<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.133145.2</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>Fraxin and Quercetin, separately and combined, reduced cytokine release in LPS-induced RAW 264.7 cell line through targeting TLR-4 and PPAR-&#x0263;</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 2; peer review: 2 approved with reservations, 1 not approved]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>S. Shaker</surname>
                        <given-names>Nada</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <uri content-type="orcid">https://orcid.org/0009-0002-9836-9625</uri>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>B. Sahib</surname>
                        <given-names>Hayder</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Software</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-0939-5622</uri>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>A. Hussein</surname>
                        <given-names>Zeena</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>J. Tahseen</surname>
                        <given-names>Nibras</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Software</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a3">3</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Pharmacology department, Al-Nahrain university, college of medicine, Baghdad, 10072, Iraq</aff>
                <aff id="a2">
                    <label>2</label>Pharmacology department, Al- Nahrain university, college of pharmacy, Baghdad, 10072, Iraq</aff>
                <aff id="a3">
                    <label>3</label>Pharmacology Department, Al-Bayan university, college of pharmacy, Baghdad, 10023, Iraq</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:dr.nada.s.shaker@gmail.com">dr.nada.s.shaker@gmail.com</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>10</day>
                <month>9</month>
                <year>2025</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2023</year>
            </pub-date>
            <volume>12</volume>
            <elocation-id>1120</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>1</day>
                    <month>9</month>
                    <year>2025</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2025 S. Shaker N et al.</copyright-statement>
                <copyright-year>2025</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/12-1120/pdf"/>
            <abstract>
                <sec>
                    <title>Background</title>
                    <p>Cytokine storm syndrome (CSS) is a leading cause of morbidity and mortality in patients with late-stage coronavirus disease 2019 (COVID-19), causing multiple organ failure and death. According to prior research, fraxin, and quercetin have anti-inflammatory, antioxidant, antimicrobial, and antiviral properties. Therefore, this study aimed to investigate the anti-cytokine storm activity of fraxin and quercetin, their combination, and the molecular mechanism behind this activity in Lipopolysaccharide (LPS)-induced RAW 264.7 cells.</p>
                </sec>
                <sec>
                    <title>Methods</title>
                    <p>
LPS-induced macrophage cells were treated with fraxin, quercetin, or their combinations at various doses. Cytotoxicity and cytokine release were evaluated, and gene expression analyses were performed. An enzyme-linked immunosorbent assay was used to quantify the levels of proinflammatory cytokines, interleukin 1 beta (IL1&#x03b2;), interleukin 6 (IL-6), and tumor necrosis factor-&#x03b1; (TNF-&#x03b1;), and RT-PCR was used to measure the gene expression of PPAR-&#x03b3; and Toll-like receptor 4 (TLR-4) concerning GAPDH as a reference gene.</p>
                </sec>
                <sec>
                    <title>Results</title>
                    <p>The results revealed a slight decrease in cell viability only when higher concentrations were applied to the cells. Fraxin, quercetin, and their combination reduced the generation of proinflammatory cytokines. The combination (fraxin + quercetin (FQ)) reduced the levels of IL-1&#x03b2;, IL-6, and TNF-&#x03b1; by 56.2%, 58.5%, and 70.6% respectively, compared to the LPS-only control; pretreatment of cells with farxin, quercetin, and their combination resulted in significant inhibition of TLR-4 gene expression by 89%, 82%, and 93% respectively, compared to the control (P&#x02c2; 0.05); FQ upregulated PPAR-&#x03b3; expression up to 60-fold compared to the control, while fraxin and quercetin increased PPAR-&#x03b3; by 17.6 and 8.6-folds, respectively.</p>
                </sec>
                <sec>
                    <title>Conclusions</title>
                    <p>Based on these findings, fraxin, quercetin, and their combination were able to mitigate cytokine release and improve the levels of gene expression involved in their pathways, making these agents and their combination candidates for further investigation in in vivo settings to expand knowledge about their kinetics and dynamics.</p>
                </sec>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>Fraxin</kwd>
                <kwd>Quercetin</kwd>
                <kwd>Anti-Cytokine Storm</kwd>
                <kwd>RAW 264.7 Murine Macrophage Cell Line</kwd>
                <kwd>Lipopolysaccharide</kwd>
                <kwd>Proinflammatory Cytokines</kwd>
                <kwd>PPAR &#x0393;</kwd>
                <kwd>TLR-4</kwd>
                <kwd>Tnf&#x03b1;</kwd>
                <kwd>IL1&#x03b2;</kwd>
                <kwd>IL6</kwd>
                <kwd>Synergistic Combination</kwd>
                <kwd>MTT Assay</kwd>
            </kwd-group>
            <funding-group>
                <funding-statement>The author(s) declared that no grants were involved in supporting this work.</funding-statement>
            </funding-group>
        </article-meta>
        <notes>
            <sec sec-type="version-changes">
                <label>Revised</label>
                <title>Amendments from Version 1</title>
                <p>The revised version of this work includes the following changes: 1- Rephrasing the research title for clarity and relevance&#x00a0; 2- Rephrasing and corrections in the language for clarity&#x00a0; 3- The addition of a "study design flow diagram" for better understanding&#x00a0; 4- Deletion of unnecessary parts in the methods&#x00a0; 5- Summarizing the majority of the methodology part to the most relevant points&#x00a0; 6- Additional future research recommendations</p>
            </sec>
        </notes>
    </front>
    <body>
        <sec id="sec1" sec-type="intro">
            <title>Introduction</title>
            <p>A cytokine storm is a condition of uncontrolled systemic hyperinflammation caused by excess cytokines, leading to multiorgan failure.
                <sup>
                    <xref ref-type="bibr" rid="ref1">1</xref>
                </sup> Cytokine storms may occur for many reasons, including malignancy, rheumatoid arthritis, and sepsis. Recently, cytokine storms were found to be related to mortality and morbidity in many cases of coronavirus disease 2019 (COVID-19).
                <sup>
                    <xref ref-type="bibr" rid="ref2">2</xref>
                </sup> Since coronavirus disease is characterized by hyperinflammation and an excessive immune response, the need to develop anti-cytokine drugs has increased.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>
                </sup> Lipopolysaccharide (LPS), a component of the outer membrane of gram-negative bacteria, signals toll-like receptor 4 (TLR 4) to activate macrophages, which stimulates several intracellular signaling pathways, including those for nuclear transcription factor kappa-B (NF-B) and mitogen-activated protein kinases (MAPKs). Interleukin IL-6, IL-1, and tumor necrosis factor (TNF-&#x03b1;) are proinflammatory cytokines activated macrophages release.
                <sup>
                    <xref ref-type="bibr" rid="ref4">4</xref>
                </sup>
            </p>
            <p>Fraxin, a coumarin derived from the plant Fraxinus and Cortex fraxin, is referred to as 7,8-Dihydroxy-6-methoxy coumarin, 8-D glucopyranoside.
                <sup>
                    <xref ref-type="bibr" rid="ref5">5</xref>
                </sup> Fraxin possesses different pharmacological activities, including anticancer, antiviral, anti-inflammatory, and antioxidant.
                <sup>
                    <xref ref-type="bibr" rid="ref6">6</xref>
                </sup> For this vast potential, fraxin is a target for further immunomodulating studies.</p>
            <p>Quercetin is a bioflavonoid widely distributed in apples, berries, grapes, and onions. Quercetin reported in previous studies to have a wide range of biological actions, including anti-inflammatory properties due to the inhibition of inflammation-related enzymes, cyclooxygenase (COX), and lipoxygenase (LOX).
                <sup>
                    <xref ref-type="bibr" rid="ref7">7</xref>
                </sup> RAW 264.7, a standard monocyte/macrophage cell line, is mainly used to study the anti-inflammatory activity of plant-derived extracts and their active constituents by evaluating the reduction in the production of inflammatory mediators, cytokines, and chemokines in LPS-stimulated RAW 264.7 cells (RAW 264.7 a macrophage cell line that was established from a tumor in a male mouse induced with the Abelson murine leukemia virus).
                <sup>
                    <xref ref-type="bibr" rid="ref8">8</xref>
                </sup>
            </p>
            <p>Peroxisome proliferator-activated receptor &#x03b3; (PPAR-&#x03b3;) is a nuclear hormone receptor and a ligand-activated transcription factor family member. Increasing evidence indicates promising anti-inflammatory properties of cancer cells exerted by activating PPAR-&#x03b3; with synthetic ligands.
                <sup>
                    <xref ref-type="bibr" rid="ref9">9</xref>
                </sup>
            </p>
            <p>PPAR-&#x03b3; agonists have been thought to inhibit the production of monocyte inflammatory cytokines and the expression of inducible nitric oxide synthase (iNOS), which has been observed in response to synthetic anti-diabetic thiazolidinedione drugs (such as BRL 49653 and ciglitizone), and negatively regulates the expression of proinflammatory genes and suppresses tumor cell growth.
                <sup>
                    <xref ref-type="bibr" rid="ref10">10</xref>
                </sup> The anti-inflammatory effect derived from the activation of PPAR-&#x03b3; is likely the result of inhibition of NF-kB, STAT signaling pathway, and MAPK signaling pathway. The inhibition of pro-inflammatory transcriptional factors and signaling pathways results in a reduction in the transcription of genes encoding pro-inflammatory cytokines (e.g., TNF-&#x03b1;, IL-1&#x03b2;, IL-6, IL-12), chemokines, and adhesion molecules. Additionally, it enhances the release of IL-10 and suppresses macrophage polarization toward the M1 phenotype (pro-inflammatory) while promoting the M2 phenotype (anti-inflammatory, tissue repair).
                <sup>
                    <xref ref-type="bibr" rid="ref11">11</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref12">12</xref>
                </sup>
            </p>
            <p>Drug combinations have been previously used as a new approach for treating many diseases. Their beneficial effects appear to be enhancing pharmacological activity and minimizing the dose to avoid any unwanted side effects of drugs without compromising their efficacy.
                <sup>
                    <xref ref-type="bibr" rid="ref13">13</xref>
                </sup> Furthermore, previous literature mentioned that both fraxin and quercetin possess some antioxidant and anti-inflammatory activity in different disease models. This research was designed to investigate the cytokine release inhibitory activity of fraxin and quercetin from the LPS-induced murine macrophage RAW 264.7 cell line, the possible mechanism underlying it, through changes in expression of TLR4 and PPAR-&#x03b3; signaling pathways, and whether exhibiting a potential synergy as combination using iso-bolographic analysis, based on the median effect principle.
                <sup>
                    <xref ref-type="bibr" rid="ref14">14</xref>
                </sup>
            </p>
        </sec>
        <sec id="sec2" sec-type="methods">
            <title>Methods</title>
            <sec id="sec3">
                <title>Study design &amp; Ethical consideration</title>
                <p>This study was designed to evaluate the cytotoxicity, anti-inflammatory activity, and molecular effects of fraxin, quercetin, and their combination (FQ) in LPS-stimulated RAW 264.7 macrophages, with dexamethasone used as a positive control, as illustrated in 
                    <xref ref-type="fig" rid="f1">Figure 1</xref>. The investigations followed the guidelines established by the Ethics Committee of Al-Nahrain University, College of Medicine (approval number Nah. Co. 
                    <italic toggle="yes">Pha.12</italic> on 27 June 2022).</p>
                <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                    <label>
Figure 1. </label>
                    <caption>
                        <title>A summarized illustration of the study design flow diagram.</title>
                    </caption>
                    <graphic id="gr1" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/187473/46764e28-6f04-4555-b263-d7855fdccf99_figure1.gif"/>
                </fig>
            </sec>
            <sec id="sec4">
                <title>Chemicals and reagents</title>
                <p>Quercetin hydrated 2-(3,4-dihydroxy phenyl)-3,5,7-trihydroxy-4Hchromenen-4-one dihydrate (purity &#x2265; 96%), fraxin (7,8-Dihydroxy-6-methoxy coumarin-8-beta-D-glucoside) (purity &#x2265; 98%), dexamethasone (purity &#x2265; 98%), and lipopolysaccharide (LPS) (Escherichia coli, 055: B5) were purchased from Hangzhou-Hyper Chem. Limited/China, dimethyl sulfoxide (DMSO) from Thomas Baker/India, Mouse Interleukin1&#x03b2; (IL-1&#x03b2;), (IL-6), and (TNF-&#x03b1;) enzyme-linked immunosorbent assay (ELISA) kits were purchased from MyBiosource, USA, RAW 264.7, (TIB-71) murine macrophage cell line (ATCC
                    <sup>&#x00ae;</sup> TIB-71&#x2122;), and Dulbecco&#x2019;s modified Eagle&#x2019;s medium (DMEM) from American Type Culture Collection (ATCC, USA), fetal bovine serum (10% FBS), Trypsin- EDTA, penicillin/streptomycin solution from Capricorn Scientific/Germany, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) kit from MyBioSource, USA; TRIazol
                    <sup>&#x00ae;</sup> reagent (Invitrogen); RT-PCR primers: glyceraldehyde 3-phosphate dehydrogenase (GAPDH), PPAR-&#x03b3;, and TLR-4 from OriGene/USA, LightCycler
                    <sup>&#x00ae;</sup> FastStart&#x2122; SYBR
                    <sup>&#x00ae;</sup> Green master kit/Roche, Germany, Revert AidTM first strand Complementary Deoxyribonucleic acid (cDNA) synthesis kit/Thermo Scientific, USA.</p>
                <p>

