<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="brief-report" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.122004.1</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Brief Report</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>Validating skin swabbing as a refined technique to collect DNA from small-bodied fish species</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 1; peer review: 1 approved, 1 approved with reservations]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Tilley</surname>
                        <given-names>Ceinwen</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-2800-405X</uri>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Sneddon</surname>
                        <given-names>Lynne</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Software</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0001-9787-3948</uri>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Mallon</surname>
                        <given-names>Eamonn</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a3">3</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Barber</surname>
                        <given-names>Iain</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0003-3955-6674</uri>
                    <xref ref-type="aff" rid="a4">4</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Norton</surname>
                        <given-names>William</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-3244-0145</uri>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a3">3</xref>
                    <xref ref-type="aff" rid="a5">5</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Department of Neuroscience, Psychology and Behaviour, University of Leicester, Leicester, LE1 7RH, UK</aff>
                <aff id="a2">
                    <label>2</label>Department of Biological and Environmental Sciences, University of Gothenburg, Gothenburrg, 413 90, Sweden</aff>
                <aff id="a3">
                    <label>3</label>Department of Genetics and Genome Biology, University of Leicester, Leicester, LE1 7RH, UK</aff>
                <aff id="a4">
                    <label>4</label>Department of Life Sciences, Aberystwyth University, Penglais, SY23 3FL, UK</aff>
                <aff id="a5">
                    <label>5</label>Department of Genetics, Eotvos Lorand University, Budapest, Hungary</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:whjn1@le.ac.uk">whjn1@le.ac.uk</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>9</day>
                <month>1</month>
                <year>2023</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2023</year>
            </pub-date>
            <volume>12</volume>
            <elocation-id>28</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>29</day>
                    <month>11</month>
                    <year>2022</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2023 Tilley C et al.</copyright-statement>
                <copyright-year>2023</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/12-28/pdf"/>
            <abstract>
                <p>DNA samples are often used to identify fish before they are utilised in other experiments. Our recent research has shown that skin swabbing can be used to collect DNA for genotyping, and that swabbing causes less harm to fish than fin clipping, another common technique. In this study we investigated potential refinements to the skin swabbing protocol by pre-treating fish with the analgesic lidocaine. We could not detect any differences in cortisol release, behaviour or expression of stress axis marker genes in skin swabbed sticklebacks or zebrafish regardless of lidocaine application. In contrast, fin clipping caused changes in cortisol release, gene expression and behaviour when analgesia was not used. These changes were rescued by pre-treatment with lidocaine confirming that analgesia was effective. The results demonstrates that skin swabbing is a refined technique for DNA collection that does not require analgesia.</p>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>Fin clipping</kwd>
                <kwd>skin swabbing</kwd>
                <kwd>lidocaine</kwd>
                <kwd>analgesia</kwd>
                <kwd>zebrafish</kwd>
                <kwd>stickleback</kwd>
            </kwd-group>
            <funding-group>
                <award-group id="fund-1" xlink:href="http://dx.doi.org/10.13039/501100010757">
                    <funding-source>National Centre for the Replacement Refinement and Reduction of Animals in Research</funding-source>
                    <award-id>NC/R001049/1</award-id>
                </award-group>
                <funding-statement>The author(s) declared that no grants were involved in supporting this work.</funding-statement>
            </funding-group>
        </article-meta>
    </front>
    <body>
        <sec>
            <title>&#x2009;</title>
            <p>
                <boxed-text id="B1" orientation="portrait" position="float">
                    <label>Research highlights</label>
                    <p>
                        <bold>Scientific benefit(s)</bold>
                        <list list-type="bullet">
                            <list-item>
                                <label>&#x2022;</label>
                                <p>Skin swabbing provides DNA of suitable quality to genotype small laboratory fish species.</p>
                            </list-item>
                        </list>
                    </p>
                    <p>
                        <bold>3Rs benefit(s)</bold>
                        <list list-type="bullet">
                            <list-item>
                                <label>&#x2022;</label>
                                <p>Skin swabbing is a refined technique to collect DNA compared to fin clipping, causing fewer health and welfare changes.</p>
                            </list-item>
                            <list-item>
                                <label>&#x2022;</label>
                                <p>It may be possible to use fewer animals in subsequent experiments when collecting DNA by skin swabbing rather than fin clipping.</p>
                            </list-item>
                        </list>
                    </p>
                    <p>
                        <bold>Practical benefit(s)</bold>
                        <list list-type="bullet">
                            <list-item>
                                <label>&#x2022;</label>
                                <p>Skin swabbing is quick to perform and gives reliable results across different institutions.</p>
                            </list-item>
                            <list-item>
                                <label>&#x2022;</label>
                                <p>There is no need to use anaesthetic, analgesic, or sharp blades when skin swabbing.</p>
                            </list-item>
                        </list>
                    </p>
                    <p>
                        <bold>Current applications</bold>
                        <list list-type="bullet">
                            <list-item>
                                <label>&#x2022;</label>
                                <p>The current applications of skin swabbing are to collect DNA samples from small-bodied fish species for use in PCR amplification or genotyping.</p>
                            </list-item>
                        </list>
                    </p>
                    <p>
                        <bold>Potential applications</bold>
                        <list list-type="bullet">
                            <list-item>
                                <label>&#x2022;</label>
                                <p>Skin swabbing might also be suitable to assay mucus samples for small metabolites or hormone levels, such as cortisol.</p>
                            </list-item>
                        </list>
                    </p>
                </boxed-text>
            </p>
        </sec>
        <sec id="sec1" sec-type="intro">
            <title>Introduction</title>
            <p>Refining the experimental techniques applied to laboratory animals is a vital part of scientific research. Experimental fish are often identified by collecting a small sample of DNA that can be used for genotyping. There are several procedures that can be used to collect DNA from fish including fin clipping and skin swabbing. Fin clipping is the more common technique, and it involves anaesthetising a fish and removing a small piece of fin tissue before allowing it to recover in fresh system water. However, there is evidence showing that fin clipping is harmful for fish, indicated by stress axis activation, changes in behaviour and negative effects on survival and growth.
                <sup>
                    <xref ref-type="bibr" rid="ref1">1</xref>
                </sup>
                <sup>&#x2013;</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref6">6</xref>
                </sup>
            </p>
            <p>As an alternative to fin clipping, our recent research has investigated the welfare benefits of using skin swabbing to collect mucus samples from small fish species.
                <sup>
                    <xref ref-type="bibr" rid="ref7">7</xref>
                </sup>
                <sup>&#x2013;</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref9">9</xref>
                </sup> The swabbing procedure involves restraining a non-anaesthetised fish upon a wetted sponge. A mucus sample is collected from the fish&#x2019;s flank using a rayon-tipped swab. Skin swabbing has been shown to be less invasive than fin clipping since it activates fewer endocrine, genetic and behavioural indicators of stress and leads to less variability in post-hoc data collection.
                <sup>
                    <xref ref-type="bibr" rid="ref7">7</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref8">8</xref>
                </sup> In addition, the skin swabbing protocol is easy to perform and leads to reliable DNA sampling.
                <sup>
                    <xref ref-type="bibr" rid="ref8">8</xref>
                </sup>
            </p>
            <p>In this study we have investigated ways to improve the skin swabbing protocol. We first independently verified our study comparing changes to cortisol release and behaviour following fin clipping or skin swabbing using fish held at the University of Gothenburg. In addition, we examined whether swabbing could be improved by applying the analgesic lidocaine. Previous research suggests that analgesia administration post-fin clipping improves fish welfare.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref4">4</xref>
                </sup> We found no difference in the impact of swabbing when carried out with or without analgesia. However, although lidocaine significantly improved the welfare of fin-clipped fish, this procedure brings additional steps to the fin clipping protocol, and lidocaine can affect fish for significant periods of time. Our results confirm that swabbing is a refined technique to collect DNA from small fish species.</p>
        </sec>
        <sec id="sec2" sec-type="methods">
            <title>Methods</title>
            <sec id="sec3">
                <title>Fish stocks and husbandry</title>
                <p>All work was conducted under a UK Home Office licence (University of Leicester, no. P8F9CCE8B) or a local ethics permit (University of Gothenburg, no. 5.8.18-16941/2021). Zebrafish and sticklebacks were kept under standard conditions in accordance with institutional guidelines for animal welfare. Three-spined sticklebacks were generated by 
                    <italic toggle="yes">in vitro</italic> fertilisation as described in.
                    <sup>
                        <xref ref-type="bibr" rid="ref10">10</xref>
                    </sup> They had an average length of 39.02 &#x00b1; 5.81 mm and an average weight of 0.83 &#x00b1; 0.41 g. The water parameters were pH ~7.1, 0 ppm ammonia, 0 ppm nitrate, ~4 ppm nitrite and ~4000 &#x03bc;s/cm conductivity. AB wild-type zebrafish kept at the University of Leicester were generated by in-crossing parental stock. Zebrafish used in the lidocaine experiment had an average length of 29.67 &#x00b1; 2.38 mm and an average weight of 0.24 g &#x00b1; 0.15 g. Those used in the water supplements experiment had an average length of 41.13 &#x00b1; 3.79 mm and an average weight of 0.94 &#x00b1; 0.52 g. The water parameters were pH ~7.1, 0 ppm ammonia, 4 ppm nitrate, ~0 ppm nitrite and ~525 &#x03bc;s/cm conductivity. AB wild-type zebrafish kept at the University of Gothenburg were obtained from the Zebrafish Core Facility, Karolinska Institute, Stockholm, Sweden. They had an average length of 25.86 &#x00b1; 1.02 mm and an average weight of 0.22 g &#x00b1; 0.12 g. The water quality parameters were pH ~7.4, &lt;0.1 ppm ammonia, &lt;10 ppm nitrate, and &lt;0.1 ppm nitrite. No fish of either species died during these experiments and all animals were killed by a Schedule 1 procedure at the end of the study.</p>
                <p>
                    <bold>Experiment 1. Cortisol and measurements of behaviour (University of Gothenburg)</bold>
                </p>
                <p>Cortisol release and measurements of behaviour using the Fish Behavioural Index (FBI) were carried out in Gothenburg. A total number of 48 zebrafish were used. Experiments were conducted as outlined in.
                    <sup>
                        <xref ref-type="bibr" rid="ref3">3</xref>
