>2014 May 1</year>;<volume>13</volume>(<issue>3</issue>):<fpage>289</fpage>&#x2013;<lpage>295</lpage>.
                    <pub-id pub-id-type="pmid">24369896</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.jcf.2013.12.001</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref57">
                <label>57</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Zlatina</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Galuska</surname>
                            <given-names>SP</given-names>
                        </name>
</person-group>:
                    <article-title>The n-glycans of lactoferrin: More than just a sweet decoration.</article-title>
                    <source>

                        <italic toggle="yes">Biochem. Cell Biol.</italic>
</source>
                    <year>2021 [cited 2022 Jun 25]</year>;<volume>99</volume>(<issue>1</issue>):<fpage>117</fpage>&#x2013;<lpage>127</lpage>.
                    <pub-id pub-id-type="pmid">32464076</pub-id>
                    <pub-id pub-id-type="doi">10.1139/bcb-2020-0106</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref58">
                <label>58</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Scanlon</surname>
                            <given-names>TC</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Teneback</surname>
                            <given-names>CC</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Gill</surname>
                            <given-names>A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Enhanced antimicrobial activity of engineered human lysozyme.</article-title>
                    <source>

                        <italic toggle="yes">ACS Chem. Biol.</italic>
</source>
                    <year>2010 Sep 17 [cited 2022 Jan 19]</year>;<volume>5</volume>(<issue>9</issue>):<fpage>809</fpage>&#x2013;<lpage>818</lpage>.
                    <pub-id pub-id-type="pmid">20604527</pub-id>
                    <pub-id pub-id-type="doi">10.1021/cb1001119</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref59">
                <label>59</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Griswold</surname>
                            <given-names>KE</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bement</surname>
                            <given-names>JL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Teneback</surname>
                            <given-names>CC</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Bioengineered lysozyme in combination therapies for Pseudomonas aeruginosa lung infections.</article-title>
                    <source>

                        <italic toggle="yes">Bioengineered.</italic>
</source>
                    <year>2014 Feb 26 [cited 2022 Jan 19]</year>;<volume>5</volume>(<issue>2</issue>):<fpage>143</fpage>&#x2013;<lpage>147</lpage>.
                    <pub-id pub-id-type="pmid">24637705</pub-id>
                    <pub-id pub-id-type="doi">10.4161/bioe.28335</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref60">
                <label>60</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Deckers</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Vanlint</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Callewaert</surname>
                            <given-names>L</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Role of the lysozyme inhibitor Ivy in growth or survival of Escherichia coli and Pseudomonas aeruginosa bacteria in hen egg white and in human saliva and breast milk.</article-title>
                    <source>

                        <italic toggle="yes">Appl. Environ. Microbiol.</italic>
</source>
                    <year>2008 Jul [cited 2022 Jun 20]</year>;<volume>74</volume>(<issue>14</issue>):<fpage>4434</fpage>&#x2013;<lpage>4439</lpage>.
                    <pub-id pub-id-type="pmid">18515493</pub-id>
                    <pub-id pub-id-type="doi">10.1128/AEM.00589-08</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref61">
                <label>61</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Mariam</surname>
                            <given-names>DH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mengistu</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hoffner</surname>
                            <given-names>SE</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Effect of rpoB Mutations Conferring Rifampin Resistance on Fitness of Mycobacterium tuberculosis.</article-title>
                    <source>

                        <italic toggle="yes">Antimicrob. Agents Chemother.</italic>
</source>
                    <year>2004 Apr [cited 2021 Apr 11]</year>;<volume>48</volume>(<issue>4</issue>):<fpage>1289</fpage>&#x2013;<lpage>1294</lpage>.
                    <pub-id pub-id-type="pmid">15047531</pub-id>
                    <pub-id pub-id-type="doi">10.1128/AAC.48.4.1289-1294.2004</pub-id>
                    <pub-id pub-id-type="pmcid">PMC375340</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref62">
                <label>62</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Cohen-Cymberknoh</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kerem</surname>
                            <given-names>E</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ferkol</surname>
                            <given-names>T</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Airway inflammation in cystic fibrosis: molecular mechanisms and clinical implications.</article-title>
                    <source>

                        <italic toggle="yes">Thorax.</italic>
</source>
                    <year>2013 Dec 1 [cited 2022 Mar 15]</year>;<volume>68</volume>(<issue>12</issue>):<fpage>1157</fpage>&#x2013;<lpage>1162</lpage>.
                    <pub-id pub-id-type="pmid">23704228</pub-id>
                    <pub-id pub-id-type="doi">10.1136/thoraxjnl-2013-203204</pub-id>
                    <ext-link ext-link-type="uri" xlink:href="https://thorax.bmj.com/content/68/12/1157">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref63">
                <label>63</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Holloway</surname>
                            <given-names>BW</given-names>
                        </name>
</person-group>:
                    <article-title>Genetic recombination in Pseudomonas aeruginosa.</article-title>
                    <source>

                        <italic toggle="yes">J. Gen. Microbiol.</italic>
</source>
                    <year>1955 Dec 1 [cited 2022 Jan 19]</year>;<volume>13</volume>(<issue>3</issue>):<fpage>572</fpage>&#x2013;<lpage>581</lpage>.
                    <pub-id pub-id-type="doi">10.1099/00221287-13-3-572</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref64">
                <label>64</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Fothergill</surname>
                            <given-names>JL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Panagea</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hart</surname>
                            <given-names>CA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Widespread pyocyanin over-production among isolates of a cystic fibrosis epidemic strain.</article-title>
                    <source>

                        <italic toggle="yes">BMC Microbiol.</italic>
</source>
                    <year>2007 [cited 2022 Jun 20]</year>;<volume>7</volume>:<fpage>45</fpage>.
                    <pub-id pub-id-type="pmid">17521417</pub-id>
                    <pub-id pub-id-type="doi">10.1186/1471-2180-7-45</pub-id>
                    <pub-id pub-id-type="pmcid">PMC1890549</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref65">
                <label>65</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Rogan</surname>
                            <given-names>MP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Taggart</surname>
                            <given-names>CC</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Greene</surname>
                            <given-names>CM</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Loss of Microbicidal Activity and Increased Formation of Biofilm Due to Decreased Lactoferrin Activity in Patients with Cystic Fibrosis.</article-title>
                    <source>