                    <bold>Cell culture</bold>
                </p>
                <p>Mouse monocytes/macrophages (TIB-71&#x2122;) were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). Cells were maintained in Dulbecco&#x2019;s Modified Eagle Medium (DMEM) (Capricorn Scientific, Germany) supplemented with 10% fetal bovine serum (FBS) and antibiotics (penicillin 10 IU/mL, streptomycin 10 &#x03bc;g/mL, amphotericin B 0.025 &#x03bc;g/mL) at 37 &#x00b0;C in a humidified atmosphere with 5% CO
                    <sub>2</sub>.</p>
                <p>Cell authenticity was confirmed by morphological assessment and growth curve analysis, and cultures were routinely screened for mycoplasma contamination using Hoechst staining after each passage. Cells up to passage 10 were used in all experiments. For assays, cells were seeded in six-well plates at a density of ~6 &#x00d7; 10
                    <sup>4</sup> cells/mL and incubated for 2&#x2013;3 days until reaching 70&#x2013;80% confluence.</p>
            </sec>
            <sec id="sec5">
                <title>Cell viability assay (MTT assay)</title>
                <p>Cell viability in RAW264.7 macrophages was assessed using the MTT assay following treatment with quercetin, fraxin, and their combination (FQ). RAW264.7 cells were seeded at a density of 1 &#x00d7; 10
                    <sup>4</sup> cells/well in 96-well plates and allowed to adhere and grow for 24 h. After this period, the medium was replaced, and cells were exposed to serial dilutions (200, 100, 50, 25, 12.5, and 6.25 &#x03bc;g/mL) of fraxin, quercetin, or FQ (1:1 ratio). Each concentration was tested in triplicate. Two hours post-treatment, lipopolysaccharide (LPS, 1 &#x03bc;g/mL) was added to each well, and the cells were incubated for an additional 24 h. Subsequently, 20 &#x03bc;L of MTT solution (5 mg/mL) was added to each well, followed by a 4 h incubation at 37&#x00b0;C in a 5% CO
                    <sub>2</sub> atmosphere. The medium was then discarded, and 150 &#x03bc;L of dimethyl sulfoxide (DMSO) was added to dissolve the insoluble formazan crystals formed by viable cells. Absorbance was measured at 540 nm using an ELISA plate reader (Human&#x00ae;, USA). Cell viability was calculated relative to untreated control cells, which were considered to have 100% viability.
                    <sup>
                        <xref ref-type="bibr" rid="ref11">11</xref>
                    </sup>
                    <sup>,</sup>
                    <sup>
                        <xref ref-type="bibr" rid="ref15">15</xref>
                    </sup> The percentage of viable cells was determined using the following formula:
                    <disp-formula id="e1">

