<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.126044.2</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>Cloning and characterization of the 
                    <italic>LvCTL</italic> genes encoding C-type lectin from white-leg shrimp (
                    <italic>Litopenaeus vannamei</italic>)</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 2; peer review: 1 approved]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Phuong</surname>
                        <given-names>Tran Vinh</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Software</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-7616-2482</uri>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Nguyen</surname>
                        <given-names>Xuan Huy</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Quang Lich</surname>
                        <given-names>Nguyen</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Hoang</surname>
                        <given-names>Quang Tan</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Tran</surname>
                        <given-names>Ngoc Nguyen</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Software</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <xref ref-type="aff" rid="a3">3</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Nguyen</surname>
                        <given-names>Phuoc Ngoc</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Software</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <uri content-type="orcid">https://orcid.org/0000-0003-1928-7462</uri>
                    <xref ref-type="aff" rid="a3">3</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Linh</surname>
                        <given-names>Nguyen Quang</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Software</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-8424-1148</uri>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a4">4</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Hue University, Hue, 49000, Vietnam</aff>
                <aff id="a2">
                    <label>2</label>Institute of Biotechnology, Hue University, Hue, 49000, Vietnam</aff>
                <aff id="a3">
                    <label>3</label>Faculty of Fisheries, Hue University of Agriculture and Forestry, Hue, Thua Thien Hue, 49000, Vietnam</aff>
                <aff id="a4">
                    <label>4</label>Faculty of Animal Sciences and Veterinary Medicine, Hue University of Agriculture and Forestry, HUE, 49000, Vietnam</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:nguyenquanglinh@hueuni.edu.vn">nguyenquanglinh@hueuni.edu.vn</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>8</day>
                <month>9</month>
                <year>2023</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2023</year>
            </pub-date>
            <volume>12</volume>
            <elocation-id>260</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>17</day>
                    <month>4</month>
                    <year>2023</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2023 Phuong TV et al.</copyright-statement>
                <copyright-year>2023</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/12-260/pdf"/>
            <abstract>
                <p>
                    <bold>Background:</bold> Lectins are carbohydrate-binding protein domains. The C-type designates a requirement for calcium for binding. Proteins contain C-type lectin domains that have a diverse range of functions, including cell-cell adhesion, immune response to pathogens, and apoptosis. This study aimed to investigate the characters of LvCTL-encoding genes from white-leg shrimp (
                    <italic toggle="yes">Litopenaeus vannamei</italic>) in Central Vietnam.</p>
                <p>
                    <bold>Methods:</bold> Two PCR products (LvCTL3 and LvCTL4) were cloned and sequenced. The structure and characterization of LvCTL proteins were predicted using bioinformatics tools.</p>
                <p>
                    <bold>Results:</bold> The results showed that the 
                    <italic toggle="yes">LvCTL3</italic> gene was 444 nucleotides long and 98.87% similar to the published 
                    <italic toggle="yes">LvCTL3</italic> gene (accession number: KF156943). The polypeptide sequence had 147 amino acids, which were 97.28% identical to the reference sequence (AGV68681) and the 
                    <italic toggle="yes">LvCTL4</italic> gene had a length of 417 nucleotides and homology of 99.52% compared to the published gene (KM387560). The deduced polypeptide sequence had 138 amino acids, and was 100% similar to the reference sequence (AKA64754). The 
                    <italic toggle="yes">LvCTL3</italic> had a molecular weight of 16.91 kDa and an isoelectric point (pI) of 4.66, while 
                    <italic toggle="yes">LvCTL4</italic> had 15.75 and 4.58 kDa, respectively. The structure prediction results showed that 
                    <italic toggle="yes">LvCTL3</italic> and 
                    <italic toggle="yes">LvCTL4</italic> had one domain (CTLD), 
                    <italic toggle="yes">LvCTL3 </italic>had two &#x03b1; helices and nine &#x03b2; sheets, and 
                    <italic toggle="yes">LvCTL4</italic> had two &#x03b1; helices and eight &#x03b2; sheets.</p>
                <p>
                    <bold>Conclusions:</bold> Our results provide essential information for the heterologous expression and biosynthesis production of C-type lectins.</p>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>C-type lectin</kwd>
                <kwd>gene encoding</kwd>
                <kwd>LvCTL genes</kwd>
                <kwd>white leg shrimp.</kwd>
            </kwd-group>
            <funding-group>
                <award-group id="fund-1">
                    <funding-source>National Foundation for Science and Technology Development</funding-source>
                    <award-id>NVQG-2019/DA.18</award-id>
                </award-group>
                <award-group id="fund-2">
                    <funding-source>Vietnam program of National Gene Fund</funding-source>
                    <award-id>NVQG-2019/DA.18</award-id>
                </award-group>
                <funding-statement>This paper was funded by the Domestic Ph.D. scholarship program of Vingroup Innovation Foundation (VINIF), Vingroup Institute of big data (VINBIGDATA) [VINIF.2022.TS.097].&#13;
This study was partly supported by the Hue University Strong Research Group (NCM.DHH.2022.05) and by the Vietnam Ministry of Science and Technology (project code: DTDLCN.56/22). </funding-statement>
                <funding-statement>
                    <italic>The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.</italic>
                </funding-statement>
            </funding-group>
        </article-meta>
        <notes>
            <sec sec-type="version-changes">
                <label>Revised</label>
                <title>Amendments from Version 1</title>
                <p>1. We added Fig. 4. The amino acid similarity of the isolated 
                    <italic>LvCTL3 </italic>gene and the published 
                    <italic>LvCTL3</italic> gene (AGV68681) and Fig. 5. The similarity of the amino acid of the isolated 
                    <italic>LvCTL4</italic> gene and the published 
                    <italic>LvCTL4</italic> gene (AKA64754) and discussed in the text.&#x00a0; 2. https://www.ncbi.nlm.nih.gov/nuccore/OP584994.1/ and 3. https://www.ncbi.nlm.nih.gov/nuccore/OP584995.1/ 4. Writing mistake: This project contains the following underlying data: - 2. 
                    <italic>CTL3</italic>-pcr (Original).jpg (Western Blot gel image) - 3. 
                    <italic>CTL4</italic>-pcr (Original).jpg (Western Blot gel image) 5.&#x00a0;Grant Information [Tran Vinh Phuong] was funded by the Master, PhD Scholarship Programme of Vingroup Innovation Foundation (VINIF), [VINIF.2022.TS097]. This study was partly supported by the Hue University Strong Research Group (NCM.DHH.2022.05) and by the Vietnam Ministry of Science and Technology (project code: DTDLCN.56/22)</p>
            </sec>
        </notes>
    </front>
    <body>
        <sec id="sec1" sec-type="intro">
            <title>Introduction</title>
            <p>C-type lectins (CTLs) are proteins/glycoproteins capable of reversibly binding to carbohydrates by non-covalent bonds without altering their structure (
                <xref ref-type="bibr" rid="ref17">Zhang 
                    <italic toggle="yes">et al.,</italic> 2009</xref>). Lectins can bind to cells with glycoproteins or microbial surface glycolipids and are considered pattern recognition receptors (PRR) recognizing and releasing invading microorganisms in the system. The shrimp lectin protein family is very rich and diverse; members of the eight PRR families have been identified in several shrimp species, based on structure and specificity to different sugars of the carbohydrate recognition domain (CRD). These families are lipopolysaccharide and b-1,3-glucan binding proteins (LGBPs), CTLs, galectin, thioester-containing proteins (TEP), fibrinogen-related proteins (FREP), scavenger receptors (SR), down syndrome cell adhesion molecules (DSCAM) and Toll-like receptors (TLR) (
                <xref ref-type="bibr" rid="ref14">Wang and Wang, 2013</xref>). According to form and function, lectins are classified as Calnexin, C-, L-, P-, I-, R-, and S-type lens (
                <xref ref-type="bibr" rid="ref3">Janeway and Medzhitov, 2002</xref>; 
                <xref ref-type="bibr" rid="ref17">Zhang 
                    <italic toggle="yes">et al.,</italic> 2009</xref>). Among the lectins, CTL is the most diverse and well-studied (
                <xref ref-type="bibr" rid="ref17">Zhang 
                    <italic toggle="yes">et al.,</italic> 2009</xref>).</p>
            <p>CTLs are a group of proteins that play an essential role in many animal biological processes, including cell signaling and pathogen recognition. CTLs are a superfamily of more than 1,000 proteins identified by having one or more well-characterized C-type lectin-like domains (CTLDs). They are divided into 17 subgroups based on their species and domain organization (
                <xref ref-type="bibr" rid="ref15">Weis 
                    <italic toggle="yes">et al.,</italic> 1998</xref>; 
                <xref ref-type="bibr" rid="ref16">Zelensky and Gready, 2005</xref>). CTL also plays an essential role in mammalian innate immunity. The mannose-binding lectin (MBL) is primarily expressed in the liver and released into the plasma, where it recognizes potentially pathogenic bacteria and binds to microbial surfaces. Animals can also activate the complement pathway (
                <xref ref-type="bibr" rid="ref13">Thiel and Gadjeva, 2009</xref>). Similarly, CTLs are also important immune recognition receptors in invertebrates. CTLs in shrimp can currently be divided into three subgroups based on domain composition and organization: those containing only one C-type lectin domain (CTLD), those having two CTLDs, and those containing one CTLD and another part (