                        <italic toggle="yes">J. Infect. Dis.</italic>
</source>
                    <year>2004 Oct</year>;<volume>190</volume>(<issue>7</issue>):<fpage>1245</fpage>&#x2013;<lpage>1253</lpage>.
                    <pub-id pub-id-type="pmid">15346334</pub-id>
                    <pub-id pub-id-type="doi">10.1086/423821</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref66">
                <label>66</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Venkatakrishnan</surname>
                            <given-names>V</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Packer</surname>
                            <given-names>NH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Thaysen-Andersen</surname>
                            <given-names>M</given-names>
                        </name>
</person-group>: Expert Review of Respiratory Medicine Host mucin glycosylation plays a role in bacterial adhesion in lungs of individuals with cystic fibrosis.<year>2014 [cited 2022 Mar 8]</year>.
                    <ext-link ext-link-type="uri" xlink:href="https://www.tandfonline.com/action/journalInformation?journalCode=ierx20">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref67">
                <label>67</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hoffman</surname>
                            <given-names>CL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lalsiamthara</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Aballay</surname>
                            <given-names>A</given-names>
                        </name>
</person-group>:
                    <article-title>Host mucin is exploited by Pseudomonas aeruginosa to provide monosaccharides required for a successful infection.</article-title>
                    <source>

                        <italic toggle="yes">MBio.</italic>
</source>
                    <year>2020 Mar 1 [cited 2022 Mar 8]</year>;<volume>11</volume>(<issue>2</issue>).
                    <pub-id pub-id-type="pmid">32127446</pub-id>
                    <pub-id pub-id-type="doi">10.1128/mBio.00060-20</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref68">
                <label>68</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Walker</surname>
                            <given-names>TS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tomlin</surname>
                            <given-names>KL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Worthen</surname>
                            <given-names>GS</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Enhanced Pseudomonas aeruginosa biofilm development mediated by human neutrophils.</article-title>
                    <source>

                        <italic toggle="yes">Infect. Immun.</italic>
</source>
                    <year>2005 Jun</year>;<volume>73</volume>(<issue>6</issue>):<fpage>3693</fpage>&#x2013;<lpage>3701</lpage>.
                    <pub-id pub-id-type="pmid">15908399</pub-id>
                    <pub-id pub-id-type="doi">10.1128/IAI.73.6.3693-3701.2005</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref69">
                <label>69</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Wilton</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Charron-Mazenod</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Moore</surname>
                            <given-names>R</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Extracellular DNA Acidifies Biofilms and Induces Aminoglycoside Resistance in Pseudomonas aeruginosa.</article-title>
                    <year>2015 [cited 2020 Jun 3]</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://aac.asm.org/">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref70">
                <label>70</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Mulcahy</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Charron-Mazenod</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lewenza</surname>
                            <given-names>S</given-names>
                        </name>
</person-group>:
                    <article-title>Extracellular DNA chelates cations and induces antibiotic resistance in Pseudomonas aeruginosa biofilms.</article-title>
                    <source>

                        <italic toggle="yes">PLoS Pathog.</italic>
</source>
                    <year>2008 Nov</year>;<volume>4</volume>(<issue>11</issue>):<fpage>e1000213</fpage>.
                    <pub-id pub-id-type="pmid">19023416</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.ppat.1000213</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref71">
                <label>71</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Barth</surname>
                            <given-names>AL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Pitt</surname>
                            <given-names>TL</given-names>
                        </name>
</person-group>:
                    <article-title>The high amino-acid content of sputum from cystic fibrosis patients promotes growth of auxotrophic Pseudomonas aeruginosa.</article-title>
                    <source>

                        <italic toggle="yes">J. Med. Microbiol.</italic>
</source>
                    <year>1996 [cited 2022 Mar 8]</year>;<volume>45</volume>(<issue>2</issue>):<fpage>110</fpage>&#x2013;<lpage>119</lpage>.
                    <pub-id pub-id-type="pmid">8683546</pub-id>
                    <pub-id pub-id-type="doi">10.1099/00222615-45-2-110</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref72">
                <label>72</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Diraviam</surname>
                            <given-names>D</given-names>
                        </name>
</person-group>:
                    <article-title>Microbiology Insights Amino Acids enhance Adaptive Behaviour of Pseudomonas Aeruginosa in the cystic Fibrosis Lung environment.</article-title>
                    <year>2010 [cited 2020 Jun 2]</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.la-press.com.http//www.la-press.com">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref73">
                <label>73</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kruczek</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wachtel</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Alabady</surname>
                            <given-names>MS</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Serum albumin alters the expression of ironcontrolled genes in Pseudomonas aeruginosa.</article-title>
                    <source>

                        <italic toggle="yes">Microbiology.</italic>
</source>
                    <year>2012 Feb 1 [cited 2022 Mar 8]</year>;<volume>158</volume>(<issue>2</issue>):<fpage>353</fpage>&#x2013;<lpage>367</lpage>.
                    <pub-id pub-id-type="pmid">22053004</pub-id>
                    <pub-id pub-id-type="doi">10.1099/mic.0.053371-0</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref74">
                <label>74</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Khubchandani</surname>
                            <given-names>KR</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Oberley</surname>
                            <given-names>RE</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Snyder</surname>
                            <given-names>JM</given-names>
                        </name>
</person-group>:
                    <article-title>Effects of Surfactant Protein A and NaCl Concentration on the Uptake of Pseudomonas aeruginosa by THP-1 Cells.</article-title>
                    <year>2012 Dec 14 [cited 2022 Mar 8]</year>;<volume>25</volume>(<issue>6</issue>):<fpage>699</fpage>&#x2013;<lpage>706</lpage>.
                    <pub-id pub-id-type="doi">10.1165/ajrcmb2564366</pub-id>
                    <ext-link ext-link-type="uri" xlink:href="http://www.atsjournals.org">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref75">
                <label>75</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Flynn</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Reen</surname>
                            <given-names>FJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>O&#x2019;gara</surname>
                            <given-names>F</given-names>
                        </name>
</person-group>:
                    <article-title>Exposure to bile leads to the emergence of adaptive signaling variants in the opportunistic pathogen pseudomonas aeruginosa.</article-title>
                    <source>

