The study was conducted at a male maximum and female prison institution in Nairobi County. The Maximum prison has a capacity of 1400 prisoners but now houses 1800 and 2500 prisoners. Women’s prison is the largest in Kenya, with a capacity of 700 inmates. The two maximum prisons were selected purposely as the research site because of their geographical location, capacity, and proximity to the prison headquarters, allowing access to records as well as some key informants to participate in the study.

This was a cross-sectional study with laboratory investigation. Through purposive sampling, inmates with clinical symptoms of respiratory tract infections and UTI were recruited between January 2023 and March 2023. Sputum and urine samples were collected and shipped to the Mycology Division, Centre for Microbiology Research, Kenya Medical Research Institute (KEMRI) for fungal investigations using standard protocols. The isolates were identified using macro-and microscopic features. Antifungal susceptibility was determined using the broth microdilution method. Sociodemographic information, diagnosis, and intervention were sought using the data collection tool from consenting prison inmates. The study population consisted of adolescent and adult men and women aged 18-76 years old who were crime suspects or convicts at the prison and presented with clinical manifestations of respiratory and urogenital infections.

Fungal culture and identification

Sputum and urine samples were subjected to direct microscopy and cultured on Sabouraud dextrose agar supplemented with chloramphenicol (16 mg/ml). The inoculated SDA plates were incubated at 35°C for four weeks and examined daily for growth. Yeast isolates were differentiated using the CHROMagar ^® Candida and Dalmau techniques. Morphological features, such as hyphae, pseudohyphae, blastospores, chlamydospores, basidiospores, and sporangia, were noted.

Mold identification was performed using standard macroscopic features, such as colony growth rate, surface color, and reverse, texture, and diffusing pigments. Microscopic features of lactophenol cotton blue stain at ×40 magnification such as conidia, shape, and arrangement of phialides, were used. Clarus Histoplasma GM Enzyme Immunoassay (IMMY, Norman Oklahoma) was used to detect Histoplasma antigens in urine samples according to the manufacturer’s instructions. ¹³ Titres of 1.0 EIA units were interpreted as positive for histoplasma antigen, whereas values less than 1.0 were interpreted as negative.

Antifungal resistance testing

The minimum inhibitory concentrations of fluconazole, itraconazole, and voriconazole were determined using the broth microdilution method. ¹⁴ Briefly, 9.6 mg of azoles (Fluconazole, Itraconazole and Voriconazole) was dissolved in 3.0 ml of DMSO to get 1600 μg/ml (Sigma chemicals, USA) stock drug concentration while the required concentration was achieved with further dilution with RPMI. Briefly, the final dilution was achieved by serial dilution where 4.9 ml of RPMI was added to each of the ten tubes. Two hundred microlitres of the test concentration was dispensed into microtiter plates and inoculated with 10 μl of the 0.2 MacFarland concentration of inoculum. The plates were then incubated at 30°C for 72 h. The MIC values of all the drugs were determined visually as the lowest concentrations with no visible growth. The European Committee on Antimicrobial Susceptibility (EUCAST) drug-susceptible control strain ATCC 46645 was used for QC. Antifungal susceptibility was interpreted based on the European Committee on Antimicrobial Susceptibility Testing (EUCAST). The results were interpreted based on the EUCAST breakpoints for itraconazole (resistant isolates: MIC > 1 mg/L) and voriconazole (resistant isolates: MIC > 2 mg/L). Eucast has no set break points for fluconazole; therefore, in this study, susceptibility testing to fluconazole was based on the Clinical and Laboratory Standard Institute M38-A2 protocol. ¹⁵

DNA extraction from fungal isolates

Extraction of DNA from the fungal isolates was undertaken according to the method described by (Kumar, 2018). Mycelial tufts were boiled for 10 min, vortexed and boiled for other 10 min and then centrifuged at 14,900 g for 5 min at 25 °C. 250 μl of supernatant were added to an equal amount of isopropanol, and incubated at −80°C for 30 min. After centrifugation at 14,900 g for 2 min, the pellet was washed with 70% ethanol, centrifuged at 14,900 g for 5 min, dried, and suspended in 20 μl of ultrapure H ₂O.

Molecular determination of antifungal resistance genes

PCR amplification of resistant genes from fungal isolates was carried according to the method described by Raja et al. (2017). Briefly, a reaction volume of 25 ul was constituted comprising of: 12.5 ul 1x Taq standard buffer [20 mM Tris/HCL (Ph 8.9@25°C), 22 mMKCl, 1.8 mM MgCl ₂, 22 Mm NH ₄Cl,0.2 mM DNTPs, 5% glycerol, 0.06% IGEPALR CA-630, 0.05% TweenR 20, 25 units/ml One Taq DNA Polymerase], template DNA 1 ul, 10 Um forward primer 0.5 ul, 10 uM reverse primer 0.5 ul and nuclease free water to 25 ul. The thermocycler PCR conditions was set as per the requirement of specific primers. For the detection of antimicrobial resistant genes, the Thermo-cycler conditions was set as initial denaturation at 95°C for 3 minutes, followed by 40 cycles of denaturation at 95°C for 1 minute, annealing at 60°C for 30 seconds, and elongation at 72°C for 1 minute 30 seconds, followed by a final elongation step at 72°C for 10 minutes in a thermal cycler.