                    </sup> Zebrafish were randomly selected and transferred to a semi-closed recirculation system containing two parallel rows of glass tanks (20 &#x00d7; 30 &#x00d7; 20 cm; n = 1 fish per tank). Fish were acclimatised in their individual tanks for two weeks prior to experimentation. They were in visual contact with adjacent tanks until the evening prior to experimentation when two opaque pieces of plastic were placed between tanks to visually isolate individuals. Fish were randomly assigned by haphazard netting from a home tank into one of the following groups: Fin Clip; Fin Clip plus Lidocaine; Skin Swab or Skin Swab plus Lidocaine (n = 12 per group). At the start of the experiment the water flow to the experimental tanks was switched off and 5 mg/L lidocaine was administered to the tank. Behaviour was compared at pre-treatment and 1, 2, 3 and 6 h afterwards. At each time point behaviour was recorded for 25 min using video cameras linked to FBI tracking software. The FBI assigns one value based upon activity and distance travelled to classify behaviour as: Healthy (0.84-1.0); OK (0.67-0.83); Unhealthy (0.33-0.66); or Abnormal (0-0.32) (Deakin 
                    <italic toggle="yes">et al</italic>., 2019). After the video recording, a water sample was obtained for cortisol analysis.
                    <sup>
                        <xref ref-type="bibr" rid="ref1">1</xref>
                    </sup> Water samples were collected into two clean 120 mL containers per treatment group using siphons. Blank water samples (n = 2) were taken directly from empty tanks at each sampling point to account for residual cortisol levels (ranging from 37-56 pg/cartridge) and blank values were subtracted from the corresponding experimental sample.
                    <sup>
                        <xref ref-type="bibr" rid="ref11">11</xref>
                    </sup> Following collection, samples were immediately frozen at -20&#x00b0;C and were allowed to thaw at 4&#x00b0;C for 24 hours before cortisol extraction at a later date. Water samples were filtered with 0.45 micron nitrocellulose filters (10 cm diameter, Whatman, UK) before undergoing solid phase extraction using C-18 Sep-pak cartridges fitted to a mini-pulse machine set at 25 ml min
                    <sup>-1</sup>. Cartridges were first primed with 5 ml methanol and washed with 5 ml distilled water. The water sample was then passed through the cartridge, followed by a final wash with 5 ml distilled water. All cartridges were labelled and allowed to dry before being frozen for future analysis (-20&#x00b0;C). Cortisol was assayed blind using 200 &#x03bc;L of eluate in a radioimmunoassay.
                    <sup>
                        <xref ref-type="bibr" rid="ref12">12</xref>
                    </sup>
                </p>
                <p>
                    <bold>Experiment 2. Administration of lidocaine (University of Leicester)</bold>
                </p>
                <p>In separate experiments carried out in Leicester, we investigated the welfare impact of administering analgesia prior to DNA sampling and stress relief water supplements post-sampling. Two weeks prior to experimentation, fish were caught and were distributed by blind randomization into ten tanks on the system, (six for analgesia studies and four for water supplements with nine sticklebacks in 13.4 L tanks and nine zebrafish in 3.5 L tanks). The tanks were located in central locations of large racks within the respective species rooms, ensuring that all tanks received similar illumination and were surrounded by other tanks on the sides. No enrichment was provided. The number of fish per group was based on numbers needed for qPCR analysis. On the day of the experiment tanks were removed from the rack and placed on a trolley for 30 minutes before the start. Lidocaine studies were carried out on one day and water supplements on the following day. This was repeated two more times each week to give three technical replicates for each study. On the day of the experiment a 400 mg/L stock solution of lidocaine (Sigma-Aldrich) was prepared and diluted to 2 mg/L
                    <sup>
                        <xref ref-type="bibr" rid="ref4">4</xref>
                    </sup> using reverse osmosis water. Lidocaine was applied by immersion for 45 min before manipulation. Six groups were investigated in both species: Non-manipulated with no pain relief (un-manipulated); Netted, swabbed and released with no pain relief; netted, anaesthetised, fin clipped and allowed to recover with no pain relief; Un-manipulated after immersion in lidocaine; Netted, swabbed and then released after immersion in lidocaine; netted, anaesthetised and fin clipped after immersion in lidocaine. The total number of individuals used were 162 sticklebacks and 162 zebrafish (9 &#x00d7; 6 groups &#x00d7; 3 independent replicates).</p>
            </sec>
            <sec id="sec4">
                <title>DNA collection procedure and gene expression analysis</title>
                <p>For details of DNA collection by skin swabbing or fin clipping, and gene expression analysis refer to.
                    <sup>
                        <xref ref-type="bibr" rid="ref8">8</xref>
                    </sup> The expression of five stress marker genes were investigated: 
                    <italic toggle="yes">brain-derived neurotrophic factor</italic> (
                    <italic toggle="yes">bdnf</italic>), 
                    <italic toggle="yes">corticotropin releasing hormone a</italic> (
                    <italic toggle="yes">crha</italic>), 
                    <italic toggle="yes">corticotropin releasing hormone b</italic> (
                    <italic toggle="yes">crhb</italic>), 
                    <italic toggle="yes">galanin</italic> (
                    <italic toggle="yes">galn</italic>) and 
                    <italic toggle="yes">neuropeptide y</italic> (
                    <italic toggle="yes">npy</italic>).
                    <sup>
                        <xref ref-type="bibr" rid="ref8">8</xref>
                    </sup> The data were normalised against the geometric means of 
                    <italic toggle="yes">ribosomal protein L8</italic> (
                    <italic toggle="yes">rpL8</italic>), 
                    <italic toggle="yes">ribosomal protein L13A</italic> (
                    <italic toggle="yes">rpL13A</italic>) and 
                    <italic toggle="yes">ubiquitin</italic> (
                    <italic toggle="yes">ubiq</italic>) genes in sticklebacks and 
                    <italic toggle="yes">ribosomal protein L13A</italic> (
                    <italic toggle="yes">rpL13A</italic>) and 
                    <italic toggle="yes">elongation factor 1a</italic> (
                    <italic toggle="yes">elf1a</italic>) genes in zebrafish. The fold change was calculated using the 2-ddCT method.
                    <sup>
                        <xref ref-type="bibr" rid="ref13">13</xref>
                    </sup> Primer details are shown in 
                    <xref ref-type="table" rid="T1">Table 1</xref>.</p>
                <table-wrap id="T1" orientation="portrait" position="float">
                    <label>Table 1. </label>
                    <caption>
                        <title>Primer sequences for qPCR.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Gene</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Forward primer</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Reverse primer</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Reference</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="4" rowspan="1" valign="top">
                                    <bold>Stickleback</bold>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">bdnf</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GACCAAGGATGTCGACCTGT</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GCTGTCACCCACTGGCTAAT</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Lai, et al.</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crha</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GATCTGACCTTCCACCTGCTGAGA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GGTGTCCATCATCTTGCGGTTG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Primer3</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crhb</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CGCCAAAGATCTCCGTTTAG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CCGTATACGCGCCATAGTTT</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Primer3</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">galn</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GATGGAGACGTCATCCACACCATC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CATCTGATGTCACAGAGGACCGGC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Primer3</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">npy</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GAGGCACTACATCAACCTCATCA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GCTTTCCTTCAACAGCAGCTCTG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Primer3</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">rpL8</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CGACCCGTACCGCTTCAAGAA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GGACATTGCCAATGTTCAGCTGA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Geoghegan et al.</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">rpL13A</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CACCTTGGTCAACTTGAACAGTG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TCCCTCCGCCCTACGAC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Hibbeler et al.</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">ubiq</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AGACGGGCATAGCACTTGC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAGGACAAGGAAGGCATCC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Hibbeler et al.</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="4" rowspan="1" valign="top">
                                    <bold>Zebrafish</bold>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">bdnf</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CCTTACCATGGATAGCAAAAGGAA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CTATCTGCCCCTCTTAATGGTCAA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Primer3</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crha</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAGCAGACTCTCACCGACAA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">ACACCGCAACGACAACCA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Primer3</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crhb</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CATCCCAGTATCCAAAAAGAGC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TCGTAGCAGATGAAAGGTCAGA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Sarath Babu, et al.</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">npy</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GACTCTCACAGAAGGGTATCC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GGTTGATGTAGTGTCTTAGTGCTG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Yokobori, et al.</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">rpl13</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TCTGGAGGACTGTAAGAGGTATGC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AGACGCACAATCTTGAGAGCAG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Primer3</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">elf1a</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CCTCTTGGTCGCTTTGC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GGTGTGATTGAGGGAAATTCA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Primer3</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <table-wrap id="T2" orientation="portrait" position="float">
                    <label>Table 2. </label>
                    <caption>
                        <title>Statistical analysis using ANOVA or linear mixed model analysis of data presented in 
                            <xref ref-type="fig" rid="f2">Figures 2</xref> and 
                            <xref ref-type="fig" rid="f3">3</xref>, comparing gene expression in sticklebacks or zebrafish with and without lidocaine treatment.</title>