                        <italic toggle="yes">Front. Microbiol.</italic>
</source>
                    <year>2019</year>;<volume>10</volume>(<issue>AUG</issue>):<fpage>2013</fpage>.
                    <pub-id pub-id-type="pmid">31555243</pub-id>
                    <pub-id pub-id-type="doi">10.3389/fmicb.2019.02013</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref76">
                <label>76</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Riquelme</surname>
                            <given-names>SA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lozano</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Moustafa</surname>
                            <given-names>AM</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>CFTR-PTEN-dependent mitochondrial metabolic dysfunction promotes Pseudomonas aeruginosa airway infection.</article-title>
                    <source>

                        <italic toggle="yes">Sci. Transl. Med.</italic>
</source>
                    <year>2019 Jul 3</year>;<volume>11</volume>(<issue>499</issue>).
                    <pub-id pub-id-type="pmid">31270271</pub-id>
                    <pub-id pub-id-type="doi">10.1126/scitranslmed.aav4634</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref77">
                <label>77</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Schwab</surname>
                            <given-names>U</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Abdullah</surname>
                            <given-names>LH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Perlmutt</surname>
                            <given-names>OS</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Localization of Burkholderia cepacia complex bacteria in cystic fibrosis lungs and interactions with Pseudomonas aeruginosa in hypoxic mucus.</article-title>
                    <source>

                        <italic toggle="yes">Infect. Immun.</italic>
</source>
                    <year>2014</year>;<volume>82</volume>(<issue>11</issue>):<fpage>4729</fpage>&#x2013;<lpage>4745</lpage>.
                    <pub-id pub-id-type="pmid">25156735</pub-id>
                    <pub-id pub-id-type="doi">10.1128/IAI.01876-14</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref78">
                <label>78</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Henke</surname>
                            <given-names>MO</given-names>
                        </name>

                        <name name-style="western">
                            <surname>John</surname>
                            <given-names>G</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Germann</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>MUC5AC and MUC5B mucins increase in cystic fibrosis airway secretions during pulmonary exacerbation.</article-title>
                    <source>

                        <italic toggle="yes">Am. J. Respir. Crit. Care Med.</italic>
</source>
                    <year>2007 Apr 14</year>;<volume>175</volume>(<issue>8</issue>):<fpage>816</fpage>&#x2013;<lpage>821</lpage>.
                    <pub-id pub-id-type="pmid">17255563</pub-id>
                    <pub-id pub-id-type="doi">10.1164/rccm.200607-1011OC</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref79">
                <label>79</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Blanchette</surname>
                            <given-names>KA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Shenoy</surname>
                            <given-names>AT</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Milner</surname>
                            <given-names>J</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Neuraminidase A-exposed galactose promotes Streptococcus pneumoniae biofilm formation during colonization.</article-title>
                    <source>

                        <italic toggle="yes">Infect. Immun.</italic>
</source>
                    <year>2016</year>;<volume>84</volume>(<issue>10</issue>):<fpage>2922</fpage>&#x2013;<lpage>2932</lpage>.
                    <pub-id pub-id-type="pmid">27481242</pub-id>
                    <pub-id pub-id-type="doi">10.1128/IAI.00277-16</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref80">
                <label>80</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Reen</surname>
                            <given-names>FJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Woods</surname>
                            <given-names>DF</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mooij</surname>
                            <given-names>MJ</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Respiratory Pathogens Adopt a Chronic Lifestyle in Response to Bile. Kaufmann GF, editor.</article-title>
                    <source>

