<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.156321.1</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>Unleashing the cardioprotective potential of Ezetimibe against Doxorubicin-induced cardiotoxicity in Wistar rats: Targeting oxidative stress and NF-&#x03ba;B-mediated inflammation</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 1; peer review: 1 approved with reservations]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Sabry</surname>
                        <given-names>Aya Thaer</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Software</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <uri content-type="orcid">https://orcid.org/0009-0006-6493-316X</uri>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>AL-Zobaidy</surname>
                        <given-names>Mohammed AH Jabarah</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Department of Pharmacology and Toxicology, College of Pharmacy, University of Baghdad, Baghdad, Iraq</aff>
                <aff id="a2">
                    <label>2</label>Department of Pharmacology, College of Medicine, University of Baghdad, Baghdad, Iraq</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:aya.thaer2206m@comed.uobaghdad.edu.iq">aya.thaer2206m@comed.uobaghdad.edu.iq</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>11</day>
                <month>10</month>
                <year>2024</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2024</year>
            </pub-date>
            <volume>13</volume>
            <elocation-id>1210</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>4</day>
                    <month>10</month>
                    <year>2024</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2024 Sabry AT and AL-Zobaidy MAJ</copyright-statement>
                <copyright-year>2024</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/13-1210/pdf"/>
            <abstract>
                <sec>
                    <title>Background</title>
                    <p>Doxorubicin (DOX) is a potent antineoplastic agent used in treating various adult and pediatric cancers, but it tends to provoke dose-dependent cardiotoxicity. Ezetimibe (EZE), a cholesterol-lowering drug, has been reported to possess defensive actions against oxidative stress and inflammation, which are two of the main proposed mechanisms underlying the development of DOX-induced cardiotoxicity (DIC), hence, we aimed to inspect the possible protective effect of EZE against DIC in rats.</p>
                </sec>
                <sec>
                    <title>Methods</title>
                    <p>24 adult male Wistar rats were allocated into four groups of six: control, DOX, 10 mg/kg EZE plus DOX and 20 mg/kg EZE plus DOX. At the end of the study, the experimental rats were anesthetized and blood samples were collected for biochemical analysis, after which the hearts were excised and heart tissue samples were obtained for biochemical and gene expression analyses.</p>
                </sec>
                <sec>
                    <title>Results</title>
                    <p>Pretreatment with EZE at a dose of 10 or 20 mg/kg alleviated cardiac damage induced by DOX, as EZE blunted the rise in serum levels of cardiac injury biomarkers, including cardiac troponin I (cTnI) and N-terminal pro-B-type natriuretic peptide (NT-proBNP). Additionally, pretreating rats with EZE at either dose mitigated DOX-induced oxidative stress by elevating the levels of the antioxidant enzymes superoxide dismutase (SOD) and glutathione peroxidase (GPx), with consequent reduction in the lipid peroxidation biomarker malondialdehyde (MDA) in cardiac tissues. Furthermore, pretreatment with either dose of EZE hindered DOX-mediated inflammation, where EZE suppressed cardiac nuclear factor-kappa B (NF-&#x03ba;B) signaling and negatively regulated the gene expression of its downstream proinflammatory cytokines, including tumor necrosis factor-alpha (TNF-&#x03b1;) with either dose and interleukin-1 beta (IL-1&#x03b2;) with the higher one.</p>
                </sec>
                <sec>
                    <title>Conclusions</title>
                    <p>Our findings indicate that EZE exhibited cardioprotection against DIC in rats, which makes EZE an interesting area for further investigations, animal- and human-wise, that can pave the way for a potential clinical application in preventing DIC in the future.</p>
                </sec>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>Cardiotoxicity</kwd>
                <kwd>Doxorubicin</kwd>
                <kwd>Ezetimibe</kwd>
                <kwd>inflammation</kwd>
                <kwd>oxidative stress</kwd>
            </kwd-group>
            <funding-group>
                <funding-statement>The author(s) declared that no grants were involved in supporting this work.</funding-statement>
            </funding-group>
        </article-meta>
    </front>
    <body>
        <sec id="sec5" sec-type="intro">
            <title>Introduction</title>
            <p>Cancer is a prevalent systemic disease characterized by uncontrolled cell proliferation and distant invasion, resulting in multiple organ damage, and ultimately, leading to a high rate of morbidity and mortality worldwide.
                <sup>
                    <xref ref-type="bibr" rid="ref1">1</xref>,
                    <xref ref-type="bibr" rid="ref2">2</xref>
                </sup>
            </p>
            <p>One of the most important anticancer drugs in clinical practice is doxorubicin (DOX), also known as adriamycin, which belongs to the family of anthracycline antibiotics.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>
                </sup> Since its approval, DOX has been utilized in treating different types of cancer, including solid tumors, like breast, ovarian, testicular, thyroid, lung, liver, stomach and bladder cancers, as well as soft tissue sarcomas. Moreover, the drug has been employed in the treatment of hematologic malignancies, such as multiple myeloma, acute lymphoblastic leukemia, Hodgkin&#x2019;s and non-Hodgkin&#x2019;s lymphomas, in addition to certain childhood cancers, including neuroblastoma, osteosarcoma, Ewing&#x2019;s sarcoma and rhabdomyosarcoma.
                <sup>
                    <xref ref-type="bibr" rid="ref1">1</xref>,
                    <xref ref-type="bibr" rid="ref4">4</xref>
                </sup>
            </p>
            <p>Unfortunately, despite its broad antitumor spectrum, the clinical application of DOX is often limited by its irreversible and dose-dependent cardiotoxicity, which can result in left ventricular dysfunction (LVD) and heart failure (HF).
                <sup>
                    <xref ref-type="bibr" rid="ref5">5</xref>,
                    <xref ref-type="bibr" rid="ref6">6</xref>
                </sup> On top of that, it has been estimated that the risk of LVD is approximately 7&#x2013;26% when the cumulative dose of DOX reaches 550 mg/m
                <sup>2</sup>, and about 18&#x2013;48% at a cumulative dose of 700 mg/m
                <sup>2</sup>.
                <sup>
                    <xref ref-type="bibr" rid="ref7">7</xref>
                </sup>
            </p>
            <p>Cardiotoxicity that is induced by DOX seems to be a multifactorial and complex process, and there has been a long list of proposed mechanisms in this regard,
                <sup>
                    <xref ref-type="bibr" rid="ref8">8</xref>
                </sup> one of which is the ability of DOX to generate excessive reactive oxygen species (ROS) and reactive nitrogen species (RNS) to the point that they would overpower the antioxidant defense system, causing disruption of cellular hemostasis and activation of the inflammatory response pathways, eventually leading to cell death,
                <sup>
                    <xref ref-type="bibr" rid="ref9">9</xref>,
                    <xref ref-type="bibr" rid="ref10">10</xref>
                </sup> and from this point of view, developing a strategy that can hinder the development of the aforementioned events would be a possible approach to alleviate DOX-induced cardiotoxicity (DIC).</p>
            <p>Ezetimibe (EZE) is a cholesterol-lowering drug that inhibits the absorption of dietary and biliary cholesterol from the small intestine by blocking the Niemann-Pick C1-Like protein (NPC1L1), which is a sterol transporter found on the brush border membrane of the intestinal epithelium.
                <sup>
                    <xref ref-type="bibr" rid="ref11">11</xref>
                </sup>
            </p>
            <p>Apart from its beneficial impact on lipid profile, EZE has been shown to have pleiotropic properties, including antioxidant and anti-inflammatory effects that are independent of its ability to inhibit NPC1L1.
                <sup>
                    <xref ref-type="bibr" rid="ref11">11</xref>,
                    <xref ref-type="bibr" rid="ref12">12</xref>
                </sup> Therefore, the current study was conducted to assess the hypothesis that EZE can provide protection against DIC in rats, which to our knowledge, has not been studied yet, and to elucidate the mechanisms underlying EZE&#x2019;s possible cardioprotective effect.</p>
        </sec>
        <sec id="sec6" sec-type="methods">
            <title>Methods</title>
            <sec id="sec7">
                <title>Ethical considerations</title>
                <p>The current study followed the Animal Research: Reporting of 
                    <italic toggle="yes">In Vivo</italic> Experiments (ARRIVE) guidelines,
                    <sup>
                        <xref ref-type="bibr" rid="ref13">13</xref>
                    </sup> and was commenced after receiving approval from the Research Ethics Committee of the College of Medicine, University of Baghdad (approval date: December 31, 2023; approval number: 03-31).</p>
            </sec>
            <sec id="sec8">
                <title>Animals</title>
                <p>A total of 24 adult male Wistar rats, weighing 200&#x2013;250 g each, were included in the present study. The animals were acquired from and maintained in the animal house of the Iraqi Center for Cancer Research and Medical Genetics under conditions of controlled temperature and relative humidity, as well as alternating 12-hour intervals of light and darkness. In addition, rats were supplied with commercial pellets and had free access to 
                    <italic toggle="yes">ad libitum</italic> water throughout the experiment, and were acclimatized for one week ahead of the study.</p>
                <p>All efforts were made to ameliorate suffering of the experimental rats, including proper ventilation of the animal house, cleaning the animal cages every other day, careful handling of the animals throughout the experiment, use of effective anesthetic dose and animal euthanasia was carried out far away from the alive ones.</p>
            </sec>
            <sec id="sec9">
                <title>Experimental design</title>
                <p>Rats included in the present study were randomly allocated into four groups of six and treated as follows:</p>
                <p>Group I (control): rats received corn oil via oral gavage for 14 consecutive days.</p>
                <p>Group II (DOX): rats received corn oil via oral gavage for 14 consecutive days, and a single intraperitoneal (IP) injection of 15 mg/kg DOX hydrochloride (Pfizer, Australia) on the 12
                    <sup>th</sup> day of the experiment.</p>
                <p>Group III (10 mg/kg EZE + DOX): rats received 10 mg/kg EZE (Meryer, China) dissolved in corn oil via oral gavage for 14 consecutive days, and a single IP injection of 15 mg/kg DOX hydrochloride on the 12
                    <sup>th</sup> day of the experiment.</p>
                <p>Group IV (20 mg/kg EZE + DOX): rats received 20 mg/kg EZE dissolved in corn oil via oral gavage for 14 consecutive days, and a single IP injection of 15 mg/kg DOX hydrochloride on the 12
                    <sup>th</sup> day of the experiment.</p>
                <p>After 24 hours from final administration, the experimental rats were anesthetized using a combination of 150 mg/kg ketamine (Bremer Pharma GmbH, Germany) and 10 mg/kg lidocaine hydrochloride (GF Bonn GmbH, Germany). Then, for each rat, an abdominal incision was made and the inferior vena cava was exposed in order to collect a blood sample for biochemical analysis, after which the heart was excised, washed with cold phosphate-buffered saline (Sigma, USA) to get rid of any residual blood and bloated on filter paper. Following that, heart tissue samples were obtained for biochemical and gene expression analyses.</p>
            </sec>
            <sec id="sec10">
                <title>Preparation of serum samples</title>
                <p>Each rat blood sample was immediately transferred into a serum separator tube (gel and clot activator tube), then the tubes were placed in a test tube rack and the blood was left to clot at room temperature for 30 min. Next, the tubes were centrifuged at 3500 rpm for 20 min, after which each sample supernatant layer, which represents the serum, was transferred into a pre-chilled microcentrifuge tube and preserved at &#x2212;20 &#x00b0;C until utilization for the biochemical analysis.</p>
            </sec>
            <sec id="sec11">
                <title>Preparation of cardiac tissue samples</title>
                <p>For the biochemical analysis, the heart tissue samples were homogenized in an extraction medium that involved a combination of T-PER&#x2122; Tissue Protein Extraction Reagent (Thermo Fisher Scientific, USA) and Halt&#x2122; Protease Inhibitor Cocktail, EDTA-Free (Thermo Fisher Scientific, USA). Following their manufacturers&#x2019; instructions, enough working solution of the tissue protein extraction reagent and the protease inhibitor cocktail was prepared for all samples, then the tissue samples were weighed and placed in microcentrifuge tubes, after which the appropriate volume of the prepared working solution was added to each sample, with subsequent homogenization using a tissue grinding pestle and centrifugation at 10,000 rpm for 5 min to pellet tissue debris. Lastly, each sample supernatant layer was transferred into a pre-chilled fresh microcentrifuge tube and stored at &#x2212;20 &#x00b0;C until use.</p>
                <p>As for the gene expression analysis, the tissue samples were lysed by placing them in microcentrifuge tubes containing 1 mL TRIzol&#x2122; Reagent (Thermo Fisher Scientific, USA) and homogenized using tissue grinding pestles, after which the tubes were incubated for 5 min to allow complete dissociation of the nucleoprotein complex. Then, 0.2 mL chloroform was added to each tube, followed by incubation for 2&#x2013;3 min and centrifugation for 10 min at 12,000 rpm. Subsequently, each tube mixture was separated into a lower red phenol-chloroform organic phase, an interphase, and a colorless upper aqueous phase that contains total RNA.</p>
                <p>The next step was to transfer each tube aqueous phase into a new microcentrifuge tube. Then, 0.5 mL isopropanol was added to each tube in order to precipitate total RNA, after which the tubes were incubated for 10 min at 4&#x00b0;C and centrifuged for 10 min at 12,000 rpm, with subsequent precipitation of total RNA in the form of a white gel-like pellet at the bottom of the tubes.</p>
                <p>Afterwards, for each tube, the supernatant layer was discarded, and 1 mL of 75% ethanol was added to resuspend the RNA pellet. Next, the tubes were vortexed briefly and centrifuged for 5 min at 7500 rpm, after which the supernatant layer of each tube was discarded, and the RNA pellet was air-dried for 10 min. Thereafter, 50 &#x03bc;L RNase-free water was added to each tube to solubilize the RNA pellet, followed by incubation in a heat block set at 55&#x00b0;C for 10 min. Finally, the tubes were stored at &#x2212;20 &#x00b0;C until use.</p>
            </sec>
            <sec id="sec12">
                <title>Biochemical analysis</title>
                <p>Serum levels of cardiac injury biomarkers, including cardiac troponin I (cTnI) and N-terminal pro-B-type natriuretic peptide (NT-proBNP), as well as levels of oxidative stress biomarkers, including superoxide dismutase (SOD), glutathione peroxidase (GPx) and malonaldehyde (MDA), in addition to the inflammatory biomarker nuclear factor-kappa B (NF-&#x03ba;B) in the heart tissue homogenates were analyzed by means of enzyme-linked immunosorbent assay (ELISA) technique, using their commercially available kits (Cloud-Clone Corp, USA) and following the manufacturers&#x2019; instructions.</p>
            </sec>
            <sec id="sec13">
                <title>Gene expression analysis</title>
                <p>Two-step reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was performed to analyze the relative mRNA expression of proinflammatory cytokines, including tumor necrosis factor-alpha (TNF-&#x03b1;) and interleukin-1 beta (IL-1&#x03b2;) in cardiac tissues, and all procedures were performed following the manufacturers&#x2019; protocols. At first, for each heart tissue sample, the isolated RNA was converted to cDNA with the aid of GoScript&#x2122; Reverse Transcription System (Promega, USA), after which the synthesized cDNA was quantified utilizing QuantiFluor
                    <sup>&#x00ae;</sup> dsDNA System (Promega, USA) for downstream application. Moving forward, for each gene expression analysis, a mixture consisting of GoTaq
                    <sup>&#x00ae;</sup> qPCR Master Mix (Promega, USA), cDNA as well as the gene forward and reverse primers (Macrogen, South Korea) was assembled to perform qPCR, provided that the housekeeping gene, beta-actin (&#x03b2;-actin), was employed to normalize mRNA expression levels of the target genes, and all primer sequences are listed in 
                    <xref ref-type="table" rid="T1">Table 1</xref>.</p>
                <table-wrap id="T1" orientation="portrait" position="float">
                    <label>Table 1. </label>
                    <caption>
                        <title>Primer sequences used for RT-qPCR.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Gene</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Forward Primer</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Reverse Primer</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">TNF-&#x03b1;</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">ACCTTATCTACTCCCAGGTTCT</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GGCTGACTTTCTCCTGGTATG</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">IL-1&#x03b2;</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GACTTCACCATGGAACCCGT</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GGAGACTGCCCATTCTCGAC</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">&#x03b2;-actin</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AGGAGTACGATGAGTCCGGC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CGCAGCTCAGTAACAGTCCG</td>
                            </tr>
                        </tbody>
                    </table>
                    <table-wrap-foot>
                        <p>&#x03b2;-actin
                            <bold>,</bold> beta-actin; IL-1&#x03b2;, interleukin-1 beta; TNF-&#x03b1;, tumor necrosis factor-alpha.</p>
                    </table-wrap-foot>
                </table-wrap>
                <p>Following that, qPCR was carried out utilizing a magnetic induction cycler (MIC) (Bio Molecular Systems, Australia), and the cycling conditions involved initial denaturation at 95 &#x00b0;C/5 min, followed by 40 cycles of denaturation at 95 &#x00b0;C/20 s, annealing at 55 &#x00b0;C/20 s, 65 &#x00b0;C/20 s and 60 &#x00b0;C/20 s for TNF-&#x03b1;, IL-1&#x03b2; and &#x03b2;-actin primers respectively, with subsequent extension at 75 &#x00b0;C/20 s.</p>
                <p>After cycling had been completed, the amplification curves obtained for the three genes were analyzed utilizing micPCR software (version 2.10.0), in which thresholds and cycling threshold (Ct) values were automatically determined. Finally, the 2
                    <sup>&#x2212;&#x0394;&#x0394;Ct</sup> method was used to calculate the fold changes in mRNA expression of TNF-&#x03b1; and IL-1&#x03b2; relative to the control group.</p>