                        <p>Post-hoc Pairwise comparisons of lidocaine treatment and DNA method for each fish type. Degrees of freedom are 175 except for galn where they are 94 as this was not tested using zebrafish samples. 162 sticklebacks and 162 zebrafish (9 x 6 groups x 3 independent replicates) were used and 3 technical replicates were performed in the qPCR.</p>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Gene</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Fish</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Contrast</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">t.ratio</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">p.value</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">bdnf</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">stickleback</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine clip - no_lidocaine clip</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-3.89</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.002</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">bdnf</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">stickleback</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine control - no_lidocaine clip</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-3.39</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.011</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">bdnf</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">stickleback</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">no_lidocaine clip - no_lidocaine swab</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3.21</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.020</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crha</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">stickleback</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine clip - no_lidocaine clip</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-4.98</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&lt;0.001</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crha</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">stickleback</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine clip - no_lidocaine swab</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-3.98</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.001</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crha</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">stickleback</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine control - no_lidocaine clip</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-3.38</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.011</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crha</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">stickleback</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">no_lidocaine clip - lidocaine swab</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3.65</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.005</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crha</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">stickleback</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">no_lidocaine control - no_lidocaine clip</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-4.39</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&lt;0.001</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crha</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">stickleback</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">no_lidocaine control - no_lidocaine swab</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-3.40</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.011</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">npy</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">stickleback</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine control - no_lidocaine control</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3.10</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.027</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">npy</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">stickleback</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">no_lidocaine control - lidocaine clip</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-3.84</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.002</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">npy</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">stickleback</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">no_lidocaine control - no_lidocaine clip</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-3.22</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.019</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">galn</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">stickleback</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine clip - no_lidocaine clip</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-3.98</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.002</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">galn</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">stickleback</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">no_lidocaine clip - lidocaine swab</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3.24</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.020</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">bdnf</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine clip - no_lidocaine clip</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-8.15</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&lt;0.001</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">bdnf</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine clip - no_lidocaine swab</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-6.90</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&lt;0.001</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">bdnf</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine control - lidocaine clip</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3.54</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.007</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">bdnf</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine control - no_lidocaine clip</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-4.69</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&lt;0.001</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">bdnf</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine control - no_lidocaine swab</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-3.42</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.010</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">bdnf</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine swab - no_lidocaine swab</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-3.84</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.002</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">bdnf</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">no_lidocaine clip - lidocaine swab</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">5.07</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&lt;0.001</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">bdnf</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">no_lidocaine control - lidocaine clip</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">5.67</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&lt;0.001</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crha</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine clip - no_lidocaine clip</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-3.59</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.006</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crha</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine control - no_lidocaine clip</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-5.79</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&lt;0.001</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crha</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine control - no_lidocaine control</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-3.99</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.001</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crha</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine control - no_lidocaine swab</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-4.01</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.001</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crha</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">no_lidocaine clip - lidocaine swab</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">4.24</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&lt;0.001</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crhb</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine clip - no_lidocaine clip</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-6.31</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&lt;0.001</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crhb</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine clip - no_lidocaine swab</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-5.17</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&lt;0.001</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crhb</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine control - lidocaine clip</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3.27</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.016</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crhb</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine control - lidocaine swab</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2.93</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.044</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crhb</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine control - no_lidocaine clip</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-3.09</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.028</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crhb</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine control - no_lidocaine control</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-3.60</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.006</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crhb</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine swab - no_lidocaine swab</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-4.79</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&lt;0.001</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crhb</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">no_lidocaine clip - lidocaine swab</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">5.91</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&lt;0.001</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crhb</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">no_lidocaine control - lidocaine clip</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6.81</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&lt;0.001</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crhb</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">no_lidocaine control - lidocaine swab</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6.40</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&lt;0.001</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">npy</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine clip - no_lidocaine clip</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-6.87</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&lt;0.001</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">npy</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine clip - no_lidocaine swab</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-3.38</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.011</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">npy</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine control - no_lidocaine clip</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-6.35</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&lt;0.001</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">npy</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">lidocaine control - no_lidocaine control</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-3.48</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.008</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">npy</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">no_lidocaine clip - lidocaine swab</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">5.31</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&lt;0.001</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">npy</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">no_lidocaine clip - no_lidocaine swab</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3.55</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.006</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">npy</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">zebrafish</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">no_lidocaine control - lidocaine clip</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">4.06</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.001</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
            </sec>
            <sec id="sec5">
                <title>Statistical analysis</title>
                <p>Statistical analyses were carried out using GraphPad Prism7 and RStudio. Data were tested for normality using the using the Shapiro-Wilk test, followed by a non-parametric Kruskal-Wallis test and Dunn's multiple comparisons test comparing each treatment to the control group. Gene expression data was Log2 transformed. An ANOVA was carried out for each gene separately (model: log2(expression) = lidocaine + treatment + fish + lidocaine:treatment:fish). Post-hoc tests were carried out using the Emmeans package version 1.5.4 in R.
                    <sup>
                        <xref ref-type="bibr" rid="ref14">14</xref>
                    </sup>
                </p>
            </sec>
        </sec>
        <sec id="sec6" sec-type="results|discussion">
            <title>Results and discussion</title>
            <sec id="sec7">
                <title>Lidocaine pre-treatment does not refine skin swabbing but does improve fin clipping</title>
                <p>Our previous research has shown that skin swabbing is a refined technique to collect DNA compared to fin clipping.
                    <sup>
                        <xref ref-type="bibr" rid="ref8">8</xref>
                    </sup> In the first set of experiments we treated 48 zebrafish with the analgesic lidocaine before either fin clipping or skin swabbing. We investigated changes to locomotion and space usage in the tank using the Fish Behavioural Index (FBI), an automated system that gives an unbiased readout of fish welfare.
                    <sup>
                        <xref ref-type="bibr" rid="ref5">5</xref>
                    </sup> Fin clipping caused a sharp decrease in fish welfare, demonstrated by a reduction of FBI units that persisted over time (&gt;6 h). Fin-clipped fish displayed a score of 0.18 FBI units (representing abnormal behaviour) six hours after fin clipping. Pre-treatment with lidocaine prevented this decrease in welfare. However, since FBI scores had not normalised after 6 h, lidocaine may only represent temporary relief for fin-clipped fish. In comparison, skin swabbed animals displayed similar profiles regardless of the treatment group (with or without lidocaine). All swabbed fish displayed &#x2018;healthy&#x2019; behaviour profiles (FBI scores 0.90-0.96) (
                    <xref ref-type="fig" rid="f1">Figure 1B</xref>). We next compared excretion of cortisol. In keeping with other published studies,
