<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.142769.1</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>Impact of 
                    <italic>hemB</italic> mutations on 5-aminolevulinic acid production in 
                    <italic>Escherichia coli</italic>
                </article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 1; peer review: 1 approved, 1 approved with reservations]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Ninomiya</surname>
                        <given-names>Koki</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Yoneda</surname>
                        <given-names>Kohei</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Maeda</surname>
                        <given-names>Yoshiaki</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Iwata</surname>
                        <given-names>Yasushi</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a3">3</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Suzuki</surname>
                        <given-names>Iwane</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-5591-9642</uri>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Graduate School of Life and Environmental Sciences, University of Tsukuba, Tsukuba, Ibaraki, 305-8572, Japan</aff>
                <aff id="a2">
                    <label>2</label>Institute of Life and Environmental Sciences, University of Tsukuba, Tsukuba, Ibaraki, 305-8572, Japan</aff>
                <aff id="a3">
                    <label>3</label>Research Institute for Advanced Electronics and Photonics, National Institute of Advanced Industrial Science and Technology, Tsukuba, Ibaraki, 305-8568, Japan</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:iwanes6803@biol.tsukuba.ac.jp">iwanes6803@biol.tsukuba.ac.jp</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>23</day>
                <month>2</month>
                <year>2024</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2024</year>
            </pub-date>
            <volume>13</volume>
            <elocation-id>142</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>4</day>
                    <month>1</month>
                    <year>2024</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2024 Ninomiya K et al.</copyright-statement>
                <copyright-year>2024</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/13-142/pdf"/>
            <abstract>
                <sec>
                    <title>Background</title>
                    <p>Microbial production of 5-aminolevulinic acid (ALA) attracts attention due to a wide range of biotechnological and medical applications of ALA, including cancer treatment and diagnosis. Various genetic engineering approaches have been employed to improve ALA production in bacterial hosts such as 
                        <italic toggle="yes">Escherichia coli</italic> possessing the C5 pathway. Glutamyl-tRNA reductase (GluTR) encoded by 
                        <italic toggle="yes">hemA</italic>, glutamate-1-semialdehyde aminotransferase (GSA-AT) encoded by 
                        <italic toggle="yes">hemL</italic>, and ALA dehydratase (ALAD) encoded by 
                        <italic toggle="yes">hemB</italic> play important roles in ALA metabolism including the C5 pathway. Attenuation of the intercellular ALAD activity, which condensates 2 molecules of ALA to synthesize porphobilinogen (PBG), has been employed by various measures. However, a mutation approach by substituting catalytically important residues in ALAD encoded by 
                        <italic toggle="yes">hemB</italic> has never been attempted. The aim of this study is to assess the impact of 
                        <italic toggle="yes">hemB</italic> mutations on the ALA production in 
                        <italic toggle="yes">E. coli.</italic>
                    </p>
                </sec>
                <sec>
                    <title>Methods</title>
                    <p>In this study, the authors mutated the amino acid residues potentially related to the enzymatic activity of 
                        <italic toggle="yes">E. coli</italic> ALAD by referring to a mutation experiment of human ALAD. The authors created five types of mutated 
                        <italic toggle="yes">hemB</italic> genes, introduced these genes to the 
                        <italic toggle="yes">hemB</italic>-deleted mutant strain of 
                        <italic toggle="yes">E. coli</italic>, and assessed the impact of the ALAD mutations on ALA production. In addition, 
                        <italic toggle="yes">hemA, hemL</italic>, and 
                        <italic toggle="yes">rhtA</italic> encoding an ALA exporter were introduced to the 
                        <italic toggle="yes">E. coli</italic> possessing a mutated 
                        <italic toggle="yes">hemB.</italic>
                    </p>
                </sec>
                <sec>
                    <title>Results</title>
                    <p>The authors revealed that the mutations of ALAD employed in this study did not significantly enhance ALA production. Overexpression of 
                        <italic toggle="yes">hemA, hemL</italic>, and 
                        <italic toggle="yes">rhtA</italic> substantially increased ALA production in any 
                        <italic toggle="yes">E. coli</italic> strain possessing mutated 
                        <italic toggle="yes">hemB</italic>, while a difference in ALA production of the strain could be rather attributed to its growth behaviour than ALAD inactivation.</p>
                </sec>
                <sec>
                    <title>Conclusions</title>
                    <p>This study provides an important piece of information to design the bioprocess of ALA production using 
                        <italic toggle="yes">E. coli</italic> engineered through the C5 pathway.</p>
                </sec>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>5-aminolevulinic acid</kwd>
                <kwd>5-aminolevulinic acid dehydratase</kwd>
                <kwd>hemB</kwd>
                <kwd>hemA</kwd>
                <kwd>hemL</kwd>
                <kwd>rhtA</kwd>
            </kwd-group>
            <funding-group>
                <award-group id="fund-1">
                    <funding-source>Japanese Society for the Promotion of Sciences</funding-source>
                    <award-id>JP17H00800</award-id>
                </award-group>
                <award-group id="fund-2" xlink:href="http://dx.doi.org/10.13039/501100002241">
                    <funding-source>Japan Science and Technology Agency</funding-source>
                    <award-id>JPMJOP1832</award-id>
                </award-group>
                <funding-statement>This study was supported by the JSPS KAKENHI [JP17H00800] and the JST OPERA [JPMJOP1832].</funding-statement>
                <funding-statement>
                    <italic>The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.</italic>
                </funding-statement>
            </funding-group>
        </article-meta>
    </front>
    <body>
        <sec id="sec5" sec-type="intro">
            <title>Introduction</title>
            <p>5-aminolevulinic acid (ALA) is an intermediate in the synthetic pathway of porphyrin derivatives indispensable to life such as heme, vitamin B
                <sub>12</sub> and chlorophyll, and thus found in a wide range of prokaryotic and eukaryotic organisms.
                <sup>
                    <xref ref-type="bibr" rid="ref1">1</xref>
                </sup> ALA has been useful compounds or agents of very considerable interest because it is applicable to various biotechnologies including diagnosis and treatment of cancer, biodegradable herbicide, and growth promotion factor for plants.
                <sup>
                    <xref ref-type="bibr" rid="ref2">2</xref>
                </sup>
            </p>
            <p>Industrial production of ALA was conventionally performed using a photosynthetic bacterium 
                <italic toggle="yes">Rhodobacter sphaeroides</italic> possessing the C4 pathway in which ALA synthase (EC 2.3.1.37) produces ALA from glycine and succinyl-CoA.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>
                </sup> The mutation and metabolic engineering approaches of 
                <italic toggle="yes">R. sphaeroides</italic> have successfully demonstrated a significant improvement in ALA productivity.
                <sup>
                    <xref ref-type="bibr" rid="ref4">4</xref>
                </sup> Another option is to use bacteria (including 
                <italic toggle="yes">Escherichia coli</italic>) that possess another pathway of ALA-synthesis referred to as the C5 pathway, which originates with glutamate (Glu) and subsequently glutamyl-tRNA, glutamate-1-semialdehyde leading to ALA (
                <xref ref-type="fig" rid="f1">Figure 1</xref>).
                <sup>
                    <xref ref-type="bibr" rid="ref5">5</xref>
                </sup>
                <sup>&#x2013;</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref7">7</xref>
                </sup> The enzymes that specify the C5 pathway to produce the precursors of ALA accumulation are glutamyl-tRNA reductase (GluTR, EC 1.2.1.70) encoded by 
                <italic toggle="yes">hemA</italic> and glutamate-1-semialdehyde aminotransferase (GSA-AT, EC 5.4.3.8) encoded by 
                <italic toggle="yes">hemL.</italic> In the downstream pathway of the C5 pathway, ALA dehydratase (ALAD, EC 4.2.1.24) encoded by 
                <italic toggle="yes">hemB</italic> condensates two molecules of ALA to synthesize porphobilinogen (PBG), which is converted to various types of tetrapyrrole including heme. Membrane transporter RhtA encoded by 
                <italic toggle="yes">rhtA</italic> serves as an exporter of ALA.</p>
            <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                <label>Figure 1. </label>
                <caption>
                    <title>C5 pathway to produce 5-aminolevulinic acid (ALA) and the subsequent heme-synthesizing pathway in 
                        <italic toggle="yes">Escherichia coli.</italic>
                    </title>
                    <p>The genes 
                        <italic toggle="yes">hemA</italic> encoding glutamyl-tRNA reductase (GluTR), 
                        <italic toggle="yes">hemL</italic> encoding glutamate-1-semialdehyde aminotransferase (GSA-AT), 
                        <italic toggle="yes">hemB</italic> encoding ALA dehydratase (ALAD), and RhtA-encoding gene were engineered in this study.</p>
                </caption>
                <graphic id="gr1" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/156352/d3026619-81e8-4f8f-aa09-49b01305dee6_figure1.gif"/>
            </fig>
            <p>Various types of genetic engineering approaches have been examined to enhance ALA production through the C5 pathway. Kang 
                <italic toggle="yes">et al.</italic>, obtained a high ALA accumulation in 
                <italic toggle="yes">E. coli</italic> through the synergetic effect of the endogenous 
                <italic toggle="yes">hemL</italic> and heterologous 
                <italic toggle="yes">hemA</italic>
                <italic toggle="yes">
                    <sup>M</sup>
                </italic> that was mutated to stabilize the encoding GluTR structurally.
                <sup>
                    <xref ref-type="bibr" rid="ref8">8</xref>
                </sup> They also found that overexpression of 
                <italic toggle="yes">rhtA</italic> increased ALA production. Inhibiting the conversion of ALA to porphyrin derivatives is also a well-known strategy to improve ALA production. Since the ALDA encoded by the 
                <italic toggle="yes">hemB</italic> gene plays a crucial role in synthesizing porphyrin derivatives essential to the cellular growth, an efficient inhibitory node can be arranged on the downstream metabolic pathways not by completely knocking-out 
                <italic toggle="yes">hemB</italic> but by lowering the ALAD enzyme activity (
                <xref ref-type="fig" rid="f1">Figure 1</xref>). Zhang 
                <italic toggle="yes">et al.</italic>, verified inactivation of the ALAD enzyme activity in 
                <italic toggle="yes">Corynebacterium glutamicum</italic> as reduced to 47% and 69% in contrast with the enhancement of ALA accumulation as 1.34 and 1.19 times, respectively, by replacing the intrinsic ribosome-binding site (RBS) of 
                <italic toggle="yes">hemB</italic> to relatively weak RBS along with overexpression of 
                <italic toggle="yes">hemA</italic>, 
                <italic toggle="yes">hemL</italic> and 
                <italic toggle="yes">rhtA.</italic>
                <sup>
                    <xref ref-type="bibr" rid="ref9">9</xref>
                </sup> Attenuation of the 
                <italic toggle="yes">hemB</italic> expression was also achieved by some other approaches such as promoter exchanging,
                <sup>
                    <xref ref-type="bibr" rid="ref10">10</xref>
                </sup> CRISPRi,
                <sup>
                    <xref ref-type="bibr" rid="ref11">11</xref>
                </sup> and antisense RNA expression.
                <sup>
                    <xref ref-type="bibr" rid="ref12">12</xref>