                <xref ref-type="bibr" rid="ref14">Wang and Wang, 2013</xref>). Among them, the group containing only one CTLD was more common than the few CTLs in shrimp containing two CTLDs. The presence of two or more binding sites for each lectin molecule allows it to bind to many different cell types. The prevalence of CTLD in invertebrates is much higher than in vertebrates. Typically, CTLD is the seventh most common domain in the 
                <italic toggle="yes">Caenorhabditis elegans</italic> genome, but only the 43
                <sup>rd</sup> most common domain in the human genome (
                <xref ref-type="bibr" rid="ref16">Zelensky and Gready, 2005</xref>). Shrimp CTLD can bind multiple ligands and constructs inducible expression of CTLs. Recent studies have revealed multiple functions and mechanisms of shrimp CTLs in antimicrobial and antiviral immunity. These protective functions of CTLs in the shrimp species 
                <italic toggle="yes">Fenneropenaeus chinensis</italic> are based on their ability to recognize and bind CTLDs (
                <xref ref-type="bibr" rid="ref11">Sun 
                    <italic toggle="yes">et al.,</italic> 2008</xref>). In the framework of this study, we present the results of cloning and characterization of the 
                <italic toggle="yes">LvCTL</italic> genes isolated from white-leg shrimp (
                <italic toggle="yes">Litopenaeus vannamei</italic>) in Thua Thien Hue as a prerequisite for the production of recombinant LvCTL proteins for further research.</p>
        </sec>
        <sec id="sec2" sec-type="methods">
            <title>Methods</title>
            <sec id="sec3">
                <title>Ethical approval</title>
                <p>Animal use in this study was allowed by Hue University of Animal Ethics Committee with certificate reference number: HUVN0018, April 10
                    <sup>th</sup>, 2022. Principal Researcher: Nguyen Quang Linh. All efforts were undertaken to minimize the suffering of animals.</p>
            </sec>
            <sec id="sec4">
                <title>Animals</title>
                <p>White-leg shrimp (
                    <italic toggle="yes">L. vannamei</italic>) with a weight of ~20 g per head, which were collected from shrimp ponds; the samples were aseptically dissected to collect the hepatopancreas shrimp samples and stored in liquid nitrogen, and used directly for RNA extraction.</p>
            </sec>
            <sec id="sec5">
                <title>Isolation and cloning of 
                    <italic toggle="yes">LvCTL</italic> gene</title>
                <p>Total RNA from hepatopancreas samples was extracted using the Gene JET RNA Purification Kit (Thermo Scientific, USA) according to the manufacturer's instructions. Electrophoresis was conducted to check the total RNA obtained on 1% agarose gel with TAE 1X at 70V for 30 min by using Power Pac 3000 (Bio-Rad). The cDNA biosynthesis was performed using Revert Aid First Strand cDNA Synthesis kit (Thermo Fisher Scientific, USA), and the obtained product was used directly for PCR amplification.</p>
                <p>The sequences of 
                    <italic toggle="yes">LvCTL</italic> encoding genes were obtained from GenBank to design a specific primer (
                    <xref ref-type="table" rid="T1">Table 1</xref>). PCR was performed using the following conditions: 95&#x00b0;C for 2 min, and then 40 cycles of 95&#x00b0;C for 1 min, 55&#x00b0;C for 30 s, and 72&#x00b0;C for 1 min, followed by a final extension at 72&#x00b0;C for 7 min. PCR products were confirmed by electrophoresis at 70V for 35 min on 1% agarose gel with TAE 1X stained SafeViewTM Classic (abm, Canada).</p>
                <table-wrap id="T1" orientation="portrait" position="float">
                    <label>Table 1. </label>
                    <caption>
                        <title>Specific primers for 
                            <italic toggle="yes">LvCTL</italic> genes cloning.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Genes</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Primers</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Sequences (5&#x2019;-3&#x2019;)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Product sizes</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">References</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="2" valign="middle">
                                    <italic toggle="yes">LvCTLD</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="2" valign="middle">LvCTLD-F/ LvCTLD-R</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">GACTGCACGGGCGACGAG</td>
                                <td align="left" colspan="1" rowspan="2" valign="middle">888</td>
                                <td align="left" colspan="1" rowspan="2" valign="middle">(
                                    <xref ref-type="bibr" rid="ref4">Junkunlo 
                                        <italic toggle="yes">et al.</italic>, 2012</xref>)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">TTAGACAGCGGTGACGCAGAG</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="2" valign="middle">
                                    <italic toggle="yes">LvCTL3</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="2" valign="middle">LvCTL3-F/ LvCTL3-R</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">CTCTCCAATCCCATCTCAATC</td>
                                <td align="left" colspan="1" rowspan="2" valign="middle">444</td>
                                <td align="left" colspan="1" rowspan="2" valign="middle">(
                                    <xref ref-type="bibr" rid="ref8">Li 
                                        <italic toggle="yes">et al.</italic>, 2014</xref>)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">CTATTTCTCACAGATAATG</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="2" valign="middle">
                                    <italic toggle="yes">LvCTL4</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="2" valign="middle">LvCTL4-F/ LvCTL4-R</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">TGTTCTGATGGCTGGCTGG</td>
                                <td align="left" colspan="1" rowspan="2" valign="middle">417</td>
                                <td align="left" colspan="1" rowspan="2" valign="middle">(
                                    <xref ref-type="bibr" rid="ref7">Li 
                                        <italic toggle="yes">et al.</italic>, 2015</xref>)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">TTAAACCATACAAATGGGATG</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="2" valign="middle">
                                    <italic toggle="yes">LvAV</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="2" valign="middle">LvAV-F/ LvAV-R</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">ACCTTATACGAGAAAAGTG</td>
                                <td align="left" colspan="1" rowspan="2" valign="middle">474</td>
                                <td align="left" colspan="1" rowspan="2" valign="middle">(
                                    <xref ref-type="bibr" rid="ref2">He 
                                        <italic toggle="yes">et al.</italic>, 2015</xref>)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">TCAAAACTTGTCAGCAGATG</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="2" valign="middle">
                                    <italic toggle="yes">LvLdlrCTL</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="2" valign="middle">LvLdlrCTL-F/ LvLdlrCTL-R</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">GAGTGTACCAACAGGGAC</td>
                                <td align="left" colspan="1" rowspan="2" valign="middle">855</td>
                                <td align="left" colspan="1" rowspan="2" valign="middle">(
                                    <xref ref-type="bibr" rid="ref10">Liang 
                                        <italic toggle="yes">et al.</italic>, 2019</xref>)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">TCACGCCCTCTCACTGGG</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <table-wrap id="T2" orientation="portrait" position="float">
                    <label>Table 2. </label>
                    <caption>
                        <title>Characteristic of the gene encoding LvCTLs.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="2" valign="top">Characteristics</th>
                                <th align="left" colspan="2" rowspan="1" valign="top">LvCTL3</th>
                                <th align="left" colspan="2" rowspan="1" valign="top">LvCTL4</th>
                            </tr>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">
                                    <xref ref-type="bibr" rid="ref8">Li 
                                        <italic toggle="yes">et al.</italic> (2014)</xref>
                                </th>
                                <th align="left" colspan="1" rowspan="1" valign="top">This study</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
                                    <xref ref-type="bibr" rid="ref7">Li 
                                        <italic toggle="yes">et al.</italic> (2015)</xref>
                                </th>
                                <th align="left" colspan="1" rowspan="1" valign="top">This study</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">Gene full lenghts (bp)</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">579</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">-</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">563</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">-</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">Coding segment</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">492</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">444</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">471</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">417</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">Polypeptide chain (amino acid)</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">163</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">147</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">156</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">138</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">Molecular weight (kDa)</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">17.9</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">16.91</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">-</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">15.75</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">Isoelectric point (pI)</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">4.80</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">4.66</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">-</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">4.58</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">Domain</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">-</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">&#x03b1; helix</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">-</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">2</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">-</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">2</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">&#x03b2; strain</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">-</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">9</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">-</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">8</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <p>PCR products were recovered from agarose gels and purified using the GeneJET Gel Extraction kit (Thermo Scientific, USA). Purified PCR products were cloned into pGEM T-easy vector with T4 DNA Ligase for 1 hour at room temperature (Promega, USA), then, the recombinant vectors were transferred into 