                        <mml:math display="block">
                            <mml:mtext>Cell viability</mml:mtext>
                            <mml:mspace width="0.25em"/>
                            <mml:mfenced close=")" open="(">
                                <mml:mo>%</mml:mo>
                            </mml:mfenced>
                            <mml:mo>=</mml:mo>
                            <mml:mtext>absorbance of sample</mml:mtext>
                            <mml:mo>/</mml:mo>
                            <mml:mtext>absorbance of control</mml:mtext>
                            <mml:mo>&#x00d7;</mml:mo>
                            <mml:mn>100</mml:mn>
                            <mml:mo>.</mml:mo>
                        </mml:math>
</disp-formula>
                </p>
                <p>Experiments were performed in triplicate, and the data are presented as mean &#x00b1; standard error of the mean.</p>
            </sec>
            <sec id="sec6">
                <title>Sample preparation</title>
                <p>Quercetin hydrated 2-(3,4-dihydroxy phenyl)-3,5,7-trihydroxy-4Hchromenen-4-one dihydrate (purity &#x02c3; 96%), Fraxin (7,8-Dihydroxy-6-methoxy coumarin-8-beta-D-glucoside) (purity &#x02c3; 98%), and LPS (lipopolysaccharide) (
                    <italic toggle="yes">Escherichia coli</italic>, 055: B5) were all purchased from Hangzhou-Hyper Chem. Limited/China. Both quercetin and fraxin were dissolved using DMSO (Dimethyl sulfoxide, from Thomas Baker/India), and LPS was dissolved and diluted in PBS for preparation of 1 &#x03bc;g/ml solution. Each agent (quercetin and fraxin) was dissolved in DMSO and then diluted to a final volume with (Mg
                    <sup>2+</sup>, Ca
                    <sup>2+</sup>)-free PBS buffers at pH 7.4 to prepare a stock solution of 1 mg/ml for each fraxin and quercetin. Serial dilutions were freshly prepared on the same day of the experiment from the stock solution. Agents were tested at concentrations of 200, 100, 50, 25, 12.5, and 6.25 &#x03bc;g/ml, and for FQ (half the concentration was tested for each agent in the same well), cells were supplemented with 200 &#x03bc;l of fresh medium along with the tested agent. The concentration of DMSO used (&lt;0.1%) did not influence the performed assays.</p>
            </sec>
            <sec id="sec7">
                <title>Calculation of the combination index (CI)</title>
                <p>The MTT assay results were analyzed using the isobologram method and the median-effect/combination index (CI) equation as described previously. Dose&#x2013;response curves were generated for each compound individually and in combination across a range of concentrations. In this analysis, D represents the dose, and Dm corresponds to the median-effect dose (IC
                    <sub>50</sub>). The parameters of the dose&#x2013;effect relationships were calculated using the CompuSyn software, which also provided the CI values based on the general combination index equation. Interpretation of the CI values was as follows: CI &lt; 1 indicates synergism, CI = 1 indicates an additive effect, and CI &gt; 1 indicates antagonism.
                    <sup>
                        <xref ref-type="bibr" rid="ref14">14</xref>
                    </sup>
                </p>
            </sec>
            <sec id="sec8">
                <title>Cytokine release inhibitory activity</title>
                <p>The inhibitory effects of fraxin, quercetin, and their combination (FQ) on cytokine release were evaluated in RAW 264.7 macrophages, with dexamethasone serving as the positive control. Proinflammatory cytokines (IL-1&#x03b2;, IL-6, and TNF-&#x03b1;) were quantified following LPS stimulation (1 &#x03bc;g/mL). RAW 264.7 cells were seeded in 96-well plates at a density of 1 &#x00d7; 10
                    <sup>4</sup> cells/well and incubated for 24 h. Cells were then pretreated with fraxin (25 &#x03bc;g/mL), quercetin (12.5 &#x03bc;g/mL), or FQ (6.25 &#x03bc;g/mL), concentrations selected based on MTT assay results. Dexamethasone (5 &#x03bc;g/mL) was included as a reference control. All treatments were performed in triplicate, while untreated cells served as the negative control. After 2 h of pretreatment, LPS was added to each well, and cells were incubated for 24 h at 37 &#x00b0;C in a 5% CO
                    <sub>2</sub> humidified incubator.
                    <sup>
                        <xref ref-type="bibr" rid="ref16">16</xref>
                    </sup>
                    <sup>,</sup>
                    <sup>
                        <xref ref-type="bibr" rid="ref17">17</xref>
                    </sup> Supernatants were collected, centrifuged at 2000 &#x00d7; g for 10 min, and analyzed for cytokine levels using ELISA kits (MyBioSource, USA) specific for IL-1&#x03b2;, IL-6, and TNF-&#x03b1;. All reagents and dilutions were prepared according to the manufacturer&#x2019;s instructions. Cytokine concentrations were determined by fitting sample absorbance values (OD measured at 450 nm) to the standard curve generated from known concentrations, and results were expressed as pg/mL.</p>
            </sec>
            <sec id="sec9">
                <title>Cell treatments and mRNA extraction</title>
                <p>RAW 264.7 cells were seeded into 6-well plates at a density of 1 &#x00d7; 10
                    <sup>6</sup> cells/well and incubated for 24 h. Cells were then pretreated in triplicate with fraxin (25 &#x03bc;g/mL), quercetin (12.5 &#x03bc;g/mL), or their combination FQ (6.25 &#x03bc;g/mL). After 2 h of pretreatment, LPS (1 &#x03bc;g/mL) was added, and cells were further incubated for 24 h at 37 &#x00b0;C in a 5% CO
                    <sub>2</sub> humidified incubator. Following treatment, cells were washed three times with PBS, and growth medium was removed. Total RNA was extracted by lysing cells with 1 mL of TRIzol&#x2122; reagent (Invitrogen, Thermo Fisher Scientific, USA) according to the manufacturer&#x2019;s protocol.
                    <sup>
                        <xref ref-type="bibr" rid="ref18">18</xref>
                    </sup> The concentration of extracted mRNA was determined using a NanoDrop spectrophotometer (Thermo Fisher Scientific, USA). An aliquot of the measured mRNA of each sample concentration was made using nuclease-free water to make the final concentration of mRNA in all samples 0.125 &#x03bc;g/ml.</p>
            </sec>
            <sec id="sec10">
                <title>Determination of the relative gene expression by RT-qPCR</title>
                <p>The two-step SYBR Green RT-qPCR method was used to measure the relative gene expression of the targeted genes (PPAR-&#x03b3; and TLR4) in the RAW264.7 cell line. Quantitative PCR was performed in a final volume of 20 &#x03bc;L, consisting of 18 &#x03bc;L SYBR Green PCR master mix (containing nuclease-free water, forward and reverse primers, SYBR Green I dye, Taq DNA polymerase [1 U], 1.25 mM MgCl
                    <sub>2</sub>, PCR buffer, and 100 &#x03bc;M dNTPs) and 2 &#x03bc;L of cDNA template. In a preliminary step, cDNA was synthesized from total RNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, USA) according to the manufacturer&#x2019;s instructions.</p>
                <p>Primers used for amplification, and their sequences (5&#x2032;&#x2013;3&#x2032;) are listed in 
                    <xref ref-type="table" rid="T1">
Table 1</xref>.</p>
                <table-wrap id="T1" orientation="portrait" position="float">
                    <label>
Table 1. </label>
                    <caption>
                        <title>Gene and primer sequence.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Gene</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
Primer sequence (5&#x2032;&#x2013;3&#x2032;)</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="center" colspan="1" rowspan="1" valign="top">PPAR-&#x03b3;</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Forward: ATCTACACGATGCTGGC
                                    <break/>Reverse: GGATGTCCTCGATGGG</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1" valign="top">TLR4</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Forward: TAGCCATTGCTGCCAACATC
                                    <break/>Reverse: CCTCAGCAGGGACTTCTCAA</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1" valign="top">GAPDH</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Forward: TGCTGAGTATGTCGTGGAGT
                                    <break/>Reverse: GTTCACACCCATCACAAACA
</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <p>Amplification was initiated with an initial denaturation at 95 &#x00b0;C for 3 min, followed by 40 cycles of 95 &#x00b0;C for 25 s and 55 &#x00b0;C for 25 s. To confirm specificity, a melting curve analysis was performed from 60 to 94 &#x00b0;C with a ramp rate of 1 &#x00b0;C/s. Relative gene expression was calculated using the 2
                    <sup>-&#x25b3;&#x25b3;Ct</sup> method, normalized to GAPDH as the reference gene, and expressed as fold-change compared to the control group.
                    <sup>
                        <xref ref-type="bibr" rid="ref19">19</xref>
                    </sup>
                </p>
            </sec>
            <sec id="sec11">
                <title>Statistical analysis</title>
                <p>All tests were performed in triplicate, and the results are presented as mean &#x00b1; standard error of the mean (SEM), analyzed by one-way ANOVA followed by Tukey 
                    <italic toggle="yes">post hoc</italic> test for multiple comparisons. 
                    <ext-link ext-link-type="uri" xlink:href="https://www.google.com/url?sa=t&amp;rct=j&amp;q=&amp;esrc=s&amp;source=web&amp;cd=&amp;cad=rja&amp;uact=8&amp;ved=2ahUKEwjj2Pig--T9AhWJgv0HHZ6VDMkQFnoECBAQAw&amp;url=https%3A%2F%2Fwww.ibm.com%2Fproducts%2Fspss-statistics&amp;usg=AOvVaw0lebISejeVG37EO0IeNV5P">SPSS</ext-link> (RRID: SCR_013726) version 25 was used for statistical analysis; 
                    <italic toggle="yes">P</italic> &lt; 0.05 was considered significant.</p>
            </sec>
        </sec>
        <sec id="sec12" sec-type="results">
            <title>Results</title>
            <sec id="sec13">
                <title>Cell viability assay</title>
                <p>The MTT assay determined the cell viability of RAW 264.7 cells; 
                    <xref ref-type="fig" rid="f2">Figure 2</xref> illustrates the effects of fraxin, quercetin, and FQ on cell viability (expressed as a percentage compared to the control-untreated cells-considered 100% cell viability) in the presence of LPS. A reduction in cell viability was noticeable with higher concentrations of both fraxin and quercetin. While FQ exhibited the highest cytotoxicity among all three treatment groups, the viability of cells was decreased in a dose-dependent manner.</p>
                <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                    <label>
Figure 2. </label>
                    <caption>
                        <title>Effects of fraxin, quercetin, and fraxin + quercetin on RAW 264.7 cell viability.</title>
                        <p>Cell viability was determined using an MTT assay. The lower red line indicates that cells were subjected to different concentrations of all treatment groups with the presence of lipopolysaccharide (LPS) (1 &#x03bc;g/ml), and the upper red line represents 70% cell viability in all treatments. Cell viability was expressed as a percentage compared with the control, which was considered 100% cell viability, and data are presented as mean &#x00b1; SEM.</p>
                    </caption>
                    <graphic id="gr2" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/187473/46764e28-6f04-4555-b263-d7855fdccf99_figure2.gif"/>
                </fig>
                <p>Half-maximal inhibitory concentration (IC
                    <sub>50</sub>) values were 248, 54, and 26.5 for fraxin, quercetin, and FQ, respectively. Based on these results, the threshold for cell viability was set at 70% or higher for further evaluation of the inhibitory activity of cytokine release,
                    <sup>
                        <xref ref-type="bibr" rid="ref8">8</xref>
                    </sup> and the concentrations (25, 12.5, 6.25 &#x03bc;g/ml) for fraxin, quercetin, and FQ were selected, respectively, for the evaluation.</p>
            </sec>
            <sec id="sec14">
                <title>Calculation of the combination index (CI)</title>
                <p>The combination index (CI) for FQ in a 1:1 ratio was calculated using CompuSyn based on the MTT results. Dose-effect and median-effect curves were plotted for each drug and its combination. The Results showed that FQ in a 1:1 ratio exhibited synergism, with CI values of 0.297 at IC
                    <sub>50</sub> and CI values of 0.409, 0.333, 0.332, 0.267, 0.265, and 0.276 at the following concentrations FQ (200, 100, 50, 25, 12,5, 6.25 g/ml).</p>
            </sec>
            <sec id="sec15">
                <title>The inhibitory activity of cytokine release</title>
                <p>Fraxin, quercetin, and FQ in concentrations of 25, 12.5, 6.25 &#x03bc;g/ml, respectively, significantly suppressed the production of IL-1&#x03b2;, IL-6, and TNF-&#x03b1; (
                    <italic toggle="yes">P</italic> &#x02c2; 0.01) in a dose-dependent manner when compared to control (cells treated with LPS only). LPS significantly upregulated production of proinflammatory cytokines compared to the control group (
                    <italic toggle="yes">P</italic> &#x02c2; 0.05). The highest inhibition activity was recorded with dexamethasone (5 &#x03bc;g/ml) (positive, treated group) which significantly (
                    <italic toggle="yes">P</italic> &#x02c2; 0.05) suppressed IL-1&#x03b2;, IL-6, and TNF-&#x03b1; by 75.7%, 69%, and 79% respectively, compared with the LPS-treated control. In the case of the combination, FQ, the levels of IL-1&#x03b2;, IL-6, and TNF-&#x03b1; were reduced by 56.2%, 58.5%, and 70.6% respectively, suggesting it is more effective in inactivating cytokine production than each drug alone. The results are shown in 
                    <xref ref-type="fig" rid="f3">
Figure 3A</xref>, 
                    <xref ref-type="fig" rid="f3">
B</xref>, and 
                    <xref ref-type="fig" rid="f3">
C</xref>).</p>
                <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                    <label>
Figure 3. </label>
                    <caption>
                        <title>A: Effects of fraxin, quercetin, and fraxin + quercetin on cytokine levels (IL-1) in RAW 264.7 cells at varied doses (25, 12.5,6.25 g/ml), 2 hours apart. Subsequently, all the cells were exposed to lipopolysaccharide (LPS) (1 &#x03bc;g/ml) for 24 h. All data are presented as mean &#x00b1; SEM. * 
                            <italic toggle="yes">P</italic> &#x02c2; 0.01 vs. LPS group, ** 
                            <italic toggle="yes">P</italic> &#x02c2; 0.05 vs. control. B:
 Effects of fraxin, quercetin, and fraxin + quercetin on cytokine levels (IL-6) in RAW 264.7 cells at various doses (25, 12.5,6.25 g/ml) after 2 hours. Subsequently, all cells were exposed to lipopolysaccharide (LPS) (1 &#x03bc;g/ml) for 24 h. *
                            <italic toggle="yes">P</italic> &#x02c2; 0.01 vs. LPS group, **
                            <italic toggle="yes">P</italic> &#x02c2; 0.05 vs. control. C: Effects of fraxin, quercetin, and fraxin + quercetin on cytokines levels (TNF-&#x03b1;) in RAW 264.7 cells using different concentrations (25, 12.5,6.25 &#x03bc;g/ml), after 2 h. Later all cells were exposed to LPS (1 &#x03bc;g/ml) for 24 h. All data are presented as mean &#x00b1; SEM. *
                            <italic toggle="yes">P</italic> &#x02c2; 0.01 vs. LPS group, **
                            <italic toggle="yes">P</italic> &#x02c2;0.05 vs. control.</title>
                    </caption>
                    <graphic id="gr3" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/187473/46764e28-6f04-4555-b263-d7855fdccf99_figure3.gif"/>
                </fig>
            </sec>
            <sec id="sec16">
                <title>Gene expression analysis</title>
                <p>When compared to the control, pretreatment of RAW 264.7 cells with farxin (25 &#x03bc;g/ml), quercetin (12.5 &#x03bc;g/ml), and FQ (6.25 &#x03bc;g/ml) for 2 hours before LPS (1 &#x03bc;g/ml) resulted in significant (