            </sec>
            <sec id="sec14">
                <title>Statistical analysis</title>
                <p>Statistical analysis was performed utilizing GraphPad Prism software (version 9.5.1), in which the numeric data obtained from the study, presented as mean &#x00b1; standard error of the mean (SEM), were analyzed by one-way analysis of variance (ANOVA) to evaluate the statistical significance of the results, followed by Tukey&#x2019;s Post Hoc test for multiple comparisons, and 
                    <italic toggle="yes">P</italic> values of less than 0.05 were considered to be statistically significant.</p>
            </sec>
        </sec>
        <sec id="sec15" sec-type="results">
            <title>Results</title>
            <sec id="sec16">
                <title>Serum levels of cardiac injury biomarkers</title>
                <p>As shown in 
                    <xref ref-type="table" rid="T2">Table 2</xref> and 
                    <xref ref-type="fig" rid="f1">Figure 1</xref>, the means of serum cTnI and NT-proBNP levels in DOX-treated rats were significantly elevated in compression with those of the control group. In contrast, treatment with either 10 or 20 mg/kg EZE prior to DOX administration significantly decreased the means of the earlier mentioned cardiac injury biomarkers compared with those of DOX group.
                    <sup>
                        <xref ref-type="bibr" rid="ref14">14</xref>
                    </sup>
                </p>
                <table-wrap id="T2" orientation="portrait" position="float">
                    <label>Table 2. </label>
                    <caption>
                        <title>Serum levels of cardiac injury biomarkers at the end of the study.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Group</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">cTnI (pg/mL)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">NT-proBNP (pg/mL)</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Control</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">137.74 &#x00b1; 12.00</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.67 &#x00b1; 0.12</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">DOX</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">564.32 &#x00b1; 58.71
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn1">a</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn4">****</xref>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">4.91 &#x00b1; 1.01
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn1">a</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn4">****</xref>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">10 mg/kg EZE + DOX</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">197.71 &#x00b1; 15.54
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn2">b</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn4">****</xref>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.91 &#x00b1; 0.10
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn2">b</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn3">***</xref>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">20 mg/kg EZE + DOX</td>
                                <td align="left" colspan="1" rowspan="1" valign="bottom">156.27 &#x00b1; 16.62
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn2">b</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn4">****</xref>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.77 &#x00b1; 0.07
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn2">b</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn4">****</xref>
                                </td>
                            </tr>
                        </tbody>
                    </table>
                    <table-wrap-foot>
                        <p>Data are presented as mean &#x00b1; standard error of the mean (SEM), n = 6.</p>
                        <fn-group content-type="footnotes">
                            <fn id="tfn1">
                                <label>
                                    <sup>a</sup>
                                </label>
                                <p>Significant difference versus control group.</p>
                            </fn>
                            <fn id="tfn2">
                                <label>
                                    <sup>b</sup>
                                </label>
                                <p>Significant difference versus DOX group.</p>
                            </fn>
                            <fn id="tfn3">
                                <label>***</label>
                                <p>
                                    <italic toggle="yes">p</italic> &lt; 0.001.</p>
                            </fn>
                            <fn id="tfn4">
                                <label>****</label>
                                <p>
                                    <italic toggle="yes">p</italic> &lt; 0.0001.</p>
                            </fn>
                        </fn-group>
                        <p>cTnI, cardiac troponin I; DOX, doxorubicin; EZE, ezetimibe; NT-proBNP, N-terminal pro-B-type natriuretic peptide.</p>
                    </table-wrap-foot>
                </table-wrap>
                <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                    <label>Figure 1. </label>
                    <caption>
                        <title>Cardiac injury biomarkers at the end of the study.</title>
                        <p>Serum levels of (A) cTnI and (B) NT-proBNP. Data are presented as mean &#x00b1; standard error of the mean (SEM), n = 6. ***
                            <italic toggle="yes">p</italic> &lt; 0.001; ****
                            <italic toggle="yes">p</italic> &lt; 0.0001. cTnI, cardiac troponin I; DOX, doxorubicin; EZE, ezetimibe; NT-proBNP, N-terminal pro-B-type natriuretic peptide.</p>
                    </caption>
                    <graphic id="gr1" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/171611/d6b56dac-5ab0-49a1-af6d-39955e847003_figure1.gif"/>
                </fig>
            </sec>
            <sec id="sec17">
                <title>Oxidative stress biomarkers in cardiac tissues</title>
                <p>DOX administration resulted in a significant depletion in the means of cardiac SOD and GPx levels, as well as a significant increment in the mean of cardiac MDA levels compared with their corresponding values in the control group. On the other hand, the means of cardiac SOD and GPx levels were significantly higher, while the mean of cardiac MDA levels was significantly lower in rats that were treated with either 10 or 20 mg/kg EZE before receiving DOX than in those that received only DOX (
                    <xref ref-type="table" rid="T3">Table 3</xref> and 
                    <xref ref-type="fig" rid="f2">Figure 2</xref>).
                    <sup>
                        <xref ref-type="bibr" rid="ref14">14</xref>
                    </sup>
                </p>
                <table-wrap id="T3" orientation="portrait" position="float">
                    <label>Table 3. </label>
                    <caption>
                        <title>Oxidative stress biomarkers in cardiac tissues at the end of the study.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Group</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">SOD (ng/mL)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">GPx (ng/mL)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">MDA (ng/mL)</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Control</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">9.57 &#x00b1; 0.85</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">103.06 &#x00b1; 5.37
                                    <xref ref-type="table-fn" rid="tfn6"/>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2.18 &#x00b1; 0.55</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">DOX</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2.23 &#x00b1; 0.43
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn5">a</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn11">****</xref>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">28.11 &#x00b1; 6.55
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn5">a</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn11">****</xref>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">12.36 &#x00b1; 1.92
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn5">a</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn11">****</xref>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">10 mg/kg EZE + DOX</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">5.62 &#x00b1; 0.60
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn5">a</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn8">*</xref>
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn6">b</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn8">*</xref>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">60.62 &#x00b1; 2.64
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn5">a</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn9">**</xref>
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn6">b</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn8">*</xref>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6.13 &#x00b1; 0.74
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn6">b</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn9">**</xref>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">20 mg/kg EZE + DOX</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">8.06 &#x00b1; 1.22
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn6">b</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn10">***</xref>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">92.50 &#x00b1; 11.39
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn6">b</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn11">****</xref>
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn7">c</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn8">*</xref>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3.46 &#x00b1; 0.76
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn6">b</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn10">***</xref>
                                </td>
                            </tr>
                        </tbody>
                    </table>
                    <table-wrap-foot>
                        <p>Data are presented as mean &#x00b1; standard error of the mean (SEM), n = 6.</p>
                        <fn-group content-type="footnotes">
                            <fn id="tfn5">
                                <label>
                                    <sup>a</sup>
                                </label>
                                <p>Significant difference versus control group.</p>
                            </fn>
                            <fn id="tfn6">
                                <label>
                                    <sup>b</sup>
                                </label>
                                <p>Significant difference versus DOX group.</p>
                            </fn>
                            <fn id="tfn7">
                                <label>
                                    <sup>c</sup>
                                </label>
                                <p>Significant difference versus 10 mg/kg EZE + DOX group.</p>
                            </fn>
                            <fn id="tfn8">
                                <label>*</label>
                                <p>
                                    <italic toggle="yes">p</italic> &lt; 0.05.</p>
                            </fn>
                            <fn id="tfn9">
                                <label>**</label>
                                <p>
                                    <italic toggle="yes">p</italic> &lt; 0.01.</p>
                            </fn>
                            <fn id="tfn10">
                                <label>***</label>
                                <p>
                                    <italic toggle="yes">p</italic> &lt; 0.001.</p>
                            </fn>
                            <fn id="tfn11">
                                <label>****</label>
                                <p>
                                    <italic toggle="yes">p</italic> &lt; 0.0001.</p>
                            </fn>
                        </fn-group>
                        <p>DOX, doxorubicin; EZE, ezetimibe; GPx, glutathione peroxidase; MDA, malonaldehyde; SOD, superoxide dismutase.</p>
                    </table-wrap-foot>
                </table-wrap>
                <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                    <label>Figure 2. </label>
                    <caption>
                        <title>Oxidative stress biomarkers in cardiac tissues at the end of the study.</title>
                        <p>Levels of cardiac (A) SOD, (B) GPx and (C) MDA. Data are presented as mean &#x00b1; standard error of the mean (SEM), n = 6. *
                            <italic toggle="yes">p</italic> &lt; 0.05; **
                            <italic toggle="yes">p</italic> &lt; 0.01; ***
                            <italic toggle="yes">p</italic> &lt; 0.001; ****
                            <italic toggle="yes">p</italic> &lt; 0.0001. DOX, doxorubicin; EZE, ezetimibe; GPx, glutathione peroxidase; MDA, malonaldehyde; SOD, superoxide dismutase.</p>
                    </caption>
                    <graphic id="gr2" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/171611/d6b56dac-5ab0-49a1-af6d-39955e847003_figure2.gif"/>
                </fig>
            </sec>
            <sec id="sec18">
                <title>Inflammatory biomarkers in cardiac tissues</title>
                <p>Treatment with DOX significantly elevated the mean of cardiac NF-&#x03ba;B levels when it was set up against that of the control group. On the contrary, rats that received either 10 or 20 mg/kg EZE ahead of DOX administration exhibited a significant decline in the mean of the earlier stated biomarker in comparison with that of DOX group, as presented in 
                    <xref ref-type="table" rid="T4">Table 4</xref> and 
                    <xref ref-type="fig" rid="f3">Figure 3</xref>.
                    <sup>
                        <xref ref-type="bibr" rid="ref14">14</xref>
                    </sup>
                </p>
                <table-wrap id="T4" orientation="portrait" position="float">
                    <label>Table 4. </label>
                    <caption>
                        <title>Inflammatory biomarkers in cardiac tissues at the end of the study.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Group</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">NF-&#x03ba;B (ng/mL)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">TNF-&#x03b1; relative mRNA expression</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">IL-1&#x03b2; relative mRNA expression</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Control</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">4.45 &#x00b1; 0.34</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1.00 &#x00b1; 0.47</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1.00 &#x00b1; 0.47</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">DOX</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">21.42 &#x00b1; 4.74
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn12">a</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn17">***</xref>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3.38 &#x00b1; 0.92
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn12">a</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn15">*</xref>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6.18 &#x00b1; 2.37
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn12">a</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn15">*</xref>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">10 mg/kg EZE + DOX</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">5.99 &#x00b1; 0.53
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn13">b</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn16">**</xref>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.93 &#x00b1; 0.24
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn13">b</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn15">*</xref>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">7.26 &#x00b1; 0.48
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn12">a</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn15">*</xref>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">20 mg/kg EZE + DOX</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">5.26 &#x00b1; 0.43
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn13">b</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn17">***</xref>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.24 &#x00b1; 0.09
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn13">b</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn16">**</xref>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1.20 &#x00b1; 0.51
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn13">b</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn15">*</xref>
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn14">c</xref>
                                    </sup>
                                    <xref ref-type="table-fn" rid="tfn15">*</xref>
                                </td>
                            </tr>
                        </tbody>
                    </table>
                    <table-wrap-foot>
                        <p>Data are presented as mean &#x00b1; standard error of the mean (SEM), 
                            <italic toggle="yes">n</italic> = 6.</p>
                        <fn-group content-type="footnotes">
                            <fn id="tfn12">
                                <label>
                                    <sup>a</sup>
                                </label>
                                <p>Significant difference versus control group.</p>
                            </fn>
                            <fn id="tfn13">
                                <label>
                                    <sup>b</sup>
                                </label>
                                <p>Significant difference versus DOX group.</p>
                            </fn>
                            <fn id="tfn14">
                                <label>
                                    <sup>c</sup>
                                </label>
                                <p>Significant difference versus 10 mg/kg EZE + DOX group.</p>
                            </fn>
                            <fn id="tfn15">
                                <label>*</label>
                                <p>
                                    <italic toggle="yes">p</italic> &lt; 0.05.</p>
                            </fn>
                            <fn id="tfn16">
                                <label>**</label>
                                <p>
                                    <italic toggle="yes">p</italic> &lt; 0.01.</p>
                            </fn>
                            <fn id="tfn17">
                                <label>***</label>
                                <p>
                                    <italic toggle="yes">p</italic> &lt; 0.001.</p>
                            </fn>
                        </fn-group>
                        <p>DOX, doxorubicin; EZE, ezetimibe; IL-1&#x03b2;, interleukin-1 beta; NF-&#x03ba;B, nuclear factor-kappa B; TNF-&#x03b1;, tumor necrosis factor-alpha.</p>
                    </table-wrap-foot>
                </table-wrap>
                <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                    <label>Figure 3. </label>
                    <caption>
                        <title>Inflammatory biomarkers in cardiac tissues at the end of the study.</title>