                        <italic toggle="yes">PLoS One.</italic>
</source>
                    <year>2012 Sep 26 [cited 2020 Apr 2]</year>;<volume>7</volume>(<issue>9</issue>):<fpage>e45978</fpage>.
                    <pub-id pub-id-type="pmid">23049911</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0045978</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref81">
                <label>81</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ruhluel</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>O&#x2019;Brien</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Fothergill</surname>
                            <given-names>JL</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Underlying data for &#x201c;Development of liquid culture media mimicking the conditions of sinuses and lungs in cystic fibrosis and health&#x201d;. figshare. [Dataset].</article-title>
                    <year>2022</year>.
                    <pub-id pub-id-type="doi">10.6084/m9.figshare.20463159.v6</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report152082">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.137340.r152082</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Azimi</surname>
                        <given-names>Sheyda</given-names>
                    </name>
                    <xref ref-type="aff" rid="r152082a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0001-9358-6087</uri>
                </contrib>
                <contrib contrib-type="author">
                    <name>
                        <surname>Vanderwoude</surname>
                        <given-names>Jelly</given-names>
                    </name>
                    <xref ref-type="aff" rid="r152082a2">2</xref>
                    <role>Co-referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-4520-2867</uri>
                </contrib>
                <aff id="r152082a1">
                    <label>1</label>School of Biological Sciences, Center for Microbial Dynamics and Infection, Georgia State University, Atlanta, GA, USA</aff>
                <aff id="r152082a2">
                    <label>2</label>Georgia Institute of Technology, Atlanta, GA, USA</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>25</day>
                <month>10</month>
                <year>2022</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2022 Azimi S and Vanderwoude J</copyright-statement>
                <copyright-year>2022</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport152082" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.125074.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>In this article, the authors sought to develop four new culturing media&#x2014;Healthy Sinus Media (HSM), Healthy Lung Media (HLM), Cystic Fibrosis Sinus Media (CFSM), and</p>
            <p> Cystic Fibrosis Lung Media (CFLM)&#x2014;to recapitulate the environment of human lungs and sinuses, both in healthy individuals and those with cystic fibrosis (CF). The authors justify the need for the development of novel media by emphasizing that Artificial Sputum Media (ASM) and Synthetic Cystic Fibrosis Media (SCFM and SCFM2) capture many key nutritional aspects of the CF lung, they lack critical host-derived antimicrobials, polyamines, glucose, and bile salts. All of which impact 
                <italic>Pseudomonas aeruginosa</italic> growth. Furthermore, there are yet no media that have been developed to capture the environments of healthy human lungs or sinuses, nor that of CF-impacted sinuses.</p>
            <p> </p>
            <p> This article is scientifically sound in developing and thoroughly testing four novel media to model human airways. The authors employ many different experimental tests to assay the viability of these novel media and assess their relevance to 
                <italic>P. aeruginosa </italic>infection, including but not limited to: culturing strains in each chemical component independently before pooling, measuring growth and biofilm phenotypes, assessing long-term media stability, measuring gene expression, etc.</p>
            <p> </p>
            <p> The authors use appropriate statistical tests as necessary and conduct all experiments with technical and biological replicates. In addition, the authors describe detailed methods for preparing each medium, including supplier information for all reagents, stock concentrations, volumes, final concentrations, sterilization procedures, and special notes on media preparation so that others may easily reproduce these&#x00a0;procedures.</p>
            <p> </p>
            <p> The authors provide a rationale for each component added with references to literature. The authors conduct all experiments in appropriate conditions to mimic 
                <italic>in vivo</italic>, for example, altering growth temperatures between sinus and lung media. The article also provides sufficient rationale for the necessity of these media in the scientific community. The creation of these novel media will significantly add to the scientific community&#x2019;s ability to better model CF infection dynamics 
                <italic>in vitro</italic> preclinical models. Including healthy lung and sinus media will no doubt serve as a useful control for these experiments than LB or M9. Having accurate models for upper airway infection is also key in understanding the intermittent colonization and persistence of 
                <italic>P. aeruginosa</italic> during initial colonization and antibiotic treatment.</p>
            <p> </p>
            <p> The various components tested by the authors for the development of these novel media were: Lysozyme, Lactoferrin, Spermidine, Spermine, Putrescine, Mucin, eDNA,</p>
            <p> Albumin, CaCl2, MgCl2, FeCl2, CuCl2, ZnCl2, NaCl, Sialic acid, Bile, N-acetyl glucosamine, Glucose, Succinate, Galactose, L-Methionine, L-Phenylalanine, LProline,</p>
            <p> L-Serine, L-Threonine, L-Tryptophan, L-Valine, L-Ornithine, L-Tyrosine, L(+)-Asparagine monohydrate, L-Alanine, L-Arginine, L(+)-Aspartic acid, L-Cysteine, LGlutamine,</p>
            <p> L-Glycine, L-Histidine, L-Isoleucine, L-Leucine, and L-Lysine. The authors chose the PAO1 and LESB65 as representative laboratory and CF-adapted strains of 
                <italic>P. aeruginosa</italic> in their tested conditions. The authors first grew these strains in M9 media supplemented with each chemical component independently at three different concentrations. These concentrations were selected to most closely reflect the physiological concentration of each compound within each niche, based upon cited references in the literature or experimental testing of metabolites. Upon confirmation that these strains could grow sufficiently at the selected concentration of each metabolite, the authors then pooled the components at the appropriate ratios to yield four novel respiratory media: Healthy Sinus Media (HSM), Healthy Lung Media (HLM), Cystic Fibrosis Sinus Media (CFSM), and Cystic Fibrosis Lung Media (CFLM).</p>
            <p> </p>
            <p> The authors tested the viability and relevance of these media as preclinical models for human respiratory infections by assessing the:</p>
            <p> i) growth and biofilm formation of strains cultured continuously for 72 hours;</p>
            <p> ii) viscosity and shear rate in the media pre- and post-biofilm formation;</p>
            <p> iii) the stability of media after storage at 4&#x00b0; C for 40 days;</p>
            <p> iv) transcriptional changes of infection-relevant genes; and</p>
            <p> v) changes in colony morphology of strains evolved for 40 days;</p>
            <p> of PAO1 and LESB65 in each medium.</p>
            <p> </p>
            <p> The growth rate experiments show that PAO1 and LESB65 could be maintained for at least 72 hours, with similar dynamics to those previously published for 
                <italic>P. aeruginosa</italic> in SCFM (authors may include the publications that used these media to study various aspects of 