                    <sup>
                        <xref ref-type="bibr" rid="ref4">4</xref>
                    </sup>
                    <sup>,</sup>
                    <sup>
                        <xref ref-type="bibr" rid="ref8">8</xref>
                    </sup> fin clipping in the absence of lidocaine led to heightened cortisol release compared to fin clipping with lidocaine, or skin swabbing with or without lidocaine. Importantly, there was no significant difference between the amount of cortisol excreted by zebrafish following skin swabbing with or without lidocaine, suggesting that skin swabbing is not as stressful to fish as fin clipping and that it is not refined by analgesia administration (
                    <xref ref-type="fig" rid="f1">Figure 1A</xref>). We were thus able to confirm the findings of our previous research
                    <sup>
                        <xref ref-type="bibr" rid="ref8">8</xref>
                    </sup> using fish housed in a different country and data collected by researchers that were not involved in earlier studies.</p>
                <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                    <label>Figure 1. </label>
                    <caption>
                        <title>Cortisol excretion is heightened after fin clipping in the absence of lidocaine.</title>
                        <p>A. There is no significant difference in cortisol release between fin clipping with lidocaine treatment, or skin swabbing with and without lidocaine treatment. Treatment groups: fin clipping without lidocaine (Clip no lido); fin clipping following lidocaine pre-treatment (Clip lido); skin swabbing without lidocaine (Swab no lido and skin swabbing following lidocaine pre-treatment (Swab lido). One-way ANOVA followed by Dunnett&#x2019;s multiple comparisons test. Clip no lido vs Clip lido, n=12 DF=44, p &lt; 0.001; Clip no lido vs Swab no lido, n=12, DF=44, p &lt; 0.001; Clip no lido vs Swab lido, n=12, DF=44, p &lt; 0.001. B. Fin clipping in the absence of lidocaine decreases zebrafish health status compared to skin swabbing with or without lidocaine treatment. Treatment groups: fin clipping without lidocaine; fin clipping following lidocaine pre-treatment; skin swabbing without lidocaine and skin swabbing following lidocaine pre-treatment. Scores from the FBI are interpreted as follows: Healthy 0.84-1.0, OK 0.67-0.83, Unhealthy 0.33-0.66 and Abnormal 0-0.32.</p>
                    </caption>
                    <graphic id="gr1" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/133935/2b401c94-f750-4e9e-823f-be318f4e86f2_figure1.gif"/>
                </fig>
            </sec>
            <sec id="sec8">
                <title>Lidocaine treatment is not required for DNA collection by skin swabbing</title>
                <p>We next used quantitative PCR to compare the expression level of five genes related to the stress response in sticklebacks and zebrafish: 
                    <italic toggle="yes">brain derived neurotrophic factor</italic> (
                    <italic toggle="yes">bdnf</italic>); 
                    <italic toggle="yes">corticotropin releasing hormone a</italic> (
                    <italic toggle="yes">crha</italic>); 
                    <italic toggle="yes">corticotropin releasing hormone b</italic> (
                    <italic toggle="yes">crhb</italic>); 
                    <italic toggle="yes">galanin</italic> (
                    <italic toggle="yes">gln</italic>) and 
                    <italic toggle="yes">neuropeptide y</italic> (
                    <italic toggle="yes">npy</italic>). We compared the effect of lidocaine treatment in fish that were either un-manipulated, fin clipped or skin swabbed either with or without lidocaine (n = 27 for each treatment group, 162 in total for each species). Heightened expression of these genes would indicate higher stress levels in fish. In the absence of lidocaine, fin clipping led to heightened expression of 
                    <italic toggle="yes">crha</italic>, 
                    <italic toggle="yes">galn</italic> and 
                    <italic toggle="yes">npy</italic> compared to un-manipulated sticklebacks (
                    <xref ref-type="fig" rid="f2">Figure 2</xref>). There was also a significant difference in 
                    <italic toggle="yes">bdnf</italic> expression between skin swabbed and fin clipped sticklebacks (
                    <xref ref-type="fig" rid="f2">Figure 2</xref>). Pre-experimental lidocaine treatment heightened 
                    <italic toggle="yes">npy</italic> expression in sticklebacks that were not used for DNA collection, suggesting that lidocaine application can be harmful, or that the concentration and treatment regime needs to be optimised (
                    <xref ref-type="fig" rid="f2">Figure 2</xref>). However, lidocaine treatment decreased the expression of 
                    <italic toggle="yes">bdnf</italic>, 
                    <italic toggle="yes">crha</italic> and 
                    <italic toggle="yes">galn</italic> in fin clipped sticklebacks compared to sticklebacks that had been fin clipped without analgesia (
                    <xref ref-type="fig" rid="f2">Figure 2</xref>). There were no significant differences in gene expression between skin swabbed sticklebacks with or without lidocaine application.</p>
                <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                    <label>Figure 2. </label>
                    <caption>
                        <title>Lidocaine pre-treatment decreases activation of stickleback stress marker genes following DNA sampling.</title>
                        <p>qPCR data showing expression relative to the geometric mean of 
                            <italic toggle="yes">rpL8, rpL13A</italic> and 
                            <italic toggle="yes">ubiq</italic> of (A) stickleback 
                            <italic toggle="yes">brain-derived neurotrophic factor</italic> (
                            <italic toggle="yes">bdnf</italic>). (B) stickleback 
                            <italic toggle="yes">corticotropin releasing hormone a</italic> (
                            <italic toggle="yes">crha</italic>). (C) stickleback 
                            <italic toggle="yes">corticotropin releasing hormone b</italic> (
                            <italic toggle="yes">crhb</italic>). (D) stickleback 
                            <italic toggle="yes">galanin</italic> (
                            <italic toggle="yes">galn</italic>). (E) stickleback 
                            <italic toggle="yes">neuropeptide y</italic> (
                            <italic toggle="yes">npy</italic>). Groups include: 1) un-manipulated control fish (control no lidocaine); 2) skin swabbed fish (swab no lidocaine); 3) Fin clipped fish; (clip no lidocaine); 4) un-manipulated fish pre-treated with lidocaine (control lidocaine); 5) lidocaine pre-treated skin swabbed fish (swab lidocaine) and 6) lidocaine pre-treated fin clipped fish (clip lidocaine). For each group n = 27 (162 in total). Each qPCR consisted of three technical replicates. Comparisons include: a) un-manipulated no lidocaine versus fin clip no lidocaine fish (1 versus 3); b) fin clip no lidocaine versus skin swab no lidocaine (3 versus 2); c) un-manipulated no lidocaine versus un-manipulated lidocaine (1 versus 4); d) fin clip no lidocaine versus fin clip with lidocaine (3 versus 6); e) un-manipulated no lidocaine versus swab no lidocaine (1 versus 2) and f) skin swab no lidocaine vs swab with lidocaine (2 versus 5). Primer sequences are included in 
                            <xref ref-type="table" rid="T1">Table 1</xref> and full statistical information is included in 
                            <xref ref-type="table" rid="T2">Table 2</xref>. Group legend: C = un-manipulated fish, SS = skin swabbed fish, FC = fin clipped fish.</p>
                    </caption>
                    <graphic id="gr2" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/133935/2b401c94-f750-4e9e-823f-be318f4e86f2_figure2.gif"/>
                </fig>
                <p>In the absence of lidocaine there was a significant increase in 
                    <italic toggle="yes">npy</italic> expression in the fin clipped zebrafish compared to the skin swabbed group (
                    <xref ref-type="fig" rid="f3">Figure 3</xref>). Application of lidocaine to un-manipulated zebrafish caused a significant decrease in the expression of 
                    <italic toggle="yes">crha</italic>, 
                    <italic toggle="yes">crhb</italic> and 
                    <italic toggle="yes">npy</italic> (
                    <xref ref-type="fig" rid="f3">Figure 3</xref>). These findings are difficult to interpret because it is not clear what a decrease in gene expression represents in terms of fish welfare. Further research comparing gene expression to other welfare readouts is needed to clarify this point. Similarly, lidocaine treatment decreased the expression of 
                    <italic toggle="yes">bdnf</italic>, 
                    <italic toggle="yes">crha</italic>, 
                    <italic toggle="yes">crhb</italic> and 
                    <italic toggle="yes">npy</italic> in fin clipped zebrafish compared to the no-lidocaine group. Finally, lidocaine treatment also decreased 
                    <italic toggle="yes">bdnf</italic> and 
                    <italic toggle="yes">crhb</italic> expression following skin swabbing compared to the swabbing without lidocaine (
                    <xref ref-type="fig" rid="f3">Figure 3</xref>). In summary, skin swabbing is a refined technique to collect DNA, even without lidocaine application.</p>
                <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                    <label>Figure 3. </label>
                    <caption>
                        <title>Lidocaine pre-treatment decreases activation of zebrafish stress marker genes following DNA sampling.</title>
                        <p>qPCR data showing expression relative to the geometric mean of 
                            <italic toggle="yes">rpL13A</italic> and 
                            <italic toggle="yes">elf1A</italic> of (A) zebrafish 
                            <italic toggle="yes">brain-derived neurotrophic factor</italic> (
                            <italic toggle="yes">bdnf</italic>). (B) zebrafish 
                            <italic toggle="yes">corticotropin releasing hormone a</italic> (
                            <italic toggle="yes">crha</italic>). (C) zebrafish 
                            <italic toggle="yes">corticotropin releasing hormone b</italic> (
                            <italic toggle="yes">crhb</italic>). (D) zebrafish 
                            <italic toggle="yes">neuropeptide y</italic> (
                            <italic toggle="yes">npy</italic>). Groups include: 1) un-manipulated control fish (control no lidocaine); 2) skin swabbed fish (swab no lidocaine); 3) Fin clipped fish; (clip no lidocaine); 4) un-manipulated fish pre-treated with lidocaine (control lidocaine); 5) lidocaine pre-treated skin swabbed fish (swab lidocaine) and 6) lidocaine pre-treated fin clipped fish (clip lidocaine). For each group n = 27 (162 in total). Each qPCR consisted of 3 technical replicates. Comparisons include: a) un-manipulated no lidocaine vs fin clip no lidocaine fish (1 versus 3); b) fin clip no lidocaine versus skin swab no lidocaine (3 versus 2); c) un-manipulated no lidocaine versus un-manipulated lidocaine (1 versus 4); d) fin clip no lidocaine versus fin clip with lidocaine (3 versus 6). e) un-manipulated no lidocaine versus swab no lidocaine (1 versus 2) and f) skin swab no lidocaine versus swab with lidocaine (2 versus 5). Primer sequences are included in 
                            <xref ref-type="table" rid="T1">Table 1</xref> and full statistical information is included in 
                            <xref ref-type="table" rid="T2">Table 2</xref>. Group legend: C = un-manipulated fish, SS = skin swabbed fish, FC = fin clipped fish.</p>
                    </caption>
                    <graphic id="gr3" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/133935/2b401c94-f750-4e9e-823f-be318f4e86f2_figure3.gif"/>
                </fig>
            </sec>
        </sec>
        <sec id="sec9">
            <title>Summary</title>
            <p>We have replicated our findings from an independent study in another facility, using different fish, equipment and researchers, demonstrating that swabbing is a refinement from fin clipping. We also confirmed that lidocaine is an effective analgesic for diminishing pain caused by the fin clipping procedure. Therefore, it is recommended that lidocaine should be provided when fin clipping is used. However, the changes in gene expression in fish exposed to lidocaine with no additional manipulation show that administration of analgesia is a procedure that can result in complex responses, including potential aversion. In addition, it is possible that longer-term welfare impacts remain once the lidocaine wears off, meaning that lidocaine treatment is not ideal. Swabbing is not further refined by administering lidocaine, suggesting swabbing does not cause discomfort. As swabbing is a refinement even in the absence of analgesia, the use of controlled substances can be avoided. We have therefore demonstrated that swabbing represents a true refinement to fin clipping for DNA collection.</p>
        </sec>
    </body>
    <back>
        <sec id="sec15" sec-type="data-availability">
            <title>Data availability</title>
            <sec id="sec16">
                <title>Underlying data</title>
                <p>Open Science Framework: Lidocaine and water conditioners, 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.17605/OSF.IO/6MD5V">https://doi.org/10.17605/OSF.IO/6MD5V</ext-link>.
                    <sup>