                    <italic toggle="yes">P</italic>
 &#x02c2; 0.05) suppression of TLR-4 gene upregulation by (89%, 82%, and 93%, respectively). Treatment with LPS activated the TLR-4 pathway, as shown in 
                    <xref ref-type="fig" rid="f4">
Figure 4A</xref>, and treatment with fraxin, quercetin, and FQ successfully counteracted the stimulatory impact of LPS on RAW 264.7 cells. Furthermore, compared to either treatment alone, the combination synergistically reversed the impact of LPS on cells.</p>
                <fig fig-type="figure" id="f4" orientation="portrait" position="float">
                    <label>
Figure 4. </label>
                    <caption>
                        <title>A: The effects of treatment on the gene expression of Toll-like receptor 4. Cells were pretreated with fraxin (25 &#x03bc;g/ml), quercetin (12.5 &#x03bc;g/ml), and quercetin + fraxin (6.25 &#x03bc;g/ml) for 2 h. Cells were then treated with lipopolysaccharide (LPS) (1 &#x03bc;g/ml) and incubated for 24 h. **
                            <italic toggle="yes">P</italic> &lt; 0.001; compared with the control, each graph has been represented as Mean. B: The effects of treatment on gene expression of PPAR-&#x03b3;, RAW 264.7 Cells were pretreated with fraxin (25 &#x03bc;g/m), quercetin (12.5 &#x03bc;g/m), and quercetin + fraxin (6.25 &#x03bc;g/m) for 2 h. Cells were treated with lipopolysaccharide (LPS) (1 &#x03bc;g/ml) and incubated for 24 h. **
                            <italic toggle="yes">P</italic> &lt; 0.001; compared with the control, each graph has been represented as Mean.</title>
                    </caption>
                    <graphic id="gr4" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/187473/46764e28-6f04-4555-b263-d7855fdccf99_figure4.gif"/>
                </fig>
                <p>While 
                    <xref ref-type="fig" rid="f4">
Figure 4B</xref> reveals that there is a considerable stimulatory impact on the PPAR-&#x03b3; pathway, this effect is shown as enhanced gene expression. FQ increased up to 60-fold relative to the control, whereas fraxin and quercetin (17.6, 8.6-folds, respectively) decreased proinflammatory cytokines (
                    <xref ref-type="fig" rid="f4">Figure 4B</xref>), indicating a mechanism by which fraxin, quercetin, and their combination reduce proinflammatory cytokines.</p>
            </sec>
        </sec>
        <sec id="sec17" sec-type="discussion">
            <title>Discussion</title>
            <p>The devastating epidemic caused by SARS-CoV-2 in 2019 prompted researchers to make a considerable effort to search for a possible solution to limit infection. Following the demonstration of the pathological role of the &#x201c;cytokine storm&#x201d;, evidence for a cytokine release syndrome can be seen in increased proinflammatory cytokines in late-stage COVID-19. As seen in previous epidemics caused by SARS-CoV and MERS-CoV, dysregulated cytokine production and an influx of inflammatory myeloid cells can cause lung infiltration, septic shock, respiratory failure, acute respiratory distress syndrome (ARDS), multiorgan failure, and death.
                <sup>
                    <xref ref-type="bibr" rid="ref20">20</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref21">21</xref>
                </sup> Gram-negative bacteria&#x2019;s outer membrane lipopolysaccharide (LPS) is used in inducing a cytokine storm model both 
                <italic toggle="yes">in vivo</italic> and 
                <italic toggle="yes">in vitro</italic> studies. The stimulation of macrophages with LPS can cause the excessive release of proinflammatory cytokines by activating the nuclear factor &#x03ba;B (NF- &#x03ba;B) and mitogen-activated protein kinase (MAPK) signaling pathways, increasing (COX-2) and (iNOS).
                <sup>
                    <xref ref-type="bibr" rid="ref22">22</xref>
                </sup> RAW 264.7 cells induced by LPS is the most widely used model for evaluating anti-cytokines 
                <italic toggle="yes">in vitro.</italic> For centuries, plants have been used as a natural remedy for numerous illnesses. Hong 
                <italic toggle="yes">et al.</italic> (2012) reported a dose-dependent reduction in cell spreading and pseudopodia production after treatment with an ethanol extract of 
                <italic toggle="yes">Fraxinus rhynchophylla</italic> bark on LPS-stimulated macrophages.
                <sup>
                    <xref ref-type="bibr" rid="ref23">23</xref>
                </sup> Whang 
                <italic toggle="yes">et al</italic>. (2005) suggested in their study that fraxin and fraxin-related chemicals improved cell survival rate in human umbilical vein endothelial cells (HUVECs) when exposed to hydrogen peroxide (H
                <sub>2</sub>O
                <sub>2</sub>) mediated oxidative stress; other previous studies discussed the effect of quercetin on cell migration, which plays a vital role in the development of cancer.
                <sup>
                    <xref ref-type="bibr" rid="ref24">24</xref>
                </sup>
            </p>
            <p>Quercetin strongly inhibited LPS-induced macrophage adhesion and migration in a dose-dependent manner.
                <sup>
                    <xref ref-type="bibr" rid="ref25">25</xref>
                </sup> Previous research has highlighted the various biological activities of fraxin and quercetin, including anti-inflammatory and antioxidant effects, raising the need for additional investigation into their role in cytokine storms. Our study observed that fraxin, quercetin, and fraxin + quercetin exerted low cytotoxic activity on RAW 264.7, and only when cells were exposed to higher concentrations of fraxin and quercetin, which was in agreement with a study by Cui 
                <italic toggle="yes">et al.</italic> that suggested that only the highest concentration of quercetin reduced macrophage viability when administered together with LPS (1 &#x03bc;g/mL).
                <sup>
                    <xref ref-type="bibr" rid="ref25">25</xref>
                </sup> Other previous studies compatible with our study support that the presence or absence of LPS did not compromise the cell viability of RAW 264.7.
                <sup>
                    <xref ref-type="bibr" rid="ref23">23</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref26">26</xref>
                </sup>
            </p>
            <p>Li 
                <italic toggle="yes">et al.</italic> (2019) concluded that fraxin confers protection against LPS-induced lung injury and the inflammatory response in A549 cells.
                <sup>
                    <xref ref-type="bibr" rid="ref26">26</xref>
                </sup> In an approach to modulate virus hyperinflammation such as chronic systemic symptoms, the anti-inflammatory effects of quercetin were investigated in mouse macrophage cells exposed to polyinosinic-polycytidylic acid (poly (I:C) as an experimental model for viral inflammation by Kim YJ and Park W. (2016). They found that quercetin might suppress poly (I:C)-induced inflammation by reducing the levels of inflammatory mediators.
                <sup>
                    <xref ref-type="bibr" rid="ref27">27</xref>
                </sup>
            </p>
            <p>Our findings support previous research that found that both fraxin and quercetin were effective at suppressing the release of proinflammatory mediators from LPS-induced RAW 264.7, the mechanism underlying which may be related to interference with various inflammatory signaling pathways, including the TLR signaling system. Following their activation, proinflammatory molecules (such as IL-1, IL-6, and TNF-&#x03b1;) are abundantly generated, and NF-&#x03ba;B phosphorylation, nuclear translocation, and upregulated transcription of proinflammatory factors are all results of TLR-4 activation.
                <sup>
                    <xref ref-type="bibr" rid="ref22">22</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref28">28</xref>
                </sup>
            </p>
            <p>In numerous macrophage models, PPAR-&#x03b3; has been demonstrated to exert anti-inflammatory effects by suppressing the expression of multiple pro-inflammatory genes, including IL-6, TNF-&#x03b1;, and IL-12.
                <sup>
                    <xref ref-type="bibr" rid="ref29">29</xref>
                </sup> From earlier studies, fraxin, isolated from the roots of 
                <italic toggle="yes">Ulmus macrocarpa</italic> Hance, significantly suppressed the expression of iNOS and COX-2, increased PPAR-&#x03b3; expression, activated the nuclear factor erythroid 2-related factor 2/heme oxygenase-1 (HO-1) (Nrf2/HO-1) pathway, and inhibited NF-&#x03ba;B and ERK1/2 in a dose-dependent manner The neuroprotective and anti-inflammatory effects of fraxin were also diminished by treatment with GW9662 which is a PPAR-&#x03b3; antagonist.
                <sup>
                    <xref ref-type="bibr" rid="ref30">30</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref31">31</xref>
                </sup>
            </p>
            <p>In LPS-induced ARDS in mice, fraxin reduced the production of TNF-&#x03b1;, IL-1&#x03b2;, IL-6, Reactive oxygen species (ROS), and Malondialdehyde (MDA), increased superoxide dismutase (SOD), and suppressed NF-&#x03ba;B and MAPK signaling.
                <sup>
                    <xref ref-type="bibr" rid="ref32">32</xref>
                </sup>
            </p>
            <p>Li 
                <italic toggle="yes">et al.</italic>, 2019 discovered that pretreatment with fraxin decreased protein expressions of NF-&#x03ba;B and nucleotide-binding domain, leucine-rich&#x2013;containing family, pyrin domain&#x2013;containing-3 (NLRP3) activated in response to lipopolysaccharide (LPS).
                <sup>
                    <xref ref-type="bibr" rid="ref33">33</xref>
                </sup> Aesculin, a hydroxycoumarin, is the 6-O-beta-D-glucoside of esculetin, another organic compound isolated from Cortex fraxini that is structurally related to fraxin. Furthermore, studies in the peritoneum and macrophages demonstrated that aesculin inhibits the production of inflammatory mediators such as iNOS, IL-1, and TNF-&#x03b1; via the PPAR-&#x03b3;/NF-&#x03ba;B pathway.
                <sup>
                    <xref ref-type="bibr" rid="ref34">34</xref>
                </sup>
            </p>
            <p>While quercetin inhibits liver inflammation mainly through NF-&#x03ba;B/TLR/NLRP3, it also inhibits LPS-stimulated NO increase by suppressing iNOS.
                <sup>
                    <xref ref-type="bibr" rid="ref35">35</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref36">36</xref>
                </sup> In addition, in the differentiated human acute monocyte leukemia cell line (THP-1), quercetin might lower cholesterol levels in macrophages with elevated PPAR-&#x03b3; expression. Quercetin metabolites, such as quercetin-3-glucuronide (Q3G) and quercetin-3&#x2032;-sulfate, also upregulated PPAR-&#x03b3; in A549 lung cancer cells.
                <sup>
                    <xref ref-type="bibr" rid="ref37">37</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref38">38</xref>
                </sup>
            </p>
            <p>Flavonoids, such as quercetin and kaempferol, increase PPAR-&#x03b3;-mediated gene expression through a mechanism distinct from conventional PPAR-&#x03b3; agonists.
                <sup>
                    <xref ref-type="bibr" rid="ref39">39</xref>
                </sup>
            </p>
            <p>Dihydroquercetin activates AMPK/Nrf2/HO-1 signaling in macrophages, which mediates its anti-inflammatory effects.
                <sup>
                    <xref ref-type="bibr" rid="ref40">40</xref>
                </sup>
            </p>
            <p>Our results were consistent with previous studies supporting that fraxin and quercetin upregulated PPAR-&#x03b3; expression and downregulated TLR-4, stimulated by LPS treatment in macrophage RAW 264.7 cells.</p>
            <p>Fraxin + quercetin showed synergistic activity when combined, which may be due to multiple targets involved when coming to their anti-inflammatory mechanism, resulting in suppression of proinflammatory mediators IL-1, IL-6, TNF-&#x03b1;, and suppression of other pathways like iNOS, COX-2, Nrf2/HO-1, NF-&#x03ba;B, NLRP3, TLR-4, and upregulation of PPAR-&#x03b3;.</p>
            <p>A study described the synergistic combination of two bioflavonoids: quercetin and catechin; this combination caused inhibition of the LPS-activated upregulation of iNOS and COX-2.
                <sup>
                    <xref ref-type="bibr" rid="ref26">26</xref>
                </sup> Previous studies have shown that drug combinations, especially in phytopharmaceuticals, may activate entirely different sets of genes than those started by each drug alone.
                <sup>
                    <xref ref-type="bibr" rid="ref41">41</xref>
                </sup> This may provide another theoretical explanation for the synergistic activity between fraxin and quercetin, despite the differences in their chemical structures.</p>
        </sec>
        <sec id="sec18" sec-type="conclusions">
            <title>Conclusions</title>
            <p>Our study showed that fraxin, quercetin, and their combination exert anti-cytokine storm activity on LPS-induced RAW246.7 cells by targeting multiple signaling pathways and suppressing TLR-mediated NF-&#x03ba;B. Upregulation of PPAR-&#x03b3; mediated gene expression (
                <xref ref-type="fig" rid="f4">Figure 4A</xref> and 
                <xref ref-type="fig" rid="f4">B</xref>) may serve as a foundation for future research into other combinations of fraxin and quercetin and pathways involved in their molecular mechanisms explaining the synergistic cytokine release inhibitory activity. As the current study demonstrates an effect against cytokine release with potential synergism, these outcomes need further exploration using in vivo models of LPS to validate the synergism through pharmacokinetic studies and explore other signaling pathways to explain and relate to the current outcomes.</p>
        </sec>
    </body>
    <back>
        <sec id="sec21" sec-type="data-availability">
            <title>Data availability</title>
            <sec id="sec22">
                <title>Underlying data</title>
                <p>Zenodo: Anti-cytokine storm activity of fraxin and quercetin, alone and in combination, and their possible molecular mechanisms via TLR4 and PPAR&#x03b3; signaling pathways in LPS-induced RAW 264.7 cell line article data 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.5281/zenodo.7822393">https://doi.org/10.5281/zenodo.7822393</ext-link>.
                    <sup>
                        <xref ref-type="bibr" rid="ref42">42</xref>
                    </sup>
                </p>
                <p>This project contains the following underlying data:
                    <list list-type="bullet">
                        <list-item>
                            <label>&#x2022;</label>
                            <p>Article data.xlsx (Anti-cytokine storm activity of fraxin and quercetin, alone and in combination, and their possible molecular mechanisms via TLR4 and PPAR&#x03b3; signaling pathways in LPS-induced RAW 264.7 cell line article data).
</p>
                        </list-item>
                    </list>
                </p>
                <p>Data are available under the terms of the 
                    <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution 4.0 International license</ext-link> (CC-BY 4.0).</p>
            </sec>
        </sec>
        <ref-list>
            <title>References</title>
            <ref id="ref1">
                <label>1</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Rabaan</surname>
                            <given-names>AA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Al-Ahmed</surname>
                            <given-names>SH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Muhammad</surname>
                            <given-names>J</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Role of inflammatory cytokines in COVID-19 patients: A review on molecular mechanisms, immune functions, immunopathology and immunomodulatory drugs to counter cytokine storm.</article-title>
                    <source>

