<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.133145.1</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>Anti-cytokine storm activity of fraxin and quercetin, alone and in combination, and their possible molecular mechanisms via TLR4 and PPAR-&#x03b3; signaling pathways in lipopolysaccharide-induced RAW 264.7 cell line</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 1; peer review: 1 approved with reservations, 1 not approved]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>S. Shaker</surname>
                        <given-names>Nada</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <uri content-type="orcid">https://orcid.org/0009-0002-9836-9625</uri>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>B. Sahib</surname>
                        <given-names>Hayder</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Software</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-0939-5622</uri>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>A. Hussein</surname>
                        <given-names>Zeena</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>J. Tahseen</surname>
                        <given-names>Nibras</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Software</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a3">3</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Pharmacology department, Al-Nahrain university, college of medicine, Baghdad, 10072, Iraq</aff>
                <aff id="a2">
                    <label>2</label>Pharmacology department, Al- Nahrain university, college of pharmacy, Baghdad, 10072, Iraq</aff>
                <aff id="a3">
                    <label>3</label>Pharmacology Department, Al-Bayan university, college of pharmacy, Baghdad, 10023, Iraq</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:dr.nada.s.shaker@gmail.com">dr.nada.s.shaker@gmail.com</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>8</day>
                <month>9</month>
                <year>2023</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2023</year>
            </pub-date>
            <volume>12</volume>
            <elocation-id>1120</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>30</day>
                    <month>5</month>
                    <year>2023</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2023 S. Shaker N et al.</copyright-statement>
                <copyright-year>2023</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/12-1120/pdf"/>
            <abstract>
                <p>
                    <bold>Background:</bold> Cytokine storm syndrome (CSS) is a leading cause of morbidity and mortality in patients with late-stage coronavirus disease 2019 (COVID-19), causing multiple organ failure and death. According to prior research, fraxin, and quercetin have anti-inflammatory, antioxidant, antimicrobial, and antiviral properties. Therefore, this study aimed to investigate the anti-cytokine storm activity of fraxin and quercetin, their combination, and the molecular mechanism behind this activity in Lipopolysaccharide (LPS)-induced RAW 264.7 cells.</p>
                <p>
                    <bold>Methods:</bold> LPS-induced macrophage cells were treated with fraxin, quercetin, or their combinations at various doses for cytotoxicity, anti-cytokine assays, and gene expression analyses. An enzyme-linked immunosorbent assay was used to quantify the levels of proinflammatory cytokines, interleukin 1 beta (IL1&#x03b2;), interleukin 6 (IL-6), and tumor necrosis factor-&#x03b1; (TNF-&#x03b1;), and RT-PCR was used to measure the gene expression of PPAR-&#x03b3; and Toll-like receptor 4 (TLR-4) concerning GAPDH as a reference gene.</p>
                <p>
                    <bold>Results:</bold> The results revealed a slight decrease in cell viability only when higher concentrations were applied to the cells. Fraxin, quercetin, and their combination reduced the generation of proinflammatory cytokines. The combination (fraxin + quercetin (FQ)) reduced the levels of IL-1&#x03b2;, IL-6, and TNF-&#x03b1; by 56.2%, 58.5%, and 70.6% respectively, compared to the LPS-only control; pretreatment of cells with farxin, quercetin, and their combination resulted in significant inhibition of TLR-4 gene expression by 89%, 82%, and 93% respectively, compared to the control (P&#x02c2; 0.05); FQ upregulated PPAR-&#x03b3; expression up to 60-fold compared to the control, while fraxin and quercetin increased PPAR-&#x03b3; by 17.6 and 8.6-folds, respectively.</p>
                <p>
                    <bold>Conclusions:</bold> Based on these findings, fraxin, quercetin and their combination might be considered anti-cytokine storm agents, which could lay the groundwork for future research into other combinations of fraxin and quercetin, as well as the pathways involved in the molecular mechanisms underlying the synergistic anti-cytokine-storm-activity.</p>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>Fraxin</kwd>
                <kwd>Quercetin</kwd>
                <kwd>Anti-Cytokine Storm</kwd>
                <kwd>RAW 264.7 Murine Macrophage Cell Line</kwd>
                <kwd>Lipopolysaccharide</kwd>
                <kwd>Proinflammatory Cytokines</kwd>
                <kwd>PPAR &#x0393;</kwd>
                <kwd>TLR-4</kwd>
                <kwd>Tnf&#x03b1;</kwd>
                <kwd>IL1&#x03b2;</kwd>
                <kwd>IL6</kwd>
                <kwd>Synergistic Combination</kwd>
                <kwd>MTT Assay</kwd>
            </kwd-group>
            <funding-group>
                <funding-statement>The author(s) declared that no grants were involved in supporting this work.</funding-statement>
            </funding-group>
        </article-meta>
    </front>
    <body>
        <sec id="sec1" sec-type="intro">
            <title>Introduction</title>
            <p>A cytokine storm is a condition of uncontrolled systemic hyperinflammation caused by excess cytokines, leading to multiorgan failure.
                <sup>
                    <xref ref-type="bibr" rid="ref1">1</xref>
                </sup> Cytokine storms may occur for many reasons, including malignancy, rheumatoid arthritis, and sepsis. Recently, cytokine storms were found to be related to mortality and morbidity in many cases of coronavirus disease 2019 (COVID-19).
                <sup>
                    <xref ref-type="bibr" rid="ref2">2</xref>
                </sup> Since coronavirus disease is characterized by hyperinflammation and an excessive immune response, the need to develop anti-cytokine drugs has increased.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>
                </sup> Lipopolysaccharide (LPS), a component of the outer membrane of gram-negative bacteria, signals toll-like receptor 4 (TLR 4) to activate macrophages, which stimulates several intracellular signaling pathways, including those for nuclear transcription factor kappa-B (NF-B) and mitogen-activated protein kinases (MAPKs). Interleukin IL-6, IL-1, and tumor necrosis factor (TNF-&#x03b1;) are proinflammatory cytokines activated macrophages release.
                <sup>
                    <xref ref-type="bibr" rid="ref4">4</xref>
                </sup>
            </p>
            <p>Fraxin, a coumarin derived from the plant Fraxinus and Cortex fraxin, is referred to as 7,8-Dihydroxy-6-methoxy coumarin, 8-D glucopyranoside.
                <sup>
                    <xref ref-type="bibr" rid="ref5">5</xref>
                </sup> Fraxin possesses different pharmacological activities, including as an anticancer, antiviral, anti-inflammatory, and antioxidant.
                <sup>
                    <xref ref-type="bibr" rid="ref6">6</xref>
                </sup> For this vast potential, fraxin is a target for further immunomodulating studies.</p>
            <p>Quercetin is a bioflavonoid widely distributed in apples, berries, grapes, and onions. Quercetin was reported in previous studies as having a wide range of biological actions, such as anti-inflammatory properties due to the inhibition of inflammation-related enzymes, cyclooxygenase (COX), and lipoxygenase (LOX).
                <sup>
                    <xref ref-type="bibr" rid="ref7">7</xref>
                </sup> RAW 264.7, a standard monocyte/macrophage cell line, is mainly used to study the anti-inflammatory activity of plant-derived extracts and their active constituents by evaluating the reduction in the production of inflammatory mediators, cytokines, and chemokines in LPS-stimulated RAW 264.7 cells (RAW 264.7 a macrophage cell line that was established from a tumor in a male mouse induced with the Abelson murine leukemia virus).
                <sup>
                    <xref ref-type="bibr" rid="ref8">8</xref>
                </sup>
            </p>
            <p>Peroxisome proliferator-activated receptor &#x03b3; (PPAR-&#x03b3;) is a nuclear hormone receptor and a ligand-activated transcription factor family member. Increasing evidence indicates promising anti-inflammatory properties of cancer cells exerted by activating PPAR&#x03b3; by synthetic ligands.
                <sup>
                    <xref ref-type="bibr" rid="ref9">9</xref>
                </sup>
            </p>
            <p>PPAR-&#x03b3; agonists have been thought to inhibit the production of monocyte inflammatory cytokines and the expression of inducible nitric oxide synthase (iNOS), which has been observed in response to synthetic anti-diabetic thiazolidinedione drugs (such as BRL 49653 and ciglitizone), and negatively regulates the expression of proinflammatory genes and suppresses tumor cell growth.
                <sup>
                    <xref ref-type="bibr" rid="ref10">10</xref>
                </sup>
            </p>
            <p>Drug combinations have been previously used as a new approach for treating many diseases. Their beneficial effects appear to be enhancing pharmacological activity and minimizing the dose to avoid any unwanted side effects of drugs without compromising their efficacy.
                <sup>
                    <xref ref-type="bibr" rid="ref11">11</xref>
                </sup> Furthermore, previous literature mentioned that both fraxin and quercetin possess some antioxidant and anti-inflammatory activity in different disease models. In this research, we aim to investigate fraxin and quercetin anti-cytokine storm effects through suppression of the production of proinflammatory cytokines from the LPS-induced murine macrophage RAW 264.7 cell line, the possible mechanism underlying it, through changes in expression of TLR4 and PPAR-&#x03b3; signaling pathways, and if there is a potential synergy between them when combined using isobolographic analysis, based on the median effect principle.
                <sup>
                    <xref ref-type="bibr" rid="ref12">12</xref>
                </sup>
            </p>
        </sec>
        <sec id="sec2" sec-type="methods">
            <title>Methods</title>
            <sec id="sec3">
                <title>Ethical consideration</title>
                <p>The investigations followed the guidelines established by the Ethics Committee of Al-Nahrain University, College of Medicine (approval number Nah. Co)
                    <italic toggle="yes">. Pha.12</italic> on 27 June 2022.</p>
            </sec>
            <sec id="sec4">
                <title>Chemicals and reagents</title>
                <p>Quercetin hydrated 2-(3,4-dihydroxy phenyl)-3,5,7-trihydroxy-4Hchromenen-4-one dihydrate (purity &#x2265; 96%), fraxin (7,8-Dihydroxy-6-methoxy coumarin-8-beta-D-glucoside) (purity &#x2265; 98%), dexamethasone (purity &#x2265; 98%), and lipopolysaccharide (LPS) (Escherichia coli, 055: B5) were purchased from Hangzhou-Hyper Chem. Limited/China, dimethyl sulfoxide (DMSO) from Thomas Baker/India, Mouse Interleukin1&#x03b2; (IL-1&#x03b2;), (IL-6), and (TNF-&#x03b1;) enzyme-linked immunosorbent assay (ELISA) kits were purchased from MyBiosource, USA, RAW 264.7, (TIB-71) murine macrophage cell line (ATCC
                    <sup>&#x00ae;</sup> TIB-71&#x2122;), and Dulbecco&#x2019;s modified Eagle&#x2019;s medium (DMEM) from American Type Culture Collection (ATCC, USA), fetal bovine serum (10% FBS), Trypsin- EDTA, penicillin/streptomycin solution from Capricorn Scientific/Germany, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) kit from MyBioSource, USA; TRIazol
                    <sup>&#x00ae;</sup> reagent (Invitrogen); RT-PCR primers: glyceraldehyde 3-phosphate dehydrogenase (GAPDH), PPAR-&#x03b3;, and TLR-4 from OriGene/USA, LightCycler
                    <sup>&#x00ae;</sup> FastStart&#x2122; SYBR
                    <sup>&#x00ae;</sup> Green master kit/Roche, Germany, Revert AidTM first strand Complementary Deoxyribonucleic acid (cDNA) synthesis kit/Thermo Scientific, USA (
                    <xref ref-type="table" rid="T1">Tables 1</xref> and 
                    <xref ref-type="table" rid="T2">2</xref>).</p>
                <table-wrap id="T1" orientation="portrait" position="float">
                    <label>Table 1. </label>
                    <caption>
                        <title>Kits and equipment summary.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">CHEMICALS AND EQUIPMENT</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">PROVIDER</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">BATCH, LOT, CAS NO.</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">PRODUCTION AND EXPIRY</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">QUERCETIN HYDRATED</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">HANGZHOU-HYPER CHEM. LIMITED/CHINA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAS NO. 849061-97-8
                                    <break/>LOT NO. C0508275</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">PROD: 1 DEC 2021
                                    <break/>EXP: 30 NOV 2023</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">FRAXIN</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">HANGZHOU-HYPER CHEM. LIMITED/CHINA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAS NO. 524-30-1
                                    <break/>BATCH NO. DSTQ000701</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">PROD: 3 JUNE 2021
                                    <break/>EXP: 2 JUNE 2023</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">DEXAMETHASONE</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">HANGZHOU-HYPER CHEM. LIMITED/CHINA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAS NO. 50-02-2
                                    <break/>BATCH RH278006</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">PROD: 17 JULY 2021
                                    <break/>EXP: 12 JULY 2023</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">LPS (LIPOPOLYSACCHARIDE) ESCHERICHIA COLI, 055: B5</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">HANGZHOU-HYPER CHEM. LIMITED/CHINA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">BATCH NO. 0000114326</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">PROD: 29 DEC 2020
                                    <break/>EXP: DEC. 2026</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">DMSO (DIMETHYL SULFOXIDE)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">THOMAS BAKER/INDIA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAS NO. 67-68-5
                                    <break/>HSN-29309099</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">PROD: MARCH 2021
                                    <break/>EXP: FEB 2026</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">DULBECCO'S MODIFIED EAGLE'S MEDIUM (DMEM)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AMERICAN TYPE CULTURE COLLECTION (ATCC, USA)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. ATCC
                                    <sup>&#x00ae;</sup> 30-2002</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">EXP: JULY 2023</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">FETAL BOVINE SERUM 10%</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAPRICORN, GERMANY</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. FBS-12B
                                    <break/>LOT NO. CP22-5255</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">EXP: JUNE 2027</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">TRYPSIN- EDTA (0.05%) WITH PHENOL RED</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAPRICORN, GERMANY</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. TRY-4B</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">EXP: JUNE 2023</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">PENICILLIN/STREPTOMYCIN SOLUTION</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAPRICORN, GERMANY</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. PS-B
                                    <break/>LOT NO. CP21-4278</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">EXP: JULY 2023</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">MOUSE INTERLEUKIN1B (IL-1B)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">MY BIOSOURCE, USA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. MBS2021142</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">EXP: JULY 2023</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">MOUSE INTERLEUKIN (IL-6),</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">MY BIOSOURCE, USA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. MBS450807</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">EXP: JULY 2023</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">MOUSE INTERLEUKIN (TNF-A)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">MY BIOSOURCE, USA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. MBS2500421</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">EXP: JULY 2023</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">RAW 264.7 (TIB-71) MURINE MACROPHAGE CELL LINE (ATCC
                                    <sup>&#x00ae;</sup> TIB-71&#x2122;)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">FROM AMERICAN TYPE CULTURE COLLECTION (ATCC, USA)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. ATCC
                                    <sup>&#x00ae;</sup> TIB-71&#x2122;</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">NA</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">3-(4,5-DIMETHYLTHIAZOL-2-YL)-2,5-DIPHENYLTETRAZOLIUM BROMIDE (MTT)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">MY BIOSOURCE, USA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. MBS2557032
                                    <break/>LOT NO. DP19BPX83816</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">PROD: NOV 2021</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">ELISA READER
                                    <break/>HUMAREADER HS</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">HUMAN, GERMANY</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT. NO. 16670</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">NA</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">ELISA WASHER, COMBIWASH HUMAN</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">HUMAN, GERMANY</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. 18460</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">NA</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">TRIAZOL
                                    <sup>&#x00ae;</sup> REAGENT</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">(INVITROGEN), USA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. 15596018
                                    <break/>LOT NO. 423910</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">PROD: SEP 2022
                                    <break/>EXP: SEP 2023</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">GAPDH MOUSE QPCR PRIMER PAIR (NM_008084)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">ORIGENE, USA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. MP205604</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">EXP: SEP 2023</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">PPARG MOUSE QPCR PRIMER PAIR (NM_011146)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">ORIGENE, USA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. MP210761</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">EXP: SEP 2023</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">RT-PCR PRIMERS TLR-4
                                    <break/>TLR4 MOUSE QPCR PRIMER PAIR (NM_021297)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">ORIGENE, USA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. MP217025</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">EXP: SEP 2023</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">LIGHTCYCLER
                                    <sup>&#x00ae;</sup> FASTSTARTTM DNA MASTER SYBER GREEN I KIT</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">ROCHE, GERMANY</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. 03003230001</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">EXP: MARCH 2023</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">REVERT AID&#x2122; FIRST STRAND CDNA SYNTHESIS KIT/</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">THERMO SCIENTIFIC, USA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. K1621
                                    <break/>LOT NO. 2682573</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">EXP: 30 SEP 2024</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">DULBECCO&#x2019;S PBS (1X), WITHOUT CA &amp; MG, WITHOUT PHENOL RED (PHOSPHATE-BUFFERED SALINE, PBS)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAPRICORN SCIENTIFIC/GERMANY</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. PBS-1A</td>
                                <td colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Corning cell lifter</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Sigma-Aldrich</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. CLS3008</td>
                                <td colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CHLOROFORM</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">MERCK/GERMANY</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. 107024</td>
                                <td colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">ISOPROPANOL</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">MERCK/GERMANY</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. 109634</td>
                                <td colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">ETHANOL 75%</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">MERCK/GERMANY</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. 100983</td>
                                <td colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">RNASE-FREE WATER</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">SIGMA-ALDRICH/</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. W4502</td>