                <italic>P. aeruginosa</italic> infection). The crystal violet assays, which included growth in M9 and Luria-Bertani (LB) as additional comparators against the newly described media, show niche, disease state, and strain-specific differences in surface-attached and free-floating biofilm formation, highlighting the importance of using clinically-relevant models for estimating biofilm formation. Although the aggregate and aggregate formation are not tested here, authors can discuss those future assessments for these media.</p>
            <p> </p>
            <p> The authors also show that the viscosity and shear rate measurements of their proposed media agree with those published previously for CF and healthy human sputum. The authors also show that each media could support the same level of biofilm formation in PAO1 after 0, 10, 20, and 30 days of storage at 4&#x00b0; C, implying that the media remains stable for this duration. qPCR analysis shows that expression of the four tested virulence genes&#x2014;algU, mexB, PA2911, and PA2382&#x2014;significantly increased in all four novel media compared to their transcription levels in LB and additionally were comparable to transcription levels of the same strains grown in SCFM2. Long-term culturing of PAO1 in these media shows the evolution of a wrinkly colony morphotype, a potential redox-driven adaptation to maximize oxygen availability in biofilms, and morphological adaptations specific to CF media.</p>
            <p> </p>
            <p> 
                <bold>Some minor comments:</bold>
            </p>
            <p> </p>
            <p> The authors determined these novel media's viability over 30 days by measuring PAO1 biofilm formation at 0, 10, 20, and 30 days. While it is nice to show that the media sustain similar levels of biofilm growth regardless of whether the media is freshly prepared, this might not be the best indicator of media stability over long periods. Instead, it would have been nice to see the authors conduct LCMS analyses to determine the stability of each of the chemical components at 0 and 30 days and detect if any possible degradation had occurred. Also, it is important to determine whether the growth of 
                <italic>P. aeruginosa</italic> in the stored media displays any altered metabolism, physiology, or spatial organization.</p>
            <p> </p>
            <p> Additionally, instead of hand-picking a short list of four genes, it would have greatly strengthened the supporting case for these novel media by RNA-seq analysis. For example, comparing the entire transcriptional profile of 
                <italic>P. aeruginosa</italic> grown in new media (fresh and stored at 4&#x00b0; C) to the transcriptional profile of cells grown in SCFM2 and 
                <italic>in vivo</italic> samples would confirm the similarity of these preclinical models to the infection and healthy environments.</p>
            <p> </p>
            <p> I also understand that these experiments can be addressed in the future and are out of the scope of this study, which aimed to introduce these novel media for upper and lower respiratory tracts; however, I recommend that authors address this in the discussion section. I recommend authors include these studies and discuss the key benefits of using the novel HSM, CFSM, HLM, and CFLM media over the other versions available.</p>
            <p> </p>
            <p> In the section titled &#x201c;Airway mimicking media is stable for at least 30 days at 4&#x00b0; C,&#x201d; the wording of the first sentence leads to some confusion. At first glance, it appears to imply that PAO1 was cultured for 30 days, although the authors meant to say that PAO1 was cultured in media that had been stored for 30 days. The authors may want to re-write this sentence to avoid confusion.</p>
            <p> </p>
            <p> In Tables 3, 8, and 12, please use a consistent format for the concentration units &#x03bc;g/L or &#x03bc;g/l.</p>
            <p> </p>
            <p> In Figure 5, the legend below the chart is redundant, as it shows the same data as the labels on the X-axis. I would recommend removing this legend to simplify the readers' view.</p>
            <p> </p>
            <p> In Figure 6, standard deviation bars and significance labels would help the reader understand which relationships are significant without having to reference the text.</p>
            <p> </p>
            <p> There are studies on the evolution of 
                <italic>P. aeruginosa</italic> in TSB, SCFM, and SCFM2 by Schick A, Kassen R (2018)
                <sup>
                    <xref ref-type="bibr" rid="rep-ref-152082-1">1</xref>
                </sup>, Azimi 
                <italic>et al., </italic>2020
                <sup>
                    <xref ref-type="bibr" rid="rep-ref-152082-2">2</xref>
                </sup>, and Flynn 
                <italic>et al.,</italic> 2016
                <sup>
                    <xref ref-type="bibr" rid="rep-ref-152082-3">3</xref>
                </sup>, showing the emergence of various morphotypes in the populations that authors may want to include.</p>
            <p> </p>
            <p> The emergence of the observed morphotypes and phenotypes in this study is similar to what is observed as a result of evolving 
                <italic>P. aeruginosa </italic>in other preclinical infection models are not unique to novel developed media. I suggest that authors include&#x00a0;previous studies, discussing how future studies of genetic and phenotypic adaptation to the developed media are required. Thus, future analysis can confirm the unique adaptive traits observed in this study, similar to upper and lower CF respiratory infections.</p>
            <p> </p>
            <p> In Table 14, I believe the title is somewhat of a misnomer. The table shows when each morphotype appears and whether it is maintained in the populations. I would consider re-titling this table to reflect the prevalence of each morphotype over the evolution period.</p>
            <p>Is the rationale for developing the new method (or application) clearly explained?</p>
            <p>Yes</p>
            <p>Are the 3Rs implications of the work described accurately?</p>
            <p>Yes</p>
            <p>Is the description of the method technically sound?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Yes</p>
            <p>Are the conclusions about the method and its performance adequately supported by the findings presented in the article?</p>
            <p>Partly</p>
            <p>If any results are presented, are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Are a suitable application and appropriate end-users identified?</p>
            <p>Yes</p>
            <p>Are sufficient details provided to allow replication of the method development and its use by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Chronic infections, Biogeography of Infection, Pseudomonas aeruginosa population dynamics.</p>
            <p>We confirm that we have read this submission and believe that we have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
        <back>
            <ref-list>
                <title>References</title>
                <ref id="rep-ref-152082-1">
                    <label>1</label>
                    <mixed-citation publication-type="journal">
                        <person-group person-group-type="author"/>:
                        <article-title>Rapid diversification ofPseudomonas aeruginosa in cystic fibrosis lung-like conditions</article-title>.
                        <source>
                            <italic>Proceedings of the National Academy of Sciences</italic>
                        </source>.<year>2018</year>;<volume>115</volume>(<issue>42</issue>) :
                        <elocation-id>10.1073/pnas.1721270115</elocation-id>
                        <fpage>10714</fpage>-<lpage>10719</lpage>
                        <pub-id pub-id-type="doi">10.1073/pnas.1721270115</pub-id>
                    </mixed-citation>