                    <italic toggle="yes">Escherichia coli</italic> TOP10 bacteria using the heat shock method. The recombinant vectors were selected on LB medium (Luria Bertani Agar, Merck, Germany) supplemented with 50 &#x03bc;g/mL Amp, X-Gal/IPTG. 
                    <italic toggle="yes">E. coli</italic> cells carrying the recombinant vector (white colonies) were then inoculated with 5 mL of liquid LB medium supplemented with 50 &#x03bc;g/mL Amp, and DNA plasmids were isolated using the GeneJET Plasmid Miniprep Kit (Thermo Fisher Scientific, USA). The isolated DNA plasmid was examined by 1.0% agarose gel electrophoresis at 70V for 35 min and used for 
                    <italic toggle="yes">LvCTL</italic> sequencing (
                    <xref ref-type="bibr" rid="ref1">Ha 
                        <italic toggle="yes">et al.,</italic> 2018</xref>). The sequence of the 
                    <italic toggle="yes">LvCTL</italic> genes was analyzed using the Sanger method (First base Company, Malaysia). The results were checked using BioEdit software and then compared with those published in GenBank using the 
                    <ext-link ext-link-type="uri" xlink:href="https://blast.ncbi.nlm.nih.gov/">BLAST tool</ext-link>. A phylogenetic tree of CTL encoding genes was built using MEGA 11 software with the Neighbor-Joining algorithm (
                    <xref ref-type="bibr" rid="ref12">Tamura 
                        <italic toggle="yes">et al.,</italic> 2021</xref>).</p>
            </sec>
            <sec id="sec6">
                <title>Characterization and molecular structure of the CTL encoding genes</title>
                <p>Characterization of LvCTL proteins was determined using bioinformatics tools, including amino acid sequence translation with 
                    <ext-link ext-link-type="uri" xlink:href="https://web.expasy.org/translate/">Expasy</ext-link>, protein domain using 
                    <ext-link ext-link-type="uri" xlink:href="http://smart.embl-heidelberg.de/">SMART</ext-link> (
                    <xref ref-type="bibr" rid="ref6">Letunic 
                        <italic toggle="yes">et al.,</italic> 2021</xref>), spatial structure model using 
                    <ext-link ext-link-type="uri" xlink:href="http://www.sbg.bio.ic.ac.uk/phyre2">Phyre2</ext-link> (
                    <xref ref-type="bibr" rid="ref5">Kelley 
                        <italic toggle="yes">et al.,</italic> 2015</xref>), isoelectric point using 
                    <ext-link ext-link-type="uri" xlink:href="http://www.ipc2-isoelectric-point.org/">IPC2</ext-link> (
                    <xref ref-type="bibr" rid="ref8">Li 
                        <italic toggle="yes">et al.,</italic> 2014</xref>).</p>
            </sec>
        </sec>
        <sec id="sec7" sec-type="results">
            <title>Results</title>
            <sec id="sec8">
                <title>Isolating and cloning of the 
                    <italic toggle="yes">LvCTL</italic> genes</title>
                <p>After PCR with specific primers, the&#x00a0;results showed that two DNA fragments were amplified and expressed approximately at 450 and 420 bp in size, respectively. According to the theoretical length of the cDNA fragment of the 
                    <italic toggle="yes">LvCTL3</italic> and 
                    <italic toggle="yes">LvCTL4</italic> genes. PCR reaction using specific primers with pGEM vector as template was performed, electrophoresis images showed very specific PCR products (
                    <xref ref-type="fig" rid="f1">Figure 1</xref>), which proved that 
                    <italic toggle="yes">LvCTL</italic> genes was successfully attached to pGEM vector T-easy (referred to as the recombinant vector pGEM/LvCTL3 and pGEM/LvCTL4). Therefore, the recombinant vectors were used to analyze the nucleotide sequences. The previous reports indicate several CTLs in some shrimp species, such as: 
                    <italic toggle="yes">Litopenaeus vannamei</italic>, 
                    <italic toggle="yes">L. schmitti</italic>, 
                    <italic toggle="yes">L. setiferus</italic>, 
                    <italic toggle="yes">Fenneropenaeus chinensis</italic>, 
                    <italic toggle="yes">F. merguiensis</italic>, 
                    <italic toggle="yes">Penaeus monodon</italic>, 
                    <italic toggle="yes">Marsupenaeus japonicus</italic> and 
                    <italic toggle="yes">Macrobrachium rosenbergii</italic> (
                    <xref ref-type="bibr" rid="ref14">Wang and Wang, 2013</xref>). We constructed a phylogenetic tree from the deduced LvCTL polypeptide sequences compared with the CTL fragment sequences of other shrimp species. The results show that 
                    <italic toggle="yes">LvCTL3</italic> and 
                    <italic toggle="yes">LvCTL4</italic> belong to two groups in the dendrogram and our arrangements were similar to the published lines of white-leg shrimp (
                    <italic toggle="yes">L. vannamei</italic>) but different from other shrimp species (
                    <xref ref-type="fig" rid="f6">Figure 6</xref>).</p>
                <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                    <label>Figure 1. </label>
                    <caption>
                        <title>PCR product 
                            <italic toggle="yes">LvCTL</italic> genes on agarose gel.</title>
                        <p>M: DNA ladder (GeneRuler
                            <sup>TM</sup> 1 kb DNA Ladder, Thermo Scientific, USA). NC: Negative control. 1-5: PCR product with cDNA of 
                            <italic toggle="yes">LvCTL3-LvCTL4</italic>-
                            <italic toggle="yes">LvAV-LvCTLD-LvLdlrCTL</italic> genes. 6-7: PCR product of 
                            <italic toggle="yes">LvCTL3</italic> gene from 2 different colonies. 8-9: PCR product of 
                            <italic toggle="yes">LvCTL4</italic> gene from 2 different colonies.</p>
                    </caption>
                    <graphic id="gr1" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/147015/bb28cd51-d911-49dd-8184-9b35b2275439_figure1.gif"/>
                </fig>
            </sec>
            <sec id="sec9">
                <title>Characteristic determination and molecular structure of the gene encoding CTLs</title>
                <p>In our study, the nucleotide sequence of 
                    <italic toggle="yes">LvCTL3</italic> PCR product was 444 bp in length, encoding a polypeptide sequence of 147 amino acids. The nucleotide sequence of 
                    <italic toggle="yes">LvCTL3</italic> PCR product was 417 bp in length, encoding a polypeptide sequence of 138 amino acids. These were fragment of genes containing the open reading frame (ORF) region cut off the peptide signal, intended to be used to produce recombinant 
                    <italic toggle="yes">LvCTL</italic> protein for other studies related to recombinant protein production. For the conserved domain determined using the SMART program, the ORF sequence of 
                    <italic toggle="yes">LvCTL3</italic> had one domain (CTLD) from amino acid position 14 to 146.
                    <italic toggle="yes"> LvCTL3 </italic>had a molecular weight of 16.91 kDa, and the isoelectric point (pI) was 4.66. The results of spatial structure prediction showed that the 
                    <italic toggle="yes">LvCTL3</italic> molecule had two alpha helices (16%) and nine beta strands (28%) (
                    <xref ref-type="fig" rid="f7">Figure 7</xref>). Meanwhile, the ORF sequence of 
                    <italic toggle="yes">LvCTL4</italic> had one domain (amino acid 1 to 137), a molecular weight of 15.75 kDa and a pI is 4.58. LvCTL4 structure had two alpha helices (17%) and eight beta strands (32%) (
                    <xref ref-type="fig" rid="f8">Figure 8</xref>).</p>
            </sec>
        </sec>
        <sec id="sec10" sec-type="discussion">
            <title>Discussion</title>
            <p>The results of sequence analysis showed a change in the isolated 
                <italic toggle="yes">LvCTL</italic> genes compared with the published genes. The isolated 
                <italic toggle="yes">LvCTL3</italic> fragment was 444 bp in size (including the stop codon), 98.87% homologous to the published gene (439/444 nucleotides compared with KF156943) (
                <xref ref-type="fig" rid="f2">Figure 2</xref>). The change of the 
                <italic toggle="yes">LvCTL3</italic> gene resulted in a difference in the sequence of the encoded polypeptide, the highest similarity obtained was 97.28% (143/147 amino acids) compared with the reference sequence AGV68681. Meanwhile, the 
                <italic toggle="yes">LvCTL4</italic> fragment was 417 bp, 99.52% homologous to the gene of KM387560 (415/417 nucleotides) (
                <xref ref-type="fig" rid="f3">Figure 3</xref>). However, the change of the 
                <italic toggle="yes">LvCTL4</italic> gene resulted in no change in the sequence of the encoded polypeptide (100% similarity) compared with the reference sequence (AKA64754).</p>
            <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                <label>Figure 2. </label>
                <caption>
                    <title>The similarity of the nucleotide sequences of the isolated 
                        <italic toggle="yes">LvCTL3</italic> gene and the published 
                        <italic toggle="yes">LvCTL3</italic> gene (KF156943).</title>
                </caption>
                <graphic id="gr2" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/147015/bb28cd51-d911-49dd-8184-9b35b2275439_figure2.gif"/>
            </fig>
            <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                <label>Figure 3. </label>
                <caption>
                    <title>The similarity of the nucleotide sequences of the isolated 
                        <italic toggle="yes">LvCTL4</italic> gene and the published 
                        <italic toggle="yes">LvCTL4</italic> gene (KM387560).</title>
                </caption>
                <graphic id="gr3" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/147015/bb28cd51-d911-49dd-8184-9b35b2275439_figure3.gif"/>
            </fig>
            <fig fig-type="figure" id="f4" orientation="portrait" position="float">
                <label>Figure 4. </label>
                <caption>
                    <title>The similarity of the amino acid of the isolated 
                        <italic toggle="yes">LvCTL3</italic> gene and the published 
                        <italic toggle="yes">LvCTL3</italic> gene (AGV68681).</title>
