F1000Research F1000Research 2046-1402 F1000 Research Limited London, UK 10.12688/f1000research.145766.1 Research Article Articles Co-administration of a Hepatitis B vaccine with CpG-ODN 2395 induces stronger immune response in BALB/c mice

[version 1; peer review: 1 approved with reservations, 2 not approved]

 ADEDJOBI Titilayo Kemi Sophia Nelly Conceptualization Data Curation Formal Analysis Funding Acquisition Investigation Methodology Resources Visualization Writing – Original Draft Preparation Writing – Review & Editing https://orcid.org/0009-0000-3593-4768 a 1 Kariuki Daniel Formal Analysis Supervision Validation Writing – Review & Editing 2 Kimotho James Conceptualization Formal Analysis Supervision Validation Writing – Review & Editing 3 Department of Molecular Biology and Biotechnology, Pan African University Institute for Basic Sciences, Technology and Innovation (PAUSTI), Nairobi, P.O. Box 62000-00200, Kenya School of Biomedical Sciences, Jomo Kenyatta University of Agriculture and Technology, Nairobi, Nairobi County, P.O. Box 62000-00200, Kenya Innovation and Technology Transfer Division, Kenya Medical Research Institute, Nairobi, P.O Box 54840-00200, Kenya nellyadedjobi@gmail.com

No competing interests were disclosed.

 26 4 2024 2024 13 404 1 4 2024 Copyright: © 2024 ADEDJOBI TKSN et al. 2024 This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Background

Proof of effects of Cytosine Phosphoguanine Oligodeoxynucleotides (CpG ODNs), adjuvanted Hepatitis B Virus (HBV) vaccine on immune response is limited. This study aimed to assess the effect of five CpG ODNs in HBV Vaccine-immunized BALB/c mice and to identify the most effective CpG ODN adjuvant.

 Methods

This laboratory-based experimental study was conducted using a total of 36 female BALB/c mice, which were clustered into 12 groups and immunized intramuscularly. Group 1 was immunized with CpG ODN 18281-1 alone, group 2 with vaccine plus CpG ODN 18281-1, group 3 with CpG ODN 18281-2 alone, group 4 with CpG ODN 18281-2 plus vaccine, group 5 CpG ODN 18289 alone, group 6 with CpG ODN 18289 plus vaccine, group 7 CpG ODN 1826 S alone, group 8 with CpG ODN 1826 S plus vaccine, group 9 CpG ODN 2395 alone, group 10 with CpG ODN 2395 plus vaccine, group 11 with vaccine alone and group 12 with Phosphate Buffer Saline (PBS). All the groups were observed for 14 and 28 days after immunization.

 Results

In the vaccinated groups, those receiving supplementation with CpG 2395 exhibited a significant 4.4-fold elevation, resulting in a signal-to-noise ratio (S/N) value of 14.1 compared to the vaccine group only (S/N = 3.22) by day 28 ( p-value < 0.0001). For mice immunized with the vaccine plus CpG ODNs, cytokine profiling using real-time quantitative polymerase chain reaction revealed increased IL-6 expression levels and decreased TNF-α levels compared to the untreated group, normalized with the housekeeping gene HPRT 1. However, the expression of IL-6 and TNF-α was not statistically significant between the treated groups ( p-value ≥ 0.2). Parameters for toxicity were within the normal range in all treatment groups.

 Conclusion

Based on these results the co-administration of the HBV vaccine with CpG ODN 2395 induces high immune responses in comparison to HBV vaccine alone.

 Hepatitis B virus (HBV); vaccine; adjuvants; CpG ODNs African Union through Pan African University Institute for Basic Sciences, Technology and Innovation (PAUSTI) This research was funded by the African Union through the Pan African University Institute for Basic Sciences, Technology, and Innovation (PAUISTI). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. 1. Introduction

Infectious diseases pose a significant threat to human health. 1 The etiological agent of both acute and chronic hepatitis B virus infections in humans is the Hepatitis B Virus (HBV), a partly double-stranded hepatotropic DNA virus. After six months of infection, serum Hepatitis B Surface Antigen (HBsAg; the viral glycoprotein) indicates a chronic HBV infection. 2 Currently, about 250 million people have chronic HBV infection globally, and every year, almost 800,000 people die from liver illnesses linked to HBV. 3 African regions have the highest prevalence of chronic HBV infection. 2 According to a dashboard from the World Health Organization, over 91 million Africans have Hepatitis B or C infections and almost 70% of all HBV infections occur there (WHO Africa, 2021). Although antiviral medications have advanced, primary prevention by immunization remains the most effective and cost-efficient public health intervention. 4 The introduction of immunization has greatly reduced the prevalence and death rate of infectious diseases. 1 Therefore, the best method to prevent HBV infection is vaccination.

