<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="other" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.131637.1</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Genome Note</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>The complete genome sequences of 
                    <italic>Penicillium concavorugulosum</italic>
                </article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 1; peer review: 1 not approved]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Ramachela</surname>
                        <given-names>Khosi</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-4295-9696</uri>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Segone</surname>
                        <given-names>Galaletsang</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Food Security and Safety Niche Area, Northwest University, Mmabatho, South Africa</aff>
                <aff id="a2">
                    <label>2</label>Northwest University, Mmabatho, South Africa</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:Khosi.ramachela@nwu.ac.za">Khosi.ramachela@nwu.ac.za</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>23</day>
                <month>3</month>
                <year>2023</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2023</year>
            </pub-date>
            <volume>12</volume>
            <elocation-id>321</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>10</day>
                    <month>3</month>
                    <year>2023</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2023 Ramachela K and Segone G</copyright-statement>
                <copyright-year>2023</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/12-321/pdf"/>
            <abstract>
                <p>The fungal genus 
                    <italic toggle="yes">Penicillium</italic> and many other soil-borne fungi have widely been reported to create soil myco-rhizhospheric conditions that influence plant growth. These fungal species are relatively difficult to differentiate to species level. Of the three 
                    <italic toggle="yes">Penicillium</italic> species that were morphologically identified, one isolate was established to have a bio-suppressive effect on 
                    <italic toggle="yes">Fusarium oxysporum.</italic> Molecular identification using the polymerase chain reaction (PCR) technique was carried out to accurately identify this isolate to species level. The BLAST consensus and alignments of related species was carried out. The species was identified as 
                    <italic toggle="yes">Penicillium concavorugulosum</italic> (
                    <ext-link ext-link-type="uri" xlink:href="https://informaplc.sharepoint.com/teams/F1000Editorialarchive/Shared%20Documents/F1000Research%20articles/1-0%20Active%20papers/131637%20-%20Khosi%20Ramachela/Initial/author_files_144498/131637-V1-1-Genome_note_P._concavorugulosum-15-02-2023.docx?web=1">NCBI</ext-link> accession number MK841454.1).</p>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>Genome</kwd>
                <kwd>assembly</kwd>
                <kwd>Penicillium concavorugulosum</kwd>
                <kwd>Polymerase chain reaction (PCR)</kwd>
            </kwd-group>
            <funding-group>
                <funding-statement>The author(s) declared that no grants were involved in supporting this work.</funding-statement>
            </funding-group>
        </article-meta>
    </front>
    <body>
        <sec id="sec1" sec-type="intro">
            <title>Introduction</title>
            <p>
                <italic toggle="yes">Penicillium</italic> species are a widespread group of facultative fungi which are found in various habitats such as soil, air and decaying plant matter (
                <xref ref-type="bibr" rid="ref4">Pitt and Hocking, 2009</xref>; 
                <xref ref-type="bibr" rid="ref9">Visagie 
                    <italic toggle="yes">et al</italic>., 2005</xref>). Various studies have reported the genus to contain several species which play different roles in agriculture and human health. For example, species such as 
                <italic toggle="yes">Penicillium cyclopium</italic> and 
                <italic toggle="yes">Penicillium citrinum</italic> have been reported to be contaminants in corn, soybean, and dried beans (
                <xref ref-type="bibr" rid="ref3">Munkvold 
                    <italic toggle="yes">et al</italic>., 2019</xref>). Whereas 
                <italic toggle="yes">Penicillium expansum</italic> and many other 
                <italic toggle="yes">Penicillium</italic> species have been reported to cause post-harvest losses in pome fruits and apples (
                <xref ref-type="bibr" rid="ref4">Pitt and Hocking, 2009</xref>; 
                <xref ref-type="bibr" rid="ref11">Wu 
                    <italic toggle="yes">et al</italic>., 2019</xref>).</p>
            <p>Many 
                <italic toggle="yes">Penicillium</italic> species produce extracellular enzymes such as cellulolytic enzymes, polysaccharases and pectic enzymes that aid in the breakdown of organic materials and use in antibiotic production, cell degeneration, as well as food production (
                <xref ref-type="bibr" rid="ref12">Yoon 
                    <italic toggle="yes">et al</italic>., 2007</xref>; 
                <xref ref-type="bibr" rid="ref5">Rabha and Jha, 2018</xref>). Production of these enzymes and phytohormones by 
                <italic toggle="yes">Penicillium</italic> fungal species that influence plant physiological processes was also reported by (
                <xref ref-type="bibr" rid="ref1">Chanclud and Morel, 2016</xref>). 
                <xref ref-type="bibr" rid="ref8">Tiwari 
                    <italic toggle="yes">et al</italic>. (2011)</xref> also highlighted 
                <italic toggle="yes">Penicillium</italic> species as some of many fungal microorganisms that possess multifunctional properties that enable them to be used in various agro-industries, biological, medicinal, and commercial purposes.</p>
            <p>This potential widespread use of different fungal species, including 