                </caption>
                <graphic id="gr4" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/147015/bb28cd51-d911-49dd-8184-9b35b2275439_figure4.gif"/>
            </fig>
            <fig fig-type="figure" id="f5" orientation="portrait" position="float">
                <label>Figure 5. </label>
                <caption>
                    <title>The similarity of the amino acid of the isolated 
                        <italic toggle="yes">LvCTL4</italic> gene and the published 
                        <italic toggle="yes">LvCTL4</italic> gene (AKA64754).</title>
                </caption>
                <graphic id="gr5" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/147015/bb28cd51-d911-49dd-8184-9b35b2275439_figure5.gif"/>
            </fig>
            <fig fig-type="figure" id="f6" orientation="portrait" position="float">
                <label>Figure 6. </label>
                <caption>
                    <title>Taxonomy tree LvCTL compared to other published CTLs.</title>
                </caption>
                <graphic id="gr6" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/147015/bb28cd51-d911-49dd-8184-9b35b2275439_figure6.gif"/>
            </fig>
            <fig fig-type="figure" id="f7" orientation="portrait" position="float">
                <label>Figure 7. </label>
                <caption>
                    <title>The predicted of LvCTL3 structure.</title>
                </caption>
                <graphic id="gr7" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/147015/bb28cd51-d911-49dd-8184-9b35b2275439_figure7.gif"/>
            </fig>
            <fig fig-type="figure" id="f8" orientation="portrait" position="float">
                <label>Figure 8. </label>
                <caption>
                    <title>The predicted of LvCTL4 structure.</title>
                </caption>
                <graphic id="gr8" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/147015/bb28cd51-d911-49dd-8184-9b35b2275439_figure8.gif"/>
            </fig>
            <p>According to 
                <xref ref-type="bibr" rid="ref8">Li 
                    <italic toggle="yes">et al.</italic> (2014)</xref>, the 
                <italic toggle="yes">LvCTL3</italic> gene from shrimp (
                <italic toggle="yes">L. vannamei</italic>) has a length of 579 bp, in which the coding segment is 492 bp (from nucleotide positions 25 to 516), encoding a polypeptide chain with a length of 163 amino acids, and has an estimated molecular weight of 17.9 kDa, an estimated pI of 4.80 (
                <xref ref-type="bibr" rid="ref8">Li 
                    <italic toggle="yes">et al.,</italic> 2014</xref>). The 
                <italic toggle="yes">LvCTL4</italic> gene, also from 
                <italic toggle="yes">L. vannamei</italic> shrimp, has a length of 563 bp, in which the coding segment is 471 bp (from nucleotide positions 27 to 497). The ORF encoded a protein of 156 amino acids consisting of a single CTLD (residues 19-155) and a putative signal peptide (residues 1-18). Tissue expression analysis showed LvCTL4 was distributed with high levels in the gills, intestine, epithelium and hepatopancreas (
                <xref ref-type="bibr" rid="ref7">Li 
                    <italic toggle="yes">et al.,</italic> 2015</xref>). Meanwhile, LvTRAF3 was also cloned and characterized from the shrimp 
                <italic toggle="yes">L.vannamei</italic>; it had a transcript of 3,865 bp, with an ORF of 1,002 bp, and encoded a polypeptide of 333 amino acids, with a calculated molecular weight of 38.6 kDa (
                <xref ref-type="bibr" rid="ref9">Li 
                    <italic toggle="yes">et al.,</italic> 2020</xref>).TRAF3 functions as a regulator of innate immune response that involves many cellular processes.</p>
            <p>When comparing to the 
                <italic toggle="yes">L. vannamei</italic> genes, the predicted 
                <italic toggle="yes">LvCTL3</italic> sequence resulted in 97.28% similarity to the sequence of AGV68681 or 96.60% to XP_027212325, while 
                <italic toggle="yes">LvCTL4</italic> was 100% similar to the sequence of AKA64754 and XP_027228060. 
                <italic toggle="yes">LvCTL3</italic> and 
                <italic toggle="yes">LvCTL4</italic> were 60.69% (XP_042883674) and 80.43% (QEX50549) homologous to kuruma prawn (
                <italic toggle="yes">Penaeus japonicus</italic>), respectively. Compared with black tiger shrimp (
                <italic toggle="yes">Penaeus monodon</italic>), 
                <italic toggle="yes">LvCTL3</italic> was 59.18% similar to the protein encoded by XP_037787306 while 
                <italic toggle="yes">LvCTL4</italic> was 88.21% similar to that of XP_037800826. Compared with other crustacean species, the difference in LvCTL sequences was higher. The similarity of the LvCTL3 sequence was only 45.58% identical to the AYD41573 sequence from red swamp crayfish (
                <italic toggle="yes">Procambarus clarkii</italic>) or 40.25 % to the XP_042233235 sequence from the American lobster (
                <italic toggle="yes">Homarus americanus</italic>). 
                <italic toggle="yes">LvCTL4</italic> was only 59.12% similar to the XP_045611199 sequence from red swamp crayfish, 60.14% to XP_042237721 from the American lobster, or 57.258% to the XP_045118055 sequence from gazami crab (
                <italic toggle="yes">Portunus trituberculatus</italic>).</p>
            <p>The amino acid sequence alignments of two proteins (
                <xref ref-type="fig" rid="f4">Figure 4</xref> &amp; 
                <xref ref-type="fig" rid="f5">Figure 5</xref>) that may cause protein secondary structure shifts (
                <xref ref-type="bibr" rid="ref7">Li 
                    <italic toggle="yes">et al.</italic>, 2015</xref>). The form of a protein is related to its function. Knowledge of protein&#x2019;s 3D structure is a huge hint for understanding how protein&#x2019;s work. Although other refinement tools such as homology-modeling tools based on high sequence similiritues provide higher quality structure. However, our 3D structures have been modelled with 99.9% and 99.8% confidence by the single highest scoring template with the 3D structure of LvCTL3 and LvCTL4, respectively. This showed that the function of these proteins is not changed. Protein folding is determined by the physicochemical properties that are encoded in the amino acids. Although most of the predictions were highly accurate, the system that we used is not perfect. Programs such as Alpha Fold will exponentially increase our general understanding of different biological processes. So the 3D structure of these proteins should be further study by another program to provide higher-quality structures. And the simulation of these proteins at pH of shrimp stomach (5.7) should be considered for further experiments.</p>
        </sec>
        <sec id="sec11" sec-type="conclusions">
            <title>Conclusions</title>
            <p>In this study, two 
                <italic toggle="yes">LvCTL3</italic> and 
                <italic toggle="yes">LvCTL4</italic> genes from white-leg shrimp were successfully isolated, cloned, and sequenced. The ORF of 
                <italic toggle="yes">LvCTL</italic> sequences had homology levels of 98.87% (
                <italic toggle="yes">LvCTL3</italic>, KF156943) and 99.52% (
                <italic toggle="yes">LvCTL4</italic>, KM387560 respectively) compared to the published gene. The predicted LvCTL proteins have one conserved domain and are defined as C-type lectins. They can be used for heterologous expression and scale-up production of recombinant C-type lectin in the future to add to the aquatic feed to enhance immunity and prevent disease in shrimp.</p>
        </sec>
    </body>
    <back>
        <sec id="sec14" sec-type="data-availability">
            <title>Data availability</title>
            <sec id="sec15">
                <title>Underlying data</title>
                <p>Genbank: C-type lectin [Penaeus vannamei]; Accession number: OP584994, 
                    <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/nuccore/OP584994.1/">https://www.ncbi.nlm.nih.gov/nuccore/OP584994.1/</ext-link>.</p>
                <p>Genbank: C-type lectin 4 [Penaeus vannamei]; Accession number: OP584995, 
                    <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/nuccore/OP584995.1/">https://www.ncbi.nlm.nih.gov/nuccore/OP584995.1/</ext-link>.</p>
                <p>Figshare: F1000Research Figures, 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.21428799.v1">https://doi.org/10.6084/m9.figshare.21428799.v1</ext-link> (
                    <xref ref-type="bibr" rid="ref19">Linh 
                        <italic toggle="yes">et al</italic>., 2022</xref>).</p>
                <p>This project contains the following underlying data:
                    <list list-type="bullet">
                        <list-item>
                            <label>-</label>
                            <p>1. 
                                <italic toggle="yes">LvCTL3-LvCTL4-LvAV-LvCTLD-LvLdlrCTL </italic>(PCR 5 gene).jpg (Western Blot gel image)</p>
                        </list-item>
                        <list-item>
                            <label>-</label>
                            <p>2. 
                                <italic toggle="yes">CTL3</italic>-pcr (Original).jpg (Western Blot gel image)</p>
                        </list-item>
                        <list-item>
                            <label>-</label>
                            <p>3. 
                                <italic toggle="yes">CTL4</italic>-pcr (Original).jpg (Western Blot gel image)</p>
                        </list-item>
                        <list-item>
                            <label>-</label>
                            <p>4. bw 
                                <italic toggle="yes">LvCTL3-LvCTL4</italic>-
                                <italic toggle="yes">LvAV-LvCTLD-LvLdlrCTL</italic> (Edited).jpg (Western Blot gel image)</p>
                        </list-item>
                        <list-item>
                            <label>-</label>
                            <p>5. 
                                <italic toggle="yes">LvCTL3</italic> PCR colony (Edited).jpg (Western Blot gel image)</p>
                        </list-item>
                        <list-item>
                            <label>-</label>
                            <p>6. CTL4 bw - colony (Editted).jpg (Western Blot gel image)</p>
                        </list-item>
                        <list-item>
                            <label>-</label>
                            <p>7. The predicted of LvCTL3 structure.png (Predicted 3D structure of LvCTL3)</p>
                        </list-item>
                        <list-item>
                            <label>-</label>
                            <p>8. The predicted of LvCTL4 structure.png (Predicted 3D structure of LvCTL4)</p>
                        </list-item>
                    </list>
                </p>
            </sec>
            <sec id="sec16">
                <title>Extended data</title>
                <p>