                </ref>
                <ref id="rep-ref-152082-2">
                    <label>2</label>
                    <mixed-citation publication-type="journal">
                        <person-group person-group-type="author"/>:
                        <article-title>Allelic polymorphism shapes community function in evolving Pseudomonas aeruginosa populations.</article-title>
                        <source>
                            <italic>ISME J</italic>
                        </source>.<volume>14</volume>(<issue>8</issue>) :
                        <elocation-id>10.1038/s41396-020-0652-0</elocation-id>
                        <fpage>1929</fpage>-<lpage>1942</lpage>
                        <pub-id pub-id-type="pmid">32341475</pub-id>
                        <pub-id pub-id-type="doi">10.1038/s41396-020-0652-0</pub-id>
                    </mixed-citation>
                </ref>
                <ref id="rep-ref-152082-3">
                    <label>3</label>
                    <mixed-citation publication-type="journal">
                        <person-group person-group-type="author"/>:
                        <article-title>Evolution of Ecological Diversity in Biofilms of Pseudomonas aeruginosa by Altered Cyclic Diguanylate Signaling</article-title>.
                        <source>
                            <italic>Journal of Bacteriology</italic>
                        </source>.<year>2016</year>;<volume>198</volume>(<issue>19</issue>) :
                        <elocation-id>10.1128/JB.00048-16</elocation-id>
                        <fpage>2608</fpage>-<lpage>2618</lpage>
                        <pub-id pub-id-type="doi">10.1128/JB.00048-16</pub-id>
                    </mixed-citation>
                </ref>
            </ref-list>
        </back>
        <sub-article article-type="response" id="comment9031-152082">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>RUHLUEL</surname>
                            <given-names>DILEM</given-names>
                        </name>
                        <aff>University of Liverpool, UK</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>18</day>
                    <month>11</month>
                    <year>2022</year>
                </pub-date>
            </front-stub>
            <body>
                <p>Thank you for the positive comments regarding the manuscript and for your helpful suggestions for improvements and discussion points. We have addressed each point raised, below and have submitted an updated manuscript version in which the changes have been made.</p>
                <p> </p>
                <p> 
                    <italic>The authors determined these novel media's viability over 30 days by measuring PAO1 biofilm formation at 0, 10, 20, and 30 days. While it is nice to show that the media sustain similar levels of biofilm growth regardless of whether the media is freshly prepared, this might not be the best indicator of media stability over long periods. Instead, it would have been nice to see the authors conduct LCMS analyses to determine the stability of each of the chemical components at 0 and 30 days and detect if any possible degradation had occurred. Also, it is important to determine whether the growth of&#x00a0;P. aeruginosa&#x00a0;in the stored media displays any altered metabolism, physiology, or spatial organization.</italic>
                </p>
                <p> </p>
                <p> We agree both that LCMS would offer a more complete determination of chemical stability and that investigation of bacterial metabolism, physiology and spatial organisation would be desirable. We have added a sentence to the discussion, highlighting the need for further studies into media stability. These studies are underway in our lab.</p>
                <p> </p>
                <p> 
                    <italic>Additionally, instead of hand-picking a short list of four genes, it would have greatly strengthened the supporting case for these novel media by RNA-seq analysis. For example, comparing the entire transcriptional profile of&#x00a0;P. aeruginosa&#x00a0;grown in new media (fresh and stored at 4&#x00b0; C) to the transcriptional profile of cells grown in SCFM2 and&#x00a0;in vivo&#x00a0;samples would confirm the similarity of these preclinical models to the infection and healthy environments.</italic>
                </p>
                <p>
                    <italic> </italic>
                </p>
                <p>
                    <italic> I also understand that these experiments can be addressed in the future and are out of the scope of this study, which aimed to introduce these novel media for upper and lower respiratory tracts; however, I recommend that authors address this in the discussion section. I recommend authors include these studies and discuss the key benefits of using the novel HSM, CFSM, HLM, and CFLM media over the other versions available.</italic>
                </p>
                <p> </p>
                <p> We completely agree and these studies have already begun. The large RNAseq dataset will require careful analysis. We feel that the space and word count needed to describe those data fully would make the current manuscript overly lengthy. As the reviewers suggest, we have instead mentioned the need for these investigations in the discussion.</p>
                <p> </p>
                <p> 
                    <italic>In the section titled &#x201c;Airway mimicking media is stable for at least 30 days at 4&#x00b0; C,&#x201d; the wording of the first sentence leads to some confusion. At first glance, it appears to imply that PAO1 was cultured for 30 days, although the authors meant to say that PAO1 was cultured in media that had been stored for 30 days. The authors may want to re-write this sentence to avoid confusion.</italic>
                </p>
                <p> </p>
                <p> Sorry for this confusion, we have now reworded the sentence.</p>
                <p> </p>
                <p> 
                    <italic>In Tables 3, 8, and 12, please use a consistent format for the concentration units &#x03bc;g/L or &#x03bc;g/l.</italic>
                </p>
                <p> </p>
                <p> We have now used &#x03bc;g/l throughout.</p>
                <p> </p>
                <p> 
                    <italic>In Figure 5, the legend below the chart is redundant, as it shows the same data as the labels on the X-axis. I would recommend removing this legend to simplify the readers' view.</italic>
                </p>
                <p> </p>
                <p> This figure has been reworked and the legend removed.</p>
                <p> </p>
                <p> 
                    <italic>In Figure 6, standard deviation bars and significance labels would help the reader understand which relationships are significant without having to reference the text.</italic>
                </p>
                <p> </p>
                <p> Standard deviation bars and significance labels have now been added to these graphs and we have described ANOVA summary statistics in the main text.</p>
                <p> </p>
                <p> 
                    <italic>There are studies on the evolution of&#x00a0;P. aeruginosa&#x00a0;in TSB, SCFM, and SCFM2 by Schick A, Kassen R (2018)
                        <ext-link ext-link-type="uri" xlink:href="https://f1000research.com/articles/11-1007/v1#rep-ref-152082-1">1</ext-link>
                    </italic>
                    <italic>, Azimi&#x00a0;et al.,&#x00a0;2020
                        <ext-link ext-link-type="uri" xlink:href="https://f1000research.com/articles/11-1007/v1#rep-ref-152082-2">2</ext-link>
                    </italic>
                    <italic>, and Flynn&#x00a0;et al.,&#x00a0;2016
                        <ext-link ext-link-type="uri" xlink:href="https://f1000research.com/articles/11-1007/v1#rep-ref-152082-3">3</ext-link>
                    </italic>
                    <italic>, showing the emergence of various morphotypes in the populations that authors may want to include.</italic>