                                <td colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">ULTRAPURE&#x2122; SODIUM DODECYL SULFATE (SDS)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">THEMO SCIENTIFIC&#x2122;/USA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. 15525017</td>
                                <td colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CENTRIFUGE 5425 R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">EPPENDORF/GERMANY</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. 5406000640</td>
                                <td colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">EPPENDORF SAFE-LOCK TUBES</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">EPPENDORF/GERMANY</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. 022363212</td>
                                <td colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">WATER BATH</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">THEMO SCIENTIFIC&#x2122;/USA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. TSGP02</td>
                                <td colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">NANODROP&#x2122; SPECTROPHOTOMETER</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">THEMO SCIENTIFIC&#x2122;/USA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. ND-2000</td>
                                <td colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">LIGHTCYCLER
                                    <sup>&#x00ae;</sup> FASTSTART
                                    <break/>DNA MASTER SYBR
                                    <break/>GREEN</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">LIFE SCIENCE/ROCHE/SWITZERLAND</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. 03003230001</td>
                                <td colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">EXICYCLER&#x2122;384 REAL &#x2013; TIME PCR SYSTEM</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">BIONEER/REPUBLIC OF KOREA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAT NO. A-2061</td>
                                <td colspan="1" rowspan="1"/>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <table-wrap id="T2" orientation="portrait" position="float">
                    <label>Table 2. </label>
                    <caption>
                        <title>Kits types and sources.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Kit name</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Antibody</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Species/Type</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Polyclonal or Monoclonal</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Mouse Interlukin-6 Elisa Kit</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Capture Antibody</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Rat</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Monoclonal</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Mouse Interlukin-6 Elisa Kit</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Immunogen</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Mouse Protein Corresponding To Uniprot</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&#x2026; ..</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Mouse Interlukin-6 Elisa Kit</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Detection Antibody</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Goat</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Polyclonal</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Mouse Interlukin-6 Elisa Kit</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Standard</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">E. coli Expressed Recombinant Protein Corresponding To Amino Acids 25-211</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&#x2026; &#x2026; ..</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Mouse Interlukin-1 Beta Elisa Kit</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Capture Antibody</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Rabbit</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Polyclonal</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Mouse Interlukin-1 Beta Elisa Kit</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Immunogen</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Recombinant Partial-Length Protein Corresponding To Amino Acids Val118-Ser269, Of Uniprot, Via E. coli</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">----------</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Mouse Interlukin-1 Beta Elisa Kit</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Detection Antibody</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Rabbit</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Polyclonal</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Mouse Interlukin-1 Beta Elisa Kit</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Standard</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Recombinant Partial-Length Protein Corresponding To Amino Acids Val118-Ser269, Of Uniprot, Via E. coli.</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">----------</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Mouse TNF-Alpha Elisa Kit</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Capture Antibody</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Rat</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Monoclonal</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Mouse TNF-Alpha Elisa Kit</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Immunogen</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Recombinant Partial-Length Protein Corresponding To Amino Acids 80-235, Of Uniprot ID P06804, Via E. coli.</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">---------</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Mouse TNF-Alpha Elisa Kit</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Detection Antibody</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Rabbit</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Polyclonal</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Mouse TNF-Alpha Elisa Kit</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Standard</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Recombinant Partial-Length Protein Corresponding To Amino Acids 80-235, Of Uniprot ID P06804, Via E. coli.</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">----------</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <p>
                    <bold>Cell culture</bold>
                </p>
                <p>The RAW264.7 TIB-71 murine macrophage cell line was maintained in Dulbecco&#x2019;s Modified Eagle Medium (Capricorn Scientific) with 10% fetal bovine serum (FBS) 1% penicillin-streptomycin and then kept in an incubator at 37&#x00b0;C with 5% carbon dioxide until confluent. Trypsin-EDTA was used to clean and harvest cells.
                    <sup>
                        <xref ref-type="bibr" rid="ref13">13</xref>
                    </sup>
                </p>
                <p>
                    <bold>Method of trypsinization, cell harvesting using trypsin-EDTA</bold>
                </p>
                <p>The trypsinization procedure was performed in a laminar flow hood using proper aseptic technique. Trypsin, media, and phosphate buffer solution (PBS) were warmed in a 36&#x00b0;C water bath for at least 20 minutes prior to the procedure. All growth media was aspirated from the cell culture flask, washed once with PBS, and gently shaken with the PBS around the flask and aspirated. Half of the culture volume of trypsin was ejected directly onto cells, which was enough to cover the cells. The cells were incubated for 5 minutes at 37&#x00b0;C. cells were quite adherent to the flask. Cell lifter was needed at this point, trypsin was neutralized with serum containing medium (half of culture volume + 0.5 mL); warm media was directly ejected onto cells and a cell lifter was used gently to scrape cells off the flask. The cell suspension was collected from the flask and centrifuged for 4 minutes at 2500 rpm, after which the trypsin-containing supernatant was then discarded, and the cell pellet was resuspended with fresh medium, and counted or cultured as desired.
                    <sup>
                        <xref ref-type="bibr" rid="ref13">13</xref>
                    </sup>
                </p>
            </sec>
            <sec id="sec5">
                <title>Cell viability assay (MTT assay)</title>
                <p>Cell viability in RAW264.7 was evaluated using the MTT assay after treatment with quercetin, fraxin, and fraxin + quercetin (FQ). RAW264.7 cells were plated at a density of 1 &#x00d7; 10
                    <sup>4</sup> cells/well in a 96-well plate and allowed to grow for 24 h. before the medium was removed. Then the cells were treated with fraxin, quercetin, and FQ in a ratio of 1:1 in serial dilutions (200, 100, 50, 25, 12.5, and 6.25 &#x03bc;g/ml), each concentration in tri-replicate, for 2 h. from the treatment. First, LPS (1 &#x03bc;g/ml) was added to each well and incubated for 24 h. Next, 20 &#x03bc;L of MTT (5 mg/mL) was added to each well, followed by incubation for 4 h at 37&#x00b0;C with 5% CO
                    <sub>2</sub>. After removing the media, 150 &#x03bc;L of dimethyl sulfoxide (DMSO) was added to each well to dissolve the insoluble formazan crystals in viable cells. The ELISA plate reader read an absorbance of 540 nm. Cell viability was calculated relative to the untreated control cells, which were considered to have 100% viability. The following formula was used to determine cell viability:
                    <disp-formula id="e1">
                        <mml:math display="block">
                            <mml:mtext>Cell viability</mml:mtext>
                            <mml:mspace width="0.25em"/>
                            <mml:mfenced close=")" open="(">
                                <mml:mo>%</mml:mo>
                            </mml:mfenced>
                            <mml:mo>=</mml:mo>
                            <mml:mtext>absorbance of sample</mml:mtext>
                            <mml:mo>/</mml:mo>
                            <mml:mtext>absorbance of control</mml:mtext>
                            <mml:mo>&#x00d7;</mml:mo>
                            <mml:mn>100</mml:mn>
                            <mml:mo>.</mml:mo>
                        </mml:math>
                    </disp-formula>
                </p>
                <p>Experiments were performed in triplicate, and the data are presented as mean &#x00b1; standard error of the mean.</p>
            </sec>
            <sec id="sec6">
                <title>Sample preparation</title>
                <p>Quercetin hydrated 2-(3,4-dihydroxy phenyl)-3,5,7-trihydroxy-4Hchromenen-4-one dihydrate (purity &#x02c3; 96%), Fraxin (7,8-Dihydroxy-6-methoxy coumarin-8-beta-D-glucoside) (purity &#x02c3; 98%), and LPS (lipopolysaccharide) (
                    <italic toggle="yes">Escherichia coli</italic>, 055: B5) were all purchased from Hangzhou-Hyper Chem. Limited/China. Both quercetin and fraxin were dissolved using DMSO (Dimethyl sulfoxide, from Thomas Baker/India), and LPS was dissolved and diluted in PBS for preparation of 1 &#x03bc;g/ml solution. Each agent (quercetin and fraxin) was dissolved in DMSO and then diluted to final volume with (Mg
                    <sup>2+</sup>, Ca
                    <sup>2+</sup>)-free PBS buffers at pH 7.4 to prepare a stock solution of 1 mg/ml for each fraxin and quercetin. Serial dilutions were freshly prepared at the same day of the experiment from the stock solution. Agents were tested at concentrations of 200, 100, 50, 25, 12.5, and 6.25 &#x03bc;g/ml and for FQ (half the concentration was tested for each agent in the same well), cells were supplemented with 200 &#x03bc;l of fresh medium along with the tested agent. The concentration of DMSO used (&lt;0.1%) did not influence the performed assays.</p>
            </sec>
            <sec id="sec7">
                <title>Calculation of combination index (CI)</title>
                <p>The results of the MTT assay were analyzed using the isobologram equation for the median effect/combination index (CI) by Chou (2006) and Chou and Talalay (1984). A dose-response curve can be generated by experimenting with different concentrations of each drug and its combination. For example, D is the dose, and Dm is the dose for a 50% effect; in this case, it is equal to IC50%. The parameters of the dose-effect curves were calculated with the help of a computer program (
                    <ext-link ext-link-type="uri" xlink:href="https://www.combosyn.com/">Compusyn</ext-link>), which then determines the CI values using the general combination index equation, from which we can infer that synergism, additive effects, and antagonism are present if the CI value is less than one, equal to one, or more than one, respectively.
                    <sup>
                        <xref ref-type="bibr" rid="ref12">12</xref>
                    </sup>
                </p>
            </sec>
            <sec id="sec8">
                <title>Cytokine levels measurement</title>
                <p>In comparison with dexamethasone as a positive control drug, the anti-cytokine storm activity of fraxin, quercetin, and FQ was evaluated by measuring levels of proinflammatory cytokines IL-1&#x03b2;, IL-6, and TNF-&#x03b1; in RAW 264.7 cells induced with (1 &#x03bc;g/ml) LPS. A 96-well plate was seeded with RAW264.7 cells at a density of 1 &#x00d7; 10
                    <sup>4</sup> cells/well and incubated for 24 h. Cells were pretreated with fraxin (concentration 25 &#x03bc;g/ml), quercetin (concentration 12.5 &#x03bc;g/ml), and FQ (concentration 6.25 &#x03bc;g/ml). These concentrations were selected according to the MTT assay results, and dexamethasone (5 &#x03bc;g/ml) was used as a positive control drug. All treatments were performed in triplicate; untreated cells were considered a negative control. After 2 hours adding treatment, LPS was added to all wells in the plate and incubated for 24 h at 37 &#x00b0;C in a humidified CO
                    <sub>2</sub> 5% incubator. After that the medium was collected and centrifuged at 2000xg for 10 min. Culture supernatants were collected to quantify proinflammatory cytokines by enzyme-linked immunosorbent assay (ELISA) kits for the targeted cytokines IL-1&#x03b2;, IL-6, and TNF-&#x03b1;. All reagents, and dilutions were prepared on instructions provided by the manufacturer (My BioSource, USA). From each, 100 &#x03bc;l of dilution of standards, blank, and the collected samples were added to each well in a 96-well plate then covered, gently shaken, and incubated at 37&#x00b0;C for 60 minutes. The liquid was removed from each well, without washing. A volume of. 100 &#x03bc;l of detection reagent A was added to each well and incubated at 37&#x00b0;C for 60 minutes. The washing was repeated three times, 100 &#x03bc;l detection reagent B was added to each well, and was incubated for 30 minutes at 37&#x00b0;C. The washing was repeated five times, 90 &#x03bc;l substrate Solution was added to each well and incubated for 10&#x2013;20 minutes at 37&#x00b0;C. Away from light, the liquid turned blue, 50 &#x03bc;l stop Solution was added and the liquid turned yellow. Under 450 nm wavelength, the optical density (OD) was calculated. The linear regression equation of the standard curve was computed based on concentrations of standards and related OD values. Then the concentration of the corresponding sample was calculated, and the levels of IL-1&#x03b2;, IL-6, and TNF-&#x03b1; in cell culture supernatants were expressed as pg/ml. The OD was calculated at a wavelength of 450 nm. The linear regression equation of the standard curve was computed based on the concentrations of the standards and corresponding OD values. Then the attention of the corresponding sample was calculated, and the levels of IL-1&#x03b2;, IL-6, and TNF-&#x03b1; in cell culture supernatants were expressed as pg/ml.</p>
            </sec>
            <sec id="sec9">
                <title>Gene expression analysis</title>
                <p>Each well of a 6-well plate was inoculated with 1 &#x00d7; 10
                    <sup>6</sup> cells and incubated for 24 hours. Fraxin (25 &#x03bc;g/ml), quercetin (12.5 &#x03bc;g/ml), and FQ (6.25 &#x03bc;g/ml) were applied to cells in triplicate (1 &#x03bc;g/ml). After Two hours,cells were treated with fraxin, quercetin, and FQ, LPS was added. The cells were then incubated at 37&#x00b0;C for 24 hours in a humidified CO
                    <sub>2</sub> 5% incubator. Prior to harvesting, the cells were rinsed three times with PBS. The cells were pre-treated with fraxin (25 &#x03bc;g/ml), quercetin (12.5 &#x03bc;g/ml), and FQ (6.25 &#x03bc;g/ml) all in triplicate, (1&#x03bc;g/ml) LPS was added after 2 h. Subsequently, cells were incubated for 24 h at 37 &#x00b0;C in a humidified CO2 5% incubator. The cells were washed three times with PBS before being harvested. The growth media was then removed. To lyse the cells, 1 mL of TRIzol&#x2122; Reagent was added directly. The lysate was pipetted up and down several times to homogenize, then incubated for 5 minutes at room temperature before 0.2 mL of chloroform was added, then thoroughly mixed by shaking and incubated for 2&#x2013;3 minutes at room temperature. The sample was centrifuged at 12,000 &#x00d7; g at 4&#x00b0;C for 15 minutes. The mixture separated into a lower red phenol-chloroform, an interphase, and a colorless upper aqueous phase. By angling the tube at 45&#x00b0; and pipetting the solution out, the aqueous phase containing the RNA was transferred to a new tube. After 0.5 mL of isopropanol was added to the aqueous phase, it was incubated for 10 minutes at 4&#x00b0;C before being centrifuged for 10 minutes at 12,000 &#x00d7; g at 4&#x00b0;C. The total RNA precipitated formed a white gel-like pellet at the bottom of the tube, and the supernatant was discarded with a micro pipettor. The pellet was resuspended in 1 mL of 75% ethanol, briefly vortexed then centrifuged for 5 minutes at 7500 &#x00d7; g at 4&#x00b0;C. The supernatant was discarded with a micro pipettor, and the RNA pellet was vacuumed or air dried for 5&#x2013;10 minutes. By pipetting up and down, the pellet was resuspended in 20&#x2013;50 &#x03bc;L of RNase-free water, 0.1 mM EDTA, or 0.5% SDS solution, incubated in a water bath at 55&#x2013;60&#x00b0;C for 10&#x2013;15 minutes, then proceeded to downstream applications, or stored the RNA at -70&#x00b0;C. Total RNA was extracted from stimulated cells using TRIzol
                    <sup>&#x00ae;</sup> reagent, and the first strand of cDNA was produced using a commercial kit according to the manufacturer&#x2019;s instructions, the detailed steps were as the following: after thawing, the kit&#x2019;s components were mixed and briefly centrifuged. The following reagents were added to an ice-cold sterile, nuclease-free tube in the following order:
                    <list list-type="alpha-lower">
                        <list-item>
                            <label>a -</label>
                            <p>Template RNA (total RNA) 0.1 ng &#x2013; 5 &#x03bc;g</p>
                        </list-item>
                        <list-item>
                            <label>b -</label>
                            <p>Primer (Random Hexamer primer) 1 &#x03bc;L</p>
                        </list-item>
                        <list-item>
                            <label>c -</label>
                            <p>Water, nuclease-free added to make the total volume of 12 &#x03bc;L</p>
                        </list-item>
                    </list>
                </p>
                <p>- Total volume 12 &#x03bc;L</p>
                <p>This was gently mixed, briefly centrifuged and incubated at 65&#x00b0;C for 5 min then placed on ice for 1 min. The following components were added in the indicated order:
                    <list list-type="bullet">
                        <list-item>
                            <label>&#x2022;</label>
                            <p>5&#x00d7; Reaction Buffer 4 &#x03bc;L</p>
                        </list-item>
                        <list-item>
                            <label>&#x2022;</label>
                            <p>RiboLock RNase Inhibitor (20 U/&#x03bc;L) 1 &#x03bc;L</p>
                        </list-item>
                        <list-item>
                            <label>&#x2022;</label>
                            <p>10 mM dNTP Mix 2 &#x03bc;L</p>
                        </list-item>
                        <list-item>
                            <label>&#x2022;</label>
                            <p>Revert Aid M-MuLV RT (200 U/&#x03bc;L) 1 &#x03bc;L</p>
                        </list-item>
                    </list>
                </p>
                <p>Total volume 20 &#x03bc;L</p>
                <p>This was gently mixed, and centrifuged briefly, incubated for 5 min at 25&#x00b0;C followed by 60 min at 42&#x00b0;C. The reaction was terminated by heating at 70&#x00b0;C for 5 min.</p>
            </sec>
            <sec id="sec10">
                <title>RNA yield determination</title>
                <p>Total nucleic acid content is determined by 260 nm absorbance, while sample purity is determined by 280 nm absorbance. Because free nucleotides, RNA, ssDNA, and dsDNS absorb at 260 nm, they all contribute to the sample&#x2019;s total absorbance. Using the NanoDropTM spectrophotometer, RNA samples can be quantified by absorbance without prior dilution. In the reaction tube, 18 &#x03bc;l of SYBR Green PCR mix containing nuclease-free water, reverse and forward primers, SYBR Green I dye, 1U Taq DNA polymerase, 1.25 mM MgCl
                    <sub>2</sub>, PCR buffer, and 100 &#x03bc;M Deoxynucleotide triphosphate (dNTP) was added to 2 &#x03bc;l cDNA template to accomplish PCR in 20 &#x03bc;l of the reaction mixture. Primers were used for amplification, and their sequences (5&#x2032;&#x2013;3&#x2032;) are listed in 
                    <xref ref-type="table" rid="T3">Table 3</xref>.</p>
                <table-wrap id="T3" orientation="portrait" position="float">
                    <label>Table 3. </label>
                    <caption>
                        <title>Gene and primer sequence.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Gene</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Primer sequence (5&#x2032;&#x2013;3&#x2032;)</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="center" colspan="1" rowspan="1" valign="top">PPAR-&#x03b3;</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Forward: ATCTACACGATGCTGGC
                                    <break/>Reverse: GGATGTCCTCGATGGG</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1" valign="top">TLR4</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Forward: TAGCCATTGCTGCCAACATC