                        <p>Levels of cardiac (A) NF-&#x03ba;B, (B) TNF-&#x03b1; relative mRNA expression and (C) IL-1&#x03b2; relative mRNA expression. Data are presented as mean &#x00b1; standard error of the mean (SEM), n = 6. *
                            <italic toggle="yes">p</italic> &lt; 0.05; **
                            <italic toggle="yes">p</italic> &lt; 0.01; ***
                            <italic toggle="yes">p</italic> &lt; 0.001. DOX, doxorubicin; EZE, ezetimibe; IL-1&#x03b2;, interleukin-1 beta; NF-&#x03ba;B, nuclear factor-kappa B; TNF-&#x03b1;, tumor necrosis factor-alpha.</p>
                    </caption>
                    <graphic id="gr3" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/171611/d6b56dac-5ab0-49a1-af6d-39955e847003_figure3.gif"/>
                </fig>
                <p>Additionally, a significant increment in the means of cardiac TNF-&#x03b1; and IL-1&#x03b2; relative mRNA expression levels was observed in DOX-treated rats compared with those of the control group. Meanwhile, pretreatment with either 10 or 20 mg/kg EZE caused a significant reduction in the mean of cardiac TNF-&#x03b1; relative mRNA expression levels compared with that of DOX-challenged rats. However, only pretreatment with 20 mg/kg EZE significantly diminished the mean of cardiac IL-1&#x03b2; relative mRNA expression levels in comparison with that of DOX group (
                    <xref ref-type="table" rid="T4">Table 4</xref> and 
                    <xref ref-type="fig" rid="f3">Figure 3</xref>).
                    <sup>
                        <xref ref-type="bibr" rid="ref14">14</xref>
                    </sup>
                </p>
            </sec>
        </sec>
        <sec id="sec19" sec-type="discussion">
            <title>Discussion</title>
            <p>One of the highly efficient antineoplastic agents with broad-spectrum application is the anthracycline antibiotic DOX. Nevertheless, the cardiotoxicity it causes represents a feared adverse effect and a potentially life-threatening response that can limit the clinical use of DOX and affect the quality of life of cancer patients, apart from their oncological prognosis.
                <sup>
                    <xref ref-type="bibr" rid="ref2">2</xref>,
                    <xref ref-type="bibr" rid="ref15">15</xref>
                </sup>
            </p>
            <p>Results of the current study revealed that treating rats with a single IP injection of 15 mg/kg DOX hydrochloride caused a significant elevation in the means of serum levels of cardiac injury biomarkers, including cTnI and NT-proBNP, which is consistent with the results obtained from previous studies.
                <sup>
                    <xref ref-type="bibr" rid="ref16">16</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref18">18</xref>
                </sup>
            </p>
            <p>Considering their high sensitivity, cardiac injury biomarkers are utilized for the early detection of cardiotoxicity, especially cardiac troponins, which are regulatory proteins that control calcium-mediated contractile function of the heart, and it has been demonstrated that newly elevated serum cTnI levels in patients receiving anthracyclines anticipate subsequent development of LVD.
                <sup>
                    <xref ref-type="bibr" rid="ref7">7</xref>,
                    <xref ref-type="bibr" rid="ref19">19</xref>,
                    <xref ref-type="bibr" rid="ref20">20</xref>
                </sup> Additionally, NT-proBNP, which is secreted by cardiomyocytes in increased amounts during conditions of volume or pressure overload of the heart, is widely utilized in the detection of HF, and in terms of chemotherapy, its use can be helpful,
                <sup>
                    <xref ref-type="bibr" rid="ref7">7</xref>,
                    <xref ref-type="bibr" rid="ref21">21</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref23">23</xref>
                </sup> based on studies that validated its role as a marker for the detection of DIC.
                <sup>
                    <xref ref-type="bibr" rid="ref24">24</xref>,
                    <xref ref-type="bibr" rid="ref25">25</xref>
                </sup>
            </p>
            <p>The present study also showed that DIC was associated with notable changes in oxidative stress biomarkers in cardiac tissue, where the means of the antioxidant enzymes SOD and GPx were significantly depleted, while there was a significant increment in the mean of MDA contents, provided that MDA is a highly reactive dialdehyde derived from peroxidation of polyunsaturated fatty acids by means of reactive species.
                <sup>
                    <xref ref-type="bibr" rid="ref26">26</xref>,
                    <xref ref-type="bibr" rid="ref27">27</xref>
                </sup>
            </p>
            <p>The abovementioned outcomes are compatible with those acquired from prior studies,
                <sup>
                    <xref ref-type="bibr" rid="ref17">17</xref>,
                    <xref ref-type="bibr" rid="ref28">28</xref>,
                    <xref ref-type="bibr" rid="ref29">29</xref>
                </sup> which reinforces the theory that one of the major mechanisms underlying the development of DIC is oxidative stress, and the latter can be defined as a state of imbalance in which the production of ROS, such as superoxide anion (O
                <sub>2</sub>
                <sup>&#x2022; &#x2013;</sup>), hydrogen peroxide (H
                <sub>2</sub>O
                <sub>2</sub>) and hydroxyl radical (HO
                <sup>&#x2022;</sup>), as well as RNS, such as peroxynitrite anion (ONOO
                <sup>&#x2212;</sup>), exceeds the capacity of the endogenous antioxidant system, resulting in cellular damage.
                <sup>
                    <xref ref-type="bibr" rid="ref10">10</xref>,
                    <xref ref-type="bibr" rid="ref30">30</xref>,
                    <xref ref-type="bibr" rid="ref31">31</xref>
                </sup>
            </p>
            <p>One of the reasons that makes the heart particularly susceptible to injury by DOX-induced oxidative stress is that antioxidant enzymes, including SOD, catalase (CAT) and GPx are less abundantly expressed in cardiomyocytes as compared with other cell types. Another reason is that DOX has a tendency to accumulate in the mitochondria, and since the heart is the body&#x2019;s most metabolically active organ, it tends to have the highest mitochondrial content, rendering the cardiac cell the most vulnerable to oxidative damage.
                <sup>
                    <xref ref-type="bibr" rid="ref5">5</xref>,
                    <xref ref-type="bibr" rid="ref32">32</xref>
                </sup>
            </p>
            <p>Studies elucidated that DOX induces oxidative stress as the quinone moiety in its structure undergoes one-electron reduction through the action of NADH- or NADPH-dependent enzymes to form a semiquinone radical, which tends to react rapidly with an oxygen molecule (O
                <sub>2</sub>), where it donates an electron to O
                <sub>2</sub> to form O
                <sub>2</sub>
                <sup>&#x2022; &#x2013;</sup>, while recycling itself back to the quinone form, and this cycle is referred to as the redox cycling of DOX. Subsequently, the generated O
                <sub>2</sub>
                <sup>&#x2022; &#x2013;</sup> can be transformed by SOD into H
                <sub>2</sub>O
                <sub>2</sub> that can be converted either into O
                <sub>2</sub> and water (H
                <sub>2</sub>O) by means of CAT or GPx, or into a highly reactive and toxic HO
                <sup>&#x2022;</sup> in the presence of ferrous ion (Fe
                <sup>2+</sup>). One more point to consider is that O
                <sub>2</sub>
                <sup>&#x2022; &#x2013;</sup> can also react with nitric oxide (NO) to form the RNS ONOO
                <sup>&#x2212;</sup>. Eventually, overproduced HO
                <sup>&#x2022;</sup> and ONOO
                <sup>&#x2212;</sup> interact with the biomolecules nearby, causing lipid peroxidation, protein modification, DNA damage as well as disruption of mitochondrial function,
                <sup>
                    <xref ref-type="bibr" rid="ref33">33</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref35">35</xref>
                </sup> as shown in 
                <xref ref-type="fig" rid="f4">Figure 4</xref>.</p>
            <fig fig-type="figure" id="f4" orientation="portrait" position="float">
                <label>Figure 4. </label>
                <caption>
                    <title>Schematic diagram illustrating the redox cycling of DOX and generation of reactive species.</title>
                    <p>CAT, catalase; DOX, doxorubicin; GPx, glutathione peroxidase; GR, glutathione reductase; GSH, reduced glutathione; GSSG, glutathione disulfide; NAD
                        <sup>+</sup>, nicotinamide adenine dinucleotide; NADP
                        <sup>+</sup>, nicotinamide adenine dinucleotide phosphate; NADH, reduced nicotinamide adenine dinucleotide; NADPH, reduced nicotinamide adenine dinucleotide phosphate; SOD, superoxide dismutase. Chemical formulas: Fe
                        <sup>+2</sup>, ferrous iron; Fe
                        <sup>+3</sup>, ferric iron; H
                        <sup>+</sup>, proton; H
                        <sub>2</sub>O, water; H
                        <sub>2</sub>O
                        <sub>2</sub>, hydrogen peroxide; HO
                        <sup>&#x2022;</sup>, hydroxyl radical; NO, nitric oxide; O
                        <sub>2</sub>, oxygen; O
                        <sub>2</sub>
                        <sup>&#x2022; &#x2212;</sup>, superoxide anion; ONOO 
                        <sup>&#x2212;</sup>, peroxynitrite anion.</p>
                </caption>
                <graphic id="gr4" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/171611/d6b56dac-5ab0-49a1-af6d-39955e847003_figure4.gif"/>
            </fig>
            <p>Our results also manifested that DOX administration significantly increased the means of cardiac NF-&#x03ba;B levels and its downstream proinflammatory cytokines, including TNF-&#x03b1; and IL-1&#x03b2; relative mRNA expression levels, and these observations are in agreement with those reported in other studies,
                <sup>
                    <xref ref-type="bibr" rid="ref36">36</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref38">38</xref>
                </sup> thereby supporting another theory through which DOX induces cardiotoxicity, and that is inflammation.</p>
            <p>Researchers pointed out that inflammation in DIC occurs as a result of NF-&#x03ba;B activation in response to oxidative stress,
                <sup>
                    <xref ref-type="bibr" rid="ref10">10</xref>,
                    <xref ref-type="bibr" rid="ref39">39</xref>
                </sup> provided that NF-&#x03ba;B is a family of DNA binding proteins that function as homo or heterodimers to mediate the expression of numerous genes involved in cell proliferation, inflammation, immunity and apoptosis.
                <sup>
                    <xref ref-type="bibr" rid="ref40">40</xref>,
                    <xref ref-type="bibr" rid="ref41">41</xref>
                </sup> In its resting state, NF-&#x03ba;B presents in the cytoplasm as a complex with a member of inhibitory proteins known as inhibitors of NF-&#x03ba;B (I&#x03ba;&#x0392;s) that mask nuclear localization signals to prevent NF-&#x03ba;B from being imported into the nucleus. However, in response to stimulation, an I&#x03ba;B kinase (IKK) phosphorylates I&#x03ba;B to promote its ubiquitination and proteasomal degradation, after which NF-&#x03ba;B becomes freed from I&#x03ba;B and translocates into the nucleus, where it upregulates the expression of proinflammatory cytokines, such as TNF-&#x03b1;, IL-1&#x03b2;, IL-6 and others, with consequent development of cardiac inflammation that can lead to cardiac remodeling and dysfunction.
                <sup>
                    <xref ref-type="bibr" rid="ref39">39</xref>,
                    <xref ref-type="bibr" rid="ref42">42</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref44">44</xref>
                </sup>
            </p>
            <p>In our research, we aimed to investigate whether EZE can safeguard against DIC in rats. Interestingly, treating rats with either 10 or 20 mg/kg EZE before DOX administration significantly mitigated the cardiotoxic potential of the anticancer drug, and that was evidenced by a significant decline in the means of serum cTnI and NT-proBNP levels compared with those of DOX group, and to our knowledge, the current research is the first to estimate serum levels of the two earlier mentioned biomarkers in rats after receiving EZE for the prevention of a cardiac pathological condition.</p>
            <p>Moreover, results of the present study demonstrated that pretreatment with EZE at a dose of 10 or 20 mg/kg caused a significant increment in the means of cardiac SOD and GPx levels, along with a significant reduction in the mean of cardiac MDA levels compared with those of DOX group, and these outcomes emphasize that the drug possesses antioxidant effect, as it was reported in an 
                <italic toggle="yes">in vitro</italic> study, where EZE protected endothelial cells against oxidative stress induced by oxidized low-density lipoproteins, in which a reduction in ROS formation, as well as an enhancement in SOD and CAT activities were observed.
                <sup>
                    <xref ref-type="bibr" rid="ref45">45</xref>
                </sup>
            </p>
            <p>Our study also showed that in comparison with DOX-challenged rats, pretreatment with either 10 or 20 mg/kg EZE significantly decreased the means of cardiac NF-&#x03ba;B levels and TNF-&#x03b1; relative mRNA expression levels, while the 20 mg/kg dose was also capable of significantly reducing the mean of cardiac IL-1&#x03b2; relative mRNA expression levels, and these findings can be attributed to the anti-inflammatory effect of the drug that was mentioned in previous studies, including one that utilized THP-1 human monocytic cell line treated with water-soluble cholesterol to induce inflammation, where the results manifested that EZE treatment dramatically decreased the proinflammatory cytokine TNF-&#x03b1; production by silencing NF-&#x03ba;B signaling.
                <sup>
                    <xref ref-type="bibr" rid="ref46">46</xref>
                </sup>
            </p>
            <p>The antioxidant and anti-inflammatory actions of EZE were also evidenced in other studies, and in this regard, a recent one pointed out that EZE alleviated acetic acid-induced ulcerative colitis in rats by hampering oxidative stress and inflammation.
                <sup>
                    <xref ref-type="bibr" rid="ref11">11</xref>
                </sup> Also, in a transient middle cerebral artery occlusion model in rats, EZE attenuated oxidative stress and prevented neuroinflammation, resulting in an improvement in neurological outcome.
                <sup>
                    <xref ref-type="bibr" rid="ref12">12</xref>
                </sup>
            </p>
            <p>The rationale behind EZE attenuation of oxidative stress and inflammation can be related to its ability to activate nuclear factor erythroid 2-related factor 2 (Nrf2), a transcription factor that modulates the expression of genes involved in cellular defense against oxidative stress insults, including the ones encoding SOD, CAT, GPx and other antioxidants.
                <sup>
                    <xref ref-type="bibr" rid="ref47">47</xref>,
                    <xref ref-type="bibr" rid="ref48">48</xref>
                </sup> Under basal conditions, Nrf2 is bound to Kelch-like ECH-associated protein 1 (Keap1), a negative regulator of Nrf2 that mediates its ubiquitination and proteasomal degradation to prevent unwarranted expression of Nrf2-target genes. However, under stressed conditions, Nrf2 dissociates from Keap1 and translocates into the nucleus, where it upregulates the expression of antioxidant genes through binding to their antioxidant response element (ARE), which is an enhancer sequence placed at the promoter region of several cytoprotective genes. Consequently, the activity of antioxidants would be boosted, leading to suppression of oxidative stress-mediated activation of the NF-&#x03ba;B signaling pathway,
                <sup>
                    <xref ref-type="bibr" rid="ref49">49</xref>
                </sup> as shown in 
                <xref ref-type="fig" rid="f5">Figure 5</xref>.</p>
            <fig fig-type="figure" id="f5" orientation="portrait" position="float">
                <label>Figure 5. </label>
                <caption>
                    <title>Schematic representation for the proposed pathway through which EZE attenuates DOX-induced oxidative stress and inflammation.</title>
                    <p>AMPK, adenosine monophosphate-activated protein kinase; ARE, antioxidant response element; DOX, doxorubicin; EZE, ezetimibe; I&#x03ba;B, inhibitor of nuclear factor-kappa B; IKK, I&#x03ba;B kinase; Keap1, Kelch-like ECH-associated protein 1; NF-&#x03ba;B, nuclear factor-kappa B; Nrf2, nuclear factor erythroid 2-related factor 2; P, phosphate.</p>
                </caption>
                <graphic id="gr5" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/171611/d6b56dac-5ab0-49a1-af6d-39955e847003_figure5.gif"/>
            </fig>
            <p>The possible mechanism through which EZE induces Nrf2 activation has been elucidated in one study, where the drug was found to disrupt the interaction between Nrf2 and Keap1 through adenosine monophosphate-activated protein kinase (AMPK)-mediated phosphorylation of p62, an adaptor protein that functions as a central scaffold in various cellular processes, including autophagy. Accordingly, upon its phosphorylation, p62 binds to Keap1, resulting in autophagic degradation of the latter, after which the liberated Nrf2 translocates into the nucleus to upregulate the expression of antioxidant genes,
                <sup>
                    <xref ref-type="bibr" rid="ref48">48</xref>,
                    <xref ref-type="bibr" rid="ref50">50</xref>
                </sup> and this can explain, at least in part, why EZE exerted a protective effect against DIC in rats (
                <xref ref-type="fig" rid="f5">Figure 5</xref>).</p>
        </sec>
        <sec id="sec20" sec-type="conclusion">
            <title>Conclusion</title>
            <p>The current research demonstrates, for the first time, that pretreatment with the cholesterol-lowering drug EZE can attenuate DIC in rats, as evidenced by a notable reduction in the serum levels of cardiac injury biomarkers. Also, we believe that the cardioprotective effect of EZE was mediated by suppression of DOX-induced oxidative stress and NF-&#x03ba;B-mediated inflammation, where EZE raised the levels of antioxidant enzymes, diminished lipid peroxidation and downregulated the gene expression of proinflammatory cytokines in cardiac tissues, thereby, it has the potential to serve as a promising candidate for alleviating DOX-induced cardiac injury.</p>
        </sec>
        <sec id="sec21">
            <title>Ethical considerations</title>
            <p>The current study followed the Animal Research: Reporting of 
                <italic toggle="yes">In Vivo</italic> Experiments (ARRIVE) guidelines,
                <sup>
                    <xref ref-type="bibr" rid="ref13">13</xref>
                </sup> and was commenced after receiving approval from the Research Ethics Committee of the College of Medicine, University of Baghdad (approval date: December 31, 2023; approval number: 03-31).</p>
        </sec>
    </body>
    <back>
        <sec id="sec25" sec-type="data-availability">
            <title>Data availability</title>
            <sec id="sec26">
                <title>Underlying data</title>
                <p>Zenodo: Dataset for biochemical and gene expression analyses. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.5281/zenodo.13730571">https://doi.org/10.5281/zenodo.13730571</ext-link>.
                    <sup>