                </p>
                <p> </p>
                <p> Thank you for highlighting this. Reference to these studies has been added to our discussion.</p>
                <p> </p>
                <p> 
                    <italic>The emergence of the observed morphotypes and phenotypes in this study is similar to what is observed as a result of evolving&#x00a0;P. aeruginosa&#x00a0;in other preclinical infection models are not unique to novel developed media. I suggest that authors include&#x00a0;previous studies, discussing how future studies of genetic and phenotypic adaptation to the developed media are required. Thus, future analysis can confirm the unique adaptive traits observed in this study, similar to upper and lower CF respiratory infections.</italic>
                </p>
                <p> </p>
                <p> Thank you for this suggestion. We have added the three references mentioned in the previous comment, alongside some discussion of the need to deconvolute those phenotypes that are adaptive for different respiratory environments from those that are merely adaptive to different modes of growth.</p>
                <p> </p>
                <p> 
                    <italic>In Table 14, I believe the title is somewhat of a misnomer. The table shows when each morphotype appears and whether it is maintained in the populations. I would consider re-titling this table to reflect the prevalence of each morphotype over the evolution period.</italic>
                </p>
                <p> </p>
                <p> We have re-titled this table. Unfortunately, these data were captured as presence/absence for each morphotype, at each time point. We don&#x2019;t, therefore, have information on relative or absolute morphotype abundance over time.</p>
            </body>
        </sub-article>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report151644">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.137340.r151644</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Friman</surname>
                        <given-names>Ville-Petri</given-names>
                    </name>
                    <xref ref-type="aff" rid="r151644a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r151644a1">
                    <label>1</label>Department of Biology, University of York, York, UK</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>25</day>
                <month>10</month>
                <year>2022</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2022 Friman VP</copyright-statement>
                <copyright-year>2022</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport151644" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.125074.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>This is a very nice manuscript describing four new synthetic media mimicking growth conditions in the human lung. The main advancement is the development of both CF and healthy lung media and the addition of host-derived antimicrobials and stimulators (bile salts and polyamines) of bacterial signalling systems that are not included in commonly used SCFM2 medium. To some extent, this comparison falls a bit short as not all measurements are performed in SCFM2 and developed media. Moreover, the gene expression analysis relies on the expression of a few marker genes instead of whole genome transcriptomics, which could have revealed further interesting differences and allowed linking data with available transcriptomics data from CF lungs. Nevertheless, these are small omissions and could perhaps just be discussed briefly in the discussion.</p>
            <p> </p>
            <p> My main concern is the statistical analysis that could be improved a bit. I would suggest using full factorial analysis to clearly show if growth in the media is different for the two studied strains and if there are any interesting interactions between strain identity and specific media. These statistics should be properly reported in the text or supplementary tables including test statistics, error, and degrees of freedom.</p>
            <p> </p>
            <p> I would suggest: 
                <list list-type="bullet">
                    <list-item>
                        <p>Use Repeated Measures Anova or GLMMs for analysing time-dependent data in Figure 1.</p>
                    </list-item>
                    <list-item>
                        <p>Include strain identity in the model in Figures 2-3 to statistically compare if strains grew differently in these media.</p>
                    </list-item>
                    <list-item>
                        <p>Figure 4: Which bacteria were grown in these media before the measurements? Or is this data averaged over both bacteria? Needs a little bit more information.</p>
                    </list-item>
                    <list-item>
                        <p>Figure 5: Could also analyse the effect of time for each media and across all media to show that no change in biofilm formation was observed. I would reconsider naming this measure as &#x2018;Stability of biofilm formation&#x2019; as this is what you measure instead of media stability, which could be understood as a measure of degradation of its components. Just to avoid confusion.</p>
                    </list-item>
                    <list-item>
                        <p>Figure 6: I think the results here are much more nuanced than described in the results text. For example, the expression of algU is clearly different from other marker genes and there is no clear increase in its expression relative to growth in LB media (in contrast to what is said in the results text). Here, factorial Anova (or GLMM) would be powerful to show significant interactions between different media, studied strains, and developed media.</p>
                    </list-item>
                    <list-item>
                        <p>Figure 7 and Table 14: Do you have quantitative data for colony morphotype frequencies during the experiment? Data is now quite descriptive.</p>
                    </list-item>
                    <list-item>
                        <p>Out of interest, did you specifically test the effect of freezing (-80&#x00b0;C) for media composition?</p>
                    </list-item>
                </list>
            </p>
            <p>Is the rationale for developing the new method (or application) clearly explained?</p>
            <p>Yes</p>
            <p>Are the 3Rs implications of the work described accurately?</p>
            <p>Yes</p>
            <p>Is the description of the method technically sound?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Partly</p>
            <p>Are the conclusions about the method and its performance adequately supported by the findings presented in the article?</p>
            <p>Yes</p>
            <p>If any results are presented, are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Are a suitable application and appropriate end-users identified?</p>
            <p>Yes</p>
            <p>Are sufficient details provided to allow replication of the method development and its use by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Microbiology</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
        <sub-article article-type="response" id="comment9030-151644">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>RUHLUEL</surname>
                            <given-names>DILEM</given-names>
                        </name>
                        <aff>University of Liverpool, UK</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>18</day>
                    <month>11</month>
                    <year>2022</year>
                </pub-date>
            </front-stub>
            <body>
                <p>Thank you for the helpful comments and suggestions for alternative data analysis. We have addressed each point raised, below and have submitted a revised manuscript in which the indicated changes have been made.</p>
                <p> </p>