                </sup> Although researchers have examined various approaches to downregulation of the transcriptional or translational levels of 
                <italic toggle="yes">hemB</italic> for enhancement of ALA production, the authors have first attempted the mutation approach to lower the enzymatic activity of ALAD.</p>
            <p>It has been known that the human ALAD forms quaternary homo-oligomers (four types of morpheein forms) of high-activity octamer, transient hugging dimer, transient detached dimer, and low-activity hexamer.
                <sup>
                    <xref ref-type="bibr" rid="ref13">13</xref>
                </sup> In rare cases, heteromeric oligomers were found in the human ALAD of patients with ALAD porphyria with more than one genetic aberration.
                <sup>
                    <xref ref-type="bibr" rid="ref13">13</xref>
                </sup> The heteromeric oligomers comprise the wild-type K59 or N59 and the mutant F12L. The F12L variant forms a stable homohexamer and possesses a significantly low enzymatic activity, whereas the wild type K59 and N59 variants form a stable homooctamer (hexameric morpheein concentration is 0% and 3%, respectively) and possess a high enzymatic activity. Jaffe and Stith demonstrated that porphyria-associated mutation in the human ALAD causes the morpheein equilibrium to be shifted toward the inactive hexamer.
                <sup>
                    <xref ref-type="bibr" rid="ref13">13</xref>
                </sup> Inspired by the study, the authors considered that some mutations in the 
                <italic toggle="yes">E. coli</italic> ALAD also have a certain possibility of the morpheein shift toward the hexameric assembly for leading to enzymatic inactivation and an increase in ALA accumulation of the genetically engineered 
                <italic toggle="yes">E. coli.</italic>
            </p>
            <p>In the present study, the specific amino acid residues on 
                <italic toggle="yes">E. coli</italic> ALAD was first identified to correspond to the enzymatically important residues on the human ALAD, and then inactive residues were substituted for the specific residues. Subsequently, the impacts of these mutations on ALA accumulation in the 
                <italic toggle="yes">E. coli</italic> cells were analysed. Furthermore, the synergetic effects of these ALAD mutations and overexpression of RhtA, GluTR (encoded by 
                <italic toggle="yes">hemA</italic>) and GSA-AT (encoded by 
                <italic toggle="yes">hemL</italic>) were also examined.</p>
        </sec>
        <sec id="sec6" sec-type="methods">
            <title>Methods</title>
            <sec id="sec7">
                <title>Bacterial strains and culture conditions</title>
                <p>
                    <italic toggle="yes">E. coli</italic> strain W3110 hemB (mutant with 
                    <italic toggle="yes">hemB</italic> deletion, kanamycin resistance) was obtained from National BioResource Project (National Institute of Genetics (NIG), Shizuoka, Japan). Molecular cloning was performed using 
                    <italic toggle="yes">E. coli</italic> strain JM109. 
                    <italic toggle="yes">E.</italic> 
                    <italic toggle="yes">coli</italic> was cultured at 37&#x00b0;C in the lysogeny broth (LB) medium containing appropriate combinations of 50 &#x03bc;g/mL kanamycin sulphate (FUJIFILM Wako Pure Chemical Co., Catalogue number: 113-00343), 50 &#x03bc;g/mL chloramphenicol (FUJIFILM Wako Pure Chemical Co., Catalogue number: 034-10572), 100 &#x03bc;g/mL spectinomycin dihydrochloride pentahydrate (FUJIFILM Wako Pure Chemical Co., Catalogue number: 152067) or 150 &#x03bc;g/mL ampicillin sodium (FUJIFILM Wako Pure Chemical Co., Catalogue number: 012-23303) for selection. Isopropyl-&#x03b2;-D-thiogalactopyranoside (IPTG, final concentration: 0.1 mM, TaKaRa Bio Inc., Catalogue number: 9030) was added to induce the expression of the genes under the control of the 
                    <italic toggle="yes">lac</italic> promoter.</p>
            </sec>
            <sec id="sec8">
                <title>Alignment of proteins structures</title>
                <p>Protein structures of ALAD derived from 
                    <italic toggle="yes">Homo sapience</italic> (
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.2210/pdb1E51/pdb">PDB 1E51</ext-link>) and 
                    <italic toggle="yes">E. coli</italic> (
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.2210/pdb1B4E/pdb">PDB 1B4E</ext-link>) were obtained from the Protein Data Bank (PDB). Alignment of the protein structures was carried out using 
                    <ext-link ext-link-type="uri" xlink:href="http://www.pymol.org/">PyMoL</ext-link> (RRID:SCR_000305) (The PyMOL Molecular Graphics System, Version 2.0 Schr&#x00f6;dinger, LLC.).</p>
            </sec>
            <sec id="sec9">
                <title>Plasmid construction</title>
                <p>Primers, plasmids, and 
                    <italic toggle="yes">E. coli</italic> strains used in this study are listed in 
                    <xref ref-type="table" rid="T1">Tables 1</xref>, 
                    <xref ref-type="table" rid="T2">2</xref>, and 
                    <xref ref-type="table" rid="T3">3</xref>, respectively. pACYCDuet-1 (carrying the P15A replicon origin, ~10 copies/cell) was purchased from Sigma-Aldrich Co. (Catalogue number: 71147, St. Louis, MO, USA). A partial fragment of pACYCDuet-1 without 
                    <italic toggle="yes">lac</italic>-promoter was amplified by PCR using primers of pACYCDuet_F and pACYCDuet_R and PrimeSTAR Max DNA polymerase (TaKaRa Bio Inc., Shiga, Japan, Catalogue number: R045A). PCR amplification experiments were performed using the PCR machines (Takara Bio Inc., model TP350 and Blue-Ray Biotech Co., TurboCycler, model TCST-9612) with the thermal cycling condition unless otherwise noted; after the initial denaturation step at 98&#x00b0;C for 1 min, 30 cycles of the denaturation step at 98&#x00b0;C for 10 sec, annealing step at 50~68&#x00b0;C for 5 or 15 sec, and extension step at 72&#x00b0;C for 1 min/kbp, followed by an additional extension step at 72&#x00b0;C for 4 min. The 
                    <italic toggle="yes">hemB</italic> along with native 
                    <italic toggle="yes">hemB</italic> promoter was amplified by PCR using primers of hemB promoter+hemB_F and hemB promoter+hemB_R with the extracted 
                    <italic toggle="yes">E. coli</italic> genome as a template. DNA concentrations were measured using NanoDrop 1000 (Thermo Fisher Scientific, Waltham, MA, USA). These fragments were assembled by In-Fusion HD Cloning Kit (TaKaRa Bio Inc., Catalogue number: 639634) at 50&#x00b0;C for 15 min. The assembled samples were introduced into 
                    <italic toggle="yes">E. coli</italic> strain JM109 by heat shock method (42&#x00b0;C, 45 sec). The colonies were cultivated in LB agar (1.5%) medium containing 50 &#x03bc;g/mL chloramphenicol. The assembly of the plasmid was confirmed by restriction enzyme treatment, followed by Sanger sequencing. The resulting plasmid were designed as pACYC-hemB. Additionally, five types of plasmids containing mutated 
                    <italic toggle="yes">hemB</italic> (namely 
                    <italic toggle="yes">hemB</italic>&#x2019;[K13L], 
                    <italic toggle="yes">hemB</italic>&#x2019;[E87K], 
                    <italic toggle="yes">hemB</italic>&#x2019;[G131R], 
                    <italic toggle="yes">hemB</italic>&#x2019;[G268T], 
                    <italic toggle="yes">hemB</italic>&#x2019;[A269M]) were constructed by inverse PCR using pACYC-hemB as a template and one of the following primer sets, hemB_K13L_F and hemB_K13L_R, hemB_E87K_F and hemB_E87K_R, hemB_G131R_F and hemB_G131R_R, hemB_G268T_F and hemB_G268T_R, and hemB_A269M_F and hemB_A269M_R. The amplified fragments were assembled as described above. The resulting plasmids were designed as pACYC-hemB&#x2019;[K13L], pACYC-hemB&#x2019;[E87K], pACYC-hemB&#x2019;[G131R], pACYC-hemB&#x2019;[G268T], and pACYC-hemB&#x2019;[A269M], respectively.</p>
                <table-wrap id="T1" orientation="portrait" position="float">
                    <label>Table 1. </label>
                    <caption>
                        <title>Primers used in this study.</title>
                        <p>F, forward; R, reverse.</p>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Name</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Sequence (5&#x2032;-3&#x2032;)</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">pACYCDuet_F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GCTTCCGGTAGTCAATAAAC</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">pACYCDuet_R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TTAGCTCACTCATTAGGCAC</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">hemB promoter + hemB_F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TAATGAGTGAGCTAATGTCAACATCGCGACAACTT</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">hemB promoter + hemB_R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TTGACTACCGGAAGCTTAACGCAGAATCTTCTTCT</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">hemB_K13L_F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GCCTGCGCTTATCTCCTGCG</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">hemB_K13L_R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CGCAGGAGATAAGCGCAGGC</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">hemB_E87K_F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">ATACCGATAAAACCGGCAGC</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">hemB_E87K_R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GCTGCCGGTTTTATCGGTAT</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">hemB_G131R_F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GTCACTGCCGTGTGCTGTGC</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">hemB_G131R_R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GCACAGCACACGGCAGTGAC</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">hemB_G268T_F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TGCCGATTACCGCGTATCAG</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">hemB_G268T_R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CTGATACGCGGTAATCGGCA</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">hemB_A269M_F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CGATTGGCATGTATCAGGTG</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">hemB_A269M_R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CACCTGATACATGCCAATCG</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">pCL1920_F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TCACACAGGAAACAGCTATG</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">pCL1920_R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GAAGTAATCGCAACACCGC</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">rhtA_In_pCL1920_F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAGGAAACAGCTATGCCTGGTTCATTACGTAA</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">rhtA_In_pCL1920_R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AATCGCAACATCCGCTTAATTAATGTCTAATTCTT</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">pMD19_In_hemL_F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TTTGCGAAGTTGTGACGCTTACAGACAAGCTGTGA</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">pMD19_In_hemA_R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CATAGCTGTTTCCTGTGTGA</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">hemA_In_pMD19_F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAGGAAACAGCTATGACGAAGAAACTTCTGGCACCT</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">hemA_In_hemL_R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GGAGGGTTCCTCCTTACTCG</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">hemL_In_hemA_F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AAGGAGGAACCCTCCATGAGTAAGTCTGAAAATCT</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">hemL_In_pMD19_R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TCACAACTTCGCAAACACCC</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">pCLS-rhtA_F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GGAGGGTTCCTCCTCGCAATAGTTGGCGAAGTAAT</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">pCLS-rhtA_R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GGCTGTGAGCAATTATGTGC</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">hemA-hemL_F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GAGGAGGAACCCTCCATGACGAAGAAACTT</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">hemA-hemL_R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TAATTGCTCACAGCCTCACAACTTCGCAAACACCC</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">pACYCDuet_seq_1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CATACGATATAAGTTGTAAT</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">pACYCDuet_seq_2</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAGACACCTGCTTCTGTGAA</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">pACYCDuet_seq_3</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TGTCGGCAGAATGCTTAATG</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">pMD-hemA-hemL_seq_1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TAGCTCACTCATTAGGCACC</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">pMD-hemA-hemL_seq_2</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GATAAACAGTGGAGTGCCGC</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">pMD-hemA-hemL_seq_3</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TGACCAACCGCCTGATCCAT</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">pMD-hemA-hemL_seq_4</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">ACATTAACCTATAAAAATAG</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">pCLS-rhtA_seq_1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CCCGTCTTACTGTCGGGAAT</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">pCLS-rhtA_seq_2</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AGTCGGCAAATAATGTCTAA</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <table-wrap id="T2" orientation="portrait" position="float">