                        <xref ref-type="bibr" rid="ref14">14</xref>
</sup>
                </p>
                <p>This project contains the following underlying data:
                    <list list-type="bullet">
                        <list-item>
                            <label>&#x2022;</label>
                            <p>Biochemical analysis.xlsx</p>
                        </list-item>
                        <list-item>
                            <label>&#x2022;</label>
                            <p>Gene expression analysis.xlsx</p>
                        </list-item>
                    </list>
                </p>
                <p>Data are available under the terms of the 
                    <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution 4.0 International license</ext-link> (CC-BY 4.0).</p>
            </sec>
            <sec id="sec27">
                <title>Accession numbers</title>
                <p>NCBI Protein: Tumor necrosis factor-alpha (TNF-&#x03b1;). Accession number NM_012675; 
                    <ext-link ext-link-type="uri" xlink:href="http://identifiers.org/ncbiprotein:NM_012675.3">http://identifiers.org/ncbiprotein:NM_012675.3</ext-link>
                </p>
                <p>NCBI Protein: Interleukin-1 beta (IL-1&#x03b2;). Accession number NM_031512; 
                    <ext-link ext-link-type="uri" xlink:href="http://identifiers.org/ncbiprotein:NM_031512.2">http://identifiers.org/ncbiprotein:NM_031512.2</ext-link>
                </p>
                <p>NCBI Protein: Beta-actin (&#x03b2;-actin). Accession number NM_031144; 
                    <ext-link ext-link-type="uri" xlink:href="http://identifiers.org/ncbiprotein:NM_031144.3">http://identifiers.org/ncbiprotein:NM_031144.3</ext-link>
                </p>
            </sec>
            <sec id="sec22">
                <title>Extended data</title>
                <p>