                <italic toggle="yes">Penicillium</italic> species, require accurate identification. The need for accurate identification of various important micro-organisms has led to the development and utilization of molecular identification techniques. This technology uses polymerase chain reaction (PCR). Fungal microorganisms are mostly analyzed using the PCR method to determine the ITS region for accurate differentiation of species amongst the genus (
                <xref ref-type="bibr" rid="ref2">Johnston, 2011</xref>).</p>
            <p>One of the three 
                <italic toggle="yes">Penicillium</italic> fungal species was established to possess multifunctional properties such as antibiosis, competition and myco-parasitism, and therefore was considered valuable for use as a bio-control agent against soil fungal pathogens (
                <xref ref-type="bibr" rid="ref7">Segone, 2021</xref>). Furthermore, complete genome sequences for this 
                <italic toggle="yes">Penicillium</italic> fungal species would also contribute to taxonomic studies, and evolution processes as well as understanding its various inherent antagonistic properties.</p>
        </sec>
        <sec id="sec2" sec-type="methods">
            <title>Methods</title>
            <p>Four 
                <italic toggle="yes">Penicillium</italic> species were isolated by use of soil serial dilution procedure. Soil was collected from different sites at the North-West University Mafikeng agricultural farm (25.8278&#x00b0; S, 25.6079&#x00b0; E). These sites had previously been subjected to different agronomic practices such as minimum soil tillage, weed control, fertilizer management and controlled irrigation.</p>
            <p>DNA was extracted from the isolate mycelium by use of the Quick-DNA fungal/bacterial Miniprep Kit (Zymo Research, Catalogue No. D6005) (
                <xref ref-type="bibr" rid="ref10">White 
                    <italic toggle="yes">et al.</italic>, 1990</xref>).</p>
            <p>Amplification of the target genes was carried out by use of OneTaq Quick load 2&#x00d7;Master Mix (NEB, Catalogue No. M0486) with primers presented in 
                <xref ref-type="table" rid="T1">Table 1</xref>. Each Eppendorf tube comprised 10&#x03bc;L of NEB OneTaq 2X MasterMix with Standard Buffer (Catalogue No. M0482S), 1&#x03bc;L of genomic DNA (10-30ng/&#x03bc;L), 1&#x03bc;L forward primer (10&#x03bc;M), 1&#x03bc;L reverse primer (10&#x03bc;M), and 7&#x03bc;L nuclease-free water (Catalogue No. E476). Amplification cycles had an initial denaturation at 94&#x00b0;C for 10 minutes, 35 cycles of denaturation at 94&#x00b0;C for 30 seconds, annealing at 50&#x00b0;C, elongation at 68&#x00b0;C for 1 minute and final elongation at 72&#x00b0;C for 10 minutes. The PCR amplicons were stored at 4&#x00b0;C until electrophoresis.</p>
            <table-wrap id="T1" orientation="portrait" position="float">
                <label>Table 1. </label>
                <caption>
                    <title>Internal transcribed spacer primer sequences that were used for amplification of the ITS regions.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="left" colspan="1" rowspan="1" valign="top">Name of primer</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Target</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Sequence (5&#x2019; to 3&#x2019;)</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Cycling conditions</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">ITS 1</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Small Sub-unit</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">TCCGTAGGTGAACCTTGCGG</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <inline-formula>
                                    <mml:math display="inline">
                                        <mml:mfenced close="}" open="">
                                            <mml:mtable>
                                                <mml:mtr>
                                                    <mml:mtd>
                                                        <mml:maligngroup/>
                                                        <mml:mn>94</mml:mn>
                                                        <mml:mo>&#x00b0;</mml:mo>
                                                        <mml:mi mathvariant="normal">C</mml:mi>
                                                        <mml:mspace width="0.25em"/>
                                                        <mml:mtext>for</mml:mtext>
                                                        <mml:mspace width="0.25em"/>
                                                        <mml:mn>30</mml:mn>
                                                        <mml:mspace width="0.25em"/>
                                                        <mml:mo>sec</mml:mo>
                                                    </mml:mtd>
                                                </mml:mtr>
                                                <mml:mtr>
                                                    <mml:mtd>
                                                        <mml:maligngroup/>
                                                        <mml:mn>50</mml:mn>
                                                        <mml:mo>&#x00b0;</mml:mo>
                                                        <mml:mi mathvariant="normal">C</mml:mi>
                                                        <mml:mspace width="0.25em"/>
                                                        <mml:mtext>for</mml:mtext>
                                                        <mml:mspace width="0.25em"/>
                                                        <mml:mo>sec</mml:mo>
                                                    </mml:mtd>
                                                </mml:mtr>
                                            </mml:mtable>
                                        </mml:mfenced>
                                        <mml:mn>35</mml:mn>
                                        <mml:mspace width="0.25em"/>
                                        <mml:mtext mathvariant="italic">cycles</mml:mtext>
                                    </mml:math>
                                </inline-formula>