There are certain drawbacks to the current HBV vaccine. The delivery of recombinant HBV vaccines to nations where infection is widespread is a challenge because of the high cost of vaccine production and a small percentage of vaccine recipients are not developing protective immunity even after receiving more than the recommended three doses of the vaccine. 5 Also, in the five years following immunization, 8-42% of those who had protective antibodies lost immunity. 6

Adjuvants are added to vaccines to stabilize and increase the potential of triggering a strong immune response. 7 They have been shown to reduce the amount of antigen needed to trigger a particular degree of immunological response. 8 For example, MF59 increased the effectiveness of the flu vaccine by 5-8 times. 9 Based on their characteristics, adjuvants can be divided into several groups, such as those that are based on aluminum salts, oil emulsions, or toll-like receptor (TLR) agonists. 8 Synthetic CpG Oligodeoxynucleotides (ODNs) show promise as adjuvants in vaccines. 10 Typically, they are single-stranded DNA molecules synthesized with specific sequence settings, notably containing unmethylated CpG dinucleotides, known as CpG motifs. 11 They can trigger an innate immune response in cells expressing TLR9, such as human plasmacytoid dendritic cells and B cells, resulting in the production of T helper 1 cells and proinflammatory cytokines. 12 In addition to being potent vaccine adjuvants, synthetic CpG oligodeoxynucleotides (CpG ODNs) are TLR9 agonists and mimic the function of naturally occurring CpG motifs found in bacterial DNA. 8 Alongside boosting the function of proficient antigen-presenting cells like B cells, macrophages, dendritic cells, T cells, and natural killer cells, the simultaneous administration of CpG ODNs with vaccines facilitates the augmentation of both humoral and cellular immune responses targeted towards the vaccine. Furthermore, it enhances the efficacy of specialized antigen-presenting cells. 13 Recent studies have consistently shown that CpG ODN serves as a more potent Th1-like adjuvant in comparison to the “gold standard,” complete Freund’s adjuvant (CFA). This superiority is evident in its ability to enhance the development of cytotoxic T lymphocytes (CTL) and T cells that secrete interferon (IFN). Furthermore, other research has indicated that CpG ODN can achieve heightened levels of antigen-specific activation without eliciting the severe local inflammatory reactions associated with CFA. 14

This study established the effects of CpG ODNs adjuvanted HBV vaccine on immunological response in BALB/c mice.

 2. Methods 2.1 Study approval

Ethical clearance was granted by the Mount Kenya University Review Committee (Approval number 2196 on 16 th of September 2023) and approval to carry out this study was obtained from KEMRI- Animal Care and Use Committee (KEMRI-ACUC/03.07.2023 on 28 th of July 2023). All animal experimentation adhered to the national and international standards as approved by the KEMRI-Animal Care and Use Committee and as specified in the above protocol number. The Engerix B vaccine was solely utilized for research purposes in this study and was neither altered nor commercialized.

 2.2 Animal model

Female BALB/c mice, weighing 20 ± 2 grams each, were purchased from the Institute of Primate Research (IPR) in Kenya. The mice acclimated for seven (7) days in a standard facility at KEMRI, during which they were provided with commercial pellets for food and had unrestricted access to water. Every effort was made to adhere to the principles of the 3Rs (replacement, reduction, and refinement) to minimize their injury and suffering. 15

2.3 Sample stratification and immunization

This study was conducted at KEMRI, Innovation & Technology Transfer Division (ITTD) and followed a laboratory-based experimental study. The sample size was determined using the “resource equation (E)”. 16 A total of 36 female BALB/c mice were used in this study. Mice for the experiments were clustered into 12 groups and immunized intramuscularly. Group 1 was immunized with 0.67 μM of CpG ODN 18281-1 alone, group 2 with 1 μg of Engerix B vaccine plus 0.67 μM CpG ODN 18281-1, group 3 with 0.67 μM of CpG ODN 18281-2 alone, group 4 with 0.67 μM of CpG ODN 18281-2 plus 1 μg of Engerix B vaccine, group 5 with 0.67 μM of CpG ODN 18289 alone, group 6 with 0.67 μM of CpG ODN 18289 plus 1 μg of Engerix B vaccine, group 7 with 0.67 μM of CpG ODN 1826 S alone, group 8 with 0.67 μM of CpG ODN 1826 S plus 1 μg of Engerix B vaccine, group 9 with 0.67 μM of CpG ODN 2395 alone, group 10 with 0.67 μM of CpG ODN 2395 plus 1 μg of Engerix B vaccine, group 11 with 1 μg of Engerix B vaccine (GlaxoSmithKline, Version number: GDS015/IPI11) and group 12 with 50 μL of PBS (Thermo Fisher Scientific, Lot n°178050) as negative control. Each treatment group of mice received a booster dose on day 14, consisting of 1μg of the Engerix B vaccine and 0.67 μM of CpG ODNs (supplied by Macrogen Europe, Lot n°230620-002-C3-C7) ( Table 1).