                        <italic toggle="yes">Vaccines.</italic>
</source>
                    <year>2021</year>;<volume>9</volume>(<issue>5</issue>):<fpage>436</fpage>.
                    <pub-id pub-id-type="pmid">33946736</pub-id>
                    <pub-id pub-id-type="doi">10.3390/vaccines9050436</pub-id>
                    <pub-id pub-id-type="pmcid">PMC8145892</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref2">
                <label>2</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kim</surname>
                            <given-names>JS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lee</surname>
                            <given-names>JY</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yang</surname>
                            <given-names>JW</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Immunopathogenesis and treatment of cytokine storm in COVID-19.</article-title>
                    <source>

                        <italic toggle="yes">Theranostics.</italic>
</source>
                    <year>2021</year>;<volume>11</volume>(<issue>1</issue>):<fpage>316</fpage>&#x2013;<lpage>329</lpage>.
                    <pub-id pub-id-type="pmid">33391477</pub-id>
                    <pub-id pub-id-type="doi">10.7150/thno.49713</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7681075</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref3">
                <label>3</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Schijns</surname>
                            <given-names>V</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lavelle</surname>
                            <given-names>EC</given-names>
                        </name>
</person-group>:
                    <article-title>Prevention and treatment of COVID-19 disease by controlled modulation of innate immunity.</article-title>
                    <source>

                        <italic toggle="yes">Eur. J. Immunol.</italic>
</source>
                    <year>2020</year>;<volume>50</volume>(<issue>7</issue>):<fpage>932</fpage>&#x2013;<lpage>938</lpage>.
                    <pub-id pub-id-type="pmid">32438473</pub-id>
                    <pub-id pub-id-type="doi">10.1002/eji.202048693</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7280664</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref4">
                <label>4</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kim</surname>
                            <given-names>M-J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jeong</surname>
                            <given-names>S-M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kang</surname>
                            <given-names>B-K</given-names>
                        </name>
</person-group>:
                    <article-title>Anti-inflammatory effects of grasshopper ketone from Sargassum fulvellum ethanol extract on lipopolysaccharide-induced inflammatory responses in RAW 264.7 cells.</article-title>
                    <year>2019</year>.</mixed-citation>
            </ref>
            <ref id="ref5">
                <label>5</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Xiao</surname>
                            <given-names>B</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hao</surname>
                            <given-names>Z</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Simultaneous determination of fraxin and its metabolite, fraxetin, in rat plasma by liquid chromatography-tandem mass spectrometry and its application in a pharmacokinetic study.</article-title>
                    <source>

                        <italic toggle="yes">J. Chromatogr. B.</italic>
</source>
                    <year>2016</year>;<volume>1017</volume>:<fpage>70</fpage>&#x2013;<lpage>74</lpage>.</mixed-citation>
            </ref>
            <ref id="ref6">
                <label>6</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sarfraz</surname>
                            <given-names>I</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rasul</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jabeen</surname>
                            <given-names>F</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Fraxinus: a plant with versatile pharmacological and biological activities.</article-title>
                    <source>

                        <italic toggle="yes">Evid. Based Complement. Alternat. Med.</italic>
</source>
                    <year>2017</year>;<volume>2017</volume>:<fpage>1</fpage>&#x2013;<lpage>12</lpage>.
                    <pub-id pub-id-type="pmid">29279716</pub-id>
                    <pub-id pub-id-type="doi">10.1155/2017/4269868</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5723943</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref7">
                <label>7</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yao</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Han</surname>
                            <given-names>C</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Quercetin I. Immunity.</article-title>
                    <source>

                        <italic toggle="yes">Nutrients.</italic>
</source>
                    <year>2016</year>;<volume>8</volume>(<issue>3</issue>):<fpage>167</fpage>.
                    <pub-id pub-id-type="pmid">26999194</pub-id>
                    <pub-id pub-id-type="doi">10.3390/nu8030167</pub-id>
                    <pub-id pub-id-type="pmcid">PMC4808895</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref8">
                <label>8</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Marques</surname>
                            <given-names>RV</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sestito</surname>
                            <given-names>SE</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bourgaud</surname>
                            <given-names>F</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Anti-Inflammatory Activity of Bryophytes Extracts in LPS-Stimulated RAW264. 7 Murine Macrophages.</article-title>
                    <source>

                        <italic toggle="yes">Molecules.</italic>
</source>
                    <year>2022</year>;<volume>27</volume>(<issue>6</issue>):<fpage>1940</fpage>.
                    <pub-id pub-id-type="pmid">35335304</pub-id>
                    <pub-id pub-id-type="doi">10.3390/molecules27061940</pub-id>
                    <pub-id pub-id-type="pmcid">PMC8953629</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref9">
                <label>9</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Lokhande</surname>
                            <given-names>KB</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ballav</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yadav</surname>
                            <given-names>RS</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Probing intermolecular interactions and binding stability of kaempferol, quercetin and resveratrol derivatives with PPAR-&#x03b3;: docking, molecular dynamics and MM/GBSA approach to reveal potent PPAR-&#x03b3; agonist against cancer.</article-title>
                    <source>

                        <italic toggle="yes">J. Biomol. Struct. Dyn.</italic>
</source>
                    <year>2022</year>;<volume>40</volume>(<issue>3</issue>):<fpage>971</fpage>&#x2013;<lpage>981</lpage>.
                    <pub-id pub-id-type="pmid">32954977</pub-id>
                    <pub-id pub-id-type="doi">10.1080/07391102.2020.1820380</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref10">
                <label>10</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Liang</surname>
                            <given-names>Y-C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tsai</surname>
                            <given-names>S-H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tsai</surname>
                            <given-names>D-C</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Suppression of inducible cyclooxygenase and nitric oxide synthase through activation of peroxisome proliferator-activated receptor-&#x03b3; by flavonoids in mouse macrophages.</article-title>
                    <source>

                        <italic toggle="yes">FEBS Lett.</italic>
</source>
                    <year>2001</year>;<volume>496</volume>(<issue>1</issue>):<fpage>12</fpage>&#x2013;<lpage>18</lpage>.
                    <pub-id pub-id-type="pmid">11343698</pub-id>
                    <pub-id pub-id-type="doi">10.1016/S0014-5793(01)02393-6</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref11">
                <label>11</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hussein</surname>
                            <given-names>ZA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Abu-Raghif</surname>
                            <given-names>AR</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Fawzi</surname>
                            <given-names>HA</given-names>
                        </name>
</person-group>:
                    <article-title>The mitigating effect of para-hydroxycinnamic acid in bleomycin-induced pulmonary fibrosis in mice through targeting oxidative, inflammatory and fibrotic pathways.</article-title>
                    <source>

                        <italic toggle="yes">Basic Clin. Pharmacol. Toxicol.</italic>
</source>
                    <year>2024</year>;<volume>135</volume>(<issue>1</issue>):<fpage>23</fpage>&#x2013;<lpage>42</lpage>.
                    <pub-id pub-id-type="pmid">38745367</pub-id>
                    <pub-id pub-id-type="doi">10.1111/bcpt.14018</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref12">
                <label>12</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Fu</surname>
                            <given-names>Q</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Shen</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Fang</surname>
                            <given-names>T</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>ACT001 alleviates inflammation and pyroptosis through the PPAR-&#x03b3;/NF-&#x03ba;B signaling pathway in LPS-induced alveolar macrophages.</article-title>
                    <source>

                        <italic toggle="yes">Genes Genom.</italic>
</source>
                    <year>2024</year>;<volume>46</volume>:<fpage>323</fpage>&#x2013;<lpage>332</lpage>.
                    <pub-id pub-id-type="pmid">37831404</pub-id>
                    <pub-id pub-id-type="doi">10.1007/s13258-023-01455-w</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref13">
                <label>13</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sun</surname>
                            <given-names>W</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sanderson</surname>
                            <given-names>PE</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zheng</surname>
                            <given-names>W</given-names>
                        </name>
</person-group>:
                    <article-title>Drug combination therapy increases successful drug repositioning.</article-title>
                    <source>

                        <italic toggle="yes">Drug Discov. Today.</italic>
</source>
                    <year>2016</year>;<volume>21</volume>(<issue>7</issue>):<fpage>1189</fpage>&#x2013;<lpage>1195</lpage>.
                    <pub-id pub-id-type="pmid">27240777</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.drudis.2016.05.015</pub-id>
                    <pub-id pub-id-type="pmcid">PMC4907866</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref14">
                <label>14</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Rodea-Palomares</surname>
                            <given-names>I</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Petre</surname>
                            <given-names>AL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Boltes</surname>
                            <given-names>K</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Application of the combination index (CI)-isobologram equation to study the toxicological interactions of lipid regulators in two aquatic bioluminescent organisms.</article-title>
                    <source>

                        <italic toggle="yes">Water Res.</italic>
</source>
                    <year>2010</year>;<volume>44</volume>(<issue>2</issue>):<fpage>427</fpage>&#x2013;<lpage>438</lpage>.
                    <pub-id pub-id-type="doi">10.1016/j.watres.2009.07.026</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref15">
                <label>15</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hameed</surname>
                            <given-names>HG</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sahib</surname>
                            <given-names>HB</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Omran</surname>
                            <given-names>ZS</given-names>
                        </name>
</person-group>:
                    <article-title>Investigating the anti-carcinogenic potential action of 1,2,3 triazole core compounds: impact of introducing an aldehyde or Nitro group, integrating cell line studies, and in silico ADME and protein target prediction.</article-title>
                    <source>

                        <italic toggle="yes">Pharmacia.</italic>
</source>
                    <year>2024</year>;<volume>71</volume>:<fpage>1</fpage>&#x2013;<lpage>9</lpage>.
                    <pub-id pub-id-type="doi">10.3897/pharmacia.71.e123794</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref16">
                <label>16</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sandhiutami</surname>
                            <given-names>NMD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Moordiani</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Laksmitawati</surname>
                            <given-names>DR</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>In vitro assesment of anti-inflammatory activities of coumarin and Indonesian cassia extract in RAW264. 7 murine macrophage cell line.</article-title>
                    <source>

                        <italic toggle="yes">Iran. J. Basic Med. Sci.</italic>
</source>
                    <year>2017</year>;<volume>20</volume>(<issue>1</issue>):<fpage>99</fpage>&#x2013;<lpage>106</lpage>.
                    <pub-id pub-id-type="pmid">28133531</pub-id>
                    <pub-id pub-id-type="doi">10.22038/ijbms.2017.8102</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref17">
                <label>17</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Han</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wu</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Liu</surname>
                            <given-names>F</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Inhibition of LPS-induced inflammatory response in RAW264.7 cells by natural Chlorogenic acid isomers involved with AKR1B1 inhibition.</article-title>
                    <source>

                        <italic toggle="yes">Bioorg. Med. Chem.</italic>
</source>
                    <year>2024</year>;<volume>114</volume>:<fpage>117942</fpage>.
                    <pub-id pub-id-type="pmid">39396466</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.bmc.2024.117942</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref18">
                <label>18</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kim</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>An</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Shin</surname>
                            <given-names>SA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Anti-inflammatory effects of TP1 in LPS-induced Raw264.7 macrophages.</article-title>
                    <source>

                        <italic toggle="yes">Appl. Biol. Chem.</italic>
</source>
                    <year>2024</year>;<volume>67</volume>:<fpage>16</fpage>.
                    <pub-id pub-id-type="doi">10.1186/s13765-024-00873-y</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref19">
                <label>19</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ali</surname>
                            <given-names>ZM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kadhim</surname>
                            <given-names>HM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hassan</surname>
                            <given-names>OM</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Antiangiogenic activity of 5-bromoindole carbothioamide derivative in ex vivo, in vivo, and in vitro experimental study.</article-title>
                    <source>

                        <italic toggle="yes">Pharmacia.</italic>
</source>
                    <year>2024</year>;<volume>71</volume>:<fpage>1</fpage>&#x2013;<lpage>9</lpage>.
                    <pub-id pub-id-type="doi">10.3897/pharmacia.71.e128589</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref20">
                <label>20</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Coperchini</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Chiovato</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ricci</surname>
                            <given-names>G</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The cytokine storm in COVID-19: Further advances in our understanding the role of specific chemokines involved.</article-title>
                    <source>