                            </td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">ITS 4</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Large Sub-unit</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">TCCTCCGCTTATTGATATGC</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <inline-formula>
                                    <mml:math display="inline">
                                        <mml:mfenced close="}" open="">
                                            <mml:mtable>
                                                <mml:mtr>
                                                    <mml:mtd>
                                                        <mml:maligngroup/>
                                                        <mml:mn>68</mml:mn>
                                                        <mml:mo>&#x00b0;</mml:mo>
                                                        <mml:mi mathvariant="normal">C</mml:mi>
                                                        <mml:mspace width="0.25em"/>
                                                        <mml:mtext>for</mml:mtext>
                                                        <mml:mspace width="0.25em"/>
                                                        <mml:mn>1</mml:mn>
                                                        <mml:mspace width="0.25em"/>
                                                        <mml:mtext>min</mml:mtext>
                                                    </mml:mtd>
                                                </mml:mtr>
                                                <mml:mtr>
                                                    <mml:mtd>
                                                        <mml:maligngroup/>
                                                        <mml:mn>68</mml:mn>
                                                        <mml:mo>&#x00b0;</mml:mo>
                                                        <mml:mi mathvariant="normal">C</mml:mi>
                                                        <mml:mspace width="0.25em"/>
                                                        <mml:mtext>for</mml:mtext>
                                                        <mml:mspace width="0.25em"/>
                                                        <mml:mn>10</mml:mn>
                                                        <mml:mspace width="0.25em"/>
                                                        <mml:mtext>min</mml:mtext>
                                                    </mml:mtd>
                                                </mml:mtr>
                                            </mml:mtable>
                                        </mml:mfenced>
                                        <mml:mn>35</mml:mn>
                                        <mml:mspace width="0.25em"/>
                                        <mml:mtext mathvariant="italic">cycles</mml:mtext>
                                    </mml:math>
                                </inline-formula>
                            </td>
                        </tr>
                    </tbody>
                </table>
            </table-wrap>
            <sec id="sec3">
                <title>Agarose gel analysis</title>
                <p>The integrity of the PCR amplicons was established by using a 1% agarose gel (CSL-AG500, Cleaver Scientific Ltd) in which EZ-vision Bluelight DNA Dye was used as a stainer. The extracted fragments were sequenced in the forward and reverse direction (Nimagen, BrilliantDyeTM Terminator Cycle Sequencing Kit v3.1, BRD3-100/1000). These were purified by use of Zymo Research, ZR-96 DNA Sequencing clean-up KitTM, (Catalogue No. D4050). The purified fragments were analysed on the ABI 3500xl Genetic analyser (Applied Biosystems, ThermoFisher Scientific). This was done for each reaction and every sample. CLC Bio Main Workbench v7.6 was used to analyse the ab1 files generated by the ABI 3500xl Genetic analyser and the results were obtained by conducting a BLAST search (NCBI) (
                    <xref ref-type="bibr" rid="ref13">Stephen 
                        <italic toggle="yes">et al.,</italic> 1997</xref>).</p>
            </sec>
        </sec>
        <sec id="sec4" sec-type="results">
            <title>Results</title>
            <p>The genome assembly for the test 
                <italic toggle="yes">Penicillium</italic> fungal species yielded a total sequence length of 570 with an N50 value of 796.6 bits (882), Expect = 0E00, Identities = 441/441 (100%), Gaps = 0/441 (0%).</p>
            <p>This 
                <italic toggle="yes">Penicillium</italic> fungal isolate was identified as 
                <italic toggle="yes">Penicillium concavorugulosum</italic> (Accession: MK 841454.1).</p>
        </sec>
    </body>
    <back>
        <sec id="sec7" sec-type="data-availability">
            <title>Data availability</title>
            <sec id="sec8">
                <title>Underlying data</title>
                <p>NCBI GenBank: Penicillium concavorugulosum voucher NWUSeq42 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence. Accession number: MK841454.1; 
                    <ext-link ext-link-type="uri" xlink:href="https://identifiers.org/ncbiprotein:MK841454.1">https://identifiers.org/ncbiprotein:MK841454.1</ext-link> (
                    <xref ref-type="bibr" rid="ref6">Ramachela and Segone, 2023</xref>)</p>
            </sec>
        </sec>
        <ack>
            <title>Acknowledgements</title>
            <p>The authors would like to thank Northwest University Food Security and Safety Niche Research Entity for funding the Research and Inqaba Biotechnical Industries molecular analysis and sequencing. Part of this work has been published as an MSc. Dissertation by the co-author Miss Galaletsang Segone.</p>
        </ack>
        <ref-list>
            <title>References</title>
            <ref id="ref1">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Chanclud</surname>
                            <given-names>E</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Morel</surname>
                            <given-names>JB</given-names>
                        </name>
</person-group>:
                    <article-title>Plant hormones: a fungal point of view.</article-title>
                    <source>