Various CpG ODNs employed in the research.
CpG ODNs (Macrogen) Sequences
18281-1 (22 mer) 5’-T *C *C *A *T *G *A *C *G *T *T *C *T *A *C *T *G *A *C * G *T *T-3’
18281-2 (23 mer) 5’-T *GA *CTGT *GAACGTTCGGATGAT *T-3’
18289 (22 mer) 5’-T *CCATGACGTTC *TACTGACGT *T-3’
1826 S (20 mer) 5'-T *CC * AT *G A *CG * TTC * CTG A *CG TT-3'
2395 (22 mer) 5’-TC *G T *CG TTT TC *G GCG C *GC G *CC G-3’

Modified phosphorothioate.

 2.4 Samples collection

Mice were blood-sampled on days 14 and 28 post-vaccination. The collected blood underwent processing to obtain plasma or remained as whole blood. Tail bleeding was used for plasma collection, while cardiac puncture was employed for obtaining whole blood. Tail blood was mixed with 50 μL of heparin (Kilitch Drugs India Ltd. Batch No: KLRC1004) in a 1.25 mL cryovial tube, and then centrifuged at 4000 rpm for 20 minutes to collect the supernatant. Before collecting whole blood, mice were euthanized with CO 2, and approximately 700 μL was drawn into 1.5 mL Ethylenediaminetetraacetic acid (EDTA)-containing tubes. Plasma was stored at -20°C, while whole blood was stored at -80°C. Spleen tissues were dissected from the mice and placed in sterile 1.5 mL Eppendorf tubes on ice. These spleen samples were stored at -80°C until they were utilized for total RNA extraction and subsequent experiments.

 2.5 Assessment of humoral immune responses to the vaccine

Assessment of humoral immune responses to the vaccine involved utilizing the Enzyme-Linked Immunosorbent Assay (ELISA) to measure HBV antibody levels. The Mouse HBV Surface Antibody (HBsAb) Qualitative Test Kit ELISA, along with its protocol, was employed for this purpose (manufactured by Solarbio Science & Technology Co., Ltd, China). ELISA plates were analyzed at a wavelength of 450nm using the ELISA Microplate Reader (manufactured in California, USA). Samples from each group were tested in triplicate, and the average Optical Density (OD) value was utilized to determine antibody levels.

 2.6 Evaluating expression of Tumor necrosis factor alpha (TNF-α) and Interleukin 6 (IL-6) in immunized mice

2.6.1 Preparation of total RNA from spleen tissues and cDNA synthesis

Spleen tissue samples were processed to extract total RNA employing the Total RNA Extraction Kit (manufactured by Solarbio Science & Technology Co., Ltd, China), following the provided instructions. The concentration and purity of the RNA were evaluated using the spectrophotometer (manufactured by Thermo Fisher Scientific, Waltham, Massachusetts, USA) at absorbance 260/280. The samples were then stored at -80°C for subsequent experiments. Subsequently, cDNA synthesis from the extracted total RNA samples was performed utilizing the Universal RT-PCR Kit and its associated protocol (manufactured by Solarbio Science & Technology, Beijing, China).

2.6.2 Quantitative Polymerase Chain Reaction (qPCR)

A 2X SYBR Green quantitative PCR Mastermix (manufactured by Solarbio Science & Technology Co., Ltd, China) was utilized in a total reaction volume of 25μL. Amplification was carried out on the Applied Biosystems Quant Studio 5 qPCR platform (manufactured by PE Applied Biosystems, USA) using the PCR thermal profile detailed in Table 2. The primers employed for amplifying TNF-α, Il-6, and the housekeeping gene are listed in Table 3. The relative quantification of gene expression was determined using the delta-delta threshold cycle (∆∆Ct) formula, ∆Ct = Ct (gene of interest) – Ct (housekeeping gene), by Medrano et al. 17

Thermal profile for Quantitative Real-Time PCR.
Step Time Temperature Cycles
Pre-Denaturation 10 Minutes 95 oC 1
Denaturation 15 Seconds 95 oC 45
Annealing/Extension 1 Minute 60 oC
Primer sequences used and anticipated amplicon sizes for TNF-α and Il-6 analysis.
Cytokine Forward Primer 5′--3′ Reverse Primer 5′--3′ NCBI Size of Amplicon Reference
Tumor necrosis factor alpha (TNF-α) CTCCAGGCGGTGCCTATGT GAAGAGCGTGGTGGCCC NM_013693.3 76 bp 18
Interleukin 6 (IL-6) GAGGATACC ACTCCCAAC AGACC AAGTGCATC ATCGTTGTTCATACA XM_021163844.1 141 bp 18
HPRT1 (Hypoxanthine guanine phosphoribosyl transferase 1) TCCTCCTCAGACCGCTTTT CCTGGTTCATCATCGCTAATC NM_013556.2 90 bp 17

Key: bp: base pair.