                        <xref ref-type="bibr" rid="ref15">15</xref>
</sup>
                </p>
                <p>This project contains the following underlying data:
                    <list list-type="bullet">
                        <list-item>
                            <label>-</label>
                            <p>Tilley at al raw data.xlsx</p>
                        </list-item>
                    </list>
                </p>
                <p>Data are available under the terms of the 
                    <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/publicdomain/zero/1.0/">Creative Commons Zero &#x201c;No rights reserved&#x201d; data waiver</ext-link> (CC0 1.0 Public domain dedication).</p>
            </sec>
            <sec id="sec17">
                <title>Reporting guidelines</title>
                <p>Figshare: ARIVE Essential 10 guidelines for &#x201c;Validating skin swabbing as a refined technique to collect DNA from small-bodied fish species&#x201d;, 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.21603024.v1">https://doi.org/10.6084/m9.figshare.21603024.v1</ext-link>.
                    <sup>

                        <xref ref-type="bibr" rid="ref16">16</xref>
</sup>
                </p>
                <p>Data are available under the terms of the 
                    <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution 4.0 International license</ext-link> (CC-BY 4.0).</p>
            </sec>
        </sec>
        <ref-list>
            <title>References</title>
            <ref id="ref1">
                <label>1</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>White</surname>
                            <given-names>LJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Thomson</surname>
                            <given-names>JS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Pounder</surname>
                            <given-names>KC</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The impact of social context on behaviour and the recovery from welfare challenges in zebrafish.</article-title>
                    <source>