                                    <break/>Reverse: CCTCAGCAGGGACTTCTCAA</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1" valign="top">GAPDH</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Forward: TGCTGAGTATGTCGTGGAGT
                                    <break/>Reverse: GTTCACACCCATCACAAACA</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <p>The amplification conditions were as follows: the RT-PCR reaction began with one cycle at 95&#x00b0;C for 3 min, followed by one process at 95&#x00b0;C for 25 s, 55&#x00b0;C for 25 s, and 40 cycles at 95 &#x00b0;C for 25 s each to prevent the amplification of non-specific products. A melting curve assay was performed from 60 to 94&#x00b0;C at a transition rate of 1&#x00b0;C/s. The relative expression ratio of each target gene in the experimental group relative to the control group was computed using the 2
                    <sup>
                        <bold>&#x2212;&#x25b3;&#x25b3;Ct</bold>
                    </sup> method and normalized against GAPDH, which was used as an internal reference gene. The results are expressed as fold-changes compared to the control.</p>
            </sec>
            <sec id="sec11">
                <title>Statistical analysis</title>
                <p>All tests were performed in triplicate, and the results are presented as mean &#x00b1; standard error of the mean (SEM), analyzed by one-way ANOVA-Tukey 
                    <italic toggle="yes">post hoc</italic> test for multiple comparisons. 
                    <ext-link ext-link-type="uri" xlink:href="https://www.google.com/url?sa=t&amp;rct=j&amp;q=&amp;esrc=s&amp;source=web&amp;cd=&amp;cad=rja&amp;uact=8&amp;ved=2ahUKEwjj2Pig--T9AhWJgv0HHZ6VDMkQFnoECBAQAw&amp;url=https%3A%2F%2Fwww.ibm.com%2Fproducts%2Fspss-statistics&amp;usg=AOvVaw0lebISejeVG37EO0IeNV5P">SPSS</ext-link> (RRID: SCR_013726) version 25 was used for statistical analysis; P &lt; 0.05, was considered significant.</p>
            </sec>
        </sec>
        <sec id="sec12" sec-type="results">
            <title>Results</title>
            <sec id="sec13">
                <title>Cell viability assay</title>
                <p>The MTT assay determined the cell viability of RAW 264.7 cells
                    <sup>
                        <xref ref-type="bibr" rid="ref35">35</xref>
                    </sup>; 
                    <xref ref-type="fig" rid="f1">Figure 1</xref> illustrates the effects of fraxin, quercetin, and FQ on cell viability (expressed as a percentage compared to the control-untreated cells-considered 100% cell viability) in the presence of LPS. A reduction in cell viability was noticeable with higher concentrations of both fraxin and quercetin. While FQ exhibited the highest cytotoxicity among all three treatment groups, the viability of cells was decreased in a dose-dependent manner.</p>
                <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                    <label>Figure 1. </label>
                    <caption>
                        <title>Effects of fraxin, quercetin, and fraxin + quercetin on RAW 264.7 cell viability.</title>
                        <p>Cell viability was determined using an MTT assay. The lower red line indicates that cells were subjected to different concentrations of all treatment groups with the presence of lipopolysaccharide (LPS) (1 &#x03bc;g/ml), and the upper red line represents 70% cell viability in all treatments. Cell viability was expressed as a percentage compared with the control, which was considered 100% cell viability, and data are presented as mean &#x00b1; SEM.</p>
                    </caption>
                    <graphic id="gr1" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/146120/d528e35a-ba15-4b45-bc7f-084ec0c43ae1_figure1.gif"/>
                </fig>
                <p>Half-maximal inhibitory concentration (IC
                    <sub>50</sub>) values were 248, 54, and 26.5 for fraxin, quercetin, and FQ, respectively. Based on these results, the threshold for cell viability was set at 70% or higher for the anti-cytokine storm assay,
                    <sup>
                        <xref ref-type="bibr" rid="ref8">8</xref>
                    </sup> and the concentrations (25, 12.5, 6.25 &#x03bc;g/ml) for fraxin, quercetin, and FQ were selected, respectively, for the cytokine storm assay following assay.</p>
            </sec>
            <sec id="sec14">
                <title>Calculation of combination index (CI)</title>
                <p>The combination index (CI) for FQ in a 1:1 ratio was calculated using CompuSyn based on the MTT results. Dose-effect and median-effect curves were plotted for each drug and its combination. The Results showed that FQ in a 1:1 ratio exhibited synergism, with CI values of 0.297 at IC
                    <sub>50</sub> and CI values of 0.409, 0.333, 0.332, 0.267, 0.265, and 0.276 at the following concentrations FQ (200, 100, 50, 25, 12,5, 6.25 g/ml).</p>
            </sec>
            <sec id="sec15">
                <title>Anti-cytokine storm assay</title>
                <p>Fraxin, quercetin, and FQ in concentrations of 25, 12.5, 6.25 &#x03bc;g/ml, respectively, significantly suppressed the production of IL-1&#x03b2;, IL-6, and TNF-&#x03b1; (
                    <italic toggle="yes">P</italic> &#x02c2; 0.01) in a dose-dependent manner when compared to control (cells treated with LPS only). LPS significantly upregulated production of proinflammatory cytokines compared to the control group (
                    <italic toggle="yes">P</italic> &#x02c2; 0.05). The highest inhibition activity was recorded with dexamethasone (5 &#x03bc;g/ml) (positive, treated group) which significantly (
                    <italic toggle="yes">P</italic> &#x02c2; 0.05) suppressed IL-1&#x03b2;, IL-6, and TNF-&#x03b1; by 75.7%, 69%, and 79% respectively compared with the LPS treated control. In the case of the combination, FQ, the levels of IL-1&#x03b2;, IL-6, and TNF-&#x03b1; reduced by 56.2%, 58.5%, and 70.6% respectively, suggesting it is more effective in inactivating cytokine production than each drug alone. The results are shown in 
                    <xref ref-type="fig" rid="f2">Figure 2A</xref>, 
                    <xref ref-type="fig" rid="f2">B</xref>, and 
                    <xref ref-type="fig" rid="f2">C</xref>).</p>
                <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                    <label>Figure 2. </label>
                    <caption>
                        <title>A: Effects of fraxin, quercetin, and fraxin + quercetin on cytokine levels (IL-1) in RAW 264.7 cells at varied doses (25, 12.5,6.25 g/ml), 2 hours apart. Subsequently, all the cells were exposed to lipopolysaccharide (LPS) (1 &#x03bc;g/ml) for 24 h. All data are presented as mean &#x00b1; SEM. * 
                            <italic toggle="yes">P</italic> &#x02c2; 0.01 vs. LPS group, ** 
                            <italic toggle="yes">P</italic> &#x02c2; 0.05 vs. control. B: Effects of fraxin, quercetin, and fraxin + quercetin on cytokine levels (IL-6) in RAW 264.7 cells at various doses (25, 12.5,6.25 g/ml) after 2 hours. Subsequently, all cells were exposed to lipopolysaccharide (LPS) (1 &#x03bc;g/ml) for 24 h. *
                            <italic toggle="yes">P</italic> &#x02c2; 0.01 vs. LPS group, **
                            <italic toggle="yes">P</italic> &#x02c2; 0.05 vs. control. C: Effects of fraxin, quercetin, and fraxin + quercetin on cytokines levels (TNF-&#x03b1;) in RAW 264.7 cells using different concentrations (25, 12.5,6.25 &#x03bc;g/ml), after 2 h. Later all cells were exposed to LPS (1 &#x03bc;g/ml) for 24 h. All data are presented as mean &#x00b1; SEM. *
                            <italic toggle="yes">P</italic> &#x02c2; 0.01 vs. LPS group, **
                            <italic toggle="yes">P</italic> &#x02c2;0.05 vs. control.</title>
                    </caption>
                    <graphic id="gr2" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/146120/d528e35a-ba15-4b45-bc7f-084ec0c43ae1_figure2.gif"/>
                </fig>
            </sec>
            <sec id="sec16">
                <title>Gene expression analysis</title>
                <p>When compared to the control, pretreatment of RAW 264.7 cells with farxin (25 &#x03bc;g/ml), quercetin (12.5 &#x03bc;g/ml), and FQ (6.25 &#x03bc;g/ml) for 2 hours before LPS (1 &#x03bc;g/ml) resulted in significant (
                    <italic toggle="yes">P</italic> &#x02c2; 0.05) suppression of TLR-4 gene upregulation by (89%, 82%, and 93%, respectively). Treatment with LPS activated the TLR-4 pathway, as shown in 
                    <xref ref-type="fig" rid="f3">Figure 3A</xref>, and treatment with fraxin, quercetin, and FQ successfully counteracted the stimulatory impact of LPS on RAW 264.7 cells. Furthermore, compared to either treatment alone, the combination synergistically reversed the impact of LPS on cells.</p>
                <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                    <label>Figure 3. </label>
                    <caption>
                        <title>A: The effects of treatment on the gene expression of Toll-like receptor 4. Cells were pretreated with fraxin (25 &#x03bc;g/ml), quercetin (12.5 &#x03bc;g/ml), and quercetin + fraxin (6.25 &#x03bc;g/ml) for 2 h. Cells were then treated with lipopolysaccharide (LPS) (1 &#x03bc;g/ml) and incubated for 24 h. **
                            <italic toggle="yes">P</italic> &lt; 0.001; compared with the control, each graph has been represented as Mean. B: The effects of treatment on gene expression of PPAR-&#x03b3;, RAW 264.7 Cells were pretreated with fraxin (25 &#x03bc;g/m), quercetin (12.5 &#x03bc;g/m), and quercetin + fraxin (6.25 &#x03bc;g/m) for 2 h. Cells were treated with lipopolysaccharide (LPS) (1 &#x03bc;g/ml) and incubated for 24 h. **
                            <italic toggle="yes">P</italic> &lt; 0.001; compared with the control, each graph has been represented as Mean.</title>
                    </caption>
                    <graphic id="gr3" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/146120/d528e35a-ba15-4b45-bc7f-084ec0c43ae1_figure3.gif"/>
                </fig>
                <p>While 
                    <xref ref-type="fig" rid="f3">Figure 3B</xref> reveals that there is a considerable stimulatory impact on the PPAR-&#x03b3; pathway, this effect is shown as enhanced gene expression. FQ increased up to 60-fold relative to the control, whereas fraxin and quercetin (17.6, 8.6-folds, respectively) decreased proinflammatory cytokines (
                    <xref ref-type="fig" rid="f3">Figure 3B</xref>), indicating a mechanism by which fraxin, quercetin, and their combination reduce proinflammatory cytokines.</p>
            </sec>
        </sec>
        <sec id="sec17" sec-type="discussion">
            <title>Discussion</title>
            <p>The devastating epidemic caused by SARS-CoV-2 in 2019 prompted researchers to make a considerable effort to search for a possible solution to limit infection. Following the demonstration of the pathological role of the &#x201c;cytokine storm&#x201d;, evidence for a cytokine release syndrome can be seen in increased proinflammatory cytokines in late-stage COVID-19. As seen in previous epidemics caused by SARS-CoV and MERS-CoV, dysregulated cytokine production and an influx of inflammatory myeloid cells can cause lung infiltration, septic shock, respiratory failure, acute respiratory distress syndrome (ARDS), multiorgan failure, and death.
                <sup>
                    <xref ref-type="bibr" rid="ref14">14</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref15">15</xref>
                </sup> Gram-negative bacteria&#x2019;s outer membrane lipopolysaccharide (LPS) is used in inducing a cytokine storm model both 
                <italic toggle="yes">in vivo</italic> and in 
                <italic toggle="yes">in vitro</italic> studies. The stimulation of macrophages with LPS can cause the excessive release of proinflammatory cytokines by activating the nuclear factor &#x03ba;B (NF- &#x03ba;B) and mitogen-activated protein kinase (MAPK) signaling pathways, increasing (COX-2) and (iNOS).
                <sup>
                    <xref ref-type="bibr" rid="ref16">16</xref>
                </sup> RAW 264.7 cells induced by LPS is the most widely used model for evaluating anti-cytokines 
                <italic toggle="yes">in vitro.</italic> For centuries, plants have been used as a natural remedy for numerous illnesses. Hong 
                <italic toggle="yes">et al.</italic> (2012) reported a dose-dependent reduction in cell spreading and pseudopodia production after treatment with an ethanol extract of 
                <italic toggle="yes">Fraxinus rhynchophylla</italic> bark on LPS-stimulated macrophages.
                <sup>
                    <xref ref-type="bibr" rid="ref17">17</xref>
                </sup> Whang 
                <italic toggle="yes">et al</italic>. (2005) suggested in their study that fraxin and fraxin-related chemicals improved cell survival rate in human umbilical vein endothelial cells (HUVECs) when exposed to hydrogen peroxide (H
                <sub>2</sub>O
                <sub>2</sub>) mediated oxidative stress; other previous studies discussed the effect of quercetin on cell migration, which plays a vital role in the development of cancer.
                <sup>
                    <xref ref-type="bibr" rid="ref18">18</xref>
                </sup> Quercetin strongly inhibited LPS-induced macrophage adhesion and migration in a dose-dependent manner.
                <sup>
                    <xref ref-type="bibr" rid="ref19">19</xref>
                </sup> Previous research has highlighted the various biological activities of fraxin and quercetin, including anti-inflammatory and antioxidant effects, raising the need for additional investigation into their role in cytokine storms. Our study observed that fraxin, quercetin, and fraxin + quercetin exerted low cytotoxic activity on RAW 264.7, and only when cells were exposed to higher concentrations of fraxin and quercetin, which was in agreement with a study by Cui 
                <italic toggle="yes">et al.</italic> that suggested that only the highest concentration of quercetin reduced macrophage viability when administered together with LPS (1 &#x03bc;g/mL).
                <sup>
                    <xref ref-type="bibr" rid="ref19">19</xref>
                </sup> Other previous studies compatible with our study support that the cell viability of RAW 264.7 was not compromised by the presence or absence of LPS.
                <sup>
                    <xref ref-type="bibr" rid="ref17">17</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref20">20</xref>
                </sup>
            </p>
            <p>Li 
                <italic toggle="yes">et al.</italic> (2019) concluded that fraxin confers protection against LPS-induced lung injury and the inflammatory response in A549 cells.
                <sup>
                    <xref ref-type="bibr" rid="ref20">20</xref>
                </sup> In an approach to modulate virus hyperinflammation such as chronic systemic symptoms, the anti-inflammatory effects of quercetin were investigated in mouse macrophage cells exposed to polyinosinic-polycytidylic acid (poly (I:C) as an experimental model for viral inflammation by Kim YJ and Park W. (2016). They found that quercetin might suppress poly (I:C)-induced inflammation by reducing the levels of inflammatory mediators.</p>
            <p>Our findings support previous research that found that both fraxin and quercetin were effective at suppressing the release of proinflammatory mediators from LPS-induced RAW 264.7, the mechanism underlying which may be related to interference with various inflammatory signaling pathways, including the TLR signaling system. Following their activation, proinflammatory molecules (such as IL-1, IL-6, and TNF-&#x03b1;) are abundantly generated, and NF-&#x03ba;B phosphorylation, nuclear translocation, and upregulated transcription of proinflammatory factors are all results of TLR-4 activation.
                <sup>
                    <xref ref-type="bibr" rid="ref16">16</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref21">21</xref>
                </sup>
            </p>
            <p>In numerous macrophage models, PPAR-&#x03b3; has been shown to exert anti-inflammatory effects by suppressing the expression of multiple proinflammatory genes, such as IL-6, TNF-&#x03b1;, and IL-12.
                <sup>
                    <xref ref-type="bibr" rid="ref22">22</xref>
                </sup> From earlier studies, fraxin, isolated from the roots of 
                <italic toggle="yes">Ulmus macrocarpa</italic> Hance, significantly suppressed the expression of iNOS and COX-2, increased PPAR-&#x03b3; expression, activated the nuclear factor erythroid 2-related factor 2/heme oxygenase-1 (HO-1) (Nrf2/HO-1) pathway, and inhibited NF-&#x03ba;B and ERK1/2 in a dose-dependent manner The neuroprotective and anti-inflammatory effects of fraxin were also diminished by treatment with GW9662 which is a PPAR-&#x03b3; antagonist.
                <sup>
                    <xref ref-type="bibr" rid="ref23">23</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref24">24</xref>
                </sup>
            </p>
            <p>In LPS-induced ARDS in mice, fraxin reduced the production of TNF-&#x03b1;, IL-1&#x03b2;, IL-6, Reactive oxygen species (ROS), and Malondialdehyde (MDA), increased Super oxide dismutases (SOD), and suppressed NF-&#x03ba;B and MAPK signaling.
                <sup>
                    <xref ref-type="bibr" rid="ref25">25</xref>
                </sup>
            </p>
            <p>Li 
                <italic toggle="yes">et al.</italic>, 2019 discovered that pretreatment with fraxin decreased protein expressions of NF-&#x03ba;B and nucleotide-binding domain, leucine-rich&#x2013;containing family, pyrin domain&#x2013;containing-3 (NLRP3) activated in response to lipopolysaccharide (LPS).
                <sup>
                    <xref ref-type="bibr" rid="ref26">26</xref>
                </sup> Aesculin, a hydroxycoumarin, is the 6-O-beta-D-glucoside of esculetin, another organic compound isolated from Cortex fraxini that is structurally related to fraxin. Furthermore, studies in the peritoneum and macrophages demonstrated that aesculin inhibits the production of inflammatory mediators such as iNOS, IL-1, and TNF-&#x03b1; via the PPAR-&#x03b3;/NF-&#x03ba;B pathway.
                <sup>
                    <xref ref-type="bibr" rid="ref27">27</xref>
                </sup>
            </p>
            <p>While quercetin inhibits liver inflammation mainly through NF-&#x03ba;B/TLR/NLRP3, it also inhibits LPS-stimulated NO increase by suppressing iNOS.
                <sup>
                    <xref ref-type="bibr" rid="ref28">28</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref29">29</xref>
                </sup> In addition, in differentiated human acute monocyte leukemia cell line (THP-1), quercetin might lower cholesterol levels in macrophages with elevated PPAR-&#x03b3; expression. Quercetin metabolites, such as quercetin-3-glucuronide (Q3G) and quercetin-3&#x2032;-sulfate, also upregulated PPAR-&#x03b3; in A549 lung cancer cells.
                <sup>
                    <xref ref-type="bibr" rid="ref30">30</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref31">31</xref>
                </sup>
            </p>
            <p>Flavonoids, such as quercetin and kaempferol, increase PPAR-&#x03b3;-mediated gene expression through a mechanism distinct from conventional PPAR-&#x03b3; agonists.
                <sup>
                    <xref ref-type="bibr" rid="ref32">32</xref>
                </sup>
            </p>
            <p>Dihydroquercetin activates AMPK/Nrf2/HO-1 signaling in macrophages, which mediates its anti-inflammatory effects.
                <sup>
                    <xref ref-type="bibr" rid="ref33">33</xref>
                </sup>
            </p>
            <p>Our results were consistent with previous studies supporting that fraxin and quercetin upregulated PPAR-&#x03b3; expression and downregulated TLR-4, stimulated by LPS treatment in macrophage RAW 264.7 cells.</p>
            <p>Fraxin + quercetin showed synergistic activity when combined, which may be due to multiple targets involved when coming to their anti-inflammatory mechanism, resulting in suppression of proinflammatory mediators IL-1, IL-6, TNF-&#x03b1; and suppression of other pathways like iNOS, COX-2, Nrf2/HO-1, NF-&#x03ba;B, NLRP3, TLR-4, and upregulation of PPAR-&#x03b3;,</p>
            <p>A study described the synergistic combination of two bioflavonoids: quercetin and catechin; this combination caused inhibition of the LPS-activated upregulation of iNOS and COX-2.
                <sup>
                    <xref ref-type="bibr" rid="ref20">20</xref>
                </sup> Previous studies have shown that drug combinations, especially in phytopharmaceuticals, may activate entirely different sets of genes than those started by each drug alone.
                <sup>
                    <xref ref-type="bibr" rid="ref34">34</xref>
                </sup> This may provide another theoretical explanation for the synergistic activity between fraxin and quercetin, despite the differences in their chemical structures.</p>
        </sec>
        <sec id="sec18" sec-type="conclusions">
            <title>Conclusions</title>
            <p>Our study showed that fraxin, quercetin, and their combination exert anti-cytokine storm activity on LPS-induced RAW246.7 cells by targeting multiple signaling pathways and suppressing TLR-mediated NF-&#x03ba;B. Upregulation of PPAR-&#x03b3; mediated gene expression (
                <xref ref-type="fig" rid="f3">Figure 3A</xref> and 
                <xref ref-type="fig" rid="f3">B</xref>) may serve as a foundation for future research into other combinations of fraxin and quercetin and pathways involved in their molecular mechanisms explaining the synergistic anti-cytokine storm activity.</p>
        </sec>
    </body>
    <back>
        <sec id="sec21" sec-type="data-availability">
            <title>Data availability</title>
            <sec id="sec22">
                <title>Underlying data</title>
                <p>Zenodo: Anti-cytokine storm activity of fraxin and quercetin, alone and in combination, and their possible molecular mechanisms via TLR4 and PPAR&#x03b3; signaling pathways in LPS-induced RAW 264.7 cell line article data 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.5281/zenodo.7822393">https://doi.org/10.5281/zenodo.7822393</ext-link>.
                    <sup>