                        <italic toggle="yes">Cytokine Growth Factor Rev.</italic>
</source>
                    <year>2021</year>;<volume>58</volume>:<fpage>82</fpage>&#x2013;<lpage>91</lpage>.
                    <pub-id pub-id-type="pmid">33573850</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.cytogfr.2020.12.005</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7837329</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref21">
                <label>21</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Rizk</surname>
                            <given-names>JG</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kalantar-Zadeh</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mehra</surname>
                            <given-names>MR</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Pharmaco-immunomodulatory therapy in COVID-19.</article-title>
                    <source>

                        <italic toggle="yes">Drugs.</italic>
</source>
                    <year>2020</year>;<volume>80</volume>:<fpage>1267</fpage>&#x2013;<lpage>1292</lpage>.
                    <pub-id pub-id-type="pmid">32696108</pub-id>
                    <pub-id pub-id-type="doi">10.1007/s40265-020-01367-z</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7372203</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref22">
                <label>22</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ye</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yang</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Aloperine suppresses LPS-induced macrophage activation through inhibiting the TLR4/NF-&#x03ba;B pathway.</article-title>
                    <source>

                        <italic toggle="yes">Inflamm. Res.</italic>
</source>
                    <year>2020</year>;<volume>69</volume>:<fpage>375</fpage>&#x2013;<lpage>383</lpage>.
                    <pub-id pub-id-type="pmid">32144444</pub-id>
                    <pub-id pub-id-type="doi">10.1007/s00011-019-01313-0</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref23">
                <label>23</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hong</surname>
                            <given-names>G-E</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Park</surname>
                            <given-names>H-S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kim</surname>
                            <given-names>J-A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Anti-oxidant and anti-inflammatory effects of Fraxinus rhynchophylla on lipopolysaccharide (LPS)-induced murine Raw 264.7 cells.</article-title>
                    <source>

                        <italic toggle="yes">J. Biomed. Res.</italic>
</source>
                    <year>2012</year>;<volume>13</volume>(<issue>4</issue>):<fpage>331</fpage>&#x2013;<lpage>338</lpage>.
                    <pub-id pub-id-type="doi">10.12729/jbr.2012.13.4.331</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref24">
                <label>24</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Whang</surname>
                            <given-names>WK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Park</surname>
                            <given-names>HS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ham</surname>
                            <given-names>I</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Natural compounds, fraxin and chemicals structurally related to fraxin protect cells from oxidative stress.</article-title>
                    <source>

                        <italic toggle="yes">Exp. Mol. Med.</italic>
</source>
                    <year>2005</year>;<volume>37</volume>(<issue>5</issue>):<fpage>436</fpage>&#x2013;<lpage>446</lpage>.
                    <pub-id pub-id-type="doi">10.1038/emm.2005.54</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref25">
                <label>25</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Cui</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wu</surname>
                            <given-names>Q</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>J</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Quercetin inhibits LPS-induced macrophage migration by suppressing the iNOS/FAK/paxillin pathway and modulating the cytoskeleton.</article-title>
                    <source>

                        <italic toggle="yes">Cell Adhes. Migr.</italic>
</source>
                    <year>2019</year>;<volume>13</volume>(<issue>1</issue>):<fpage>1</fpage>&#x2013;<lpage>12</lpage>.
                    <pub-id pub-id-type="pmid">29945484</pub-id>
                    <pub-id pub-id-type="doi">10.1080/19336918.2018.1486142</pub-id>
                    <pub-id pub-id-type="pmcid">PMC6527387</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref26">
                <label>26</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Liu</surname>
                            <given-names>X</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Synergistic anti-inflammatory effects of quercetin and catechin via inhibiting activation of TLR4&#x2013;MyD88-mediated NF-&#x03ba;B and MAPK signaling pathways.</article-title>
                    <source>

                        <italic toggle="yes">Phytother. Res.</italic>
</source>
                    <year>2019</year>;<volume>33</volume>(<issue>3</issue>):<fpage>756</fpage>&#x2013;<lpage>767</lpage>.
                    <pub-id pub-id-type="doi">10.1002/ptr.6268</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref27">
                <label>27</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kim</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Park</surname>
                            <given-names>W</given-names>
                        </name>
</person-group>:
                    <article-title>Anti-Inflammatory Effect of Quercetin on RAW 264.7 Mouse Macrophages Induced with Polyinosinic-Polycytidylic Acid.</article-title>
                    <source>

                        <italic toggle="yes">Molecules.</italic>
</source>
                    <year>2016</year>;<volume>21</volume>(<issue>4</issue>):<fpage>450</fpage>.
                    <pub-id pub-id-type="pmid">27049378</pub-id>
                    <pub-id pub-id-type="doi">10.3390/molecules21040450</pub-id>
                    <pub-id pub-id-type="pmcid">PMC6273652</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref28">
                <label>28</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Shi</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hua</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kong</surname>
                            <given-names>D</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Role of Toll-like receptor mediated signaling in traumatic brain injury.</article-title>
                    <source>

                        <italic toggle="yes">Neuropharmacology.</italic>
</source>
                    <year>2019</year>;<volume>145</volume>:<fpage>259</fpage>&#x2013;<lpage>267</lpage>.
                    <pub-id pub-id-type="pmid">30075158</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.neuropharm.2018.07.022</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref29">
                <label>29</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Huang</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yang</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>WX</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Hyperin attenuates inflammation by activating PPAR-&#x03b3; in mice with acute liver injury (ALI) and LPS-induced RAW264.7 cells.</article-title>
                    <source>

                        <italic toggle="yes">Int. Immunopharmacol.</italic>
</source>
                    <year>2015</year>;<volume>29</volume>(<issue>2</issue>):<fpage>440</fpage>&#x2013;<lpage>447</lpage>.
                    <pub-id pub-id-type="doi">10.1016/j.intimp.2015.10.017</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref30">
                <label>30</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kwon</surname>
                            <given-names>J-H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kim</surname>
                            <given-names>S-B</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Park</surname>
                            <given-names>K-H</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Antioxidative and anti-inflammatory effects of phenolic compounds from the roots of Ulmus macrocarpa.</article-title>
                    <source>

                        <italic toggle="yes">Arch. Pharm. Res.</italic>
</source>
                    <year>2011</year>;<volume>34</volume>:<fpage>1459</fpage>&#x2013;<lpage>1466</lpage>.
                    <pub-id pub-id-type="pmid">21975807</pub-id>
                    <pub-id pub-id-type="doi">10.1007/s12272-011-0907-4</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref31">
                <label>31</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Yao</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zhao</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Song</surname>
                            <given-names>X</given-names>
                        </name>
</person-group>:
                    <article-title>Protective effects of fraxin on cerebral ischemia-reperfusion injury by mediating neuroinflammation and oxidative stress through PPAR-&#x03b3;/NF-&#x039a;B pathway.</article-title>
                    <source>

                        <italic toggle="yes">Brain Res. Bull.</italic>
</source>
                    <year>2022</year>;<volume>187</volume>:<fpage>49</fpage>&#x2013;<lpage>62</lpage>.
                    <pub-id pub-id-type="pmid">35772607</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.brainresbull.2022.06.010</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref32">
                <label>32</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ma</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Liu</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Feng</surname>
                            <given-names>J</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Fraxin alleviates LPS-induced ARDS by downregulating inflammatory responses and oxidative damages and reducing pulmonary vascular permeability.</article-title>
                    <source>

                        <italic toggle="yes">Inflammation.</italic>
</source>
                    <year>2019</year>;<volume>42</volume>:<fpage>1901</fpage>&#x2013;<lpage>1912</lpage>.
                    <pub-id pub-id-type="pmid">31273573</pub-id>
                    <pub-id pub-id-type="doi">10.1007/s10753-019-01052-8</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref33">
                <label>33</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>W</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>W</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zang</surname>
                            <given-names>L</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Fraxin ameliorates lipopolysaccharide-induced acute lung injury in mice by inhibiting the NF-&#x03ba;B and NLRP3 signalling pathways.</article-title>
                    <source>

                        <italic toggle="yes">Int. Immunopharmacol.</italic>
</source>
                    <year>2019</year>;<volume>67</volume>:<fpage>1</fpage>&#x2013;<lpage>12</lpage>.
                    <pub-id pub-id-type="doi">10.1016/j.intimp.2018.12.003</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref34">
                <label>34</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Tian</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Peng</surname>
                            <given-names>Z</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Luo</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Aesculin protects against DSS-Induced colitis though activating PPAR&#x03b3; and inhibiting NF-&#x043a;B pathway.</article-title>
                    <source>

                        <italic toggle="yes">Eur. J. Pharmacol.</italic>
</source>
                    <year>2019</year>;<volume>857</volume>:<fpage>172453</fpage>.
                    <pub-id pub-id-type="pmid">31202807</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.ejphar.2019.172453</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref35">
                <label>35</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Zhao</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Deng</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Quercetin as a protective agent for liver diseases: A comprehensive descriptive review of the molecular mechanism.</article-title>
                    <source>

                        <italic toggle="yes">Phytother. Res.</italic>
</source>
                    <year>2021</year>;<volume>35</volume>(<issue>9</issue>):<fpage>4727</fpage>&#x2013;<lpage>4747</lpage>.
                    <pub-id pub-id-type="pmid">34159683</pub-id>
                    <pub-id pub-id-type="doi">10.1002/ptr.7104</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref36">
                <label>36</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Chen</surname>
                            <given-names>J-C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ho</surname>
                            <given-names>F-M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Chao</surname>
                            <given-names>P-DL</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Inhibition of iNOS gene expression by quercetin is mediated by the inhibition of I&#x03ba;B kinase, nuclear factor-kappa B and STAT1, and depends on heme oxygenase-1 induction in mouse BV-2 microglia.</article-title>
                    <source>

                        <italic toggle="yes">Eur. J. Pharmacol.</italic>
</source>
                    <year>2005</year>;<volume>521</volume>(<issue>1-3</issue>):<fpage>9</fpage>&#x2013;<lpage>20</lpage>.
                    <pub-id pub-id-type="pmid">16171798</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.ejphar.2005.08.005</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref37">
                <label>37</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Lee</surname>
                            <given-names>S-M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Moon</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Cho</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Quercetin up-regulates expressions of peroxisome proliferator-activated receptor &#x03b3;, liver X receptor &#x03b1;, and ATP binding cassette transporter A1 genes and increases cholesterol efflux in human macrophage cell line.</article-title>
                    <source>

                        <italic toggle="yes">Nutr. Res.</italic>
</source>
                    <year>2013</year>;<volume>33</volume>(<issue>2</issue>):<fpage>136</fpage>&#x2013;<lpage>143</lpage>.
                    <pub-id pub-id-type="pmid">23399664</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.nutres.2012.11.010</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref38">
                <label>38</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Chuang</surname>
                            <given-names>C-H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yeh</surname>
                            <given-names>C-L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yeh</surname>
                            <given-names>S-L</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Quercetin metabolites inhibit MMP-2 expression in A549 lung cancer cells by PPAR-&#x03b3; associated mechanisms.</article-title>
                    <source>

                        <italic toggle="yes">J. Nutr. Biochem.</italic>
</source>
                    <year>2016</year>;<volume>33</volume>:<fpage>45</fpage>&#x2013;<lpage>53</lpage>.
                    <pub-id pub-id-type="pmid">27260467</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.jnutbio.2016.03.011</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref39">
                <label>39</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Beekmann</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rubi&#x00f3;</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Haan</surname>
                            <given-names>LHJ</given-names>
                            <prefix>de</prefix>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The effect of quercetin and kaempferol aglycones and glucuronides on peroxisome proliferator-activated receptor-gamma (PPAR-&#x03b3;).</article-title>
                    <source>