                    <label>Table 2. </label>
                    <caption>
                        <title>Vectors used in this study.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Plasmid</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Description</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pACYCDuet-1</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">p15A ori, Cm
                                    <sup>r</sup>,</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pACYC-hemB</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">p15A ori, Cm
                                    <sup>r</sup>, 
                                    <italic toggle="yes">E. coli hemB</italic> governed by 
                                    <italic toggle="yes">E. coli hemB</italic> promoter</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pACYC-hemB&#x2019;[K13L]</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">p15A ori, Cm
                                    <sup>r</sup>, 
                                    <italic toggle="yes">E. coli hemB&#x2019;[K13L]</italic> governed by 
                                    <italic toggle="yes">E. coli hemB</italic> promoter</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pACYC-hemB&#x2019;[E87K]</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">p15A ori, Cm
                                    <sup>r</sup>, 
                                    <italic toggle="yes">E. coli hemB&#x2019;[E87K]</italic> governed by 
                                    <italic toggle="yes">E. coli hemB</italic> promoter</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pACYC-hemB&#x2019;[G131R]</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">p15A ori, Cm
                                    <sup>r</sup>, 
                                    <italic toggle="yes">E. coli hemB&#x2019;[G131R]</italic> governed by 
                                    <italic toggle="yes">E. coli hemB</italic> promoter</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pACYC-hemB&#x2019;[G268T]</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">p15A ori, Cm
                                    <sup>r</sup>, 
                                    <italic toggle="yes">E. coli hemB&#x2019;[G268T]</italic> governed by 
                                    <italic toggle="yes">E. coli hemB</italic> promoter</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pACYC-hemB&#x2019;[A269M]</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">p15A ori, Cm
                                    <sup>r</sup>, 
                                    <italic toggle="yes">E. coli hemB&#x2019;[A269M]</italic> governed by 
                                    <italic toggle="yes">E. coli hemB</italic> promoter</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pCL1920</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pSC101 ori, Spc/Str
                                    <sup>r</sup>, 
                                    <italic toggle="yes">lacZ</italic>, 
                                    <italic toggle="yes">lac</italic> promoter</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pCLS-rhtA</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pSC101 ori, Spc/Str
                                    <sup>r</sup>, 
                                    <italic toggle="yes">lacZ</italic>, 
                                    <italic toggle="yes">E. coli rhtA</italic> governed by 
                                    <italic toggle="yes">lac</italic> promoter</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pCLS-rhtA-hemA-hemL</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pSC101 ori, Spc/Str
                                    <sup>r</sup>, 
                                    <italic toggle="yes">lacZ</italic>, 
                                    <italic toggle="yes">E. coli rhtA</italic>, 
                                    <italic toggle="yes">hemA</italic>, and 
                                    <italic toggle="yes">hemL</italic> governed by 
                                    <italic toggle="yes">lac</italic> promoter</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pMD19</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pUC19 ori, Amp
                                    <sup>r</sup>, 
                                    <italic toggle="yes">lacZ</italic>, 
                                    <italic toggle="yes">lac</italic> promoter</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pMD-hemA-hemL</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pUC19 ori, Amp
                                    <sup>r</sup>, 
                                    <italic toggle="yes">lacZ</italic>, 
                                    <italic toggle="yes">E. coli hemA</italic>, and 
                                    <italic toggle="yes">hemL</italic> governed by 
                                    <italic toggle="yes">lac</italic> promoter</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <table-wrap id="T3" orientation="portrait" position="float">
                    <label>Table 3. </label>
                    <caption>
                        <title>
                            <italic toggle="yes">Escherichia coli</italic> strains used in this study.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Strain</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Description</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">JM109</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">-</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">&#x2206;B</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">
                                    <italic toggle="yes">E. coli</italic> strain W3110 hemB, Km
                                    <sup>r</sup>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">&#x2206;B_B</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pACYC-hemB</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">&#x2206;B_B&#x2019;[K13L]</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pACYC-hemB&#x2019;[K13L]</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">&#x2206;B_B&#x2019;[E87K]</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pACYC-hemB&#x2019;[E87K]</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">&#x2206;B_B&#x2019;[G131R]</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pACYC-hemB&#x2019;[G131R]</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">&#x2206;B_B&#x2019;[G268T]</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pACYC-hemB&#x2019;[G268T]</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">&#x2206;B_B&#x2019;[A269M]</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pACYC-hemB&#x2019;[A269M]</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">&#x2206;B_B&#x2019;[K13L]&amp;R</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pACYC-hemB&#x2019;[K13L], pCLS-rhtA</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">&#x2206;B_B&#x2019;[E87K]&amp;R</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pACYC-hemB&#x2019;[E87K], pCLS-rhtA</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">&#x2206;B_B&#x2019;[G131R]&amp;R</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pACYC-hemB&#x2019;[G131R], pCLS-rhtA</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">&#x2206;B_B&#x2019;[G268T]&amp;R</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pACYC-hemB&#x2019;[G268T], pCLS-rhtA</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">&#x2206;B_B&#x2019;[A269M]&amp;R</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pACYC-hemB&#x2019;[A269M], pCLS-rhtA</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">&#x2206;B_B&#x2019;[K13L]&amp;R-A-L</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pACYC-hemB&#x2019;[K13L], pCLS-rhtA-hemA-hemL</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">&#x2206;B_B&#x2019;[E87K]&amp;R-A-L</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pACYC-hemB&#x2019;[E87K], pCLS-rhtA-hemA-hemL</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">&#x2206;B_B&#x2019;[G131R]&amp;R-A-L</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pACYC-hemB&#x2019;[G131R], pCLS-rhtA-hemA-hemL</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">&#x2206;B_B&#x2019;[G268T]&amp;R-A-L</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pACYC-hemB&#x2019;[G268T], pCLS-rhtA-hemA-hemL</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">&#x2206;B_B&#x2019;[A269M]&amp;R-A-L</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">pACYC-hemB&#x2019;[A269M], pCLS-rhtA-hemA-hemL</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <p>pCL1920 (carrying the pSC101 replicon origin, ~5 copies/cell) was purchased from National BioResource Project (NIG). A partial fragment of pCL1920 by PCR using a primer sent of pCL1920_F and pCL1920_R. The 
                    <italic toggle="yes">rhtA</italic> was amplified by PCR using primers of rhtA_In_pCL1920_F and rhtA_In_pCL1920_R with the extracted 
                    <italic toggle="yes">E. coli</italic> genomic DNA as a template. The amplified fragments were assembled as described above. The colonies were cultivated in LB agar medium containing 100 &#x03bc;g/mL spectinomycin. The resulting plasmid was designed as pCLS-rhtA.</p>
                <p>pMD19 (derived from pUC19 with ~500 copies/cell) was purchased from TaKaRa Bio (Catalogue number: 3271). A partial fragment of pMD19 was amplified by PCR using primers of pMD19_In_hemL_F and pMD19_In_hemL_R. The 
                    <italic toggle="yes">hemA</italic> and 
                    <italic toggle="yes">hemL</italic>, both derived from 
                    <italic toggle="yes">E. coli</italic>, were amplified using primers of hemA_In_pMD19_F and hemA_In_hemL_R, and hemL_In_hemA_F and hemL_In_pMD19_R, respectively. Subsequently, the amplified fragments of 
                    <italic toggle="yes">hemA</italic> and 
                    <italic toggle="yes">hemL</italic> were together assembled with the partial fragment of pMD19 by the method described above using LB agar medium containing 150 &#x03bc;g/mL ampicillin. The resulting plasmid was designed as pMD-hemA-hemL.</p>
                <p>Partial fragments of pCLS-rhtA and pMD-hemA-hemL were amplified by PCR using primer sets of pCLS-rhtA_F and pCLS-rhtA_R, and hemA-hemL_F and hemA-hemL_R, respectively. These fragments were assembled by the method described above. The resulting plasmid was designed as pCLS-rhtA-hemA-hemL containing 
                    <italic toggle="yes">rhtA, hemA</italic> and 
                    <italic toggle="yes">hemL.</italic>
                </p>
            </sec>
            <sec id="sec10">
                <title>Quantification of 5-aminolevulinic acid</title>
                <p>The amount of ALA production was measured by colorimetric quantification using a modified Ehrlich&#x2019;s reagent prepared by mixing 1 g of dimethylaminobenzaldehyde (DMAB, FUJIFILM Wako Pure Chemical Co., Catalogue number: 047-18042), 30 mL of acetic acid (FUJIFILM Wako Pure Chemical Co., Catalogue number: 017-00256), 8 ml of 60% (v/v) perchloric acid (Kanto Chemical Co. Inc., Catalogue number: 32059-1B), followed by addition of acetic acid to make the total volume 50 mL.
                    <sup>
                        <xref ref-type="bibr" rid="ref14">14</xref>
                    </sup> The supernatant of culture (100 &#x03bc;L) was added to 100 &#x03bc;L of the mixture (1:99 vol. ratio) of acetylacetone and acetate buffer (prepared by mixing 91 mL of 0.1 M acetic acid and 109 mL of 0.1 M sodium acetate solution, pH 4.7), and incubated at 100&#x00b0;C for 15 min. The mixture was then cooled down on ice. The modified Ehrlich&#x2019;s reagent (200 &#x03bc;L) was added to the mixtures and incubated at room temperature for 15 min. Ultrapure water (600 &#x03bc;L) was added, and absorbance at 553 nm was measured using a spectrophotometer UV-1900 (Shimadzu Co., Kyoto, Japan).</p>
            </sec>
        </sec>
        <sec id="sec11" sec-type="results|discussion">
            <title>Results and Discussion</title>
            <sec id="sec12">
                <title>Design of mutated ALAD</title>
                <p>
                    <xref ref-type="fig" rid="f2">Figure 2</xref> illustrates both the structures of the 
                    <italic toggle="yes">E. coli</italic> ALAD (in orange) and human ALAD (in blue) resemble each other. 
                    <xref ref-type="fig" rid="f2">Figure 2</xref> also demonstrates that the K13, E87, G131, G268 and A269 residues on the 
                    <italic toggle="yes">E. coli</italic> ALAD occupy the positions corresponding to the F12, E89, G133, A274 and V275 residues on the human ALAD. The conformational characteristics of these residues guided us to design mutations of the K13L, E87K, G131R, G268T and A269M variants in the 
                    <italic toggle="yes">E. coli</italic> ALAD following the inactive F12L, E89K, G133R, A274T and V275M variants in the human ALAD.