 2.7 Evaluation of hematological parameters and biochemical analyses

Analysis of the complete blood count in whole blood was conducted utilizing the HumaCount 30 TS hematology analyzer machine (manufactured by Human Diagnostics Worldwide, Germany) by the provided protocol. Additionally, the serum levels of Aspartate Transaminase (AST), Alanine Transferase (ALT), Creatinine, and Urea were assessed using the Reflotron colorimetric test strips (manufactured by Woodley Equipment Company, England) following the prescribed protocols.

 2.8 Data analysis

The Signal-to-noise ratio values (OD at 450 nm/PBS) calculated from the ELISA optical densities and the quantification cycle (Ct) values were recorded and analyzed in Microsoft Excel (2016). Relative mRNA expression levels of the target genes were normalized to HPRT 1 using the 2-ΔΔCt method. The data obtained for the hematological and biochemical parameters were expressed as mean values using Microsoft excel (2016). Statistical significance of differences was determined through One-way ANOVA and Student’s t-tests, with a p-value <0.05 being considered as statistically significant for all performed tests.

 3. Results 3.1 Signal-to-noise ratio values generated within different experimental groups

After the first immunization with the Engerix B vaccine supplemented with CpG-ODNs, the presence of antibodies in the plasma of all the immunized mice was observed. At day 14, it was shown that there was a statistically significant difference ( p < 0.0001) in Signal Noise ratio (S/N) values among the vaccinated groups supplemented with CpGs ( Figure 1). 19 Moreover, the findings demonstrated that the CpG 18281-1, CpG 18281-2, CpG 18289, and CpG 1826 supplemented groups exhibited 1.2, 1.8, 1.1, and 1.6-fold increases respectively with signal-to-noise ratio values (2.5, 3.8, 2.2 and 3.3 respectively) compared to vaccine group only (S/N = 2.1).

Immunostimulating activity of CpG ODNs on day 14 after administration of Engerix B vaccine, and CpG ODNs in BALB/c mice.

Key: CpG 18281-1Vac = CpG ODN 18281-1+Vaccine. CpG 18281-2Vac = CpG ODN 18281-2+Vaccine. CpG 18289Vac = CpG ODN 18289+Vaccine. CpG 1826SVac = CpG ODN 1826S+Vaccine. CpG 2395Vac = CpG ODN 2395+Vaccine. PBS = Negative control (** p < 0.01; **** p < 0.0001).

On the 28th day, the signal-to-noise (S/N) ratio values were markedly elevated in all treated groups compared to those on day 14 ( p < 0.0001). Notably, the groups supplemented with CpG 2395 showed a substantial 4.4-fold increase, reaching a signal-to-noise ratio value of 14.1 compared to the vaccine group only (S/N = 3.22). This was notably higher than the corresponding values for other CpG ODNs combined with the vaccine ( Figure 2). Specifically, CpG 18281-1, CpG 18281-2, CpG 18289, and CpG 1826 supplemented groups exhibited increases of 1.6, 2, 1.2, and 3.6-fold, respectively, with signal-to-noise ratio values of 5.1, 6.4, 3.9, and 11.7, respectively. These findings underscore that CpG ODN 2395 demonstrated the most significant effectiveness when combined with the Engerix B vaccine.

Immunostimulating activity of CpG ODNs on day 28 after administration of Engerix B vaccine, and CpG ODNs in BALB/c mice.

Key: CpG 18281-1Vac = CpG ODN 18281-1+Vaccine. CpG 18281-2Vac = CpG ODN 18281-2+Vaccine. CpG 18289Vac = CpG ODN 18289+Vaccine. CpG 1826SVac = CpG ODN 1826S+Vaccine. CpG 2395Vac = CpG ODN 2395+Vaccine. PBS = Negative control (**** p < 0.0001).

 3.2 Effect of vaccine and CpG ODNs on IL-6 and TNF-α expression

The groups of mice that received CpG ODNs-only exhibited lower levels of IL-6 compared to the expression level observed for the group treated with 1μg of vaccine. The Fold Change in Transcription (FCT) for CpG 18281-1 was 0.41, for CpG 18281-2 was 0.34, for CpG 18289 was 0.40, for CpG 1826 S was 0.35, and for CpG 2395 was 0.28 against 0.96 ( Figure 3A). However, the levels of IL-6 expressed in mice immunized with CpG ODNs plus vaccine are higher compared to the group of mice given the vaccine alone. The FCT for the CpG ODN 18281-1 + Vaccine group was 2.57, for the CpG ODN 18281-2 + Vaccine group was 2.16, for the CpG ODN 18289 + Vaccine group was 1.20, for the CpG ODN 1826 S + Vaccine group was 1.31, for the CpG ODN 2395 + Vaccine group was 2.77, and for the vaccine alone was 0.96 ( Figure 3A).

Relative expression of IL-6 and TNF-α 28 days after administration of Engerix B vaccine, and CpG ODNs in BALB/c mice.