                    <bold>Reporting guidelines</bold>
                </p>
                <p>Zenodo: ARRIVE checklist for &#x2018;Unleashing the cardioprotective potential of Ezetimibe against Doxorubicin-induced cardiotoxicity in Wistar rats: Targeting oxidative stress and NF-&#x03ba;B-mediated inflammation&#x2019;, 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.5281/zenodo.13750802">https://doi.org/10.5281/zenodo.13750802</ext-link>.
                    <sup>

                        <xref ref-type="bibr" rid="ref13">13</xref>
</sup>
                </p>
                <p>Data are available under the terms of the 
                    <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution 4.0 International license</ext-link> (CC-BY 4.0).</p>
            </sec>
        </sec>
        <ref-list>
            <title>References</title>
            <ref id="ref1">
                <label>1</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Jones</surname>
                            <given-names>IC</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Dass</surname>
                            <given-names>CR</given-names>
                        </name>
</person-group>:
                    <article-title>Doxorubicin-induced cardiotoxicity: causative factors and possible interventions.</article-title>
                    <source>

                        <italic toggle="yes">J. Pharm. Pharmacol.</italic>
</source>
                    <year>2022</year>;<volume>74</volume>(<issue>12</issue>):<fpage>1677</fpage>&#x2013;<lpage>1688</lpage>.
                    <pub-id pub-id-type="pmid">35994421</pub-id>
                    <pub-id pub-id-type="doi">10.1093/jpp/rgac063</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref2">
                <label>2</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kong</surname>
                            <given-names>CY</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Guo</surname>
                            <given-names>Z</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Song</surname>
                            <given-names>P</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Underlying the Mechanisms of Doxorubicin-Induced Acute Cardiotoxicity: Oxidative Stress and Cell Death.</article-title>
                    <source>

                        <italic toggle="yes">Int. J. Biol. Sci.</italic>
</source>
                    <year>2022</year>;<volume>18</volume>(<issue>2</issue>):<fpage>760</fpage>&#x2013;<lpage>770</lpage>.</mixed-citation>
            </ref>
            <ref id="ref3">
                <label>3</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Al-Hassawi</surname>
                            <given-names>WW</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Al-Sammak</surname>
                            <given-names>MA</given-names>
                        </name>
</person-group>:
                    <article-title>Effect of doxorubicin on the histological structure of the kidneys in male albino rats.</article-title>
                    <source>

                        <italic toggle="yes">J. Fac. Med. Baghdad.</italic>
</source>
                    <year>2014</year>;<volume>55</volume>(<issue>4</issue>):<fpage>384</fpage>&#x2013;<lpage>389</lpage>.
                    <pub-id pub-id-type="doi">10.32007/jfacmedbagdad.554595</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref4">
                <label>4</label>
                <mixed-citation publication-type="book">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Chu</surname>
                            <given-names>E</given-names>
                        </name>
</person-group>:
                    <chapter-title>Cancer Chemotherapy.</chapter-title>
                    <person-group person-group-type="editor">

                        <name name-style="western">
                            <surname>Katzung</surname>
                            <given-names>BG</given-names>
                        </name>
</person-group>, editor.
                    <source>

                        <italic toggle="yes">Basic &amp; Clinical Pharmacology.</italic>
</source>
                    <edition>14th ed.</edition>
                    <publisher-loc>New York, NY</publisher-loc>:
                    <publisher-name>McGraw-Hill Education</publisher-name>;<year>2017</year>; pp.<fpage>948</fpage>&#x2013;<lpage>976</lpage>.</mixed-citation>
            </ref>
            <ref id="ref5">
                <label>5</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Songbo</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lang</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Xinyong</surname>
                            <given-names>C</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Oxidative stress injury in doxorubicin-induced cardiotoxicity.</article-title>
                    <source>

                        <italic toggle="yes">Toxicol. Lett.</italic>
</source>
                    <year>2019</year>;<volume>307</volume>:<fpage>41</fpage>&#x2013;<lpage>48</lpage>.
                    <pub-id pub-id-type="doi">10.1016/j.toxlet.2019.02.013</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref6">
                <label>6</label>
                <mixed-citation publication-type="book">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>LaPlant</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>May</surname>
                            <given-names>P</given-names>
                        </name>
</person-group>:
                    <chapter-title>Anticancer Drugs.</chapter-title>
                    <person-group person-group-type="editor">