                    <bold>Protocols.io:</bold> Lectin C gene analysis, 
                    <ext-link ext-link-type="uri" xlink:href="https://dx.doi.org/10.17504/protocols.io.x54v9dyk1g3e/v1">https://dx.doi.org/10.17504/protocols.io.x54v9dyk1g3e/v1</ext-link> (
                    <xref ref-type="bibr" rid="ref18">Phuong 
                        <italic toggle="yes">et al.</italic>, 2022</xref>).</p>
                <p>Data are available under the terms of the 
                    <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution 4.0 International license</ext-link> (CC-BY 4.0).</p>
            </sec>
        </sec>
        <ack>
            <title>Acknowledgements</title>
            <p>Contact authors, (Nguyen Quang Linh) supported all of steps of this research and final revisions version and comments from editors, GenBank registration. A/Prof. Dr. Nguyen Ngoc Phuoc, is the PhD supervisor for Mr. Phuong in this research and participated in the revised final version. PhD student &#x2013; Mr. Tran Vinh Phuong, who supervised all steps in data collection and analysis and GenBank registration. Other authors: Nguyen Xuan Huy, Hoang Tan Quang, Tran Nguyen Ngoc monitored the data and laboratory analysis. Our research group works together in each publication.</p>
        </ack>
        <ref-list>
            <title>References</title>
            <ref id="ref1">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ha</surname>
                            <given-names>DTT</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tuan</surname>
                            <given-names>LK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lan</surname>
                            <given-names>PTN</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Cloning and sequencing laccase 3 (folac3) from 
                        <italic toggle="yes">Fusarium oxysporum</italic>.</article-title>
                    <source>