                        <xref ref-type="bibr" rid="ref35">35</xref>
</sup>
                </p>
                <p>This project contains the following underlying data:
                    <list list-type="bullet">
                        <list-item>
                            <label>&#x2022;</label>
                            <p>Article data.xlsx (Anti-cytokine storm activity of fraxin and quercetin, alone and in combination, and their possible molecular mechanisms via TLR4 and PPAR&#x03b3; signaling pathways in LPS-induced RAW 264.7 cell line article data).
</p>
                        </list-item>
                    </list>
                </p>
                <p>Data are available under the terms of the 
                    <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution 4.0 International license</ext-link> (CC-BY 4.0).</p>
            </sec>
        </sec>
        <ref-list>
            <title>References</title>
            <ref id="ref1">
                <label>1</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Rabaan</surname>
                            <given-names>AA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Al-Ahmed</surname>
                            <given-names>SH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Muhammad</surname>
                            <given-names>J</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Role of inflammatory cytokines in COVID-19 patients: A review on molecular mechanisms, immune functions, immunopathology and immunomodulatory drugs to counter cytokine storm.</article-title>
                    <source>

                        <italic toggle="yes">Vaccines.</italic>
</source>
                    <year>2021</year>;<volume>9</volume>(<issue>5</issue>):<fpage>436</fpage>.
                    <pub-id pub-id-type="pmid">33946736</pub-id>
                    <pub-id pub-id-type="doi">10.3390/vaccines9050436</pub-id>
                    <pub-id pub-id-type="pmcid">PMC8145892</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref2">
                <label>2</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kim</surname>
                            <given-names>JS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lee</surname>
                            <given-names>JY</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yang</surname>
                            <given-names>JW</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Immunopathogenesis and treatment of cytokine storm in COVID-19.</article-title>
                    <source>