                        <italic toggle="yes">Danio rerio. Anim. Behav.</italic>
</source>
                    <year>2017</year>;<volume>132</volume>:<fpage>189</fpage>&#x2013;<lpage>199</lpage>.
                    <pub-id pub-id-type="doi">10.1016/j.anbehav.2017.08.017</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref2">
                <label>2</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Taslima</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Davie</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>McAndrew</surname>
                            <given-names>BJ</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>DNA sampling from mucus in the Nile tilapia, Oreochromis niloticus: minimally invasive sampling for aquaculture-related genetics research.</article-title>
                    <source>

                        <italic toggle="yes">Aquac. Res.</italic>
</source>
                    <year>2015</year>;<volume>47</volume>(<issue>12</issue>):<fpage>4032</fpage>&#x2013;<lpage>4037</lpage>.</mixed-citation>
            </ref>
            <ref id="ref3">
                <label>3</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Deakin</surname>
                            <given-names>AG</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Spencer</surname>
                            <given-names>JW</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Cossins</surname>
                            <given-names>AR</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Welfare challenges influence the complexity of movement: fractal analysis of behaviour in zebrafish.</article-title>
                    <source>

                        <italic toggle="yes">Fishes.</italic>
</source>
                    <year>2019</year>;<volume>4</volume>:<fpage>8</fpage>.
                    <pub-id pub-id-type="doi">10.3390/fishes4010008</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref4">
                <label>4</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Schroeder</surname>
                            <given-names>PG</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sneddon</surname>
                            <given-names>LU</given-names>
                        </name>
</person-group>:
                    <article-title>Exploring the efficacy of immersion analgesics in zebrafish using an integrative approach.</article-title>
                    <source>