                <p> 
                    <italic>To some extent, [the phenotypic] comparison falls a bit short as not all measurements are performed in SCFM2 and developed media. Moreover, the gene expression analysis relies on the expression of a few marker genes instead of whole genome transcriptomics, which could have revealed further interesting differences and allowed linking data with available transcriptomics data from CF lungs. Nevertheless, these are small omissions and could perhaps just be discussed briefly in the discussion.</italic>
                </p>
                <p> </p>
                <p> We agree that transcriptomic data would represent an important validation dataset for these media. We have now added some discussion of this point to the manuscript and hope to be able to report these data shortly. We agree, also, that it would be preferable to have SCFM2 data for all phenotypic comparisons. Where these are absent, we have now referenced studies conducted by others, in which SCFM2 was used.</p>
                <p> </p>
                <p> 
                    <italic>My main concern is the statistical analysis that could be improved a bit. I would suggest using full factorial analysis to clearly show if growth in the media is different for the two studied strains and if there are any interesting interactions between strain identity and specific media. These statistics should be properly reported in the text or supplementary tables including test statistics, error, and degrees of freedom.</italic>
                </p>
                <p>
                    <italic> </italic>
                </p>
                <p>
                    <italic> I would suggest:</italic>
                </p>
                <p> 
                    <italic>Use Repeated Measures Anova or GLMMs for analysing time-dependent data in Figure 1.</italic>
                </p>
                <p> </p>
                <p> We were cautious of over-interpreting these data, particularly when comparing between strains, as PAO1 and LESB65 have considerable differences in growth profile, even in standard laboratory media. However, we agree with the reviewer that comparisons of relative growth between media would be informative. We have now included empirical area under the curve (AUC_e) values for both strains, in all four media. These were determined from the original growth data in Figure 1. Two-way ANOVA analysis (alpha 0.05) of the AUC_e values shows that both strain and media type are significant variables (p &lt; 0.0001, with 3 df for media type, p = 0.0084, with 1 df for strain). Sidak&#x2019;s multiple comparison testing demonstrates the success of PAO1 in the CF media, relative to in healthy sinus and lung media. P values and a description of the findings have been added to the manuscript text and the AUC_e values are presented in Figure 1C.</p>
                <p> 
                    <italic>Include strain identity in the model in Figures 2-3 to statistically compare if strains grew differently in these media.</italic>
                </p>
                <p> </p>
                <p> We have done as suggested and provide updated figures, analysis and text in the revised manuscript. Strain was found to be a significant variable in both biofilm assays. We have reported summary statistics and pairwise comparisons in the text. Briefly, for crystal violet assays, PAO1 formed attached biofilms more readily than LESB65 in all airway niche media bar HLM (p &lt; 0.0001 vs LESB65 in HSM, CFSM and CFLM, p &gt; 0.9999 in HLM in two-way ANOVA with Sidak&#x2019;s multiple comparisons test). In resazurin assays, PAO1 biofilm formation differed significantly from that of LESB65 in HLM (p = 0.0001) and HSM (p &lt; 0.0001) but not in the other media tested.</p>
                <p> </p>
                <p> 
                    <italic>Figure 4: Which bacteria were grown in these media before the measurements? Or is this data averaged over both bacteria? Needs a little bit more information.</italic>
                </p>
                <p> </p>
                <p> This was done with PAO1. We have added this info to the figure legend and the text in the results section.</p>
                <p> 
                    <italic>Figure 5: Could also analyse the effect of time for each media and across all media to show that no change in biofilm formation was observed.</italic>
                </p>
                <p> </p>
                <p> We have re-analysed with an ordinary two-way ANOVA. Media is a significant factor (P&lt;0.0001), whilst media storage time is not (P=0.4174). No individual pairwise comparisons between timepoints proved significant for any of the four media. We have reported the ANOVA summary statistics in the text, as suggested.</p>
                <p> </p>
                <p> 
                    <italic>I would reconsider naming this measure as &#x2018;Stability of biofilm formation&#x2019; as this is what you measure instead of media stability, which could be understood as a measure of degradation of its components. Just to avoid confusion. </italic>
                </p>
                <p> </p>
                <p> The title has been changed, as suggested.</p>
                <p> 
                    <italic>Figure 6: I think the results here are much more nuanced than described in the results text. For example, the expression of algU is clearly different from other marker genes and there is no clear increase in its expression relative to growth in LB media (in contrast to what is said in the results text). Here, factorial Anova (or GLMM) would be powerful to show significant interactions between different media, studied strains, and developed media.</italic>
                </p>
                <p> &#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;</p>
                <p> Apologies, our interpretation of these data was overly simplistic. We have now performed two-way ANOVA for each gene, to assess the contribution of strain and media type to observed differences. We have reported these in the manuscript, along with updated graphs and data descriptions. Briefly, strain was found to be a significant variable for 
                    <italic>mexB </italic>and 
                    <italic>PA2382 </italic>expression (p &lt; 0.0001 for both), whilst media type was a significant variable for 
                    <italic>mexB </italic>(p = 0.0308) and 
                    <italic>PA2911</italic> (p = 0.0462) expression. In Dunnett&#x2019;s multiple comparison test, with LB set as the control group for each strain, significant differences in gene expression were identified for 
                    <italic>mexB </italic>with LESB65 grown in HSM (p = 0.0249) or CFSM (p = 0.0201) and for 
                    <italic>PA2382 </italic>with PAO1 grown in CFSM (p = 0.0243) or CFLM (p = 0.0273). We agree that 
                    <italic>algU </italic>is clearly different from the other genes and have acknowledged this in the manuscript text.</p>
                <p> 
                    <italic>Figure 7 and Table 14: Do you have quantitative data for colony morphotype frequencies during the experiment? Data is now quite descriptive.</italic>
                </p>
                <p> </p>
                <p> Unfortunately not. We plated a proportion of the total growth at each transfer and then recorded the different colony morphotypes as present or absent, rather than a quantitative measure.</p>
                <p> 
                    <italic>Out of interest, did you specifically test the effect of freezing (-80&#x00b0;C) for media composition?</italic>
                </p>
                <p> </p>
                <p> Only in the same way as reported for the 4&#x00b0;C storage, i.e. we confirmed that the media would still support biofilm growth. We&#x2019;ve added to the discussion that LCMS could provide additional useful data on media stability under different conditions.</p>
            </body>
        </sub-article>
    </sub-article>
</article>