Key: Vacc alone: Vaccine alone. CpG 18281-1+Vacc = CpG ODN 18281-1+Vaccine. CpG 18281-2+Vacc = CpG ODN 18281-2+Vaccine. CpG 18289+Vacc = CpG ODN 18289+Vaccine. CpG 1826+Vacc = CpG ODN 1826S+Vaccine. CpG 2395+Vacc = CpG ODN 2395+Vaccine. PBS = Negative control. (A) IL-6 gene expression, (B) TNF-α gene expression.

Regarding TNF-α expression, mice treated with CpGs-only and CpG 18281-1 + Vaccine, CpG 18281-2 + Vaccine, CpG 2395 + Vaccine, and vaccine group-only exhibited lower levels of TNF-α (FCT < 1.00) compared to the non-treated PBS group (FCT=1.00). Only the groups that received vaccine + CpG 18289 and CpG 1826 expressed a high level of TNF-α, with FCT values of 2.29 and 4.96, respectively ( Figure 3B).

 3.3 Assessment of hematological and biochemical parameters

The hematological characteristics of female BALB/c mice inoculated with 1 μg of vaccine alongside CpG ODN 2395 and PBS alone are presented in Table 4. The Neutrophil counts in the group of vaccine supplemented with CpG ODN 2395 and vaccine alone were lower than the untreated group (PBS). All the parameters for White Blood Cells, Lymphocytes, Monocytes, Eosinophils, Basophils, Red Blood Cells, HB, HCT, MCV, and Platelets were within the normal range. Higher MCHC counts were found in all treated and untreated groups. Also, higher MCH was observed in the vaccine group.

Results from hematological profiles.
Parameters Units ODN 5Vac Vaccine PBS Range
WBC 10 3/UL 3.6 ± 0.3 6.5 ± 0.1 10.3 ± 1.1 3.6-14
Neutrophils % 6.7 ± 0.6 6 ± 0.3 16.5 ± 1 11-29
Lymphocytes % 84 ± 7.5 85.5 ± 0.7 70.7 ± 0.3 65-87
Monocytes % 8.3 ± 0.6 7.5 ± 0.7 10 ± 0.4 3.75-14.33
Eosinophils % 1 ± 0 1 ± 0 1 ± 0 0-5
Basophils % 0 ± 0 0 ± 0 0 ± 0 0-1
RBC 10 6/UL 7.1 ± 0.9 7.9 ± 1 8.4 ± 1.1 7.1-9.5
HB g/dl 12.4 ± 1.3 15.5 ± 1.5 17.2 ± 1.7 12.4-18.9
HCT % 34.3 ± 4.5 38.9 ± 5.4 46.6 ± 6.1 37.4-51.7
MCV fl 49.1 ± 3.4 51.9 ± 4.5 48.9 ± 6.4 41.5-57.4
MCH Pg 17.4 ± 1.9 19.7 ± 0.5 16.3 ± 1.5 14.1-18.4
MCHC g/dl 36.3 ± 4 39.9 ± 1.8 34.8 ± 4.3 30.5-34.2
Platelets 10 3/UL 329 ± 3.6 540.5 ± 4.9 388.7 ± 10 325-888

Key: ODN 5Vac = CpG-ODN 2395 + Vaccine; PBS = Negative control; WBC = White Blood Cells; RBC = Red Blood Cells; HB = Hemoglobin; HCT = Hematocrit; MCV = Mean Corpuscular Volume; MCH = Mean Corpuscular Hemoglobin; MCHC = Mean Corpuscular Hemoglobin Concentration.

The comprehensive analysis revealed no statistically significant difference ( p ≥ 0.33) between the mice receiving treatment and those not receiving treatment.

Biochemical analysis of female BALB/c mice immunized with 1μg of vaccine plus CpG ODN 2395 and PBS alone are presented in Figure 4. Results for ALT, AST, Creatinine, and urea showed no statistical difference between treated and non-treated groups ( p ≥ 0.85).

Results of Biochemical analysis.

Key: ALT = Alanine transaminase (U/L); AST = Aspartate aminotransferase (U/L); Creatinine (mg/dl); Urea (mg/dl).

 4. Discussion

This study has demonstrated that including CpG ODN 2395 in the HBV vaccine increases the immune-potentiating effect of the vaccine. CpG ODN 2395 is a class C CpG that combines the characteristics of both CpG-A and CpG-B ODNs. The CpG-A ODNs cause pDCs to produce high levels of IFN-α and TNF-α. They weakly stimulate TLR9 and IL-6 production. The CpG-B ODNs increase B-cell activation, maturation, and proliferation. They also induce IL-6, IFN-α, and TNF-α production. 20 Strong immune-boosting effects of CpG-C ODNs have been demonstrated; nevertheless, certain sequence characteristics are required. 20 For example, ODN 2395 includes two key features in its sequence that could be contributing to its adjuvant character. First, a palindromic sequence with several CpG motifs at the 3′-end of the ODN, followed by one or more TCG elements at the 5′-end of the ODN. It has been shown that the hexameric motif 5′ GTCGTT in ODN 2395 is the ideal sequence for CpG-C ODN activities. 20