                        <italic toggle="yes">Food Funct.</italic>
</source>
                    <year>2015</year>;<volume>6</volume>(<issue>4</issue>):<fpage>1098</fpage>&#x2013;<lpage>1107</lpage>.
                    <pub-id pub-id-type="pmid">25765892</pub-id>
                    <pub-id pub-id-type="doi">10.1039/C5FO00076A</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref40">
                <label>40</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Lei</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Chai</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lin</surname>
                            <given-names>H</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Dihydroquercetin activates AMPK/Nrf2/HO-1 signaling in macrophages and attenuates inflammation in LPS-induced endotoxemic mice.</article-title>
                    <source>

                        <italic toggle="yes">Front. Pharmacol.</italic>
</source>
                    <year>2020</year>;<volume>11</volume>:<fpage>662</fpage>.
                    <pub-id pub-id-type="pmid">32508636</pub-id>
                    <pub-id pub-id-type="doi">10.3389/fphar.2020.00662</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7248193</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref41">
                <label>41</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ulrich-Merzenich</surname>
                            <given-names>G</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Panek</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zeitler</surname>
                            <given-names>H</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Drug development from natural products: exploiting synergistic effects.</article-title>
                    <year>2010</year>.</mixed-citation>
            </ref>
            <ref id="ref42">
                <label>42</label>
                <mixed-citation publication-type="data">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Shaker</surname>
                            <given-names>NS</given-names>
                        </name>
</person-group>:
                    <data-title>Anti-cytokine storm activity of fraxin and quercetin, alone and in combination, and their possible molecular mechanisms via TLR4 and PPAR&#x03b3; signaling pathways in LPS-induced RAW 264.7 cell line article data.</data-title>[Dataset].
                    <source>