                        <italic toggle="yes">Mol. Plant Pathol.</italic>
</source>
                    <year>2016</year>;<volume>17</volume>(<issue>8</issue>):<fpage>1289</fpage>&#x2013;<lpage>1297</lpage>.
                    <pub-id pub-id-type="pmid">26950404</pub-id>
                    <pub-id pub-id-type="doi">10.1111/mpp.12393</pub-id>
                    <pub-id pub-id-type="pmcid">PMC6638337</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref2">
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Johnston</surname>
                            <given-names>CL</given-names>
                        </name>
</person-group>:
                    <article-title>Identification of Penicillium species in the South African litchi export chain (Doctoral dissertation, University of Pretoria).</article-title>
                    <year>2011</year>.</mixed-citation>
            </ref>
            <ref id="ref3">
                <mixed-citation publication-type="book">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Munkvold</surname>
                            <given-names>GP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Arias</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Taschl</surname>
                            <given-names>I</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <chapter-title>Mycotoxins in corn: Occurrence, impacts, and management.</chapter-title>
                    <source>

                        <italic toggle="yes">Corn.</italic>
</source>
                    <publisher-name>AACC International Press</publisher-name>;<year>2019</year>; (pp.<fpage>235</fpage>&#x2013;<lpage>287</lpage>).</mixed-citation>
            </ref>
            <ref id="ref4">
                <mixed-citation publication-type="book">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Pitt</surname>
                            <given-names>JI</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hocking</surname>
                            <given-names>AD</given-names>
                        </name>
</person-group>:
                    <chapter-title>Primary keys and miscellaneous fungi.</chapter-title>
                    <source>