                        <italic toggle="yes">Appl. Anim. Behav. Sci.</italic>
</source>
                    <year>2017</year>;<volume>187</volume>:<fpage>93</fpage>&#x2013;<lpage>102</lpage>.
                    <pub-id pub-id-type="doi">10.1016/j.applanim.2016.12.003</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref5">
                <label>5</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Deakin</surname>
                            <given-names>AG</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Buckley</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Al Zubi</surname>
                            <given-names>HS</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Automated monitoring of behaviour in zebrafish after invasive procedures.</article-title>
                    <source>

                        <italic toggle="yes">Sci. Rep.</italic>
</source>
                    <year>2019</year>;<volume>21</volume>:<fpage>9</fpage>.</mixed-citation>
            </ref>
            <ref id="ref6">
                <label>6</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>De Lombaert</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rick</surname>
                            <given-names>EL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Krugner-Higby</surname>
                            <given-names>LA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Behavioral characteristics of adult zebrafish (Danio rerio) after MS222 anesthesia for fin excision.</article-title>
                    <source>

                        <italic toggle="yes">J. Am. Assoc. Lab. Anim. Sci.</italic>
</source>
                    <year>2017</year>;<volume>56</volume>:<fpage>377</fpage>&#x2013;<lpage>381</lpage>.
                    <pub-id pub-id-type="pmid">28724486</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref7">
                <label>7</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Breacker</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Barber</surname>
                            <given-names>I</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Norton</surname>
                            <given-names>WH</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>A low-cost method of skin swabbing for the collection of DNA samples from small laboratory fish.</article-title>
                    <source>

                        <italic toggle="yes">Zebrafish.</italic>
</source>
                    <year>2017</year>;<volume>14</volume>:<fpage>35</fpage>&#x2013;<lpage>41</lpage>.
                    <pub-id pub-id-type="pmid">27788059</pub-id>
                    <pub-id pub-id-type="doi">10.1089/zeb.2016.1348</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5312459</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref8">
                <label>8</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Tilley</surname>
                            <given-names>CA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Carreno</surname>
                            <given-names>GH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sebire</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Skin swabbing is a refined technique to collect DNA from model fish species.</article-title>
                    <source>

                        <italic toggle="yes">Sci. Rep.</italic>
</source>
                    <year>2020</year>;<volume>10</volume>:<fpage>18212</fpage>.
                    <pub-id pub-id-type="pmid">33097784</pub-id>
                    <pub-id pub-id-type="doi">10.1038/s41598-020-75304-1</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7584585</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref9">
                <label>9</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Tilley</surname>
                            <given-names>CA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Barber</surname>
                            <given-names>I</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Norton</surname>
                            <given-names>WHJ</given-names>
                        </name>
</person-group>:
                    <article-title>Skin swabbing protocol to collect DNA sample from small-bodied fish species.</article-title>
                    <source>

                        <italic toggle="yes">F1000 Res.</italic>
</source>
                    <year>2021</year>;<volume>10</volume>:<fpage>1064</fpage>.
                    <pub-id pub-id-type="doi">10.12688/f1000research.73115.1</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref10">
                <label>10</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Barber</surname>
                            <given-names>I</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Arnott</surname>
                            <given-names>SA</given-names>
                        </name>
</person-group>:
                    <article-title>Split-clutch IVF: A technique to examine indirect fitness consequences of mate preferences in sticklebacks.</article-title>
                    <source>

                        <italic toggle="yes">Behaviour.</italic>
</source>
                    <year>2000</year>;<volume>137</volume>:<fpage>1129</fpage>&#x2013;<lpage>1140</lpage>.
                    <pub-id pub-id-type="doi">10.1163/156853900502484</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref11">
                <label>11</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Scott</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sheldrick</surname>
                            <given-names>E</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Flint</surname>
                            <given-names>A</given-names>
                        </name>
</person-group>:
                    <article-title>Measurement of 17&#x03b1;, 20&#x03b2;-dihydroxy-4-pregnen-3-one in plasma of trout (Salmo gairdneri Richardson): seasonal changes and response to salmon pituitary extract.</article-title>
                    <source>

                        <italic toggle="yes">Gen. Comp. Endocrinol.</italic>
</source>
                    <year>1982</year>;<volume>46</volume>:<fpage>444</fpage>&#x2013;<lpage>451</lpage>.
                    <pub-id pub-id-type="pmid">7095406</pub-id>
                    <pub-id pub-id-type="doi">10.1016/0016-6480(82)90098-3</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref12">
                <label>12</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Pottinger</surname>
                            <given-names>TG</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Carrick</surname>
                            <given-names>TR</given-names>
                        </name>
</person-group>:
                    <article-title>Stress responsiveness affects dominant-subordinate relationships in rainbow trout.</article-title>
                    <source>

                        <italic toggle="yes">Horm. Behav.</italic>
</source>
                    <year>2001</year>;<volume>40</volume>(<issue>3</issue>):<fpage>419</fpage>&#x2013;<lpage>427</lpage>.
                    <pub-id pub-id-type="pmid">11673915</pub-id>
                    <pub-id pub-id-type="doi">10.1006/hbeh.2001.1707</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref13">
                <label>13</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Livak</surname>
                            <given-names>KJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Schmittgen</surname>
                            <given-names>TD</given-names>
                        </name>
</person-group>:
                    <article-title>Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.</article-title>
                    <source>