                    <sup>
                        <xref ref-type="bibr" rid="ref13">13</xref>
                    </sup> The authors applied an inverse PCR method to introduce mutations to 
                    <italic toggle="yes">hemB</italic> on the pACYC-based plasmids (pACYC-hemB&#x2019;[K13L], pACYC-hemB&#x2019;[E87K], pACYC-hemB&#x2019;[G131R], pACYC-hemB&#x2019;[G268T] and pACYC-hemB&#x2019;[A269M] listed in 
                    <xref ref-type="table" rid="T2">Table 2</xref>) to express these mutated 
                    <italic toggle="yes">E. coli</italic> ALAD. Successful mutations of 
                    <italic toggle="yes">hemB</italic> were confirmed by Sanger sequencing (
                    <xref ref-type="fig" rid="f3">Figure 3</xref>).</p>
                <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                    <label>Figure 2. </label>
                    <caption>
                        <title>Conformational structures of 5-aminolevlinic acid dehydratase (ALAD) derived from 
                            <italic toggle="yes">Homo sapience</italic> (in blue, PDB 1E51) and 
                            <italic toggle="yes">Escherichia coli</italic> (in orange, PDB 1B4E).</title>
                        <p>K13, E87, G131, G268, and A269 on the 
                            <italic toggle="yes">E. coli</italic> ALAD structurally correspond to F12, E89, G133, A274, and AV275 on the 
                            <italic toggle="yes">H. sapience</italic> ALAD, respectively. Porphobilinogen (PGB) products are shown in green wire forms. The figure was prepared using PyMoL (The PyMOL Molecular Graphics System, Version 2.0 Schr&#x00f6;dinger, LLC.).</p>
                    </caption>
                    <graphic id="gr2" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/156352/d3026619-81e8-4f8f-aa09-49b01305dee6_figure2.gif"/>
                </fig>
                <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                    <label>Figure 3. </label>
                    <caption>
                        <title>Sanger sequencing to confirm the introduction of mutations (highlighted in light blue) on pACYC-hemB&#x2019;[K13L], pACYC-hemB&#x2019;[E87K], pACYC-hemB&#x2019;[G131R], pACYC-hemB&#x2019;[G268T], and pACYC-hemB&#x2019;[A269M] at the positions highlighted in orange in the 5-aminolevlinic acid dehydratase (ALAD)-encoding 
                            <italic toggle="yes">hemB</italic> sequence.</title>
                    </caption>
                    <graphic id="gr3" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/156352/d3026619-81e8-4f8f-aa09-49b01305dee6_figure3.gif"/>
                </fig>
            </sec>
            <sec id="sec13">
                <title>Preparation of 
                    <italic toggle="yes">E. coli</italic> strains harbouring the mutated hemB</title>
                <p>In the present study, the mutant 
                    <italic toggle="yes">E. coli</italic> strain W3110 hemB with 
                    <italic toggle="yes">hemB</italic> deletion (hereinafter referred to as strain &#x2206;B, 
                    <xref ref-type="table" rid="T3">Table 3</xref>) was used as a basic strain to assess the impacts of ALAD mutations. The strain &#x2206;B with a lack of ALAD activity can grow only in the LB medium containing supplementation of 0.2% glucose as well (
                    <xref ref-type="fig" rid="f4">Figure 4A</xref>).
                    <sup>
                        <xref ref-type="bibr" rid="ref15">15</xref>
                    </sup> The strain &#x2206;B_B was established by introducing the intrinsic 
                    <italic toggle="yes">hemB</italic> in the strain &#x2206;B and can grow without supplementation of 0.2% glucose (
                    <xref ref-type="fig" rid="f4">Figure 4</xref>), suggesting that ALAD activity was essential to support the 
                    <italic toggle="yes">E. coli</italic> growth in the absence of glucose. When one of the five types of mutated 
                    <italic toggle="yes">hemB</italic> was introduced to the strain &#x2206;B, every strain (namely, the strains &#x2206;B_B&#x2019;[K13L], &#x2206;B_B&#x2019;[E87K], &#x2206;B_B&#x2019;[G131R], &#x2206;B_B&#x2019;[G268T], or &#x2206;B_B&#x2019;[A269M], 
                    <xref ref-type="table" rid="T3">Table 3</xref>) showed steady growth even in the LB medium without supplementation of glucose (
                    <xref ref-type="fig" rid="f4">Figure 4</xref>). This result indicates that the above-mentioned five types of the mutated 
                    <italic toggle="yes">hemB</italic> expressed the enzymatically active ALAD in 
                    <italic toggle="yes">E. coli.</italic> 
                    <xref ref-type="fig" rid="f4">Figure 4B</xref> showed the comparison of the growth of these strains. The mutant strain harbouring pACYC-hemB&#x2019;[G131R] exhibited an obviously low growth rate, while the molecular mechanism underlying the growth inhibition remains unclear.</p>
                <fig fig-type="figure" id="f4" orientation="portrait" position="float">
                    <label>Figure 4. </label>
                    <caption>
                        <title>Growth of 
                            <italic toggle="yes">Escherichia coli</italic> strains used in this study.</title>
                        <p>(A) Culture of 
                            <italic toggle="yes">E. coli</italic> strains &#x2206;B, &#x2206;B_B, and &#x2206;B_B&#x2019;[K13L] in the lysogeny broth (LB) medium after overnight incubation. (B) Growth curves of 
                            <italic toggle="yes">E. coli</italic> strains &#x2206;B_B, &#x2206;B_B&#x2019;[K13L], &#x2206;B_B&#x2019;[E87K], &#x2206;B_B&#x2019;[G131R], &#x2206;B_B&#x2019;[G268T], and &#x2206;B_B&#x2019;[A269M] (inset: specific growth rates of each strain).</p>
                    </caption>
                    <graphic id="gr4" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/156352/d3026619-81e8-4f8f-aa09-49b01305dee6_figure4.gif"/>
                </fig>
                <p>Further engineering of the strains expressing mutated ALAD was performed by introducing the ALA-exporter gene 
                    <italic toggle="yes">rhtA.</italic> We successfully obtained the transformant strains designated as &#x2206;B_B&#x2019;[K13L]&amp;R, &#x2206;B_B&#x2019;[E87K]&amp;R, &#x2206;B_B&#x2019;[G131R]&amp;R, &#x2206;B_B&#x2019;[G268T]&amp;R and &#x2206;B_B&#x2019;[A269M]&amp;R (
                    <xref ref-type="table" rid="T3">Table 3</xref>). The restriction enzyme assay confirmed that the transformed pACYC-based plasmid with mutated 
                    <italic toggle="yes">hemB</italic> and pCLS-rhtA plasmid were maintained in the transformant strains (
                    <xref ref-type="fig" rid="f5">Figure 5</xref>). Moreover, along with the pACYC-based plasmid with mutated 
                    <italic toggle="yes">hemB</italic> and pCLS-rhtA plasmid, the pMD-hemA-hemL plasmid with an ability of highly copying was also introduced to overexpress GluTR and GSA-AT. However, unfortunately, mature colonies did not grow on the LB-agar plates containing antibiotics for selection. Although tiny colonies were observed on the plates (
                    <xref ref-type="fig" rid="f6">Figure 6A</xref>), the cells forming tiny colonies did not grow in the liquid LB medium containing the antibiotics. The introduction of the empty vector pMD19 leaded to the results of the formation of mature colonies (
                    <xref ref-type="fig" rid="f6">Figure 6B</xref>), indicating that the backbone vector pMD19 did not cause the formation of tiny colonies. These results suggest that excess GluTR and GSA-AT expressed from a high copy number of plasmid pMD-hemA-hemL might negatively affect the 
                    <italic toggle="yes">E. coli</italic> growth. To avoid the problem, we replaced the backbone vector pMD19 with pCL1920 having an ability to copy a relatively low number of plasmids for expressing GluTR and GSA-AT. The 
                    <italic toggle="yes">hemA</italic> and 
                    <italic toggle="yes">hemL</italic> encoding GluTR and GSA-AT, respectively, were inserted to the expression cassette of 
                    <italic toggle="yes">rhtA</italic> in pCLS-rhtA. Resultantly, the mature colony of 
                    <italic toggle="yes">E. coli</italic> transformed with the pCLS-rhtA-hemA-hemL plasmid was successfully obtained. The results indicates that the transformant of 
                    <italic toggle="yes">E. coli</italic> was able to harbour mutated 
                    <italic toggle="yes">hemB</italic> (&#x2206;B_B&#x2019;[K13L]&amp;R-A-L, &#x2206;B_B&#x2019;[E87K]&amp;R-A-L, &#x2206;B_B&#x2019;[G131R]&amp;R-A-L, &#x2206;B_B&#x2019;[G268T]&amp;R-A-L and &#x2206;B_B&#x2019;[A269M]&amp;R-A-L, 
                    <xref ref-type="table" rid="T3">Table 3</xref>). Maintenance of both the pCLS-rhtA-hemA-hemL and pACYC-based plasmid carrying mutated 
                    <italic toggle="yes">hemB</italic> in each transformant clone was confirmed with the restriction enzyme assay (
                    <xref ref-type="fig" rid="f7">Figure 7</xref>). We should emphasize that overexpression of GluTR and GSA-AT in 
                    <italic toggle="yes">E. coli</italic> is a technical challenge involving a risk of their toxic effects on the host cells. As far as we found out, the present study has first achieved to solve the problem by fine-tuning their expression levels with reducing the number of plasmid copies.</p>
                <fig fig-type="figure" id="f5" orientation="portrait" position="float">
                    <label>Figure 5. </label>
                    <caption>
                        <title>Agarose gel electrophoresis of the DNA fragments generated by the restriction enzyme (
                            <italic toggle="yes">Acc</italic>I) treatment of pACYC-hemB&#x2019; (Lane 1), pCLS-rhtA (Lane 2), plasmids extracted from 
                            <italic toggle="yes">E. coli</italic> strain &#x2206;B_B&#x2019;[K13L]&amp;R (Lane 3), &#x2206;B_B&#x2019;[E87K]&amp;R (Lane 4), &#x2206;B_B&#x2019;[G131R]&amp;R (Lane 5), &#x2206;B_B&#x2019;[G268T]&amp;R (Lane 6), and &#x2206;B_B&#x2019;[A269M]&amp;R (Lane 7).</title>
                        <p>Lane M represents the DNA ladder.</p>
                    </caption>
                    <graphic id="gr5" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/156352/d3026619-81e8-4f8f-aa09-49b01305dee6_figure5.gif"/>
                </fig>
                <fig fig-type="figure" id="f6" orientation="portrait" position="float">
                    <label>Figure 6. </label>
                    <caption>
                        <title>Colony formation results of the transformation experiments in which (A) pMD-hemA-hemL or (B) pMD19 were introduced to 
                            <italic toggle="yes">E. coli</italic> strain &#x2206;B_B&#x2019;[E87K]&amp;R.</title>
                    </caption>
                    <graphic id="gr6" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/156352/d3026619-81e8-4f8f-aa09-49b01305dee6_figure6.gif"/>
                </fig>
                <fig fig-type="figure" id="f7" orientation="portrait" position="float">
                    <label>Figure 7. </label>
                    <caption>
                        <title>Agarose gel electrophoresis of the DNA fragments generated by the restriction enzyme (
                            <italic toggle="yes">Pst</italic>I and 
                            <italic toggle="yes">Pvu</italic>I) treatment of pACYC-hemB&#x2019; (Lane 1), pCLS-rhtA-hemA-hemL (Lane 2), plasmids extracted from 
                            <italic toggle="yes">E. coli</italic> strain &#x2206;B_B&#x2019;[K13L]&amp;R-A-L (Lane 3), &#x2206;B_B&#x2019;[E87K]&amp;R-A-L (Lane 4), &#x2206;B_B&#x2019;[G131R]&amp;R-A-L (Lane 5), &#x2206;B_B&#x2019;[G268T]&amp;R-A-L (Lane 6), and &#x2206;B_B&#x2019;[A269M]&amp;R-A-L (Lane 7).</title>
                        <p>Lane M represent the DNA ladder.</p>
                    </caption>
                    <graphic id="gr7" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/156352/d3026619-81e8-4f8f-aa09-49b01305dee6_figure7.gif"/>
                </fig>
            </sec>
            <sec id="sec14">
                <title>Production of 5-ALA using the 
                    <italic toggle="yes">E. coli</italic> transformants</title>
                <p>Taking the results mentioned above, the authors constructed three kinds of the series of 
                    <italic toggle="yes">E. coli</italic> transformant strains harbouring the mutated 
                    <italic toggle="yes">hemB</italic>; namely (1) the primary 
                    <italic toggle="yes">hemB</italic> mutation (strains &#x2206;B_B&#x2019;[mutation]) that simply express the mutated 
                    <italic toggle="yes">hemB</italic> alone, (2) the intermediate 
                    <italic toggle="yes">hemB</italic> mutation (strains &#x2206;B_B&#x2019;[mutation]&amp;R) that express the mutated 
                    <italic toggle="yes">hemB</italic> along with recombinant 
                    <italic toggle="yes">rhtA</italic>, (3) the triplet 
                    <italic toggle="yes">hemB</italic> mutation (strains &#x2206;B_B&#x2019;[mutation]&amp;R-A-L) that express the mutated 
                    <italic toggle="yes">hemB</italic> along with recombinant 