                        <italic toggle="yes">Theranostics.</italic>
</source>
                    <year>2021</year>;<volume>11</volume>(<issue>1</issue>):<fpage>316</fpage>&#x2013;<lpage>329</lpage>.
                    <pub-id pub-id-type="pmid">33391477</pub-id>
                    <pub-id pub-id-type="doi">10.7150/thno.49713</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7681075</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref3">
                <label>3</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Schijns</surname>
                            <given-names>V</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lavelle</surname>
                            <given-names>EC</given-names>
                        </name>
</person-group>:
                    <article-title>Prevention and treatment of COVID-19 disease by controlled modulation of innate immunity.</article-title>
                    <source>

                        <italic toggle="yes">Eur. J. Immunol.</italic>
</source>
                    <year>2020</year>;<volume>50</volume>(<issue>7</issue>):<fpage>932</fpage>&#x2013;<lpage>938</lpage>.
                    <pub-id pub-id-type="pmid">32438473</pub-id>
                    <pub-id pub-id-type="doi">10.1002/eji.202048693</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7280664</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref4">
                <label>4</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kim</surname>
                            <given-names>M-J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jeong</surname>
                            <given-names>S-M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kang</surname>
                            <given-names>B-K</given-names>
                        </name>
</person-group>:
                    <article-title>Anti-inflammatory effects of grasshopper ketone from Sargassum fulvellum ethanol extract on lipopolysaccharide-induced inflammatory responses in RAW 264.7 cells.</article-title>
                    <year>2019</year>.</mixed-citation>
            </ref>
            <ref id="ref5">
                <label>5</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Xiao</surname>
                            <given-names>B</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hao</surname>
                            <given-names>Z</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Simultaneous determination of fraxin and its metabolite, fraxetin, in rat plasma by liquid chromatography-tandem mass spectrometry and its application in a pharmacokinetic study.</article-title>
                    <source>