                        <italic toggle="yes">Methods.</italic>
</source>
                    <year>2001</year>;<volume>25</volume>(<issue>4</issue>):<fpage>402</fpage>&#x2013;<lpage>408</lpage>.
                    <pub-id pub-id-type="doi">10.1006/meth.2001.1262</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref14">
                <label>14</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Lenth</surname>
                            <given-names>RV</given-names>
                        </name>
</person-group>:
                    <article-title>Emmeans: estimated marginal means, aka least-squares means.</article-title>
                    <year>2021</year>.
                    <ext-link ext-link-type="uri" xlink:href="https://cran.microsoft.com/snapshot/2018-01-13/web/packages/emmeans/emmeans.pdf">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref15">
                <label>15</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Norton</surname>
                            <given-names>W</given-names>
                        </name>
</person-group>:
                    <article-title>Lidocaine and water conditioners.</article-title>
                    <year>2022, May 10</year>.
                    <pub-id pub-id-type="doi">10.17605/OSF.IO/6MD5V</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref16">
                <label>16</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Tilley</surname>
                            <given-names>C</given-names>
                        </name>
</person-group>:
                    <article-title>ARRIVE Author Checklist Validating skin swabbing as a refined technique to collect DNA from small-bodied fish species.pdf. figshare. Online resource.</article-title>
                    <year>2022</year>.
                    <pub-id pub-id-type="doi">10.6084/m9.figshare.21603024.v1</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report159524">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.133935.r159524</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Vindas</surname>
                        <given-names>Marco</given-names>
                    </name>
                    <xref ref-type="aff" rid="r159524a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-3996-0952</uri>
                </contrib>
                <aff id="r159524a1">
                    <label>1</label>Department of Preclinical Sciences and Pathology, Faculty of Veterinary Medicine, Norwegian University of Life Sciences, &#x00c5;s, Norway</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>16</day>
                <month>2</month>
                <year>2023</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2023 Vindas M</copyright-statement>
                <copyright-year>2023</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport159524" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.122004.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>The paper by Tilley
                <italic> et al. </italic>is very good and builds on previous findings from the consortium that are replicated and corroborated in this work. In addition, the authors show some novel findings as well. In general, this manuscript is well written and clear. I have some minor comments and suggestions.</p>
            <p> </p>
            <p> 
                <bold>Research highlights</bold> 
                <list list-type="order">
                    <list-item>
                        <p>Using skin swabs instead of fin clipping is already a great benefit, but I don&#x2019;t understand why it would be possible to use fewer animals? Wouldn&#x2019;t the input for DNA collection be the same if one was using one or the other technique?</p>
                    </list-item>
                    <list-item>
                        <p>How speculative is the possibility of using this technique for the analysis of small metabolites?</p>
                    </list-item>
                </list> 
                <bold>Introduction</bold> 
                <list list-type="order">
                    <list-item>
                        <p>The authors refer to their findings towards the end of the introduction regarding lidocaine affecting fish for significant periods of time, but it is bit vague here. Could it be possible to just add a brief explanation of what they mean, for example that gene expression markers associated with their stress response are altered?</p>
                    </list-item>
                </list> 
                <bold>Methods</bold> 
                <list list-type="order">
                    <list-item>
                        <p>Please include age and sex of the fish is missing for all groups of fish used in the experiments.</p>
                    </list-item>
                    <list-item>
                        <p>
                            <italic>Gene expression analysis:</italic> which tissue was used in the analysis of gene expression trends?</p>
                    </list-item>
                    <list-item>
                        <p>
                            <italic>Primer design</italic>: it appears as the authors designed some of the primers used in this study themselves. Did they also sequenced the finished product to make sure that they are obtaining results on the correct gene?</p>
                    </list-item>
                    <list-item>
                        <p>
                            <italic>Statistical analysis</italic>: why use two different statistical software? In general the R statistical program is more robust than others (such as prism) since one can include multiple parameters into the statistical model and therefore obtain a better explanation of the variation in the analyzed parameters. In addition, in terms of consistency, it would be better to only use one of them. Why were the FBI values not statistically analyzed? &#x00a0;</p>
                    </list-item>
                </list> 
                <bold>Results and discussion</bold> 
                <list list-type="order">
                    <list-item>
                        <p>The authors mention that fin clipped fish treated with lidocaine did not show a decrease in the FBI score similar to that shown by fin clipped fish with no lidocaine, which is great. However, they also write that the FBI score were not normalized after 6 h and therefore lidocaine might only be a short-term analgesic for this procedure. This is an important finding, but I struggle to see this in the data provided. There are no standard deviation bars or median values in figure 1B and no stats showing if there is a difference between pre and 6 h on the lidocaine fin clipped group and therefore hard to assess the aforementioned statement. Can the authors provide some more information here and better yet conduct a statistical analysis on the FBI data, which includes comparisons between treatment groups and timepoints?</p>
                    </list-item>
                    <list-item>
                        <p>Since the authors present the behavioral FBI data first, it would make more sense to change figure 1 so that 1A shows the FBI data and 1B cortisol.</p>
                    </list-item>
                    <list-item>
                        <p>The gene expression data is very interesting, but it may be hard for the reader to understand what changes in these genes mean. Would it be possible to include a short explanation of what these genes are associated with and what it might mean that this is up or down regulated? For example, brain derived neurotropic factor is a marker for brain plasticity, it shows an increase to acute stress and a decrease to chronic stress. Overall low levels of bdnf are associated with bad welfare (i.e. decreased brain health).</p>
                    </list-item>
                    <list-item>
                        <p>Even though its hard to compare the data across experiments, since they are conducted in different ways. Would it be possible for the authors to speculate on what the changes in gene expression means, when taking into consideration the cortisol and behavioral results from the first experiment?</p>
                    </list-item>
                </list> 
                <bold>Figures</bold> 
                <list list-type="order">
                    <list-item>
                        <p>In order to make the data easier to understand. Can the authors illustrate the different treatments with different symbols in Fig 1B? It would also be good to include statistics within the figure so as to make it easier to assess differences between the groups (both treatments and time points).</p>
                    </list-item>
                    <list-item>
                        <p>It would be a bit more practical if the authors included a box within Figure 2 showing what C, SS and FC mean, this way one could just look at the figure without having to consult the text first. It would also be nice if the authors could include an illustration for the stats so as to show which groups are significantly different from each other (such as small letters), since this is not very clear if one just looks at the figures as they are. &#x00a0;</p>
                    </list-item>
                    <list-item>
                        <p>For consistency, can the authors illustrate Fig 1A and the gene expression figs the same way?</p>
                    </list-item>
                </list>
            </p>
            <p>Are the 3Rs implications of the work described accurately?</p>
            <p>Yes</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Partly</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are a suitable application and appropriate end-users identified?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Behavioral neurobiology of fish (molecular biology, histology, behavior, stress and welfare)</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report159522">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.133935.r159522</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Ledin</surname>
                        <given-names>Johan</given-names>
                    </name>
                    <xref ref-type="aff" rid="r159522a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r159522a1">
                    <label>1</label>Department of Organismal Biology, Uppsala University, Uppsala, Sweden</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>2</day>
                <month>2</month>
                <year>2023</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2023 Ledin J</copyright-statement>
                <copyright-year>2023</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport159522" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.122004.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>The article &#x201d;Validating skin swabbing as a refined technique to collect DNA from small-bodied fish species" is an article that evaluate techniques for tissue sampling of zebrafish and stickleback. Although fin clip surgery is relatively mild, the sheer number of interventions done world-wide for genotyping purposes makes this study important. This article compares fin clipping with skin swabbing &#x2013; with and without the analgesic lidocaine. A major strength of the study is the combination of readouts, following each procedure, for behavior, cortisol and expression of stress genes which gives a rigid foundation for conclusions. The results suggest that skin swabbing is a true refinement compared to fin clip.</p>
            <p> </p>
            <p> What I would have liked, since the results are relevant for zebrafish researchers from all disciplines, is some further discussion on how big of a refinement this may be for the fish? Can the refinement be put in context with suffering of other procedures?</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Yes</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Developmental biology</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
</article>