                    <italic toggle="yes">rhtA</italic>, 
                    <italic toggle="yes">hemA</italic> and 
                    <italic toggle="yes">hemL.</italic> The ALA production of these transformants were evaluated by the colorimetric measurement. The ALA production of the primary 
                    <italic toggle="yes">hemB</italic> mutation strains was almost uniform under the mutational variation, even though the values were slightly lower than that of the wild type 
                    <italic toggle="yes">hemB</italic> strains (
                    <xref ref-type="fig" rid="f8">Figure 8A</xref> and 
                    <xref ref-type="table" rid="T4">Table 4</xref>). The primary mutation strains did not show any improvement in ALA production of 
                    <italic toggle="yes">E. coli</italic>, suggesting that the primary 
                    <italic toggle="yes">hemB</italic> mutations only slightly decreased the enzymatic activity of ALAD in 
                    <italic toggle="yes">E. coli</italic>, and those impacts on ALA accumulation were hindered by the effects of multiplication of the mutated 
                    <italic toggle="yes">hemB</italic> genes on pACYC-based plasmids (~10 copies/cell). The intermediate 
                    <italic toggle="yes">hemB</italic> mutation strains with overexpression of RhtA from low copy number plasmid marginally improved the ALA production by actively exporting ALA to the supernatant of the culture (
                    <xref ref-type="fig" rid="f8">Figure 8B</xref> and 
                    <xref ref-type="table" rid="T4">Table 4</xref>).</p>
                <fig fig-type="figure" id="f8" orientation="portrait" position="float">
                    <label>Figure 8. </label>
                    <caption>
                        <title>Production of 5-aminolevulinic acid (ALA) by the genetically modified 
                            <italic toggle="yes">E. coli</italic> with the primary 
                            <italic toggle="yes">hemB</italic> mutation (strains &#x2206;B_B&#x2019;[mutation]) that simply express the mutated 
                            <italic toggle="yes">hemB</italic> alone (A), the intermediate 
                            <italic toggle="yes">hemB</italic> mutation (strains &#x2206;B_B&#x2019;[mutation]&amp;R) that express the mutated 
                            <italic toggle="yes">hemB</italic> along with recombinant 
                            <italic toggle="yes">rhtA</italic> (B), and the triplet 
                            <italic toggle="yes">hemB</italic> mutation (strains &#x2206;B_B&#x2019;[mutation]&amp;R-A-L) express the mutated 
                            <italic toggle="yes">hemB</italic> along with recombinant 
                            <italic toggle="yes">rhtA</italic>, 
                            <italic toggle="yes">hemA</italic> and 
                            <italic toggle="yes">hemL</italic> (C). K13L, E87K, G131R, G268T, and A269M represent the mutation of 5-aminolevlinic acid dehydratase (ALAD) encoded by 
                            <italic toggle="yes">hemB.</italic>
                        </title>
                        <p>Numeric data of 
                            <xref ref-type="fig" rid="f8">Figure 8</xref> is shown in the 
                            <xref ref-type="table" rid="T4">Table 4</xref>.</p>
                    </caption>
                    <graphic id="gr8" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/156352/d3026619-81e8-4f8f-aa09-49b01305dee6_figure8.gif"/>
                </fig>
                <table-wrap id="T4" orientation="portrait" position="float">
                    <label>Table 4. </label>
                    <caption>
                        <title>Numeric data of 5-aminolevulinic acid (ALA) production of 
                            <italic toggle="yes">E. coli</italic> developed in this study.</title>
                        <p>The same data are represented in the form of bar-graph in 
                            <xref ref-type="fig" rid="f4">Figure 4</xref>. The unit of the data is mg/L. Data represent the average values of two replicated experiments.</p>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="2" valign="top">Type of HemB mutation</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">rhtA</italic> OX
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn1">1</xref>
                                    </sup> -</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">rhtA</italic> OX +</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">rhtA</italic> OX +</th>
                            </tr>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">hemA</italic> &amp; 
                                    <italic toggle="yes">hemL</italic> OX -</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">hemA</italic> &amp; 
                                    <italic toggle="yes">hemL</italic> OX -</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">hemA</italic> &amp; 
                                    <italic toggle="yes">hemL</italic> OX +</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">No mutation</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">24.24</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">ND
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn2">2</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">ND</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">[K13L]</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">21.30</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">24.67</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">368.09</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">[E87K]</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">21.84</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">22.37</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">309.70</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">[G131R]</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">20.96</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">23.76</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">262.39</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">[G268T]</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">20.53</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">21.90</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">354.56</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">[A269M]</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">20.94</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">21.58</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">288.69</td>
                            </tr>
                        </tbody>
                    </table>
                    <table-wrap-foot>
                        <fn-group content-type="footnotes">
                            <fn id="tfn1">
                                <label>
                                    <sup>1</sup>
                                </label>
                                <p>OX: over-expression.</p>
                            </fn>
                            <fn id="tfn2">
                                <label>
                                    <sup>2</sup>
                                </label>
                                <p>ND: no data.</p>
                            </fn>
                        </fn-group>
                    </table-wrap-foot>
                </table-wrap>
                <p>The triplet 
                    <italic toggle="yes">hemB</italic> mutation strains with further overexpression of GluTR and GSA-AT from low copy number of plasmid carrying 
                    <italic toggle="yes">hemA</italic> and 
                    <italic toggle="yes">hemL</italic> drastically increased the ALA production (
                    <xref ref-type="fig" rid="f8">Figure 8C</xref> and 
                    <xref ref-type="table" rid="T4">Table 4</xref>). The overexpression of GluTR could be expected to lead an enhancement in ALA production because the reaction catalysed by GluTR encoded by 
                    <italic toggle="yes">hemA</italic> is a rate-limiting step for ALA production in the C5-pathway
                    <sup>
                        <xref ref-type="bibr" rid="ref8">8</xref>
                    </sup> and GSA-AT encoded by 
                    <italic toggle="yes">hemL</italic> tightly forms a complex with GluTR.
                    <sup>
                        <xref ref-type="bibr" rid="ref8">8</xref>
                    </sup>
                    <sup>,</sup>
                    <sup>
                        <xref ref-type="bibr" rid="ref16">16</xref>
                    </sup> Clear difference also appeared in ALA production of the transformants with the aid of overexpression of GluTR and GSA-AT depending on the five types of mutated 
                    <italic toggle="yes">hemB</italic> variation. The transformant strains with 
                    <italic toggle="yes">hemB</italic>&#x2019;[K13L] showed the highest ALA production of 368.1 mg/L, followed those with 
                    <italic toggle="yes">hemB</italic>&#x2019;[G268T] (354.6 mg/L), 
                    <italic toggle="yes">hemB</italic>&#x2019;[E87K] (309.7 mg/L), 
                    <italic toggle="yes">hemB</italic>&#x2019;[A269M] (288.7 mg/L) and 
                    <italic toggle="yes">hemB</italic>&#x2019;[G131R] (262.4 mg/L). However, we have not been able to attribute the difference appeared in ALA production rigorously to the declining variation in the levels of the ALAD activity caused by the individual mutation because the ALA production depends on both the ALA contents in a unit cell and the biomass production (in other word, growth of cells) of 
                    <italic toggle="yes">E. coli.</italic> The ALA production order of the transformants (
                    <italic toggle="yes">hemB</italic>&#x2019;[K13L] was highest, followed by 
                    <italic toggle="yes">hemB</italic>&#x2019;[G268T], 
                    <italic toggle="yes">hemB</italic>&#x2019;[E87K], 
                    <italic toggle="yes">hemB</italic>&#x2019;[A269M] and 
                    <italic toggle="yes">hemB</italic>&#x2019;[G131R] in 
                    <xref ref-type="fig" rid="f8">Figure 8C</xref> and 
                    <xref ref-type="table" rid="T4">Table 4</xref>) is the exact same as the order in the specific growth rates of the corresponding platform strains with mutated 
                    <italic toggle="yes">hemB</italic> (inset figure of 
                    <xref ref-type="fig" rid="f4">Figure 4B</xref>). Given these two results; (1) the authors have not discriminated any significant difference of ALA production in the five types of 
                    <italic toggle="yes">hemB</italic> in the platform strains without overexpression of RhtA, GluTR and GSA-AT, (2) the difference of ALA production of the transformant strains with overexpression of RhtA, GluTR and GSA-AT was consistent with the growth behaviour of the platform strains, difference of ALA production shown in 
                    <xref ref-type="fig" rid="f8">Figure 8C</xref> could be most likely attributed to not the declining variation of ALAD activity encoded by the mutated 
                    <italic toggle="yes">hemB</italic>, but the different growth of 
                    <italic toggle="yes">E. coli</italic> strains.</p>
            </sec>
        </sec>
        <sec id="sec15" sec-type="conclusions">
            <title>Conclusions</title>
            <p>Five types of mutations have been introduced on the 
                <italic toggle="yes">E. coli</italic> ALAD encoded by 
                <italic toggle="yes">hemB</italic> to induce the accumulation of ALA in 
                <italic toggle="yes">E. coli.</italic> However, any mutation examined in the present study has not increased ALA production significantly. As far as we found out, the present study has been first performed to assess the impact of mutations of ALAD on ALA production in 
                <italic toggle="yes">E. coli.</italic> Tuning of the copy number of the plasmid containing 
                <italic toggle="yes">hemA</italic> and 
                <italic toggle="yes">hemL</italic> allowed us to obtain the transformant strains expressing 
                <italic toggle="yes">rhtA, hemA</italic>, 
                <italic toggle="yes">hemL</italic>, and mutated 
                <italic toggle="yes">hemB.</italic> Overexpression of RhtA, GluTR (encoded by 
                <italic toggle="yes">hemA</italic>) and GSA-AT (encoded by 
                <italic toggle="yes">hemL</italic>) substantially improved ALA production as previously reported. These transformant strains expressing each type of mutated ALAD showed different ALA production, while their different ALA production was most likely attributed to not the declining variation of ALAD activity but the difference in the growth rate of 
                <italic toggle="yes">E. coli</italic> strains.</p>
        </sec>
    </body>
    <back>
        <sec id="sec18" sec-type="data-availability">
            <title>Data availability</title>
            <sec id="sec19">
                <title>Underlying data</title>
                <p>Figshare: Gene sequence file (fasta). 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.24557605.v1">https://doi.org/10.6084/m9.figshare.24557605.v1</ext-link>.
                    <sup>