                        <italic toggle="yes">J. Chromatogr. B.</italic>
</source>
                    <year>2016</year>;<volume>1017</volume>:<fpage>70</fpage>&#x2013;<lpage>74</lpage>.</mixed-citation>
            </ref>
            <ref id="ref6">
                <label>6</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sarfraz</surname>
                            <given-names>I</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rasul</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jabeen</surname>
                            <given-names>F</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Fraxinus: a plant with versatile pharmacological and biological activities.</article-title>
                    <source>

                        <italic toggle="yes">Evid. Based Complement. Alternat. Med.</italic>
</source>
                    <year>2017</year>;<volume>2017</volume>:<fpage>1</fpage>&#x2013;<lpage>12</lpage>.
                    <pub-id pub-id-type="pmid">29279716</pub-id>
                    <pub-id pub-id-type="doi">10.1155/2017/4269868</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5723943</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref7">
                <label>7</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yao</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Han</surname>
                            <given-names>C</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Quercetin I. Immunity.</article-title>
                    <source>

                        <italic toggle="yes">Nutrients.</italic>
</source>
                    <year>2016</year>;<volume>8</volume>(<issue>3</issue>):<fpage>167</fpage>.
                    <pub-id pub-id-type="pmid">26999194</pub-id>
                    <pub-id pub-id-type="doi">10.3390/nu8030167</pub-id>
                    <pub-id pub-id-type="pmcid">PMC4808895</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref8">
                <label>8</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Marques</surname>
                            <given-names>RV</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sestito</surname>
                            <given-names>SE</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bourgaud</surname>
                            <given-names>F</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Anti-Inflammatory Activity of Bryophytes Extracts in LPS-Stimulated RAW264. 7 Murine Macrophages.</article-title>
                    <source>

                        <italic toggle="yes">Molecules.</italic>
</source>
                    <year>2022</year>;<volume>27</volume>(<issue>6</issue>):<fpage>1940</fpage>.
                    <pub-id pub-id-type="pmid">35335304</pub-id>
                    <pub-id pub-id-type="doi">10.3390/molecules27061940</pub-id>
                    <pub-id pub-id-type="pmcid">PMC8953629</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref9">
                <label>9</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Lokhande</surname>
                            <given-names>KB</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ballav</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yadav</surname>
                            <given-names>RS</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Probing intermolecular interactions and binding stability of kaempferol, quercetin and resveratrol derivatives with PPAR-&#x03b3;: docking, molecular dynamics and MM/GBSA approach to reveal potent PPAR-&#x03b3; agonist against cancer.</article-title>
                    <source>

                        <italic toggle="yes">J. Biomol. Struct. Dyn.</italic>
</source>
                    <year>2022</year>;<volume>40</volume>(<issue>3</issue>):<fpage>971</fpage>&#x2013;<lpage>981</lpage>.
                    <pub-id pub-id-type="pmid">32954977</pub-id>
                    <pub-id pub-id-type="doi">10.1080/07391102.2020.1820380</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref10">
                <label>10</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Liang</surname>
                            <given-names>Y-C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tsai</surname>
                            <given-names>S-H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tsai</surname>
                            <given-names>D-C</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Suppression of inducible cyclooxygenase and nitric oxide synthase through activation of peroxisome proliferator-activated receptor-&#x03b3; by flavonoids in mouse macrophages.</article-title>
                    <source>

                        <italic toggle="yes">FEBS Lett.</italic>
</source>
                    <year>2001</year>;<volume>496</volume>(<issue>1</issue>):<fpage>12</fpage>&#x2013;<lpage>18</lpage>.
                    <pub-id pub-id-type="pmid">11343698</pub-id>
                    <pub-id pub-id-type="doi">10.1016/S0014-5793(01)02393-6</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref11">
                <label>11</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sun</surname>
                            <given-names>W</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sanderson</surname>
                            <given-names>PE</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zheng</surname>
                            <given-names>W</given-names>
                        </name>
</person-group>:
                    <article-title>Drug combination therapy increases successful drug repositioning.</article-title>
                    <source>

                        <italic toggle="yes">Drug Discov. Today.</italic>
</source>
                    <year>2016</year>;<volume>21</volume>(<issue>7</issue>):<fpage>1189</fpage>&#x2013;<lpage>1195</lpage>.
                    <pub-id pub-id-type="pmid">27240777</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.drudis.2016.05.015</pub-id>
                    <pub-id pub-id-type="pmcid">PMC4907866</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref12">
                <label>12</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Rodea-Palomares</surname>
                            <given-names>I</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Petre</surname>
                            <given-names>AL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Boltes</surname>
                            <given-names>K</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Application of the combination index (CI)-isobologram equation to study the toxicological interactions of lipid regulators in two aquatic bioluminescent organisms.</article-title>
                    <source>