                        <name name-style="western">
                            <surname>Whalen</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Feild</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Radhakrishnan</surname>
                            <given-names>R</given-names>
                        </name>
</person-group>, editors.
                    <source>

                        <italic toggle="yes">Lippincott
                            <sup>&#x00ae;</sup> Illustrated Reviews: Pharmacology.</italic>
</source>
                    <edition>7th ed.</edition>
                    <publisher-loc>Philadelphia</publisher-loc>:
                    <publisher-name>Wolters Kluwer</publisher-name>;<year>2019</year>; pp.<fpage>454</fpage>&#x2013;<lpage>480</lpage>.</mixed-citation>
            </ref>
            <ref id="ref7">
                <label>7</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Zamorano</surname>
                            <given-names>JL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lancellotti</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rodriguez Mu&#x00f1;oz</surname>
                            <given-names>D</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>2016 ESC Position Paper on cancer treatments and cardiovascular toxicity developed under the auspices of the ESC Committee for Practice Guidelines: &#x2002;The Task Force for cancer treatments and cardiovascular toxicity of the European Society of Cardiology (ESC).</article-title>
                    <source>

                        <italic toggle="yes">Eur. Heart J.</italic>
</source>
                    <year>2016</year>;<volume>37</volume>(<issue>36</issue>):<fpage>2768</fpage>&#x2013;<lpage>2801</lpage>.
                    <pub-id pub-id-type="pmid">27567406</pub-id>
                    <pub-id pub-id-type="doi">10.1093/eurheartj/ehw211</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref8">
                <label>8</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Carvalho</surname>
                            <given-names>FS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Burgeiro</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Garcia</surname>
                            <given-names>R</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Doxorubicin-induced cardiotoxicity: from bioenergetic failure and cell death to cardiomyopathy.</article-title>
                    <source>

                        <italic toggle="yes">Med. Res. Rev.</italic>
</source>
                    <year>2014</year>;<volume>34</volume>(<issue>1</issue>):<fpage>106</fpage>&#x2013;<lpage>135</lpage>.
                    <pub-id pub-id-type="pmid">23494977</pub-id>
                    <pub-id pub-id-type="doi">10.1002/med.21280</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref9">
                <label>9</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Al-Hussaniy</surname>
                            <given-names>HA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Alburghaif</surname>
                            <given-names>AH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Alkhafaje</surname>
                            <given-names>Z</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Chemotherapy-induced cardiotoxicity: a new perspective on the role of Digoxin, ATG7 activators, Resveratrol, and herbal drugs.</article-title>
                    <source>

                        <italic toggle="yes">J. Med. Life.</italic>
</source>
                    <year>2023</year>;<volume>16</volume>(<issue>4</issue>):<fpage>491</fpage>&#x2013;<lpage>500</lpage>.
                    <pub-id pub-id-type="pmid">37305823</pub-id>
                    <pub-id pub-id-type="doi">10.25122/jml-2022-0322</pub-id>
                    <pub-id pub-id-type="pmcid">PMC10251384</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref10">
                <label>10</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Shi</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Chen</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Luo</surname>
                            <given-names>Z</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Role of oxidative stress and inflammation-related signaling pathways in doxorubicin-induced cardiomyopathy.</article-title>
                    <source>

                        <italic toggle="yes">Cell Commun. Signal.</italic>
</source>
                    <year>2023</year>;<volume>21</volume>(<issue>1</issue>):<fpage>61</fpage>.
                    <pub-id pub-id-type="pmid">36918950</pub-id>
                    <pub-id pub-id-type="doi">10.1186/s12964-023-01077-5</pub-id>
                    <pub-id pub-id-type="pmcid">PMC10012797</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref11">
                <label>11</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Mostafa</surname>
                            <given-names>RE</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Abdel-Rahman</surname>
                            <given-names>RF</given-names>
                        </name>
</person-group>:
                    <article-title>Ezetimibe alleviates acetic acid-induced ulcerative colitis in rats: targeting the Akt/NF-&#x03ba;B/STAT3/CXCL10 signaling axis.</article-title>
                    <source>

                        <italic toggle="yes">J. Pharm. Pharmacol.</italic>
</source>
                    <year>2023</year>;<volume>75</volume>(<issue>4</issue>):<fpage>533</fpage>&#x2013;<lpage>543</lpage>.
                    <pub-id pub-id-type="pmid">36892981</pub-id>
                    <pub-id pub-id-type="doi">10.1093/jpp/rgad013</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref12">
                <label>12</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Yu</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>WN</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Matei</surname>
                            <given-names>N</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Ezetimibe Attenuates Oxidative Stress and Neuroinflammation via the AMPK/Nrf2/TXNIP Pathway after MCAO in Rats.</article-title>
                    <source>

                        <italic toggle="yes">Oxidative Med. Cell. Longev.</italic>
</source>
                    <year>2020</year>;<volume>2020</volume>:<fpage>4717258</fpage>.</mixed-citation>
            </ref>
            <ref id="ref13">
                <label>13</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sabry</surname>
                            <given-names>AT</given-names>
                        </name>
</person-group>:
                    <article-title>Unleashing the cardioprotective potential of Ezetimibe against Doxorubicin-induced cardiotoxicity in Wistar rats: Targeting oxidative stress and NF-&#x03ba;B-mediated inflammation.</article-title>
                    <source>

                        <italic toggle="yes">Zenodo.</italic>
</source>
                    <year>2024</year>.</mixed-citation>
            </ref>
            <ref id="ref14">
                <label>14</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sabry</surname>
                            <given-names>AT</given-names>
                        </name>
</person-group>:
                    <article-title>Dataset for biochemical and gene expression analyses.</article-title>
                    <source>

                        <italic toggle="yes">Zenodo.</italic>
</source>
                    <year>2024</year>.</mixed-citation>
            </ref>
            <ref id="ref15">
                <label>15</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Cardinale</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Iacopo</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Cipolla</surname>
                            <given-names>CM</given-names>
                        </name>
</person-group>:
                    <article-title>Cardiotoxicity of Anthracyclines.</article-title>
                    <source>

                        <italic toggle="yes">Front. Cardiovasc. Med.</italic>
</source>
                    <year>2020</year>;<volume>7</volume>:<fpage>26</fpage>.
                    <pub-id pub-id-type="pmid">32258060</pub-id>
                    <pub-id pub-id-type="doi">10.3389/fcvm.2020.00026</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7093379</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref16">
                <label>16</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Al-Kuraishy</surname>
                            <given-names>HM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Al-Gareeb</surname>
                            <given-names>AI</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Alkhuriji</surname>
                            <given-names>AF</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Investigation of the impact of rosuvastatin and telmisartan in doxorubicin-induced acute cardiotoxicity.</article-title>
                    <source>

                        <italic toggle="yes">Biomed. Pharmacother.</italic>
</source>
                    <year>2022</year>;<volume>154</volume>:<fpage>113673</fpage>.
                    <pub-id pub-id-type="pmid">36942604</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.biopha.2022.113673</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref17">
                <label>17</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Haybar</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Goudarzi</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mehrzadi</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Effect of gemfibrozil on cardiotoxicity induced by doxorubicin in male experimental rats.</article-title>
                    <source>

                        <italic toggle="yes">Biomed. Pharmacother.</italic>
</source>
                    <year>2019</year>;<volume>109</volume>:<fpage>530</fpage>&#x2013;<lpage>535</lpage>.
                    <pub-id pub-id-type="pmid">30551518</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.biopha.2018.10.101</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref18">
                <label>18</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Karabulut</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ozturk</surname>
                            <given-names>E</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kaymak</surname>
                            <given-names>E</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Thymoquinone attenuates doxorubicin-cardiotoxicity in rats.</article-title>
                    <source>

                        <italic toggle="yes">J. Biochem. Mol. Toxicol.</italic>
</source>
                    <year>2021</year>;<volume>35</volume>(<issue>1</issue>):<fpage>e22618</fpage>.
                    <pub-id pub-id-type="pmid">32860490</pub-id>
                    <pub-id pub-id-type="doi">10.1002/jbt.22618</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref19">
                <label>19</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ibrahim</surname>
                            <given-names>AE</given-names>
                        </name>

                        <name name-style="western">
                            <surname>El-Yassin</surname>
                            <given-names>HD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Al-Janabi</surname>
                            <given-names>HK</given-names>
                        </name>
</person-group>:
                    <article-title>The impact of inflammation on Resistin, Insulin and Troponin I in Acute Myocardial Infarction patients.</article-title>
                    <source>

                        <italic toggle="yes">J. Fac. Med. Baghdad.</italic>
</source>
                    <year>2011</year>;<volume>53</volume>(<issue>3</issue>):<fpage>338</fpage>&#x2013;<lpage>342</lpage>.
                    <pub-id pub-id-type="doi">10.32007/jfacmedbagdad.533843</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref20">
                <label>20</label>
                <mixed-citation publication-type="book">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ohtsuki</surname>
                            <given-names>I</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Morimoto</surname>
                            <given-names>S</given-names>
                        </name>
</person-group>:
                    <chapter-title>Troponin.</chapter-title>
                    <person-group person-group-type="editor">

                        <name name-style="western">
                            <surname>Lennarz</surname>
                            <given-names>WJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lane</surname>
                            <given-names>MD</given-names>
                        </name>
</person-group>, editors.
                    <source>

                        <italic toggle="yes">Encyclopedia of Biological Chemistry.</italic>
</source>
                    <edition>2nd ed.</edition>
                    <publisher-loc>Waltham</publisher-loc>:
                    <publisher-name>Academic Press</publisher-name>;<year>2013</year>; pp.<fpage>445</fpage>&#x2013;<lpage>449</lpage>.</mixed-citation>
            </ref>
            <ref id="ref21">
                <label>21</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Birukov</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Eichelmann</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kuxhaus</surname>
                            <given-names>O</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Opposing Associations of NT-proBNP With Risks of Diabetes and Diabetes-Related Complications.</article-title>
                    <source>

                        <italic toggle="yes">Diabetes Care.</italic>
</source>
                    <year>2020</year>;<volume>43</volume>(<issue>12</issue>):<fpage>2930</fpage>&#x2013;<lpage>2937</lpage>.
                    <pub-id pub-id-type="pmid">32816995</pub-id>
                    <pub-id pub-id-type="doi">10.2337/dc20-0553</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7770272</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref22">
                <label>22</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Nasser</surname>
                            <given-names>TH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>El-Yassin</surname>
                            <given-names>HD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yakoob</surname>
                            <given-names>S</given-names>
                        </name>
</person-group>:
                    <article-title>&#x0392;-Natriuretic Peptide Level as a Predictor for the Severity of LV Dysfunction.</article-title>
                    <source>