                        <italic toggle="yes">Zenodo.</italic>
</source>
                    <year>2023</year>.
                    <pub-id pub-id-type="doi">10.5281/zenodo.7822393</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report414104">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.187473.r414104</article-id>
            <title-group>
                <article-title>Reviewer response for version 2</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Mahmood</surname>
                        <given-names>Ahmed</given-names>
                    </name>
                    <xref ref-type="aff" rid="r414104a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-7774-4919</uri>
                </contrib>
                <aff id="r414104a1">
                    <label>1</label>Al-Esraa University college, Baghdad, Iraq</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>14</day>
                <month>10</month>
                <year>2025</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2025 Mahmood A</copyright-statement>
                <copyright-year>2025</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport414104" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.133145.2"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>I am appreciating you to select me as reviewer for the manuscript titled &#x201c; Fraxin and Quercetin, separately and combined, reduced cytokine release in LPS-induced RAW 264.7 cell line through targeting TLR-4 and PPAR-&#x0263;&#x201d;.&#x00a0;The manuscript is generally well-written, and the experimental design is sound. However, the manuscript in its current form has several significant limitations that need to be addressed before it can be considered for indexing.</p>
            <p> </p>
            <p> </p>
            <p> 
                <bold>
                    <bold>Introduction:</bold>
                </bold>
            </p>
            <p> The introduction provides a solid foundation for the study, correctly identifying a relevant research gap (the need for anti-cytokine therapies) and introducing the key compounds (fraxin, quercetin) and mechanisms (TLR4/NF-kb vs PPAR-y) of interest. The rational for using a combination therapy approach is laos clearly stated. However, to meet the high standards of F1000Research and ensure immediate clarity for readers, the structure and logical flow need significant refinement.</p>
            <p> </p>
            <p> 
                <bold>
                    <bold>Methods</bold>
                </bold> 
                <list list-type="order">
                    <list-item>
                        <p>There is a repetition for the source of chemical and reagents in each section. No need to repeat the source that wrote in the &#x201c;chemical and reagent section&#x201d;.</p>
                    </list-item>
                    <list-item>
                        <p>The authors mention that both RAW 264.7, (TIB-71) murine macrophage cell line (ATCC&#x00ae;&#x00a0;TIB-71&#x2122;), and Dulbecco&#x2019;s modified Eagle&#x2019;s medium (DMEM)&#x00a0;were purchased&#x00a0;from American Type Culture Collection (ATCC, USA). But in the cell culture they mentioned that &#x00a0;Cells were maintained in Dulbecco&#x2019;s Modified Eagle Medium (DMEM) (Capricorn Scientific, Germany). I think the author should check that again.</p>
                    </list-item>
                </list> 
                <bold>
                    <bold>Study design and ethical consideration</bold>
                </bold>
            </p>
            <p> The authors mentioned in the figure (1) that cell serum supplement medium culture was incubated for 24 hours. While in the cell culture they time was different (the cell incubated for 2&#x2013;3 days). Please, clarify that in correct manner.</p>
            <p> 
                <bold>
                    <bold>In Cell viability assay (MTT assay)</bold>
                </bold>
            </p>
            <p> The abbreviation (FQ) which represent &#x201c; quercetin and fraxin combination &#x201c;already mentioned in the abstract. The use the abbreviation phrase writes only once.Please correct that.</p>
            <p> &#x00a0; 
                <list list-type="order">
                    <list-item>
                        <p>In cytokines release inhibitory assay I think it is better to write that the cell well was divided into groups each one treated with one of the following&#x2026;&#x2026;. etc. I know you mention that in the figure 1 but try to write that within this paragraph.</p>
                    </list-item>
                    <list-item>
                        <p>In cytokines release inhibitory assay, the author selected the following concentration: &#x00a0;fraxin (25 &#x03bc;g/mL), quercetin (12.5 &#x03bc;g/mL), or FQ (6.25 &#x03bc;g/mL), concentrations selected based on MTT assay results. But &#x00a0;the MTT assay results reveals that both Fraxin and quercetin &#x00a0;at concentration 6.25 &#x03bc;g/mL showed more than 70% cell viability. So, why the authors used &#x00a0;(25 &#x03bc;g/mL) for fraxin and quercetin (12.5 &#x03bc;g/mL) rather than 6.25?</p>
                    </list-item>
                    <list-item>
                        <p>Cytokines storm defines as &#x201c;
                            <bold>
                                <bold>A</bold>
                            </bold>
                            <bold>
                                <bold>&#x00a0;severe, uncontrolled systemic inflammatory response to infection or other stimuli that results in the release of large amounts of pro-inflammatory cytokines and the activation of a positive feedback loop, leading to more inflammation and tissue damage.</bold>
                            </bold>"&#x00a0;(Kumar, V., Abbas, A. K., &amp; Aster, J. C. (2020).&#x00a0;Robbins &amp; Cotran Pathologic Basis of Disease&#x00a0;(10th ed.). Elsevier. p. 194.)</p>
                    </list-item>
                </list> 
                <list list-type="order">
                    <list-item>
                        <p>The author use LPS as inducer for cytokines in &#x00a0;RAW 264.7 cells line. Dose this consider a model for cytokines storm? If yes, please add a reference or add a citation for a reference use this inducer to mimic cytokines storm in this type of cell line.</p>
                    </list-item>
                </list> 
                <bold>
                    <bold>Results:</bold>
                </bold>
            </p>
            <p> The results are promising and suggest a potent synergistic interaction between fraxina dn quercetin. The workflow from cytotoxicity assessment to cytokines measurement and gene expression analysis is logical. The major weaknesses lie in the presentation and interpretation of the data.</p>
            <p> 
                <bold>
                    <bold>I</bold>
                </bold>
                <bold>
                    <bold>n cell viability assay</bold>
                </bold> 
                <list list-type="order">
                    <list-item>
                        <p>The IC50 values are stated (248, 54 and 26.5) but the units (&#x00b5;g/ml) are critical and must be explicitly stated in the text. Furthermore, these values indicate that FQ is the most cytotoxic, which is crucial point that should be emphasized.</p>
                    </list-item>
                    <list-item>
                        <p>In addition to that, the logic for selecting the three sub-cytotoxic concentration (25, 12.5, 6.25 &#x00b5;g/ml) for subsequent experiments is sound but should be more clearly explained. It should be more clearly explained.</p>
                    </list-item>
                    <list-item>
                        <p>The IC&#x2085;&#x2080; values are stated (248, 54, and 26.5 &#x00b5;g/ml) but the units are critical and must be explicitly stated in the text. Furthermore, these values indicate that FQ is the most cytotoxic, which is a crucial point that should be emphasized. &#x201c; This phrasing is ambiguous. Do you mean that these three concentrations were used for all treatments, or that each compound was tested at its own specific concentration? The text must be unambiguous (e.g., &#x201c;Nno-cytotoxic concentration common to all treatments (25, 12.5 and 6.25 &#x00b5;g/ml) were selected for further experiments.&#x201d;)</p>
                    </list-item>
                </list> </p>
            <p> 
                <bold>
                    <bold>Calculation of the combination index</bold>
                </bold> 
                <list list-type="order">
                    <list-item>
                        <p>Presenting all CI values across the concentration range is good practice. However, the value for &#x201c;12,5 &#x00b5;ml seems to have a comma decimal separator; this must be corrected to a period (12.5) for consistency with international standards.</p>
                    </list-item>
                    <list-item>
                        <p>Also, it is essential to state whether the dose-effect and median-effect analyses performed by CompuSyn yielded statistically significant results (e.g., what was the linear correlation coefficient, r, for median-effect plot?). A table summarizing the CI values and r-value for the combination would be highly beneficial.</p>
                    </list-item>
                </list> </p>
            <p> 
                <bold>
                    <bold>The inhibitory activity of cytokines release</bold>
                </bold> 
                <list list-type="order">
                    <list-item>
                        <p>The results for cytokines inhibition are the core of the paper but are poorly presented in the text.</p>
                    </list-item>
                    <list-item>
                        <p>The comparison to the positive control (dexamethasone) is valuable. The statement that FQ &#x201c;is more effective&#x2026;..than each drug alone&#x201d; is a central conclusion but is not directly supported by the data presented in the text. The text provides % inhibition for dexamethasone and FQ but not for fraxin or quercetin alone at their respective concentrations. 
                            <bold>
                                <bold>This data must be included</bold>
                            </bold>&#x00a0;to justify the claim of superior efficacy for the combination.</p>
                    </list-item>
                    <list-item>
                        <p>The phrasing &#x201c;inactivating cytokines production&#x201d; is imprecise. &#x201c;Inhibiting cytokines production&#x201d; or &#x201c;suppressing cytokines release&#x201d; is more accurate.</p>
                    </list-item>
                    <list-item>
                        <p>Regarding statistical analysis, the use of &#x201c;p &lt; 0.01 vs. LPS group&#x201d; and &#x201c;p &lt; 0.05 vs. Control&#x201d; is standard. However, the description in Figure 3A, B, and C is repetitive and contains a critical error. The annotation &#x201c;** p &lt; 0.05 vs. Control&#x201d; should almost certainly be &#x201c; ** p &lt; 0.05 vs. LPS-treated control&#x201d; or &#x00a0;a similar, more relevant comparison (e.g., vs untreated control). The comparison to the untreated control is less informative than comparisons between the LPS-treated group and the compound-treated groups.</p>
                    </list-item>
                    <list-item>
                        <p>The text states that all treatments &#x201c;significantly suppressed&#x201d; cytokines production, but is does not specify if there were significant differences between the different treatments (e.g., FQ vs. Fraxin , FQ vs. Quercetin). A more robust statistical analysis comparing the treatment groups to each other is required to fully support the conclusion that the combination is superior.</p>
                    </list-item>
                    <list-item>
                        <p>The text states that all treatments "significantly suppressed" cytokines production, but it does not specify if there were significant differences&#x00a0;between&#x00a0;the different treatments (e.g., FQ vs. fraxin, FQ vs. quercetin). A more robust statistical analysis comparing the treatment groups to each other is required to fully support the conclusion that the combination is superior.</p>
                    </list-item>
                </list> 
                <bold>
                    <bold>Gene expression analysis</bold>
                </bold> 
                <list list-type="order">
                    <list-item>
                        <p>The statement that &#x201c;each graph has been represented as Mean&#x201d; is highly concerning. 
                            <bold>
                                <bold>Data must be presented as Mean &#x00b1; SEM</bold>
                            </bold>&#x00a0;(as was done for other figures) to show variability. Presenting only the mean without error bars is not acceptable for quantitative scientific data.</p>
                    </list-item>
                    <list-item>
                        <p>The sentence &#x201c;FQ increased up to 60-fold relative to the control, whereas fraxin and quercetin (17.6, 8.6 folds, respectively) decreased pro-inflammatory cytokines&#x201d; is grammatically flawed and confusing. It seems to mean: &#x201c; FQ treatment increased PPAR-y expression by 60-fold relative to the control. Fraxin and quercetin alone increased it by 17.6 and 8.6 fold, respectively. This upregulation of PPAR-y correlates with the observed decrease in pro-inflammatory cytokines.&#x201d; the text must be rewritten for clarity.</p>
                    </list-item>
                </list> 
                <bold>
                    <bold>Overall recommendations</bold>
                </bold> 
                <list list-type="order">
                    <list-item>
                        <p>Major revision for text and clarity: Re-write the entire results section for clarity, precision, and flow. Avoid ambiguous phrases and ensure every conclusion is directly supported by the data presented.</p>
                    </list-item>
                    <list-item>
                        <p>Major revision for figures: Ensure all figures (2, 3, 40) are correctly cited, have clear legends that define all symbols, error bars, and statistical comparisons, and that the data is presented with appropriate measures of variance (Mean &#x00b1; SEM).</p>
                    </list-item>
                    <list-item>
                        <p>Perform and report post-hoc testes to compare the efficacy between the different treatment groups (fraxin vs. Querecetin vs. FQ). For combination index, report the statistical pentameters (e.g., r-value)from the CompuSyn analysis.</p>
                    </list-item>
                </list> 
                <bold>
                    <bold>Discussion</bold>
                </bold> 
                <list list-type="order">
                    <list-item>
                        <p>The current discussion reads more like a literature review juxtaposed with results, rather than a critical synthesis. It begins with a very broad context (COVID-19 , cytokines storms) and then lists findings from other studies related to fraxin and quercetin. The connection between these cited studies and your own novel findings is often implicit rather than explicitly stated. The reader is left to infer the logical flow.</p>
                    </list-item>
                    <list-item>
                        <p>The sentence &#x201c;Fraxin + quercetin showed synergistic activity &#x2026;.. resulting in suppression of proinflammatory mediators IL-1, IL-6, TNF-&#x03b1;, and suppression of other pathways&#x2026;&#x201d; is long and repetitive. Break in into two sentences for better readability.</p>
                    </list-item>
                    <list-item>
                        <p>Maintain consistency in tense. Use the past tense for describing your results (e.g., &#x201c;we observed&#x201d;) and the present tense for established knowledge and conclusions (e.g., &#x201c;Our study shows that&#x2026;.&#x201d;).</p>
                    </list-item>
                </list> </p>
            <p> 
                <bold>
                    <bold>Decision:</bold>
                </bold>&#x00a0;Indexing after revision.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Partly</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Partly</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Partly</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Partly</p>
            <p>Reviewer Expertise:</p>
            <p>Pharmacology, Therapuetics, Toxicology, clinical toxicology and pharmacognosy.</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report365339">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.146120.r365339</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Jiang</surname>
                        <given-names>Fan</given-names>
                    </name>
                    <xref ref-type="aff" rid="r365339a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0001-9466-2192</uri>
                </contrib>
                <aff id="r365339a1">
                    <label>1</label>Qilu Hospital of Shandong University, Shandong, China</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>22</day>
                <month>2</month>
                <year>2025</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2025 Jiang F</copyright-statement>
                <copyright-year>2025</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport365339" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.133145.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>reject</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>1. In this study, the authors reported that fraxin, quercetin, and their combination inhibited cytokine release in LPS-stimulated RAW264.7 cells and increased the expression of PPAR-&#x03b3;. Overall, these data are too preliminary, without further mechanistic or translational investigations.&#x00a0;</p>
            <p> </p>
            <p> 2. It is not clear about how the concentrations of these compounds were selected. How these concentrations are relevant to in vivo treatment?</p>
            <p> </p>
            <p> 3. Only a murine cell line was used in the study. More validating results in primary cells will strengthen the study.</p>
            <p> </p>
            <p> 4. A causal relationship between PPAR-r and the reduced cytokine production is missing.</p>
            <p> </p>
            <p> 5. Methods: details of specific assay protocols are not necessary and the methodology should be described in a more succinct manner.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>No</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>I cannot comment. A qualified statistician is required.</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Partly</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Partly</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Please see my comments to authors.</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.</p>
        </body>
        <sub-article article-type="response" id="comment14466-365339">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname> S. Shaker</surname>
                            <given-names>Nada</given-names>
                        </name>
                        <aff>Department of Pharmacology, Al-Nahrain university, College of Medicine, Baghdad, Iraq</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>none mentioned</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>29</day>
                    <month>8</month>
                    <year>2025</year>
                </pub-date>
            </front-stub>
            <body>
                <p>Dear Reviewers, we would like to extend our gratitude for all your valuable insights regarding this humble work. We appreciate the time and effort you took to provide us with the necessary comments, ensuring this work is presented in the best possible form. Below, you will find detailed answers for each of the reviewer's comments:</p>
                <p> &#x00a0; 
                    <list list-type="bullet">
                        <list-item>
                            <p>In this study, the authors reported that fraxin, quercetin, and their combination inhibited cytokine release in LPS-stimulated RAW264.7 cells and increased the expression of PPAR-&#x03b3;. Overall, these data are too preliminary, without further mechanistic or translational investigations.</p>
                        </list-item>
                    </list> We appreciate all the raised remarks. This study is preliminary in nature and was designed to evaluate the potential cytotoxic and anti-inflammatory effects of the selected agents in LPS-stimulated murine macrophages, as a precursor to future in vivo studies modeling LPS-induced acute respiratory distress. The main limitation was the unavailability of additional cell lines at the culture facility, which restricted further exploration, along with constraints in resources and financial support.</p>
                <p> &#x00a0; 
                    <list list-type="bullet">
                        <list-item>
                            <p>It is not clear about how the concentrations of these compounds were selected. How these concentrations are relevant to in vivo treatment?</p>
                        </list-item>
                    </list> The concentrations selected to explore the anti-inflammatory activity and effect on gene expression were based on the outcome of the cytotoxicity evaluation, where the selected concentrations were half those that produced 50% inhibition of the viability for further analysis</p>
                <p> &#x00a0; 
                    <list list-type="bullet">
                        <list-item>
                            <p>Only a murine cell line was used in the study. More validating results in primary cells will strengthen the study.</p>
                        </list-item>
                    </list> We completely agree with this point, and it was explained in the first comment why this couldn&#x2019;t be done</p>
                <p> &#x00a0; 
                    <list list-type="bullet">
                        <list-item>
                            <p>A causal relationship between PPAR-r and the reduced cytokine production is missing.</p>
                        </list-item>
                    </list> It was noted, and a section explaining the relationship and role of PPAR-&#x0263; on cytokine release was included in the &#x201c;introduction&#x201d; section</p>
                <p> &#x00a0; 
                    <list list-type="bullet">
                        <list-item>
                            <p>Methods: details of specific assay protocols are not necessary and the methodology should be described in a more succinct manner.</p>
                        </list-item>
                    </list> All parts of the methodology were summarized as requested</p>
            </body>
        </sub-article>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report257418">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.146120.r257418</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Ghazy</surname>
                        <given-names>Dr. Amany</given-names>
                    </name>
                    <xref ref-type="aff" rid="r257418a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-5603-1303</uri>
                </contrib>
                <aff id="r257418a1">
                    <label>1</label>Jouf University, College of Medicine, Sakaka, Saudi Arabia</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>29</day>
                <month>6</month>
                <year>2024</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2024 Ghazy DA</copyright-statement>
                <copyright-year>2024</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
                <license>
                    <license-p>The author(s) is/are employees of the US Government and therefore domestic copyright protection in USA does not apply to this work. The work may be protected under the copyright laws of other jurisdictions when used in those jurisdictions.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport257418" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.133145.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>Dear Authors</p>
            <p> The current manuscript presents a good point for further research and is presented well. However, I have a few comments:</p>
            <p> - Authors link the cytokine storm to COVID-19 only but it can be generalized particularly, it is not a big problem now.</p>
            <p> -The study design is unclear, it can be presented by diagram to show groups of the study and the chronological order of analysis.</p>
            <p> Some parts of the methods include cell viability, gene expression, and cytokine levels without cited references.</p>
            <p> -What do you mean by anti-cytokine storm assay (misleading), it could be Determination of anti-cytokine storm markers not Anti-cytokine storm assay</p>
            <p> -&#x00c3;&#131;&#x00c2;&#130;&#x00c3;&#130;&#x00c2;&#x00a0;The methodology is too long and needs to be shortened.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>I cannot comment. A qualified statistician is required.</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>No source data required</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>No</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Micobiology and Immunology</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
        <sub-article article-type="response" id="comment14465-257418">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname> S. Shaker</surname>
                            <given-names>Nada</given-names>
                        </name>
                        <aff>Department of Pharmacology, Al-Nahrain university, College of Medicine, Baghdad, Iraq</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>none mentioned</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>29</day>
                    <month>8</month>
                    <year>2025</year>
                </pub-date>
            </front-stub>
            <body>
                <p>Dear Reviewers, we would like to extend our gratitude for all your valuable insights regarding this humble work. We appreciate the time and effort you took to provide us with the necessary comments, ensuring this work is presented in the best possible form. Below, you will find detailed answers for each of the reviewer's comments:</p>
                <p> </p>
                <p> The current manuscript presents a good point for further research and is presented well. However, I have a few comments: 
                    <list list-type="bullet">
                        <list-item>
                            <p>Authors link the cytokine storm to COVID-19 only but it can be generalized particularly, it is not a big problem now.</p>
                        </list-item>
                    </list> Thank you very much for the valuable note. Nowadays, COVID-19 has indeed become more controlled than when it was first identified, yet it remains one of the causes, especially when discussing viral infections, that leads to acute respiratory distress with excessive cytokine release&#x00a0;</p>
                <p> &#x00a0; 
                    <list list-type="bullet">
                        <list-item>
                            <p>The study design is unclear, it can be presented by diagram to show groups of the study and the chronological order of analysis.</p>
                        </list-item>
                    </list> We appreciate this note. A flow diagram is now included in the revised version of the manuscript</p>
                <p> &#x00a0; 
                    <list list-type="bullet">
                        <list-item>
                            <p>Some parts of the methods include cell viability, gene expression, and cytokine levels without cited references.</p>
                        </list-item>
                    </list> It was noted, and references were added where necessary</p>
                <p> &#x00a0; 
                    <list list-type="bullet">
                        <list-item>
                            <p>What do you mean by anti-cytokine storm assay (misleading), it could be Determination of anti-cytokine storm markers not Anti-cytokine storm assay</p>
                        </list-item>
                    </list> Thank you for highlighting this matter. To remove this unsettling term, the &#x201c;anti-cytokine storm&#x201d; was changed to &#x201c;the cytokine release inhibitory activity&#x201d;</p>
                <p> &#x00a0; 
                    <list list-type="bullet">
                        <list-item>
                            <p>The methodology is too long and needs to be shortened.</p>
                        </list-item>
                    </list> All parts of the methodology were summarized as requested</p>
            </body>
        </sub-article>
    </sub-article>
</article>