                        <xref ref-type="bibr" rid="ref17">17</xref>
</sup>
                </p>
                <p>Figshare: Uncropped raw gel images for diagnostic restriction digestion analyses 1. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.24556849.v1">https://doi.org/10.6084/m9.figshare.24556849.v1</ext-link>.
                    <sup>

                        <xref ref-type="bibr" rid="ref18">18</xref>
</sup>
                </p>
                <p>Figshare: Uncropped raw gel images for diagnostic restriction digestion analyses 2. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.24557308.v1">https://doi.org/10.6084/m9.figshare.24557308.v1</ext-link>.
                    <sup>

                        <xref ref-type="bibr" rid="ref19">19</xref>
</sup>
                </p>
                <p>Figshare: Numeric data for 
                    <italic toggle="yes">E. coli</italic> growth curve. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.24556828.v1">https://doi.org/10.6084/m9.figshare.24556828.v1</ext-link>.
                    <sup>

                        <xref ref-type="bibr" rid="ref20">20</xref>
</sup>
                </p>
                <p>Figshare: Output files from PyMoL. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.24556768.v1">https://doi.org/10.6084/m9.figshare.24556768.v1</ext-link>.
                    <sup>

                        <xref ref-type="bibr" rid="ref21">21</xref>
</sup>
                </p>
                <p>Data are available under the terms of the 
                    <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/legalcode">Creative Commons Attribution 4.0 International license</ext-link> (CC-BY 4.0).</p>
            </sec>
        </sec>
        <ref-list>
            <title>References</title>
            <ref id="ref1">
                <label>1</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Shemin</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Russell</surname>
                            <given-names>CS</given-names>
                        </name>
</person-group>:
                    <article-title>&#x03b4;-Aminolevulinic acid, its role in the biosynthesis of porphyrins and purines 1.</article-title>
                    <source>