                        <italic toggle="yes">Water Res.</italic>
</source>
                    <year>2010</year>;<volume>44</volume>(<issue>2</issue>):<fpage>427</fpage>&#x2013;<lpage>438</lpage>.
                    <pub-id pub-id-type="doi">10.1016/j.watres.2009.07.026</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref13">
                <label>13</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sandhiutami</surname>
                            <given-names>NMD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Moordiani</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Laksmitawati</surname>
                            <given-names>DR</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>In vitro assesment of anti-inflammatory activities of coumarin and Indonesian cassia extract in RAW264. 7 murine macrophage cell line.</article-title>
                    <source>

                        <italic toggle="yes">Iran. J. Basic Med. Sci.</italic>
</source>
                    <year>2017</year>;<volume>20</volume>(<issue>1</issue>):<fpage>99</fpage>&#x2013;<lpage>106</lpage>.
                    <pub-id pub-id-type="pmid">28133531</pub-id>
                    <pub-id pub-id-type="doi">10.22038/ijbms.2017.8102</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref14">
                <label>14</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Coperchini</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Chiovato</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ricci</surname>
                            <given-names>G</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The cytokine storm in COVID-19: Further advances in our understanding the role of specific chemokines involved.</article-title>
                    <source>

                        <italic toggle="yes">Cytokine Growth Factor Rev.</italic>
</source>
                    <year>2021</year>;<volume>58</volume>:<fpage>82</fpage>&#x2013;<lpage>91</lpage>.
                    <pub-id pub-id-type="pmid">33573850</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.cytogfr.2020.12.005</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7837329</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref15">
                <label>15</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Rizk</surname>
                            <given-names>JG</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kalantar-Zadeh</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mehra</surname>
                            <given-names>MR</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Pharmaco-immunomodulatory therapy in COVID-19.</article-title>
                    <source>

                        <italic toggle="yes">Drugs.</italic>
</source>
                    <year>2020</year>;<volume>80</volume>:<fpage>1267</fpage>&#x2013;<lpage>1292</lpage>.
                    <pub-id pub-id-type="pmid">32696108</pub-id>
                    <pub-id pub-id-type="doi">10.1007/s40265-020-01367-z</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7372203</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref16">
                <label>16</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ye</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yang</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Aloperine suppresses LPS-induced macrophage activation through inhibiting the TLR4/NF-&#x03ba;B pathway.</article-title>
                    <source>

                        <italic toggle="yes">Inflamm. Res.</italic>
</source>
                    <year>2020</year>;<volume>69</volume>:<fpage>375</fpage>&#x2013;<lpage>383</lpage>.
                    <pub-id pub-id-type="pmid">32144444</pub-id>
                    <pub-id pub-id-type="doi">10.1007/s00011-019-01313-0</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref17">
                <label>17</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hong</surname>
                            <given-names>G-E</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Park</surname>
                            <given-names>H-S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kim</surname>
                            <given-names>J-A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Anti-oxidant and anti-inflammatory effects of Fraxinus rhynchophylla on lipopolysaccharide (LPS)-induced murine Raw 264.7 cells.</article-title>
                    <source>

                        <italic toggle="yes">J. Biomed. Res.</italic>
</source>
                    <year>2012</year>;<volume>13</volume>(<issue>4</issue>):<fpage>331</fpage>&#x2013;<lpage>338</lpage>.
                    <pub-id pub-id-type="doi">10.12729/jbr.2012.13.4.331</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref18">
                <label>18</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Whang</surname>
                            <given-names>WK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Park</surname>
                            <given-names>HS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ham</surname>
                            <given-names>I</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Natural compounds, fraxin and chemicals structurally related to fraxin protect cells from oxidative stress.</article-title>
                    <source>

                        <italic toggle="yes">Exp. Mol. Med.</italic>
</source>
                    <year>2005</year>;<volume>37</volume>(<issue>5</issue>):<fpage>436</fpage>&#x2013;<lpage>446</lpage>.
                    <pub-id pub-id-type="doi">10.1038/emm.2005.54</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref19">
                <label>19</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Cui</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wu</surname>
                            <given-names>Q</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>J</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Quercetin inhibits LPS-induced macrophage migration by suppressing the iNOS/FAK/paxillin pathway and modulating the cytoskeleton.</article-title>
                    <source>

                        <italic toggle="yes">Cell Adhes. Migr.</italic>
</source>
                    <year>2019</year>;<volume>13</volume>(<issue>1</issue>):<fpage>1</fpage>&#x2013;<lpage>12</lpage>.
                    <pub-id pub-id-type="pmid">29945484</pub-id>
                    <pub-id pub-id-type="doi">10.1080/19336918.2018.1486142</pub-id>
                    <pub-id pub-id-type="pmcid">PMC6527387</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref20">
                <label>20</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Liu</surname>
                            <given-names>X</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Synergistic anti-inflammatory effects of quercetin and catechin via inhibiting activation of TLR4&#x2013;MyD88-mediated NF-&#x03ba;B and MAPK signaling pathways.</article-title>
                    <source>

                        <italic toggle="yes">Phytother. Res.</italic>
</source>
                    <year>2019</year>;<volume>33</volume>(<issue>3</issue>):<fpage>756</fpage>&#x2013;<lpage>767</lpage>.
                    <pub-id pub-id-type="doi">10.1002/ptr.6268</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref21">
                <label>21</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Shi</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hua</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kong</surname>
                            <given-names>D</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Role of Toll-like receptor mediated signaling in traumatic brain injury.</article-title>
                    <source>

                        <italic toggle="yes">Neuropharmacology.</italic>
</source>
                    <year>2019</year>;<volume>145</volume>:<fpage>259</fpage>&#x2013;<lpage>267</lpage>.
                    <pub-id pub-id-type="pmid">30075158</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.neuropharm.2018.07.022</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref22">
                <label>22</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Huang</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yang</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>WX</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Hyperin attenuates inflammation by activating PPAR-&#x03b3; in mice with acute liver injury (ALI) and LPS-induced RAW264.7 cells.</article-title>
                    <source>

                        <italic toggle="yes">Int. Immunopharmacol.</italic>
</source>
                    <year>2015</year>;<volume>29</volume>(<issue>2</issue>):<fpage>440</fpage>&#x2013;<lpage>447</lpage>.
                    <pub-id pub-id-type="doi">10.1016/j.intimp.2015.10.017</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref23">
                <label>23</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kwon</surname>
                            <given-names>J-H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kim</surname>
                            <given-names>S-B</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Park</surname>
                            <given-names>K-H</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Antioxidative and anti-inflammatory effects of phenolic compounds from the roots of Ulmus macrocarpa.</article-title>
                    <source>

                        <italic toggle="yes">Arch. Pharm. Res.</italic>
</source>
                    <year>2011</year>;<volume>34</volume>:<fpage>1459</fpage>&#x2013;<lpage>1466</lpage>.
                    <pub-id pub-id-type="pmid">21975807</pub-id>
                    <pub-id pub-id-type="doi">10.1007/s12272-011-0907-4</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref24">
                <label>24</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Yao</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zhao</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Song</surname>
                            <given-names>X</given-names>
                        </name>
</person-group>:
                    <article-title>Protective effects of fraxin on cerebral ischemia-reperfusion injury by mediating neuroinflammation and oxidative stress through PPAR-&#x03b3;/NF-&#x039a;B pathway.</article-title>
                    <source>

                        <italic toggle="yes">Brain Res. Bull.</italic>
</source>
                    <year>2022</year>;<volume>187</volume>:<fpage>49</fpage>&#x2013;<lpage>62</lpage>.
                    <pub-id pub-id-type="pmid">35772607</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.brainresbull.2022.06.010</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref25">
                <label>25</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ma</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Liu</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Feng</surname>
                            <given-names>J</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Fraxin alleviates LPS-induced ARDS by downregulating inflammatory responses and oxidative damages and reducing pulmonary vascular permeability.</article-title>
                    <source>

                        <italic toggle="yes">Inflammation.</italic>
</source>
                    <year>2019</year>;<volume>42</volume>:<fpage>1901</fpage>&#x2013;<lpage>1912</lpage>.
                    <pub-id pub-id-type="pmid">31273573</pub-id>
                    <pub-id pub-id-type="doi">10.1007/s10753-019-01052-8</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref26">
                <label>26</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>W</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>W</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zang</surname>
                            <given-names>L</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Fraxin ameliorates lipopolysaccharide-induced acute lung injury in mice by inhibiting the NF-&#x03ba;B and NLRP3 signalling pathways.</article-title>
                    <source>

                        <italic toggle="yes">Int. Immunopharmacol.</italic>
</source>
                    <year>2019</year>;<volume>67</volume>:<fpage>1</fpage>&#x2013;<lpage>12</lpage>.
                    <pub-id pub-id-type="doi">10.1016/j.intimp.2018.12.003</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref27">
                <label>27</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Tian</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Peng</surname>
                            <given-names>Z</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Luo</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Aesculin protects against DSS-Induced colitis though activating PPAR&#x03b3; and inhibiting NF-&#x043a;B pathway.</article-title>
                    <source>

                        <italic toggle="yes">Eur. J. Pharmacol.</italic>
</source>
                    <year>2019</year>;<volume>857</volume>:<fpage>172453</fpage>.
                    <pub-id pub-id-type="pmid">31202807</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.ejphar.2019.172453</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref28">
                <label>28</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Zhao</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Deng</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Quercetin as a protective agent for liver diseases: A comprehensive descriptive review of the molecular mechanism.</article-title>
                    <source>

                        <italic toggle="yes">Phytother. Res.</italic>
</source>
                    <year>2021</year>;<volume>35</volume>(<issue>9</issue>):<fpage>4727</fpage>&#x2013;<lpage>4747</lpage>.
                    <pub-id pub-id-type="pmid">34159683</pub-id>
                    <pub-id pub-id-type="doi">10.1002/ptr.7104</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref29">
                <label>29</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Chen</surname>
                            <given-names>J-C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ho</surname>
                            <given-names>F-M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Chao</surname>
                            <given-names>P-DL</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Inhibition of iNOS gene expression by quercetin is mediated by the inhibition of I&#x03ba;B kinase, nuclear factor-kappa B and STAT1, and depends on heme oxygenase-1 induction in mouse BV-2 microglia.</article-title>
                    <source>

                        <italic toggle="yes">Eur. J. Pharmacol.</italic>
</source>
                    <year>2005</year>;<volume>521</volume>(<issue>1-3</issue>):<fpage>9</fpage>&#x2013;<lpage>20</lpage>.
                    <pub-id pub-id-type="pmid">16171798</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.ejphar.2005.08.005</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref30">
                <label>30</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Lee</surname>
                            <given-names>S-M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Moon</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Cho</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Quercetin up-regulates expressions of peroxisome proliferator-activated receptor &#x03b3;, liver X receptor &#x03b1;, and ATP binding cassette transporter A1 genes and increases cholesterol efflux in human macrophage cell line.</article-title>
                    <source>

                        <italic toggle="yes">Nutr. Res.</italic>
</source>
                    <year>2013</year>;<volume>33</volume>(<issue>2</issue>):<fpage>136</fpage>&#x2013;<lpage>143</lpage>.
                    <pub-id pub-id-type="pmid">23399664</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.nutres.2012.11.010</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref31">
                <label>31</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Chuang</surname>
                            <given-names>C-H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yeh</surname>
                            <given-names>C-L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yeh</surname>
                            <given-names>S-L</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Quercetin metabolites inhibit MMP-2 expression in A549 lung cancer cells by PPAR-&#x03b3; associated mechanisms.</article-title>
                    <source>