Bases sequence of PCR primers for gene CYP51A

F - GCGCGCATGAGGGAGAT, 25 nmol 1

R - CAATGCATGAGGTTCCAGATC A, 25 nmol ¹⁹

Gel electrophoresis

PCR products were run on a gel to determine resistance genes. Electrophoresis was performed in 1.5% agarose (wt/vol) in Tris-borate EDTA (TBE) buffer. A 1000 base pair (bp) DNA ladder was run concurrently with amplicons for sizing of the bands. The gel was run at 100V for 40 mins. The gel was visualized using ethidium bromide under UV illumination and photographed.

Data were analyzed using SPSS software version 26. Chi-square test and multivariate logistic regression analysis were performed to investigate the correlation between the independent variables and the isolation of fungal isolates. Chi-square test analysis was applied to determine sociodemographic factors and variables associated with fungal infections in patients with respiratory and urogenital-like symptoms. Logistic regression was used to calculate the odds ratios (ORs) with 95% confidence. Statistical significance was set at p<0.05.

The study’s Ethical approval was obtained from Institutional Ethics and Review Committee at Jomo Kenyatta University of Agriculture and Technology (Ref No: JKU/ISERC/02316/0735, 22nd September 2022), National Commission for Science Tech & Innovation (Ref No: 659559, 19th October 2022), Kenyatta National Hospital University of Nairobi Ethical Review Committee (Ref No: KNH-ERC/RR/14, 9th February 2023) and Kenya Prison Service (PRIS19/26 VOLII/167, 3rd October 2022).

Of 162 samples investigated from the two prisons, 86 were sputa and 76 were urine samples. A total of 94 (58%) samples were positive for fungi, 19 (20%) for molds, and 75 (80%) for yeasts ( Table 1). Of the 94 positive fungi, 7 (7.4%) tested positive for Aspergillus flavus and 5 (5.3%) were Aspergillus fumigatus. Histoplasma antibodies were detected in 5.3% of the samples. Aspergillus flavus was the predominant filamentous fungus isolated, as shown in Figure 1.

A total of 162 samples analyzed comprising 86 sputum and 76 urine samples.

Overall, 11% (17/162) of fungi (Aspergillus fumigatus, Histoplasma, Aspergillus flavus) were isolated in both facilities. However, non of the inmates tested positive for respiratory Cryptococcol infections, only 6% (10/162) of isolated fungi were from males Prisons whereby Aspergillus flavus accounted for, 4.3%, Aspergillus fumigatus accounted for 3.2% and histoplasma accounted for 3.2% 4% (7/162) of isolated fungi were from female prison whereby Aspergillus flavus accounted for 4.4%, Aspergillus fumigatus accounted for 2.9% and histoplasma accounted for 1.8%.

A total of 162 clinical samples were analyzed, comprising 86 sputum and 76 urine specimens. Among the 94 samples obtained from male inmates (sputum = 53; urine = 41), 12 (23%) respiratory samples were positive for moulds, while 27 (51%) yielded yeasts. Urogenital yeast infections were detected in 46% of urine samples from male inmates. Similarly, among the 68 samples collected from female inmates (sputum = 33; urine = 35), 7 (21%) respiratory samples were positive for moulds, and 14 (42%) were positive for yeasts. 15 (43%) of the urine sample tested positive for yeasts. Chi-square analysis revealed a statistically significant difference (p < 0.05) in the distribution of fungal isolates between the respiratory and urogenital tracts across both genders. However, no statistically significant difference (p > 0.05) was observed in the overall prevalence of fungal infections between male and female inmates.

Twelve isolates of Aspergillus fumigatus (5) and Aspergillus flavus (7) obtained from sputum samples were subjected to antifungal susceptibility testing comprising itraconazole and voriconazole. A total of 5 isolates (41.7%) were resistant to itraconazole. Only three (25 %) Aspergillus flavus isolates were resistant to itraconazole. Two (16.7 %) isolates of Aspergillus fumigatus were resistant to itraconazole. However, all Aspergillus fumigatus and Aspergillus flavus isolates were susceptible to voriconazole ( Table 2).

According to Eucast 5 strains of Aspergilus species had MIC ≥1mg/to Itraconazole. A. flavus was resistant to itraconazole at 2 mg with 25%(3/12), while Aspergillus fumigatus was resistant to Itraconazole at 4 mg/L with 16.7%(2/12).

All the 12 Aspergillus species were sensitive to voriconazole having MIC ≤0.5 Mg/L to voriconazole while 7(58%) of the aspergillus were sensitive to itraconazole having MIC ≤ 0.5 Mg/L.

The sensitivity rate of Aspergillus species to voriconazole was 100% and that to itraconazole was 58% ( Table 2).

Six isolates of Aspergillus fumigatus (3) and Aspergillus flavus (3) obtained from sputum samples were subjected to molecular analysis for the presence of the antifungal resistance gene, cyp51a, responsible for resistance against azole class of antifungals. However, only 2 isolates (16.7%), one each of A. flavus and A. fumigatus, respectively, tested positive for the resistance gene, while 10 other isolates tested negative.

The study’s Ethical approval was obtained from Institutional Ethics and Review Committee at Jomo Kenyatta University of Agriculture and Technology (Ref No: JKU/ISERC/02316/0735, 22nd September 2022),National Commission for Science Tech & Innovation (Ref No: 659559, 19th October 2022) Kenyatta National Hospital University of Nairobi Ethical Review Committee (Ref No: KNH-ERC/RR/14, 9th February 2023) and Kenya Prison Service (PRIS19/26 VOLII/167, 3rd October 2022).