                        <italic toggle="yes">J. Am. Chem. Soc.</italic>
</source>
                    <year>1953 Oct 1</year>;<volume>75</volume>(<issue>19</issue>):<fpage>4873</fpage>&#x2013;<lpage>4874</lpage>.
                    <pub-id pub-id-type="doi">10.1021/ja01115a546</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref2">
                <label>2</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sasaki</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Watanabe</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tanaka</surname>
                            <given-names>T</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Biosynthesis, biotechnological production and applications of 5-aminolevulinic acid.</article-title>
                    <source>

                        <italic toggle="yes">Appl. Microbiol. Biotechnol.</italic>
</source>
                    <year>2002</year>;<volume>58</volume>:<fpage>23</fpage>&#x2013;<lpage>29</lpage>.
                    <pub-id pub-id-type="doi">10.1007/s00253-001-0858-7</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref3">
                <label>3</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kikuchi</surname>
                            <given-names>G</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kumar</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Talmage</surname>
                            <given-names>P</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The enzymatic synthesis of &#x03b4;-aminolevulinic acid.</article-title>
                    <source>

                        <italic toggle="yes">J. Biol. Chem.</italic>
</source>
                    <year>1958 Nov</year>;<volume>233</volume>(<issue>5</issue>):<fpage>1214</fpage>&#x2013;<lpage>1219</lpage>.
                    <pub-id pub-id-type="doi">10.1016/S0021-9258(19)77371-2</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref4">
                <label>4</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Nishikawa</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Watanabe</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tanaka</surname>
                            <given-names>T</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Rhodobacter sphaeroides mutants which accumulate 5-aminolevulinic acid under aerobic and dark conditions.</article-title>
                    <source>

                        <italic toggle="yes">J. Biosci. Bioeng.</italic>
</source>
                    <year>1999 Jun</year>;<volume>87</volume>(<issue>6</issue>):<fpage>798</fpage>&#x2013;<lpage>804</lpage>.
                    <pub-id pub-id-type="pmid">16232557</pub-id>
                    <pub-id pub-id-type="doi">10.1016/S1389-1723(99)80156-X</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref5">
                <label>5</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Oh-hama</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Stolowich</surname>
                            <given-names>NJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Scott</surname>
                            <given-names>AI</given-names>
                        </name>
</person-group>:
                    <article-title>5-Aminolevulinic acid formation from glutamate via the C 5 pathway in Clostridium thermoaceticum.</article-title>
                    <source>

                        <italic toggle="yes">FEBS Lett.</italic>
</source>
                    <year>1988 Feb 8</year>;<volume>228</volume>(<issue>1</issue>):<fpage>89</fpage>&#x2013;<lpage>93</lpage>.
                    <pub-id pub-id-type="pmid">3342879</pub-id>
                    <pub-id pub-id-type="doi">10.1016/0014-5793(88)80591-X</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref6">
                <label>6</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>JM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Brathwaite</surname>
                            <given-names>O</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Cosloy</surname>
                            <given-names>SD</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>5-Aminolevulinic acid synthesis in Escherichia coli.</article-title>
                    <source>

                        <italic toggle="yes">J. Bacteriol.</italic>
</source>
                    <year>1989 May</year>;<volume>171</volume>(<issue>5</issue>):<fpage>2547</fpage>&#x2013;<lpage>2552</lpage>.
                    <pub-id pub-id-type="pmid">2651407</pub-id>
                    <pub-id pub-id-type="doi">10.1128/jb.171.5.2547-2552.1989</pub-id>
                    <pub-id pub-id-type="pmcid">PMC209933</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref7">
                <label>7</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ikemi</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Murakami</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hashimoto</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Cloning and characterization of genes involved in the biosynthesis of &#x03b4;-aminolevulinic acid in Escherichia coli.</article-title>
                    <source>

                        <italic toggle="yes">Gene.</italic>
</source>
                    <year>1992 Nov</year>;<volume>121</volume>(<issue>1</issue>):<fpage>127</fpage>&#x2013;<lpage>132</lpage>.
                    <pub-id pub-id-type="pmid">1427085</pub-id>
                    <pub-id pub-id-type="doi">10.1016/0378-1119(92)90170-T</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref8">
                <label>8</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kang</surname>
                            <given-names>Z</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Gu</surname>
                            <given-names>P</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Engineering Escherichia coli for efficient production of 5-aminolevulinic acid from glucose.</article-title>
                    <source>

                        <italic toggle="yes">Metab. Eng.</italic>
</source>
                    <year>2011 Sep</year>;<volume>13</volume>(<issue>5</issue>):<fpage>492</fpage>&#x2013;<lpage>498</lpage>.
                    <pub-id pub-id-type="pmid">21620993</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.ymben.2011.05.003</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref9">
                <label>9</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Zhang</surname>
                            <given-names>B</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ye</surname>
                            <given-names>BC</given-names>
                        </name>
</person-group>:
                    <article-title>Pathway engineering in Corynebacterium glutamicum S9114 for 5-aminolevulinic acid production.</article-title>
                    <source>

                        <italic toggle="yes">3 Biotech.</italic>
</source>
                    <year>2018 May 1</year>;<volume>8</volume>(<issue>5</issue>):<fpage>247</fpage>.
                    <pub-id pub-id-type="pmid">29744279</pub-id>
                    <pub-id pub-id-type="doi">10.1007/s13205-018-1267-2</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5940623</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref10">
                <label>10</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Zhang</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Weng</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zhou</surname>
                            <given-names>Z</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Engineering of multiple modular pathways for high-yield production of 5-aminolevulinic acid in Escherichia coli.</article-title>
                    <source>

                        <italic toggle="yes">Bioresour. Technol.</italic>
</source>
                    <year>2019 Feb 1</year>;<volume>274</volume>:<fpage>353</fpage>&#x2013;<lpage>360</lpage>.
                    <pub-id pub-id-type="pmid">30537593</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.biortech.2018.12.004</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref11">
                <label>11</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Su</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Guo</surname>
                            <given-names>Q</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zheng</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Fine-tuning of hemB using CRISPRi for increasing 5-aminolevulinic acid production in Escherichia coli.</article-title>
                    <source>

                        <italic toggle="yes">Front. Microbiol.</italic>
</source>
                    <year>2019</year>;<volume>10</volume>(<issue>JULY</issue>).
                    <pub-id pub-id-type="pmid">31417522</pub-id>
                    <pub-id pub-id-type="doi">10.3389/fmicb.2019.01731</pub-id>
                    <pub-id pub-id-type="pmcid">PMC6685056</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref12">
                <label>12</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Luo</surname>
                            <given-names>Z</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Pan</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zhu</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Synergistic Improvement of 5-Aminolevulinic Acid Production with Synthetic Scaffolds and System Pathway Engineering.</article-title>
                    <source>