                        <italic toggle="yes">Hue University Journal of Science: Natural Science.</italic>
</source>
                    <year>2018</year>;<volume>127</volume>(<issue>1C</issue>):<fpage>1</fpage>&#x2013;<lpage>10</lpage>.
                    <pub-id pub-id-type="doi">10.26459/hueuni-jns.v127i1C.4892</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref2">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>He</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Molecular characterization of 
                        <italic toggle="yes">LvAV</italic> in response to white spot syndrome virus infection in the Pacific white shrimp (
                        <italic toggle="yes">Litopenaeus vannamei</italic>).</article-title>
                    <source>

                        <italic toggle="yes">Dev. Comp. Immunol.</italic>
</source>
                    <year>2015</year>;<volume>51</volume>(<issue>1</issue>):<fpage>48</fpage>&#x2013;<lpage>55</lpage>.
                    <pub-id pub-id-type="pmid">25735872</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.dci.2015.02.020</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref3">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Janeway</surname>
                            <given-names>CA</given-names>
                            <suffix>Jr</suffix>
                        </name>

                        <name name-style="western">
                            <surname>Medzhitov</surname>
                            <given-names>R</given-names>
                        </name>
</person-group>:
                    <article-title>Innate immune recognition.</article-title>
                    <source>

                        <italic toggle="yes">Annu. Rev. Immunol.</italic>
</source>
                    <year>2002</year>;<volume>20</volume>:<fpage>197</fpage>&#x2013;<lpage>216</lpage>.
                    <pub-id pub-id-type="doi">10.1146/annurev.immunol.20.083001.084359</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref4">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Junkunlo</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Prachumwat</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tangprasittipap</surname>
                            <given-names>A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>A novel lectin domain-containing protein (LvCTLD) associated with the response of the whiteleg shrimp 
                        <italic toggle="yes">Penaeus (Litopenaeus) vannamei</italic> to the yellow head virus (YHV).</article-title>
                    <source>

                        <italic toggle="yes">Dev. Comp. Immunol.</italic>
</source>
                    <year>2012</year>;<volume>37</volume>(<issue>3-4</issue>):<fpage>334</fpage>&#x2013;<lpage>341</lpage>.
                    <pub-id pub-id-type="pmid">22214841</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.dci.2011.12.010</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref5">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kelley</surname>
                            <given-names>LA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mezulis</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yates</surname>
                            <given-names>CM</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The Phyre2 web portal for protein modeling, prediction and analysis.</article-title>
                    <source>

                        <italic toggle="yes">Nat. Protoc.</italic>
</source>
                    <year>2015</year>;<volume>10</volume>(<issue>6</issue>):<fpage>845</fpage>&#x2013;<lpage>858</lpage>.
                    <pub-id pub-id-type="pmid">25950237</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nprot.2015.053</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref6">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Letunic</surname>
                            <given-names>I</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Khedkar</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bork</surname>
                            <given-names>P</given-names>
                        </name>
</person-group>:
                    <article-title>SMART: recent updates, new developments and status in 2020.</article-title>
                    <source>

                        <italic toggle="yes">Nucleic Acids Res.</italic>
</source>
                    <year>2021</year>;<volume>49</volume>(<issue>D1</issue>):<fpage>D458</fpage>&#x2013;<lpage>D460</lpage>.
                    <pub-id pub-id-type="pmid">33104802</pub-id>
                    <pub-id pub-id-type="doi">10.1093/nar/gkaa937</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref7">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>H</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>A C-type lectin (LvCTL4) from 
                        <italic toggle="yes">Litopenaeus vannamei</italic> is a downstream molecule of the NF-&#x03ba;B signaling pathway and participates in antibacterial immune response.</article-title>
                    <source>

                        <italic toggle="yes">Fish Shellfish Immunol.</italic>
</source>
                    <year>2015</year>;<volume>43</volume>(<issue>1</issue>):<fpage>257</fpage>&#x2013;<lpage>263</lpage>.
                    <pub-id pub-id-type="pmid">25559446</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.fsi.2014.12.024</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref8">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Identification of a C-type lectin with antiviral and antibacterial activity from pacific white shrimp 
                        <italic toggle="yes">Litopenaeus vannamei.</italic>
                    </article-title>
                    <source>

                        <italic toggle="yes">Dev. Comp. Immunol.</italic>
</source>
                    <year>2014</year>;<volume>46</volume>:<fpage>231</fpage>&#x2013;<lpage>240</lpage>.
                    <pub-id pub-id-type="pmid">24792214</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.dci.2014.04.014</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref9">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Fu</surname>
                            <given-names>Q</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>TNF-Receptor-Associated Factor 3 in 
                        <italic toggle="yes">Litopenaeus vannamei</italic> Restricts White Spot Syndrome Virus Infection Through the IRF-Vago Antiviral Pathway.</article-title>
                    <source>

                        <italic toggle="yes">Front. Immunol.</italic>
</source>
                    <year>2020</year>;<volume>11</volume>(<issue>2110</issue>):<fpage>1</fpage>&#x2013;<lpage>15</lpage>.
                    <pub-id pub-id-type="pmid">33042123</pub-id>
                    <pub-id pub-id-type="doi">10.3389/fimmu.2020.02110</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref10">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Liang</surname>
                            <given-names>Z</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yang</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zheng</surname>
                            <given-names>J</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>A low-density lipoprotein receptor (LDLR) class A domain-containing C-type lectin from 
                        <italic toggle="yes">Litopenaeus vannamei</italic> plays opposite roles in antibacterial and antiviral responses.</article-title>
                    <source>

                        <italic toggle="yes">Dev. Comp. Immunol.</italic>
</source>
                    <year>2019</year>;<volume>92</volume>:<fpage>29</fpage>&#x2013;<lpage>34</lpage>.
                    <pub-id pub-id-type="pmid">30408492</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.dci.2018.11.002</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref19">
                <mixed-citation publication-type="data">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Linh</surname>
                            <given-names>NQ</given-names>
                        </name>
</person-group>:
                    <data-title>F1000Research Figures. figshare.</data-title>Figure.<year>2022</year>.
                    <pub-id pub-id-type="doi">10.6084/m9.figshare.21428799.v1</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref18">
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Phuong</surname>
                            <given-names>TV</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Phuoc</surname>
                            <given-names>NN</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Linh</surname>
                            <given-names>NQQ</given-names>
                        </name>
</person-group>:
                    <article-title>Lectin C gene analysis. protocols.io.</article-title>
                    <year>2022</year>.
                    <pub-id pub-id-type="doi">10.17504/protocols.io.x54v9dyk1g3e/v1</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref11">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sun</surname>
                            <given-names>YD</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>A hepatopancreas-specific C-type lectin from the Chinese shrimp 
                        <italic toggle="yes">Fenneropenaeus chinensis</italic> exhibits antimicrobial activity.</article-title>
                    <source>

                        <italic toggle="yes">Mol. Immunol.</italic>
</source>
                    <year>2008</year>;<volume>45</volume>(<issue>2</issue>):<fpage>348</fpage>&#x2013;<lpage>361</lpage>.
                    <pub-id pub-id-type="pmid">17675157</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.molimm.2007.06.355</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref12">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Tamura</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Stecher</surname>
                            <given-names>G</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kumar</surname>
                            <given-names>S</given-names>
                        </name>
</person-group>:
                    <article-title>MEGA11: Molecular Evolutionary Genetics Analysis version 11.</article-title>
                    <source>

                        <italic toggle="yes">Mol. Biol. Evol.</italic>
</source>
                    <year>2021</year>;<volume>38</volume>:<fpage>3022</fpage>&#x2013;<lpage>3027</lpage>.
                    <pub-id pub-id-type="pmid">33892491</pub-id>
                    <pub-id pub-id-type="doi">10.1093/molbev/msab120</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref13">
                <mixed-citation publication-type="book">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Thiel</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Gadjeva</surname>
                            <given-names>M</given-names>
                        </name>
</person-group>:
                    <chapter-title>Humoral Pattern Recognition Molecules: Mannan-Binding Lectin and Ficolins.</chapter-title>
                    <person-group person-group-type="editor">

                        <name name-style="western">
                            <surname>Kishore</surname>
                            <given-names>U</given-names>
                        </name>
</person-group>, editor.
                    <source>