                        <italic toggle="yes">Fungi and food spoilage.</italic>
</source>
                    <publisher-name>Springer</publisher-name>;<year>2009</year>.</mixed-citation>
            </ref>
            <ref id="ref5">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Rabha</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jha</surname>
                            <given-names>DK</given-names>
                        </name>
</person-group>:
                    <article-title>Metabolic diversity of penicillium.</article-title>
                    <source>

                        <italic toggle="yes">New and Future Developments in Microbial Biotechnology and Bioengineering.</italic>
</source>
                    <year>2018</year>;<fpage>217</fpage>&#x2013;<lpage>234</lpage>.
                    <pub-id pub-id-type="doi">10.1016/B978-0-444-63501-3.00012-0</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref6">
                <mixed-citation publication-type="data">
                    <collab>Ramachela and Segone</collab>:
                    <data-title>Penicillium concavorugulosum voucher NWUSeq42 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence</data-title>. [Data set].
                    <source>

                        <italic toggle="yes">GenBank.</italic>
</source>
                    <year>2023</year>. Accession number: MK841454.1</mixed-citation>
            </ref>
            <ref id="ref7">
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Segone</surname>
                            <given-names>GP</given-names>
                        </name>
</person-group>:
                    <article-title>Analysis of efficacy of different Penicillium fungal species as bio-control agents against Fusarium oxysporum (Doctoral dissertation, North-West University (South Africa)).</article-title>
                    <year>2021</year>.</mixed-citation>
            </ref>
            <ref id="ref13">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Stephen</surname>
                            <given-names>FA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Thomas</surname>
                            <given-names>LM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Alejandro</surname>
                            <given-names>AS</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.</article-title>
                    <source>

                        <italic toggle="yes"> Nucleic Acids Res.</italic>
</source>
                    <year>1997</year>;<volume>25</volume>(<issue>17</issue>):<fpage>3389</fpage>&#x2013;<lpage>3402</lpage>.
                    <pub-id pub-id-type="pmid"> 9254694</pub-id>
                    <pub-id pub-id-type="doi">10.1093/nar/25.17.3389</pub-id>
                    <pub-id pub-id-type="pmcid">PMC146917</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref8">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Tiwari</surname>
                            <given-names>KL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jadhav</surname>
                            <given-names>SK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kumar</surname>
                            <given-names>A</given-names>
                        </name>
</person-group>:
                    <article-title>Morphological and molecular study of different Penicillium species.</article-title>
                    <source>

                        <italic toggle="yes">Middle-East J. Sci. Res.</italic>
</source>
                    <year>2011</year>;<volume>7</volume>(<issue>1</issue>):<fpage>203</fpage>&#x2013;<lpage>210</lpage>.</mixed-citation>
            </ref>
            <ref id="ref9">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Visagie</surname>
                            <given-names>CM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Houbraken</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Frisvad</surname>
                            <given-names>JC</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Identification and nomenclature of the genus Penicillium.</article-title>
                    <source>