                        <italic toggle="yes">ACS Synth. Biol.</italic>
</source>
                    <year>2022 Aug 19</year>;<volume>11</volume>(<issue>8</issue>):<fpage>2766</fpage>&#x2013;<lpage>2778</lpage>.
                    <pub-id pub-id-type="pmid">35939037</pub-id>
                    <pub-id pub-id-type="doi">10.1021/acssynbio.2c00157</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref13">
                <label>13</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Jaffe</surname>
                            <given-names>EK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Stith</surname>
                            <given-names>L</given-names>
                        </name>
</person-group>:
                    <article-title>ALAD porphyria is a conformational disease.</article-title>
                    <source>

                        <italic toggle="yes">Am. J. Hum. Genet.</italic>
</source>
                    <year>2007</year>;<volume>80</volume>:<fpage>329</fpage>&#x2013;<lpage>337</lpage>.
                    <pub-id pub-id-type="pmid">17236137</pub-id>
                    <pub-id pub-id-type="doi">10.1086/511444</pub-id>
                    <pub-id pub-id-type="pmcid">PMC1785348</pub-id>
                    <ext-link ext-link-type="uri" xlink:href="http://www.ajhg.org">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref14">
                <label>14</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Mauzerall</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Granick</surname>
                            <given-names>S</given-names>
                        </name>
</person-group>:
                    <article-title>The occurrence and determination of saminolevulinic acid and porphobilinogen in urine.</article-title>
                    <source>

                        <italic toggle="yes">J. Biol. Chem.</italic>
</source>
                    <year>1956 Mar</year>;<volume>219</volume>(<issue>1</issue>):<fpage>435</fpage>&#x2013;<lpage>446</lpage>.
                    <pub-id pub-id-type="doi">10.1016/S0021-9258(18)65809-0</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref15">
                <label>15</label>
                <mixed-citation publication-type="other">
                    <article-title>National BioResource Project-NBRP E.coli Strain.</article-title>
                    <ext-link ext-link-type="uri" xlink:href="https://shigen.nig.ac.jp/ecoli/strain/resource/strainGeneMutant/detail/30078">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref16">
                <label>16</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>L&#x00fc;er</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Schauer</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>M&#x00f6;bius</surname>
                            <given-names>K</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Complex formation between glutamyl-tRNA reductase and glutamate-1- semialdehyde 2,1-aminomutase in Escherichia coli during the initial reactions of porphyrin biosynthesis.</article-title>
                    <source>

                        <italic toggle="yes">J. Biol. Chem.</italic>
</source>
                    <year>2005 May 13</year>;<volume>280</volume>(<issue>19</issue>):<fpage>18568</fpage>&#x2013;<lpage>18572</lpage>.
                    <pub-id pub-id-type="pmid">15757895</pub-id>
                    <pub-id pub-id-type="doi">10.1074/jbc.M500440200</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref17">
                <label>17</label>
                <mixed-citation publication-type="data">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ninomiya</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yoneda</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Maeda</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <data-title>Gene sequence file (fasta).</data-title>[Dataset].
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>
                    <year>2023</year>.
                    <pub-id pub-id-type="doi">10.6084/m9.figshare.24557605.v1</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref18">
                <label>18</label>
                <mixed-citation publication-type="data">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ninomiya</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yoneda</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Maeda</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <data-title>Uncropped raw gel images for diagnostic restriction digestion analyses 1.</data-title>[Dataset].
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>
                    <year>2023</year>.
                    <pub-id pub-id-type="doi">10.6084/m9.figshare.24556849.v1</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref19">
                <label>19</label>
                <mixed-citation publication-type="data">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ninomiya</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yoneda</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Maeda</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <data-title>Uncropped raw gel images for diagnostic restriction digestion analyses 2.</data-title>[Dataset].
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>
                    <year>2023</year>.
                    <pub-id pub-id-type="doi">10.6084/m9.figshare.24557308.v1</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref20">
                <label>20</label>
                <mixed-citation publication-type="data">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ninomiya</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yoneda</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Maeda</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <data-title>Numeric data for E. coli growth curve.</data-title>[Dataset].
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>
                    <year>2023</year>.
                    <pub-id pub-id-type="doi">10.6084/m9.figshare.24556828.v1</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref21">
                <label>21</label>
                <mixed-citation publication-type="data">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ninomiya</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yoneda</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Maeda</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <data-title>Output files from PyMoL.</data-title>[Dataset].
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>
                    <year>2023</year>.
                    <pub-id pub-id-type="doi">10.6084/m9.figshare.24556768.v1</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report254155">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.156352.r254155</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>I. Elsheery</surname>
                        <given-names>Nabil</given-names>
                    </name>
                    <xref ref-type="aff" rid="r254155a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0001-9542-1913</uri>
                </contrib>
                <aff id="r254155a1">
                    <label>1</label>Tanta University, Tanta, Gharbia Governorate, Egypt</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>13</day>
                <month>5</month>
                <year>2024</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2024 I. Elsheery N</copyright-statement>
                <copyright-year>2024</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
                <license>
                    <license-p>The author(s) is/are employees of the US Government and therefore domestic copyright protection in USA does not apply to this work. The work may be protected under the copyright laws of other jurisdictions when used in those jurisdictions.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport254155" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.142769.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>This work about&#x00a0;Five types of mutations have been introduced on the&#x00a0;
                <italic>E. coli</italic>&#x00a0;ALAD encoded by&#x00a0;
                <italic>hemB</italic>&#x00a0;to induce the accumulation of ALA in&#x00a0;
                <italic>E. coli.</italic>&#x00a0;However, any mutation examined in the present study has not increased ALA production significantly. As far as we found out, the present study has been first performed to assess the impact of mutations of ALAD on ALA production in&#x00a0;
                <italic>E. coli.</italic>&#x00a0;Tuning of the copy number of the plasmid containing&#x00a0;
                <italic>hemA</italic>&#x00a0;and&#x00a0;
                <italic>hemL</italic>&#x00a0;allowed us to obtain the transformant strains expressing&#x00a0;
                <italic>rhtA, hemA</italic>,&#x00a0;
                <italic>hemL</italic>, and mutated&#x00a0;
                <italic>hemB.</italic>&#x00a0;Overexpression of RhtA, GluTR (encoded by&#x00a0;
                <italic>hemA</italic>) and GSA-AT (encoded by&#x00a0;
                <italic>hemL</italic>) substantially improved ALA production as previously reported. These transformant strains expressing each type of mutated ALAD showed different ALA production, while their different ALA production was most likely attributed to not the declining variation of ALAD activity but the difference in the growth rate of&#x00a0;
                <italic>E. coli</italic>&#x00a0;strains.</p>
            <p> </p>
            <p> the idea is good but i still have some comments</p>
            <p> where is Statistic?</p>
            <p> improve your discussion</p>
            <p> added paragraph about the importance of ALA in geeneral</p>
            <p> </p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Yes</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>plant physiology</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report258981">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.156352.r258981</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Khuong</surname>
                        <given-names>Nguyen Quoc</given-names>
                    </name>
                    <xref ref-type="aff" rid="r258981a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r258981a1">
                    <label>1</label>Can Tho University, Can Tho, Can Tho, Vietnam</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>13</day>
                <month>5</month>
                <year>2024</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2024 Khuong NQ</copyright-statement>
                <copyright-year>2024</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport258981" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.142769.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>
                <list list-type="order">
                    <list-item>
                        <p>The title should be rewritten to suit the work of the study.</p>
                    </list-item>
                    <list-item>
                        <p>The abstract is well written.</p>
                    </list-item>
                    <list-item>
                        <p>The introduction is also well prepared. However, it lacks a sufficient number of literatures. Thus, many statements are not cited, such as &#x201c;The enzymes that &#x2026; an exporter of ALA.&#x201d;, &#x201c; Inhibiting the &#x2026;enzyme activity (Figure 1).&#x201d;, etc. Lacking of literature review could make the study less persuasive. Moreover, in this section, the sentences are too wordy. These run-on sentences should be separated into more concise ones. Should the Figure 1 be cited? Last but not least, at the end of the introduction, objectives or hypotheses should be clearly stated, instead of the methods used in the study.</p>
                    </list-item>
                    <list-item>
                        <p>Are there any studies investigating the properties of 
                            <italic>E. coli</italic> strain W3110?</p>
                    </list-item>
                    <list-item>
                        <p>How long has the strain incubated before the ALA quantification?</p>
                    </list-item>
                    <list-item>
                        <p>Are there any chances to improve the quality of Figure 5? The gel image is blur and probably contains bubbles.</p>
                    </list-item>
                    <list-item>
                        <p>The discussion in the Results and Discussion section is not adequate. The section lacks comparisons and interpretations of the results based on previous studies.</p>
                    </list-item>
                    <list-item>
                        <p>The conclusion should deliver what the study can be used and its further investigation.</p>
                    </list-item>
                </list>
            </p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Partly</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Yes</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Partly</p>
            <p>Reviewer Expertise:</p>
            <p>soil and environmental microbiology</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
    </sub-article>
</article>