Other studies have demonstrated that the addition of CpG ODN to the HBV vaccine increased the titers of antibodies against HBsAg (anti-HBs). 21 , 22 Due to its immunostimulatory properties, many studies support the use of CpG DNA-based trials for immunotherapy against infectious disorders. 23 In this study, groups of mice treated with 1 μg of Engerix B vaccine plus CpG ODNs showed substantial levels of S/N ratio values compared to groups treated with vaccine alone after 14 and 28 days of vaccination (**** p ˂ 0.0001). This supports the study conducted by Jurk et al 24 who showed that CpG ODNs are potent inducers of the innate immune system. Our findings also confirm those of 25 who showed that J&J vaccination against SARS-CoV-2 at low and high doses in combination with CpG ODN 18281-1, CpG ODN 18281-2, and CpG ODN 18289 generated higher levels of specific IgG than the vaccine alone. On the other hand, 26 demonstrated that the majority of antibodies were IgG2a in mice injected with HBsAg containing CpG ODN (1826), indicating a potent Th1-type response. Surprisingly, the CpG ODN 1826 generated substantially more IgG2a than IgG1 even when paired with alum, showing that the effects of CpG ODN 1826 dominate over those of alum about T-cell help. 26 The findings of, 27 show that CpG ODN 1826 can induce ten times more anti-HBs titers in an alum-adjuvanted HBsAg vaccination compared to vaccine plus alum only. In addition, following immunization with the combined adjuvant rather than alum alone, elevated antibody titers manifest at a significantly earlier time point and are more Th1-biased. 27 His study concludes that ODNs with cytosine guanine dinucleotides are immunomodulatory and stimulate both professional B cells and Antigen antigen-presenting cells.

The CpG-ODNs upregulate MHC II and other co-stimulatory molecules. They cause the secretion of cytokines such as TNF-α, and IL-6 and the production of immunoglobulins by B cells. 27 The IL-6 molecule is a pleiotropic cytokine predominantly expressed in activated monocytes or macrophages, but also fibroblasts or activated endothelial cells of inflamed tissues. IL-6 is inducible by LPS, TNF-α, and some interferons. Regarding the biological effects, IL-6 not only induces acute inflammation but also elicits anti-inflammatory effects. Furthermore, IL-6 induces terminal differentiation of B cells to plasma cells, which led to the descriptive name B-cell differentiation factor. 15 This study showed that all groups treated with vaccine plus CpG ODNs expressed Il-6 except the group treated with vaccine only (FCT = 0.96). This study observed no statistical difference in levels of IL-6 between treated and untreated groups ( p ≥ 0.2). This finding agrees with that of 28 who showed that both untreated and HBV vaccine-only treated groups produced less IL-6 at 0.603- and 1.469-fold changes in transcription (FCT) respectively.

TNF-α is a non-glycosylated 17-kDa protein that is mostly produced by macrophages, CD4+, CD8+, activated NK cells, neutrophils, and CD8+ T cells. 15 In this study, TNF-α levels in the untreated group (FCT: 1.00) were higher compared to treated groups. Although these differences were not statistically significant ( p ≥ 0.2), except for the treated groups of vaccine plus CpG 18289 and CpG 1826, which expressed TNF-α at FCT values of 2,29 and 4.96 respectively. This finding does not agree with the study by Ref. 28 which showed that mice treated with the HBV vaccine expressed higher levels of TNF-α than the untreated group at 28.84 – and 1.00 FCT respectively. These results showed that CpG ODNs enhance the secretion of Il-6, and only CpG 18289 and CpG 1826 had effect on the expression of TNF-α ( Figure 3).

The body weight, behavior, and body features were normal in mice treated with CpG ODN 2395. There was also no evidence of toxicity. Results of the hematological study showed that values were normal in all parameters analyzed in both treated and untreated groups. As observed by Ref. 29 RBC, Hemoglobin, MCV, monocyte, eosinophil, basophil, platelet, and lymphocyte levels were within the normal range. Though value differences were observed between treated groups regarding Neutrophils and HCT in the CpG ODN 2395 group, MCHC in all groups, and MCH in the HBV vaccine-only group, differences were not significant ( p ≥ 0.05) ( Table 4).

Blood biochemical profiles are a useful diagnostic tool since they show the animal’s physiological condition. 25 Urea and creatinine levels were determined to check kidney function and, ALT and AST levels were also determined to check liver function in mice immunized with the vaccine + CpG ODN 2395. This study observed no significant difference in values of these parameters between the treated groups and the untreated group ( p ≥ 0.05) ( Figure 4).

As a result, the findings indicated that the ALT, AST, urea, and creatinine parameters were within normal ranges.

 Conclusion

Based on the results, we conclude that the HBV vaccine with CpG ODN 2395 has a higher potential of inducing body antibody and IL-6-based protection against HBV infection and is not toxic.