                        <italic toggle="yes">Stud. Mycol.</italic>
</source>
                    <year>2005</year>;<volume>53</volume>(<issue>1</issue>):<fpage>53</fpage>&#x2013;<lpage>62</lpage>.</mixed-citation>
            </ref>
            <ref id="ref10">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>White</surname>
                            <given-names>TJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bruns</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lee</surname>
                            <given-names>SJWT</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics.</article-title>
                    <source>

                        <italic toggle="yes">PCR protocols: a guide to methods and applications.</italic>
</source>
                    <year>1990</year>;<volume>18</volume>(<issue>1</issue>):<fpage>315</fpage>&#x2013;<lpage>322</lpage>.
                    <pub-id pub-id-type="doi">10.1016/B978-0-12-372180-8.50042-1</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref11">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Wu</surname>
                            <given-names>G</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jurick</surname>
                            <given-names>WM</given-names>
                            <suffix>II</suffix>
                        </name>

                        <name name-style="western">
                            <surname>Lichtner</surname>
                            <given-names>FJ</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Whole-genome comparisons of Penicillium spp. reveals secondary metabolic gene clusters and candidate genes associated with fungal aggressiveness during apple fruit decay.</article-title>
                    <source>

                        <italic toggle="yes">PeerJ.</italic>
</source>
                    <year>2019</year>;<volume>7</volume>:<fpage>e6170</fpage>.
                    <pub-id pub-id-type="pmid">30643697</pub-id>
                    <pub-id pub-id-type="doi">10.7717/peerj.6170</pub-id>
                    <pub-id pub-id-type="pmcid">PMC6330040</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref12">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Yoon</surname>
                            <given-names>JH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hong</surname>
                            <given-names>SB</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ko</surname>
                            <given-names>SJ</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Detection of extracellular enzyme activity in Penicillium using chromogenic media.</article-title>
                    <source>

                        <italic toggle="yes">Mycobiology.</italic>
</source>
                    <year>2007</year>;<volume>35</volume>(<issue>3</issue>):<fpage>166</fpage>&#x2013;<lpage>169</lpage>.
                    <pub-id pub-id-type="pmid">24015091</pub-id>
                    <pub-id pub-id-type="doi">10.4489/MYCO.2007.35.3.166</pub-id>
                    <pub-id pub-id-type="pmcid">PMC3763148</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report167524">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.144498.r167524</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Adegoke</surname>
                        <given-names>Anthony A.</given-names>
                    </name>
                    <xref ref-type="aff" rid="r167524a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-2970-2140</uri>
                </contrib>
                <aff id="r167524a1">
                    <label>1</label>Department of Microbiology, Faculty of Science, University of Uyo, Uyo, Akwa Ibom, Nigeria</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>26</day>
                <month>4</month>
                <year>2023</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2023 Adegoke AA</copyright-statement>
                <copyright-year>2023</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport167524" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.131637.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>reject</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>The manuscript was poorly presented. All that could be deducted from the manuscript was that amplicon-based sequencing was done. It was not clearly presented. It looked like Sanger sequencing which of course contradicts the title of the manuscript (complete sequencing). Only PCR and gel electrophoresis were stated but for the mention of genetic analyzer.&#x00a0;</p>
            <p> </p>
            <p> The bioinformatic analysis of the sequenced data was not clearly enumerated.</p>
            <p>Are the datasets clearly presented in a usable and accessible format, and the assembly and annotation available in an appropriate subject-specific repository?</p>
            <p>No</p>
            <p>Are sufficient details of the sequencing and extraction, software used, and materials provided to allow replication by others?</p>
            <p>No</p>
            <p>Are the rationale for sequencing the genome and the species significance clearly described?</p>
            <p>Yes</p>
            <p>Are the protocols appropriate and is the work technically sound?</p>
            <p>No</p>
            <p>Reviewer Expertise:</p>
            <p>Medical/Molecular and Public Health Microbiology</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.</p>
        </body>
    </sub-article>
</article>