                        <italic toggle="yes">J. Fac. Med. Baghdad.</italic>
</source>
                    <year>2008</year>;<volume>49</volume>(<issue>4</issue>):<fpage>438</fpage>&#x2013;<lpage>448</lpage>.
                    <pub-id pub-id-type="doi">10.32007/jfacmedbagdad.4941336</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref23">
                <label>23</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Rossi</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jabrah</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Douglas</surname>
                            <given-names>A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Investigating the Role of Brain Natriuretic Peptide (BNP) and N-Terminal-proBNP in Thrombosis and Acute Ischemic Stroke Etiology.</article-title>
                    <source>

                        <italic toggle="yes">Int. J. Mol. Sci.</italic>
</source>
                    <year>2024</year>;<volume>25</volume>(<issue>5</issue>).
                    <pub-id pub-id-type="pmid">38474245</pub-id>
                    <pub-id pub-id-type="doi">10.3390/ijms25052999</pub-id>
                    <pub-id pub-id-type="pmcid">PMC10931830</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref24">
                <label>24</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kittiwarawut</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Vorasettakarnkij</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tanasanvimon</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Serum NT-proBNP in the early detection of doxorubicin-induced cardiac dysfunction.</article-title>
                    <source>

                        <italic toggle="yes">Asia Pac. J. Clin. Oncol.</italic>
</source>
                    <year>2013</year>;<volume>9</volume>(<issue>2</issue>):<fpage>155</fpage>&#x2013;<lpage>161</lpage>.
                    <pub-id pub-id-type="pmid">22897825</pub-id>
                    <pub-id pub-id-type="doi">10.1111/j.1743-7563.2012.01588.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref25">
                <label>25</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Zidan</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sherief</surname>
                            <given-names>LM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>El-sheikh</surname>
                            <given-names>A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>NT-proBNP as early marker of subclinical late cardiotoxicity after doxorubicin therapy and mediastinal irradiation in childhood cancer survivors.</article-title>
                    <source>

                        <italic toggle="yes">Dis. Markers.</italic>
</source>
                    <year>2015</year>;<volume>2015</volume>:<fpage>513219</fpage>.</mixed-citation>
            </ref>
            <ref id="ref26">
                <label>26</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hassan</surname>
                            <given-names>ZM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hamdi</surname>
                            <given-names>RA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Al Bassam</surname>
                            <given-names>EN</given-names>
                        </name>
</person-group>:
                    <article-title>Evaluation of the Role of Serum Malondialdehyde in the Pathogenesis of Diabetic Retinopathy.</article-title>
                    <source>

                        <italic toggle="yes">J. Fac. Med. Baghdad.</italic>
</source>
                    <year>2022</year>;<volume>64</volume>(<issue>3</issue>):<fpage>195</fpage>&#x2013;<lpage>198</lpage>.
                    <pub-id pub-id-type="doi">10.32007/jfacmedbagdad.6431957</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref27">
                <label>27</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Thanoon</surname>
                            <given-names>IA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tawfik</surname>
                            <given-names>NO</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hussin</surname>
                            <given-names>FN</given-names>
                        </name>
</person-group>:
                    <article-title>Oxidative Stress &amp; C &#x2013; Reactive Protein In Patients With Arthritis.</article-title>
                    <source>

                        <italic toggle="yes">J. Fac. Med. Baghdad.</italic>
</source>
                    <year>2007</year>;<volume>49</volume>(<issue>2</issue>):<fpage>227</fpage>&#x2013;<lpage>230</lpage>.</mixed-citation>
            </ref>
            <ref id="ref28">
                <label>28</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Cicek</surname>
                            <given-names>B</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hacimuftuoglu</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yeni</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Chlorogenic Acid Attenuates Doxorubicin-Induced Oxidative Stress and Markers of Apoptosis in Cardiomyocytes via Nrf2/HO-1 and Dityrosine Signaling.</article-title>
                    <source>

                        <italic toggle="yes">J. Pers. Med.</italic>
</source>
                    <year>2023</year>;<volume>13</volume>(<issue>4</issue>).
                    <pub-id pub-id-type="pmid">37109035</pub-id>
                    <pub-id pub-id-type="doi">10.3390/jpm13040649</pub-id>
                    <pub-id pub-id-type="pmcid">PMC10140899</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref29">
                <label>29</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Elwany</surname>
                            <given-names>NE</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mahmoud</surname>
                            <given-names>NM</given-names>
                        </name>
</person-group>:
                    <article-title>Mohamed Abdel Hamid A: Hypericum perforatum alleviates doxorubicin induced cardiotoxicity in rats via enhancement of cardiac adiponectin-AMPK signaling.</article-title>
                    <source>

                        <italic toggle="yes">Zagazig Univ. Med. J.</italic>
</source>
                    <year>2020</year>;<volume>26</volume>(<issue>6</issue>):<fpage>1140</fpage>&#x2013;<lpage>1151</lpage>.
                    <pub-id pub-id-type="doi">10.21608/zumj.2020.333619</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref30">
                <label>30</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ali</surname>
                            <given-names>EA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tahseen</surname>
                            <given-names>YH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>El-Yassin</surname>
                            <given-names>HD</given-names>
                        </name>
</person-group>:
                    <article-title>Thyroid Disorders and the Level of Malondialdehyde.</article-title>
                    <source>

                        <italic toggle="yes">J. Fac. Med. Baghdad.</italic>
</source>
                    <year>2009</year>;<volume>51</volume>(<issue>1</issue>):<fpage>67</fpage>&#x2013;<lpage>70</lpage>.
                    <pub-id pub-id-type="doi">10.32007/jfacmedbagdad.5111179</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref31">
                <label>31</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ridha</surname>
                            <given-names>NM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Taher</surname>
                            <given-names>MA</given-names>
                        </name>
</person-group>:
                    <article-title>Oxidative Stress and Some Liver Functions Parameters in Patients with Symptomatic Cholelithiasis.</article-title>
                    <source>

                        <italic toggle="yes">J. Fac. Med. Baghdad.</italic>
</source>
                    <year>2013</year>;<volume>55</volume>(<issue>1</issue>):<fpage>73</fpage>&#x2013;<lpage>76</lpage>.
                    <pub-id pub-id-type="doi">10.32007/jfacmedbagdad.551674</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref32">
                <label>32</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Wu</surname>
                            <given-names>BB</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Leung</surname>
                            <given-names>KT</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Poon</surname>
                            <given-names>EN</given-names>
                        </name>
</person-group>:
                    <article-title>Mitochondrial-Targeted Therapy for Doxorubicin-Induced Cardiotoxicity.</article-title>
                    <source>

                        <italic toggle="yes">Int. J. Mol. Sci.</italic>
</source>
                    <year>2022</year>;<volume>23</volume>(<issue>3</issue>).
                    <pub-id pub-id-type="doi">10.3390/ijms23031912</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref33">
                <label>33</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Al-Aubaidy</surname>
                            <given-names>HA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>El-Yassin</surname>
                            <given-names>HD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hashim</surname>
                            <given-names>HM</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Oxidative DNA damage and Lipid Peroxidation as Markers of Oxidative Stress Type 2 Diabetic Patients.</article-title>
                    <source>

                        <italic toggle="yes">J. Fac. Med. Baghdad.</italic>
</source>
                    <year>2008</year>;<volume>50</volume>(<issue>1</issue>):<fpage>110</fpage>&#x2013;<lpage>119</lpage>.
                    <pub-id pub-id-type="doi">10.32007/jfacmedbagdad.5011317</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref34">
                <label>34</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Jungsuwadee</surname>
                            <given-names>P</given-names>
                        </name>
</person-group>:
                    <article-title>Doxorubicin-induced cardiomyopathy: An update beyond oxidative stress and myocardial cell death.</article-title>
                    <source>

                        <italic toggle="yes">Cardiovasc. Regen. Med.</italic>
</source>
                    <year>2016</year>;<volume>3</volume>:<fpage>e1127</fpage>.</mixed-citation>
            </ref>
            <ref id="ref35">
                <label>35</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kashkool</surname>
                            <given-names>AH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Al-Sabbagh</surname>
                            <given-names>MS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Al-Kashali</surname>
                            <given-names>DK</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The Possible Cytoprotective Effects of Antioxidant Drugs (Vitamin E and C) Against the Toxicity of Doxorubicin in Breast Cancer Patients.</article-title>
                    <source>

                        <italic toggle="yes">J. Fac. Med. Baghdad.</italic>
</source>
                    <year>2009</year>;<volume>51</volume>(<issue>1</issue>):<fpage>95</fpage>&#x2013;<lpage>100</lpage>.
                    <pub-id pub-id-type="doi">10.32007/jfacmedbagdad.5111190</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref36">
                <label>36</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hekmat</surname>
                            <given-names>AS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Navabi</surname>
                            <given-names>Z</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Alipanah</surname>
                            <given-names>H</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Alamandine significantly reduces doxorubicin-induced cardiotoxicity in rats.</article-title>
                    <source>

                        <italic toggle="yes">Hum. Exp. Toxicol.</italic>
</source>
                    <year>2021</year>;<volume>40</volume>(<issue>10</issue>):<fpage>1781</fpage>&#x2013;<lpage>1795</lpage>.
                    <pub-id pub-id-type="pmid">33882726</pub-id>
                    <pub-id pub-id-type="doi">10.1177/09603271211010896</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref37">
                <label>37</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Liao</surname>
                            <given-names>W</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rao</surname>
                            <given-names>Z</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wu</surname>
                            <given-names>L</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Cariporide Attenuates Doxorubicin-Induced Cardiotoxicity in Rats by Inhibiting Oxidative Stress, Inflammation and Apoptosis Partly Through Regulation of Akt/GSK-3&#x03b2; and Sirt1 Signaling Pathway.</article-title>
                    <source>

                        <italic toggle="yes">Front. Pharmacol.</italic>
</source>
                    <year>2022</year>;<volume>13</volume>:<fpage>850053</fpage>.
                    <pub-id pub-id-type="pmid">35747748</pub-id>
                    <pub-id pub-id-type="doi">10.3389/fphar.2022.850053</pub-id>
                    <pub-id pub-id-type="pmcid">PMC9209753</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref38">
                <label>38</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ma</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kandhare</surname>
                            <given-names>AD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mukherjee-Kandhare</surname>
                            <given-names>AA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Fisetin, a plant flavonoid ameliorates doxorubicin-induced cardiotoxicity in experimental rats: the decisive role of caspase-3, COX-II, cTn-I, iNOs and TNF-&#x03b1;.</article-title>
                    <source>

                        <italic toggle="yes">Mol. Biol. Rep.</italic>
</source>
                    <year>2019</year>;<volume>46</volume>(<issue>1</issue>):<fpage>105</fpage>&#x2013;<lpage>118</lpage>.
                    <pub-id pub-id-type="pmid">30362071</pub-id>
                    <pub-id pub-id-type="doi">10.1007/s11033-018-4450-y</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref39">
                <label>39</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sumneang</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tanajak</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Oo</surname>
                            <given-names>TT</given-names>
                        </name>
</person-group>:
                    <article-title>Toll-like Receptor 4 Inflammatory Perspective on Doxorubicin-Induced Cardiotoxicity.</article-title>
                    <source>