 Institutional review board statement

Ethical clearance has been obtained by the Mount Kenya University Review Committee (Approval number 2196 on 16/09/2023).

 Author roles

Titilayo Kemi Sophia Nelly Adedjobi: Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Investigation, Methodology, Resources, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing; Daniel Kariuki: Conceptualization, Formal Analysis, Supervision, Writing – Review & Editing; James Kimotho: Conceptualization, Formal Analysis, Supervision, Writing – Review & Editing.

 Ethics and consent

Mount Kenya University Review Committee (Approval number 2196 on 16 th of September 2023) and approval to carry out this study was obtained from KEMRI - Animal Care and Use Committee (KEMRI-ACUC/03.07.2023 on 28 th of July 2023).

 Data availability Underlying data

Figshare: ‘Co-administration of a Hepatitis B vaccine with CpG-ODN 2395 induces a stronger immune response in BALB/c mice.’ https://doi.org/10.6084/m9.figshare.24745470.v2. 19

This project contains the following underlying data:

Biochemical results.png (results from biochemical analysis of the whole blood from the mice)

Hematology results.png (results from hematological analysis of the whole blood from the mice)

qPCR results.png (results from the real-time PCR for the target genes; IL-6, TNF-α and housekeeping gene, HPRT 1)

Signal-to-noise ratio values calculated from Elisa Optical Densities.png (obtained from the different treatments)

Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0)

 Reporting guidelines

Figshare: Arrive checklist for ‘Co-administration of a Hepatitis B vaccine with CpG-ODN 2395 induces a stronger immune response in BALB/c mice.’ https://doi.org/10.6084/m9.figshare.24745470.v2. 19

Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0)

 Acknowledgments

The African Union; Pan African University Institute for Basic Sciences, Technology and Innovation (PAUISTI); and Kenya Medical Research Institute (KEMRI).