                        <italic toggle="yes">Target Pattern Recognition in Innate Immunity.</italic>
                    </source>
                    <publisher-loc>New York, New York, NY</publisher-loc>:
                    <publisher-name>Springer</publisher-name>;<year>2009</year>; pp.<fpage>58</fpage>&#x2013;<lpage>73</lpage>.
                    <pub-id pub-id-type="doi">10.1007/978-1-4419-0901-5_5</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref14">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>XW</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>JX</given-names>
                        </name>
</person-group>:
                    <article-title>Pattern recognition receptors acting in the innate immune system of shrimp against pathogen infections.</article-title>
                    <source>

                        <italic toggle="yes">Fish Shellfish Immunol.</italic>
</source>
                    <year>2013</year>;<volume>34</volume>(<issue>4</issue>):<fpage>981</fpage>&#x2013;<lpage>989</lpage>.
                    <pub-id pub-id-type="pmid">22960101</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.fsi.2012.08.008</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref15">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Weis</surname>
                            <given-names>WI</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Taylor</surname>
                            <given-names>ME</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Drickamer</surname>
                            <given-names>K</given-names>
                        </name>
</person-group>:
                    <article-title>The C-type lectin superfamily in the immune system.</article-title>
                    <source>

                        <italic toggle="yes">Immunol. Rev.</italic>
</source>
                    <year>1998</year>;<volume>163</volume>:<fpage>19</fpage>&#x2013;<lpage>34</lpage>.
                    <pub-id pub-id-type="doi">10.1111/j.1600-065x.1998.tb01185.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref16">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Zelensky</surname>
                            <given-names>AN</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Gready</surname>
                            <given-names>JE</given-names>
                        </name>
</person-group>:
                    <article-title>The C-type lectin-like domain superfamily.</article-title>
                    <source>

                        <italic toggle="yes">FEBS J.</italic>
</source>
                    <year>2005</year>;<volume>272</volume>:<fpage>6179</fpage>&#x2013;<lpage>6217</lpage>.
                    <pub-id pub-id-type="pmid">16336259</pub-id>
                    <pub-id pub-id-type="doi">10.1111/j.1742-4658.2005.05031.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref17">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Zhang</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Cloning and characterization of a novel C-type lectin gene from shrimp 
                        <italic toggle="yes">Litopenaeus vannamei.</italic>
                    </article-title>
                    <source>