                        <italic toggle="yes">J. Nutr. Biochem.</italic>
</source>
                    <year>2016</year>;<volume>33</volume>:<fpage>45</fpage>&#x2013;<lpage>53</lpage>.
                    <pub-id pub-id-type="pmid">27260467</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.jnutbio.2016.03.011</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref32">
                <label>32</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Beekmann</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rubi&#x00f3;</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Haan</surname>
                            <given-names>LHJ</given-names>
                            <prefix>de</prefix>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The effect of quercetin and kaempferol aglycones and glucuronides on peroxisome proliferator-activated receptor-gamma (PPAR-&#x03b3;).</article-title>
                    <source>

                        <italic toggle="yes">Food Funct.</italic>
</source>
                    <year>2015</year>;<volume>6</volume>(<issue>4</issue>):<fpage>1098</fpage>&#x2013;<lpage>1107</lpage>.
                    <pub-id pub-id-type="pmid">25765892</pub-id>
                    <pub-id pub-id-type="doi">10.1039/C5FO00076A</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref33">
                <label>33</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Lei</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Chai</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lin</surname>
                            <given-names>H</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Dihydroquercetin activates AMPK/Nrf2/HO-1 signaling in macrophages and attenuates inflammation in LPS-induced endotoxemic mice.</article-title>
                    <source>

                        <italic toggle="yes">Front. Pharmacol.</italic>
</source>
                    <year>2020</year>;<volume>11</volume>:<fpage>662</fpage>.
                    <pub-id pub-id-type="pmid">32508636</pub-id>
                    <pub-id pub-id-type="doi">10.3389/fphar.2020.00662</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7248193</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref34">
                <label>34</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ulrich-Merzenich</surname>
                            <given-names>G</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Panek</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zeitler</surname>
                            <given-names>H</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Drug development from natural products: exploiting synergistic effects.</article-title>
                    <year>2010</year>.</mixed-citation>
            </ref>
            <ref id="ref35">
                <label>35</label>
                <mixed-citation publication-type="data">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Shaker</surname>
                            <given-names>NS</given-names>
                        </name>
</person-group>:
                    <data-title>Anti-cytokine storm activity of fraxin and quercetin, alone and in combination, and their possible molecular mechanisms via TLR4 and PPAR&#x03b3; signaling pathways in LPS-induced RAW 264.7 cell line article data.</data-title>[Dataset].
                    <source>

                        <italic toggle="yes">Zenodo.</italic>
</source>
                    <year>2023</year>.
                    <pub-id pub-id-type="doi">10.5281/zenodo.7822393</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report365339">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.146120.r365339</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Jiang</surname>
                        <given-names>Fan</given-names>
                    </name>
                    <xref ref-type="aff" rid="r365339a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0001-9466-2192</uri>
                </contrib>
                <aff id="r365339a1">
                    <label>1</label>Qilu Hospital of Shandong University, Shandong, China</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>22</day>
                <month>2</month>
                <year>2025</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2025 Jiang F</copyright-statement>
                <copyright-year>2025</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport365339" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.133145.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>reject</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>1. In this study, the authors reported that fraxin, quercetin, and their combination inhibited cytokine release in LPS-stimulated RAW264.7 cells and increased the expression of PPAR-&#x03b3;. Overall, these data are too preliminary, without further mechanistic or translational investigations.&#x00a0;</p>
            <p> </p>
            <p> 2. It is not clear about how the concentrations of these compounds were selected. How these concentrations are relevant to in vivo treatment?</p>
            <p> </p>
            <p> 3. Only a murine cell line was used in the study. More validating results in primary cells will strengthen the study.</p>
            <p> </p>
            <p> 4. A causal relationship between PPAR-r and the reduced cytokine production is missing.</p>
            <p> </p>
            <p> 5. Methods: details of specific assay protocols are not necessary and the methodology should be described in a more succinct manner.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>No</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>I cannot comment. A qualified statistician is required.</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Partly</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Partly</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Please see my comments to authors.</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.</p>
        </body>
        <sub-article article-type="response" id="comment14466-365339">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname> S. Shaker</surname>
                            <given-names>Nada</given-names>
                        </name>
                        <aff>Department of Pharmacology, Al-Nahrain university, College of Medicine, Baghdad, Iraq</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>none mentioned</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>29</day>
                    <month>8</month>
                    <year>2025</year>
                </pub-date>
            </front-stub>
            <body>
                <p>Dear Reviewers, we would like to extend our gratitude for all your valuable insights regarding this humble work. We appreciate the time and effort you took to provide us with the necessary comments, ensuring this work is presented in the best possible form. Below, you will find detailed answers for each of the reviewer's comments:</p>
                <p> &#x00a0; 
                    <list list-type="bullet">
                        <list-item>
                            <p>In this study, the authors reported that fraxin, quercetin, and their combination inhibited cytokine release in LPS-stimulated RAW264.7 cells and increased the expression of PPAR-&#x03b3;. Overall, these data are too preliminary, without further mechanistic or translational investigations.</p>
                        </list-item>
                    </list> We appreciate all the raised remarks. This study is preliminary in nature and was designed to evaluate the potential cytotoxic and anti-inflammatory effects of the selected agents in LPS-stimulated murine macrophages, as a precursor to future in vivo studies modeling LPS-induced acute respiratory distress. The main limitation was the unavailability of additional cell lines at the culture facility, which restricted further exploration, along with constraints in resources and financial support.</p>
                <p> &#x00a0; 
                    <list list-type="bullet">
                        <list-item>
                            <p>It is not clear about how the concentrations of these compounds were selected. How these concentrations are relevant to in vivo treatment?</p>
                        </list-item>
                    </list> The concentrations selected to explore the anti-inflammatory activity and effect on gene expression were based on the outcome of the cytotoxicity evaluation, where the selected concentrations were half those that produced 50% inhibition of the viability for further analysis</p>
                <p> &#x00a0; 
                    <list list-type="bullet">
                        <list-item>
                            <p>Only a murine cell line was used in the study. More validating results in primary cells will strengthen the study.</p>
                        </list-item>
                    </list> We completely agree with this point, and it was explained in the first comment why this couldn&#x2019;t be done</p>
                <p> &#x00a0; 
                    <list list-type="bullet">
                        <list-item>
                            <p>A causal relationship between PPAR-r and the reduced cytokine production is missing.</p>
                        </list-item>
                    </list> It was noted, and a section explaining the relationship and role of PPAR-&#x0263; on cytokine release was included in the &#x201c;introduction&#x201d; section</p>
                <p> &#x00a0; 
                    <list list-type="bullet">
                        <list-item>
                            <p>Methods: details of specific assay protocols are not necessary and the methodology should be described in a more succinct manner.</p>
                        </list-item>
                    </list> All parts of the methodology were summarized as requested</p>
            </body>
        </sub-article>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report257418">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.146120.r257418</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Ghazy</surname>
                        <given-names>Dr. Amany</given-names>
                    </name>
                    <xref ref-type="aff" rid="r257418a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-5603-1303</uri>
                </contrib>
                <aff id="r257418a1">
                    <label>1</label>Jouf University, College of Medicine, Sakaka, Saudi Arabia</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>29</day>
                <month>6</month>
                <year>2024</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2024 Ghazy DA</copyright-statement>
                <copyright-year>2024</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
                <license>
                    <license-p>The author(s) is/are employees of the US Government and therefore domestic copyright protection in USA does not apply to this work. The work may be protected under the copyright laws of other jurisdictions when used in those jurisdictions.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport257418" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.133145.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>Dear Authors</p>
            <p> The current manuscript presents a good point for further research and is presented well. However, I have a few comments:</p>
            <p> - Authors link the cytokine storm to COVID-19 only but it can be generalized particularly, it is not a big problem now.</p>
            <p> -The study design is unclear, it can be presented by diagram to show groups of the study and the chronological order of analysis.</p>
            <p> Some parts of the methods include cell viability, gene expression, and cytokine levels without cited references.</p>
            <p> -What do you mean by anti-cytokine storm assay (misleading), it could be Determination of anti-cytokine storm markers not Anti-cytokine storm assay</p>
            <p> -&#x00c3;&#131;&#x00c2;&#130;&#x00c3;&#130;&#x00c2;&#x00a0;The methodology is too long and needs to be shortened.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>I cannot comment. A qualified statistician is required.</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>No source data required</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>No</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Micobiology and Immunology</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
        <sub-article article-type="response" id="comment14465-257418">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname> S. Shaker</surname>
                            <given-names>Nada</given-names>
                        </name>
                        <aff>Department of Pharmacology, Al-Nahrain university, College of Medicine, Baghdad, Iraq</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>none mentioned</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>29</day>
                    <month>8</month>
                    <year>2025</year>
                </pub-date>
            </front-stub>
            <body>
                <p>Dear Reviewers, we would like to extend our gratitude for all your valuable insights regarding this humble work. We appreciate the time and effort you took to provide us with the necessary comments, ensuring this work is presented in the best possible form. Below, you will find detailed answers for each of the reviewer's comments:</p>
                <p> </p>
                <p> The current manuscript presents a good point for further research and is presented well. However, I have a few comments: 
                    <list list-type="bullet">
                        <list-item>
                            <p>Authors link the cytokine storm to COVID-19 only but it can be generalized particularly, it is not a big problem now.</p>
                        </list-item>
                    </list> Thank you very much for the valuable note. Nowadays, COVID-19 has indeed become more controlled than when it was first identified, yet it remains one of the causes, especially when discussing viral infections, that leads to acute respiratory distress with excessive cytokine release&#x00a0;</p>
                <p> &#x00a0; 
                    <list list-type="bullet">
                        <list-item>
                            <p>The study design is unclear, it can be presented by diagram to show groups of the study and the chronological order of analysis.</p>
                        </list-item>
                    </list> We appreciate this note. A flow diagram is now included in the revised version of the manuscript</p>
                <p> &#x00a0; 
                    <list list-type="bullet">
                        <list-item>
                            <p>Some parts of the methods include cell viability, gene expression, and cytokine levels without cited references.</p>
                        </list-item>
                    </list> It was noted, and references were added where necessary</p>
                <p> &#x00a0; 
                    <list list-type="bullet">
                        <list-item>
                            <p>What do you mean by anti-cytokine storm assay (misleading), it could be Determination of anti-cytokine storm markers not Anti-cytokine storm assay</p>
                        </list-item>
                    </list> Thank you for highlighting this matter. To remove this unsettling term, the &#x201c;anti-cytokine storm&#x201d; was changed to &#x201c;the cytokine release inhibitory activity&#x201d;</p>
                <p> &#x00a0; 
                    <list list-type="bullet">
                        <list-item>
                            <p>The methodology is too long and needs to be shortened.</p>
                        </list-item>
                    </list> All parts of the methodology were summarized as requested</p>
            </body>
        </sub-article>
    </sub-article>
</article>