                        <italic toggle="yes">Molecules.</italic>
</source>
                    <year>2023</year>;<volume>28</volume>(<issue>11</issue>).
                    <pub-id pub-id-type="pmid">37298770</pub-id>
                    <pub-id pub-id-type="doi">10.3390/molecules28114294</pub-id>
                    <pub-id pub-id-type="pmcid">PMC10254273</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref40">
                <label>40</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hollomon</surname>
                            <given-names>MG</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Patterson</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Santiago-O&#x2019;Farrill</surname>
                            <given-names>J</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Knock down of Fas-Associated Protein with Death Domain (FADD) Sensitizes Osteosarcoma to TNF&#x03b1;-induced Cell Death.</article-title>
                    <source>

                        <italic toggle="yes">J. Cancer.</italic>
</source>
                    <year>2020</year>;<volume>11</volume>(<issue>7</issue>):<fpage>1657</fpage>&#x2013;<lpage>1667</lpage>.
                    <pub-id pub-id-type="pmid">32194778</pub-id>
                    <pub-id pub-id-type="doi">10.7150/jca.38721</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7052864</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref41">
                <label>41</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Zinatizadeh</surname>
                            <given-names>MR</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Schock</surname>
                            <given-names>B</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Chalbatani</surname>
                            <given-names>GM</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The Nuclear Factor Kappa B (NF-kB) signaling in cancer development and immune diseases.</article-title>
                    <source>

                        <italic toggle="yes">Genes Dis.</italic>
</source>
                    <year>2021</year>;<volume>8</volume>(<issue>3</issue>):<fpage>287</fpage>&#x2013;<lpage>297</lpage>.
                    <pub-id pub-id-type="pmid">33997176</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.gendis.2020.06.005</pub-id>
                    <pub-id pub-id-type="pmcid">PMC8093649</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref42">
                <label>42</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Al-Hassan</surname>
                            <given-names>AAH</given-names>
                        </name>
</person-group>:
                    <article-title>Role of Pro- and Anti-Inflammatory Cytokines in Rheumatoid Arthritis: Correlation with Disease Activity.</article-title>
                    <source>

                        <italic toggle="yes">J. Fac. Med. Baghdad.</italic>
</source>
                    <year>2010</year>;<volume>52</volume>(<issue>3</issue>):<fpage>286</fpage>&#x2013;<lpage>291</lpage>.
                    <pub-id pub-id-type="doi">10.32007/jfacmedbagdad.523976</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref43">
                <label>43</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Giridharan</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Srinivasan</surname>
                            <given-names>M</given-names>
                        </name>
</person-group>:
                    <article-title>Mechanisms of NF-&#x03ba;B p65 and strategies for therapeutic manipulation.</article-title>
                    <source>

                        <italic toggle="yes">J. Inflamm. Res.</italic>
</source>
                    <year>2018</year>;<volume>11</volume>:<fpage>407</fpage>&#x2013;<lpage>419</lpage>.
                    <pub-id pub-id-type="pmid">30464573</pub-id>
                    <pub-id pub-id-type="doi">10.2147/JIR.S140188</pub-id>
                    <pub-id pub-id-type="pmcid">PMC6217131</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref44">
                <label>44</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Liu</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zhong</surname>
                            <given-names>Z</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Karin</surname>
                            <given-names>M</given-names>
                        </name>
</person-group>:
                    <article-title>NF-&#x03ba;B: A Double-Edged Sword Controlling Inflammation.</article-title>
                    <source>

                        <italic toggle="yes">Biomedicine.</italic>
</source>
                    <year>2022</year>;<volume>10</volume>(<issue>6</issue>).
                    <pub-id pub-id-type="doi">10.3390/biomedicines10061250</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref45">
                <label>45</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Qin</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>LL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Liu</surname>
                            <given-names>ZY</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Ezetimibe Protects Endothelial Cells against Oxidative Stress through Akt/GSK-3&#x03b2; Pathway.</article-title>
                    <source>

                        <italic toggle="yes">Curr. Med. Sci.</italic>
</source>
                    <year>2018</year>;<volume>38</volume>(<issue>3</issue>):<fpage>398</fpage>&#x2013;<lpage>404</lpage>.
                    <pub-id pub-id-type="pmid">30074204</pub-id>
                    <pub-id pub-id-type="doi">10.1007/s11596-018-1892-3</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref46">
                <label>46</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Qin</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yang</surname>
                            <given-names>YB</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yang</surname>
                            <given-names>YX</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Anti-inflammatory activity of ezetimibe by regulating NF-&#x03ba;B/MAPK pathway in THP-1 macrophages.</article-title>
                    <source>

                        <italic toggle="yes">Pharmacology.</italic>
</source>
                    <year>2014</year>;<volume>93</volume>(<issue>1-2</issue>):<fpage>69</fpage>&#x2013;<lpage>75</lpage>.</mixed-citation>
            </ref>
            <ref id="ref47">
                <label>47</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>He</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ru</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wen</surname>
                            <given-names>T</given-names>
                        </name>
</person-group>:
                    <article-title>NRF2, a Transcription Factor for Stress Response and Beyond.</article-title>
                    <source>

                        <italic toggle="yes">Int. J. Mol. Sci.</italic>
</source>
                    <year>2020</year>;<volume>21</volume>(<issue>13</issue>).
                    <pub-id pub-id-type="pmid">32640524</pub-id>
                    <pub-id pub-id-type="doi">10.3390/ijms21134777</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7369905</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref48">
                <label>48</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Lee</surname>
                            <given-names>DH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Han</surname>
                            <given-names>DH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Nam</surname>
                            <given-names>KT</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Ezetimibe, an NPC1L1 inhibitor, is a potent Nrf2 activator that protects mice from diet-induced nonalcoholic steatohepatitis.</article-title>
                    <source>

                        <italic toggle="yes">Free Radic. Biol. Med.</italic>
</source>
                    <year>2016</year>;<volume>99</volume>:<fpage>520</fpage>&#x2013;<lpage>532</lpage>.
                    <pub-id pub-id-type="pmid">27634173</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.freeradbiomed.2016.09.009</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref49">
                <label>49</label>
                <mixed-citation publication-type="book">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Bhakkiyalakshmi</surname>
                            <given-names>E</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sireesh</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ramkumar</surname>
                            <given-names>KM</given-names>
                        </name>
</person-group>:
                    <chapter-title>Redox Sensitive Transcription via Nrf2-Keap1 in Suppression of Inflammation.</chapter-title>
                    <person-group person-group-type="editor">

                        <name name-style="western">
                            <surname>Chatterjee</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jungraithmayr</surname>
                            <given-names>W</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bagchi</surname>
                            <given-names>D</given-names>
                        </name>
</person-group>, editors.
                    <source>

                        <italic toggle="yes">Immunity and Inflammation in Health and Disease: Emerging Roles of Nutraceuticals and Functional Foods in Immune Support.</italic>
</source>
                    <publisher-loc>United States</publisher-loc>:
                    <publisher-name>Academic Press</publisher-name>;<year>2018</year>; pp.<fpage>149</fpage>&#x2013;<lpage>161</lpage>.
                    <pub-id pub-id-type="doi">10.1016/B978-0-12-805417-8.00012-3</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref50">
                <label>50</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Jakobi</surname>
                            <given-names>AJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Huber</surname>
                            <given-names>ST</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mortensen</surname>
                            <given-names>SA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Structural basis of p62/SQSTM1 helical filaments and their role in cellular cargo uptake.</article-title>
                    <source>

                        <italic toggle="yes">Nat. Commun.</italic>
</source>
                    <year>2020</year>;<volume>11</volume>(<issue>1</issue>):<fpage>440</fpage>.
                    <pub-id pub-id-type="pmid">31974402</pub-id>
                    <pub-id pub-id-type="doi">10.1038/s41467-020-14343-8</pub-id>
                    <pub-id pub-id-type="pmcid">PMC6978347</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report331613">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.171611.r331613</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Sumneang</surname>
                        <given-names>Natticha</given-names>
                    </name>
                    <xref ref-type="aff" rid="r331613a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r331613a1">
                    <label>1</label>Walailak University, Thai Buri, Nakhon Si Thammarat, Thailand</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>28</day>
                <month>10</month>
                <year>2024</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2024 Sumneang N</copyright-statement>
                <copyright-year>2024</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport331613" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.156321.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>1.&#x00a0;Given that EZE confers protection against doxorubicin-induced cardiac injury. It would also be interested to examine their effects on cardiac function.</p>
            <p> 2.&#x00a0;Although using EZE alleviated doxorubicin-induced cardiac toxicity by exhibiting antioxidant and&#x00a0;anti-inflammatory properties, it would be helpful to clarify the rationale for choosing EZE (a cholesterol-lowering drug) approach.</p>
            <p> 3. The focus of this study is the limited evidence establishing a cause-and-effect relationship between the proposed molecular mechanisms and the cardioprotective effects of EZE against DIC.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Partly</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Partly</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Partly</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Partly</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Partly</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>No</p>
            <p>Reviewer Expertise:</p>
            <p>cardiovascular system, inflammation, DIC</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
        <sub-article article-type="response" id="comment12737-331613">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Thaer</surname>
                            <given-names>Aya</given-names>
                        </name>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>29</day>
                    <month>10</month>
                    <year>2024</year>
                </pub-date>
            </front-stub>
            <body>
                <p>Dear Dr. Natticha Sumneang</p>
                <p> </p>
                <p> Thank you so much for reviewing our article, we're grateful for your feedback and suggestions.</p>
                <p> Here are our justifications:</p>
                <p> </p>
                <p> 1. Regarding cardiac function examination, we also recommend that it should be taken into consideration in future studies regarding the cardioprotective potential of EZE against DIC, as the current one focused on cardiac injury evaluation by measuring cardiac biomarkers.</p>
                <p> </p>
                <p> 2. Our rationale for choosing the cholesterol-lowering drug EZE to protect against DIC in our research is that previous studies revealed that EZE possesses defensive actions against oxidative stress and inflammation, which are two of the main proposed mechanisms underlying the development of DIC, and several studies supported the potential of EZE's pleiotropic effects in improving cardiovascular outcomes, however, none has carried out the current investigation. Hence, we aimed to inspect the possible protective effect of EZE against DIC in rats.</p>
                <p> </p>
                <p> 3. We agree that further investigations should be carried out, where other tests can be performed, or perhaps other mechanisms can be studied, as the current study focused on preventing DOX-induced cardiac injury by targeting oxidative stress and inflammation, nevertheless, we believe that the results obtained from the present study are promising and can motivate other researchers who are interested in the prevention of DIC.</p>
                <p> </p>
                <p> Also, we would be pleased to provide any additional details that you wish us to include in our research article, regarding methods, analysis or other sections.</p>
            </body>
        </sub-article>
    </sub-article>
</article>