                        <italic toggle="yes">Fish Shellfish Immunol.</italic>
</source>
                    <year>2009</year>;<volume>26</volume>(<issue>1</issue>):<fpage>183</fpage>&#x2013;<lpage>192</lpage>.
                    <pub-id pub-id-type="pmid">19059792</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.fsi.2008.03.008</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report205043">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.147015.r205043</article-id>
            <title-group>
                <article-title>Reviewer response for version 2</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Tran-Van</surname>
                        <given-names>Hieu</given-names>
                    </name>
                    <xref ref-type="aff" rid="r205043a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0003-2782-5232</uri>
                </contrib>
                <aff id="r205043a1">
                    <label>1</label>Laboratory of Biosensors, Faculty of Biology and Biotechnology, University of Science, Ho Chi Minh, Vietnam</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>29</day>
                <month>9</month>
                <year>2023</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2023 Tran-Van H</copyright-statement>
                <copyright-year>2023</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport205043" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.126044.2"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>The&#x00a0;authors have satisfactorily responded&#x00a0;to&#x00a0;all my questions&#x00a0;and made the necessary changes to the&#x00a0;manuscript.&#x00a0;Therefore, the manuscript can be accepted for indexing in its current form.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Not applicable</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Biotechnology, molecular modelling, immunology</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
        <sub-article article-type="response" id="comment12009-205043">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>NGUYEN</surname>
                            <given-names>Linh Q.</given-names>
                        </name>
                        <aff>Nutritional Disease and System, Hue University, HUE, Thua Thien Hue, Vietnam</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>Thanks,</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>14</day>
                    <month>7</month>
                    <year>2024</year>
                </pub-date>
            </front-stub>
            <body>
                <p>Dear Editor and Reviewer 1, 2,&#x00a0;</p>
                <p> Thank you for your approval of our article. We agreed with all your comments and assistance, so version 3 would be nice for publication in the last version.</p>
                <p> Thank you so much; see you soon in the next manuscript.</p>
                <p> Nguyen Quang Linh</p>
            </body>
        </sub-article>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report166106">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.138419.r166106</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Tran-Van</surname>
                        <given-names>Hieu</given-names>
                    </name>
                    <xref ref-type="aff" rid="r166106a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0003-2782-5232</uri>
                </contrib>
                <aff id="r166106a1">
                    <label>1</label>Laboratory of Biosensors, Faculty of Biology and Biotechnology, University of Science, Ho Chi Minh, Vietnam</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>28</day>
                <month>3</month>
                <year>2023</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2023 Tran-Van H</copyright-statement>
                <copyright-year>2023</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport166106" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.126044.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>The authors cloned and&#x00a0;characterized two&#x00a0;
                <italic>LvCTL</italic>&#x00a0;genes encoding C-type lectin from white-leg shrimp (
                <italic>Litopenaeus vannamei</italic>).&#x00a0;</p>
            <p> </p>
            <p> There are points authors should improve before consideration for indexing. 
                <list list-type="order">
                    <list-item>
                        <p>Authors should consider using recent protein structure prediction tools such as AlphaFold or homology-modeling tools based on high sequence similarities such as SWISS-MODEL or MODELLER. Other refinement tools should be applied for higher-quality structures.</p>
                    </list-item>
                    <list-item>
                        <p>Should model reference proteins of Li et al. publication to give readers a better visualization of amino acid differences that may cause protein secondary structure shifts.</p>
                    </list-item>
                    <list-item>
                        <p>The authors didn&#x2019;t discuss any information about protein structural characteristics. According to a previous study, shrimp stomach pH is approximately 5.7, so maybe authors should consider simulation the protein at that pH for further experiments.</p>
                    </list-item>
                    <list-item>
                        <p>Does the deletion in the DNA sequence of LvCTL3 and LvCTL4 in your study might affect its functions?</p>
                    </list-item>
                    <list-item>
                        <p>According to your discussion, what is the purpose of building a 3D model of these two proteins?</p>
                    </list-item>
                    <list-item>
                        <p>Authors should include amino acid sequence alignments of two proteins to highlight the differences.</p>
                    </list-item>
                </list>
            </p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Not applicable</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Biotechnology, molecular modelling, immunology</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
        <sub-article article-type="response" id="comment9558-166106">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>NGUYEN</surname>
                            <given-names>Linh Q.</given-names>
                        </name>
                        <aff>Nutritional Disease and System, Hue University, HUE, Thua Thien Hue, Vietnam</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>10</day>
                    <month>4</month>
                    <year>2023</year>
                </pub-date>
            </front-stub>
            <body>
                <p>1</p>
                <p> Authors should consider using recent protein structure prediction tools such as AlphaFold or homology-modelling tools based on high sequence similarities such as SWISS-MODEL or MODELLER. Other refinement tools should be applied for higher-quality structures.</p>
                <p> The amino acid sequence alignments of two proteins (Figure 4 &amp; Figure 5) may cause protein secondary structure shifts (Li 
                    <italic>et al.</italic>, 2015). The form of a protein is related to its function. Knowledge of a protein&#x2019;s 3D structure is a huge hint for understanding how proteins work. Although other refinement tools, such as homology-modelling tools based on high sequence similarities, provide higher-quality structure. However, our 3D structures have been modelled with 99.9% and 99.8% confidence by the single highest-scoring template with the 3D structure of LvCTL3 and LvCTL4, respectively. This showed that the function of these proteins is not changed. Protein folding is determined by the physicochemical properties that are encoded in the amino acids. Although most of the predictions were highly accurate, our system is imperfect. Programs such as Alpha Fold will exponentially increase our general understanding of different biological processes. So the 3D structure of these proteins should be further studied by another program to provide higher-quality structures. And the simulation of these proteins at the pH of the shrimp stomach (5.7) should be considered for further experiments.</p>
                <p> </p>
                <p> We added 
                    <bold>Fig. 4</bold>. The amino acid similarity of the isolated 
                    <italic>LvCTL3 </italic>gene and the published 
                    <italic>LvCTL3</italic> gene (AGV68681) and 
                    <bold>Fig. 5</bold>. The similarity of the amino acid of the isolated 
                    <italic>LvCTL4</italic> gene and the published 
                    <italic>LvCTL4</italic> gene (AKA64754) and discussed in the text (purple colour)</p>
                <p> </p>
                <p> 2</p>
                <p> Should model reference proteins of Li et al. publication to give readers a better visualization of amino acid differences that may cause protein secondary structure shifts.</p>
                <p> </p>
                <p> 3</p>
                <p> The authors didn&#x2019;t discuss any information about protein structural characteristics. According to a previous study, shrimp stomach pH is approximately 5.7, so maybe authors should consider simulation the protein at that pH for further experiments</p>
                <p> </p>
                <p> 4</p>
                <p> Does the deletion in the DNA sequence of LvCTL3 and LvCTL4 in your study might affect its functions?</p>
                <p> </p>
                <p> 5</p>
                <p> According to your discussion, what is the purpose of building a 3D model of these two proteins?</p>
                <p> </p>
                <p> 6</p>
                <p> Authors should include amino acid sequence alignments of two proteins to highlight the differences.</p>
                <p> </p>
                <p> 7</p>
                <p> 
                    <bold>Another revision</bold> 
                    <list list-type="order">
                        <list-item>
                            <p>Added 3rd affiliation of the first author: Tran Vinh Phuong
                                <sup>1</sup>
                                <sup>, </sup>
                                <sup>3</sup>
                            </p>
                        </list-item>
                        <list-item>
                            <p>Updated another affiliation (Ex: Faculty of Fisheries, University of Agriculture and Forestry, Hue University, Thua Thien Hue, 49000, Vietnam)</p>
                        </list-item>
                        <list-item>
                            <p>Underlying data</p>
                        </list-item>
                    </list> Updated 2 new links, Genbank, to replace old ones.</p>
                <p> 
                    <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/nuccore/OP584994.1/">https://www.ncbi.nlm.nih.gov/nuccore/OP584994.1/</ext-link> and</p>
                <p> 
                    <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/nuccore/OP584995.1/">https://www.ncbi.nlm.nih.gov/nuccore/OP584995.1/</ext-link> 
                    <list list-type="order">
                        <list-item>
                            <p>Writing mistake:</p>
                        </list-item>
                    </list> This project contains the following underlying data:</p>
                <p> 
                    <bold>-</bold> 2. 
                    <italic>CTL3</italic>-pcr (Original).jpg (Western Blot gel image)</p>
                <p> 
                    <bold>-</bold> 3. 
                    <italic>CTL4</italic>-pcr (Original).jpg (Western Blot gel image) 
                    <list list-type="order">
                        <list-item>
                            <p>Grant Information</p>
                        </list-item>
                    </list> [Tran Vinh Phuong] was funded by the Master, PhD Scholarship Programme of Vingroup Innovation Foundation (VINIF), [VINIF.2022.TS097]. This study was partly supported by the Hue University Strong Research Group (NCM.DHH.2022.05) and by the Vietnam Ministry of Science and Technology (project code: DTDLCN.56/22)</p>
                <p> Red colour</p>
            </body>
        </sub-article>
        <sub-article article-type="response" id="comment10227-166106">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Tran</surname>
                            <given-names>Vinh Phuong</given-names>
                        </name>
                        <aff/>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>13</day>
                    <month>9</month>
                    <year>2023</year>
                </pub-date>
            </front-stub>
            <body>
                <p>Dear Reviewer;&#x00a0;</p>
                <p> We would like to thank the reviewer for your comments on our manuscript. We have carefully considered your suggestions in revising our manuscript, and we believe that the revised manuscript is improved and suitable for publication. Detailed responses to the comments are presented in this document</p>
                <p> 1.&#x00a0;Authors should consider using recent protein structure prediction tools such as Alpha Fold or homology-modeling tools based on high sequence similarities such as SWISS-MODEL or MODELLER. Other refinement tools should be applied for higher-quality structures</p>
                <p> 
                    <bold>Responses</bold>:&#x00a0;</p>
                <p> Although other refinement tools such as homology-modeling tools based on high sequence similarities provide higher quality structure. However, our 3D structures have been modelled with 99.9% and 99.8% confidence by the single highest scoring template with the 3D structure of LvCTL3 and LvCTL4, respectively. Programs such as Alpha Fold will exponentially increase our general understanding of different biological processes. So the 3D structure of these proteins should be further study by another program to provide higher-quality structures</p>
                <p> 2. Should model reference proteins of Li et al. publication to give readers a better visualization of amino acid differences that may cause protein secondary structure shifts.</p>
                <p> 
                    <bold>Responses</bold>:&#x00a0;</p>
                <p> Thanks for your value comment. We used the&#x00a0;model reference proteins of Li et al. 2015 to give readers a better visualization of amino acid differences that may cause protein secondary structure shifts in the revised version</p>
                <p> 3. The authors didn&#x2019;t discuss any information about protein structural characteristics. According to a previous study, shrimp stomach pH is approximately 5.7, so maybe authors should consider simulation the protein at that pH for further experiments</p>
                <p> 
                    <bold>Reponses</bold>
                </p>
                <p> We agreed and added this sentence "the simulation of these proteins at pH of shrimp stomach (5.7) should be considered for further experiments" in the discussion of the new version.</p>
                <p> 4.&#x00a0;Does the deletion in the DNA sequence of LvCTL3 and LvCTL4 in your study might affect its functions?</p>
                <p> 
                    <bold>Responses</bold>
                </p>
                <p> The form of a protein is related to its function. Knowledge of protein&#x2019;s 3D structure is a huge hint for understanding how protein&#x2019;s work. Although other refinement tools such as homology-modeling tools based on high sequence similarities provide higher quality structure. However, our 3D structures have been modelled with 99.9% and 99.8% confidence by the single highest scoring template with the 3D structure of LvCTL3 and LvCTL4, respectively. This showed that the function of these proteins is not changed. Protein folding is determined by the physicochemical properties that are encoded in the amino acids</p>
                <p> 5.&#x00a0;According to your discussion, what is the purpose of building a 3D model of these two proteins?</p>
                <p> 
                    <bold>Responses</bold>
                </p>
                <p> The purpose of building a 3D model of these two protein was explained in the discussion of the new version as read bellowed:</p>
                <p> The amino acid sequence alignments of two proteins (Figure 4 &amp; Figure 5) that may cause protein secondary structure shifts (
                    <ext-link ext-link-type="uri" xlink:href="">Li 
                        <italic>et al.</italic>, 2015</ext-link>). The form of a protein is related to its function. Knowledge of protein&#x2019;s 3D structure is a huge hint for understanding how protein&#x2019;s work.</p>
                <p> 6. Authors should include its amino acid sequence alignment of two proteins to highlight the differences.</p>
                <p> 
                    <bold>Responses</bold>
                </p>
                <p> We added 
                    <bold>Figure 4</bold>. The similarity of the amino acid of the isolated 
                    <italic>LvCTL3 </italic>gene and the published 
                    <italic>LvCTL3</italic> gene (AGV68681) and 
                    <bold>Figure 5</bold>. The similarity of the amino acid of the isolated 
                    <italic>LvCTL4</italic> gene and the published 
                    <italic>LvCTL4</italic> gene (AKA64754) and discussed in the text.</p>
                <p> </p>
                <p> Thank you very much for your consideration of this manuscript.</p>
                <p> Yours sincerely,</p>
            </body>
        </sub-article>
    </sub-article>
</article>