 References Shi S Zhu H Xia X : Vaccine adjuvants: Understanding the structure and mechanism of adjuvanticity. Vaccine. May 27, 2019;37(24):3167–3178. Elsevier Ltd. 31047671 10.1016/j.vaccine.2019.04.055 Yuen MF : Hepatitis B virus infection. Nat. Rev. Dis. Prim. Jun. 07, 2018;4. Nature Publishing Group. 10.1038/nrdp.2018.35 Taherkhani R Farshadpour F : Prevalence, genotype distribution and mutations of hepatitis B virus and the associated risk factors among pregnant women residing in the northern shores of Persian Gulf, Iran. PLoS One. Mar. 2022;17(3 March):e0265063. 35271684 10.1371/journal.pone.0265063 PMC8912131 Meireles LC Marinho RT Van Damme P : Three decades of hepatitis B control with vaccination. World J. Hepatol. 2015;7(18):2127–2132. Baishideng Publishing Group Co. 10.4254/wjh.v7.i18.2127 Qiu Y : DNA-based vaccination against hepatitis B virus using dissolving microneedle arrays adjuvanted by cationic liposomes and CpG ODN. Drug Deliv. Sep. 2016;23(7):2391–2398. 25625495 10.3109/10717544.2014.992497 ZannoIli R Morgese G Jli RZ : Therapeutic Controversies HEPATITIS B VACCINE: CURRENT ISSUES The opinions of the European. Yu P : A CpG oligodeoxynucleotide enhances the immune response to rabies vaccination in mice. Virol. J. Nov. 2018;15(1):174. 30424815 10.1186/s12985-018-1089-1 PMC6234694 Kuo TY : Development of CpG-adjuvanted stable prefusion SARS-CoV-2 spike antigen as a subunit vaccine against COVID-19. Sci. Rep. Dec. 2020;10(1):20085. 33208827 10.1038/s41598-020-77077-z PMC7676267 Ou H : Longevity of protective immune responses induced by a split influenza A (H7N9) vaccine mixed with MF59 adjuvant in BALB/c mice. 2017. Chu CY : Cytosine-phosphate-guanine oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by keyhole limpet hemocyanin antigen in dairy cattle. Nucleic Acid Ther. Oct. 2011;21(5):323–332. 21916610 10.1089/nat.2010.0275 Ou H : Longevity of protective immune responses induced by a split influenza A (H7N9) vaccine mixed with MF59 adjuvant in BALB/c mice. 2017. Suriano CM Verpeut JL Kumar N : AAV Decreases Dendritic Complexity Adeno-associated virus (AAV) reduces cortical dendritic complexity in a TLR9-dependent manner. 2021. 10.1101/2021.09.28.462148 Johns JR : CPG-B ODN AND E7-PEPTIDE FUNCTIONALIZED PAMAM DENDRIMERS FOR CO-DELIVERY OF HPV-16 CANCERS THERAPUETIC VACCINE. Vaccine Adjuvants. Möller B Villiger PM : Inhibition of IL-1, IL-6, and TNF-α in immune-mediated inflammatory diseases. Springer Semin. Immunopathol. Jun. 2006;27(4):391–408. 16738952 10.1007/s00281-006-0012-9 Charan J Kantharia N : How to calculate sample size in animal studies? J. Pharmacol. Pharmacother. Oct. 2013;4(4):303–306. 24250214 10.4103/0976-500X.119726 PMC3826013 Medrano G Guan P Barlow-Anacker AJ : Comprehensive selection of reference genes for quantitative RT-PCR analysis of murine extramedullary hematopoiesis during development. PLoS One. Jul. 2017;12(7):e0181881. 28732075 10.1371/journal.pone.0181881 PMC5521956 Odukoya OA Ajjan R Lim K : The pattern of cytokine mRNA expression in ovarian endometriomata. 1997. Adedjobi TKSN Kariuki D Kimotho J : Co-administration of a Hepatitis B vaccine with CpG-ODN 2395 induces a stronger immune response in BALB/c mice.[Dataset]. Figshare. 2024. 10.6084/m9.figshare.24745470.v2 Li T : A novel C type CpG oligodeoxynucleotide exhibits immunostimulatory activity in vitro and enhances antitumor effect in vivo. Front. Pharmacol. 2020;11. 32116691 10.3389/fphar.2020.00008 PMC7015978 Cooper CL : HBV Vaccine in Healthy Adults: A Double-Blind Phase I/II Study. 2004. Davis HL : CpG DNA overcomes hyporesponsiveness to hepatitis B vaccine in orangutans. Reference Source Zhu B Wang T Wei X : CpG DNA-triggered upregulation of TLR9 expression affects apoptosis and immune responses in human plasmacytoid dendritic cells isolated from chronic hepatitis B patients. Arch. Physiol. Biochem. 2023;129(2):330–337. 32990473 10.1080/13813455.2020.1822414 Jurk M : C-Class CpG ODN: Sequence requirements and characterization of immunostimulatory activities on mRNA level. Immunobiology. 2004;209(1–2):141–154. 15481148 10.1016/j.imbio.2004.02.006 Celise DA Kimotho J Kimani JW : Increase in the Immune Response in Balb/c Mice after the Co-Administration of a Vector-Based COVID-19 Vaccine with Cytosine Phosphoguanine Oligodeoxynucleotide. Vaccines (Basel). Dec. 2022;11(1):53. 36679896 10.3390/vaccines11010053 PMC9864427 Davis HL Weeranta R Waldschmidt TJ ; CpG DNA Is a Potent Enhancer of Specific Immunity in Mice Immunized with Recombinant Hepatitis B Surface Antigen 1. 1998. Reference Source Special Feature. Ndung’u F Nyanjom S Omari S : Preliminary assessment of adjuvant activities of Glycine Max (L.) Merr saponin extract in BALB/c mice immunized with hepatitis B virus vaccine. F1000Res. Sep. 2023;12:1145. 10.12688/f1000research.138418.1 Silva-Santana G : Clinical hematological and biochemical parameters in Swiss, BALB/c, C57BL/6 and B6D2F1 Mus musculus. Animal Model Exp. Med. Dec. 2020;3(4):304–315. 33532705 10.1002/ame2.12139 PMC7824965 10.5256/f1000research.159757.r271988 Reviewer response for version 1 Johnson-Weaver Brandi Tranae' 1 Referee Duke University Medical Center, Durham, North Carolina, USA

Competing interests: No competing interests were disclosed.

 10 9 2024 Copyright: © 2024 Johnson-Weaver BT 2024 This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. recommendation reject

The authors compare antigen-specific antibody responses in BALB/c mice after intramuscular immunization with the HepB vaccine Engerix alone, with various CpG sequences alone, or the combination of the vaccine containing various CpG sequences as an adjuvant. The authors described vaccine-induced antibody responses as a signal to noise ratio normalized to antibody responses from mice immunized with a PBS control. The authors also report vaccine-induced fold-change in key cytokines, including IL-6 and TNFa, and assessed whole blood samples for cell composition and blood chemistries to monitor for abnormal responses. The authors identify CpG 2395 as a potent adjuvant that does not induce abnormal blood counts or chemistries after immunization.

Although CpG 2395 appears to be the superior CpG adjuvant tested in the described studies, several key elements limit the enthusiasm of the results.

The authors evaluate 12 vaccine conditions using 3 mice per group. Statistical analyses are reported to be tested by ANOVA or t-test; however, it is not clear which assay used which test to determine statistical differences. More clarification and transparency is required to demonstrate the statistical differences reported in this manuscript. Please provide power calculations to identify the statistical power required to observe differences across 12 immunization groups. 

Figures 1 and 2 also appear to compare responses across multiple groups; however, the authors do not discuss if multiple comparison analyses or corrections were performed. Similarly, the methods do not provide sufficient detail to understand the ELISA results. For example, what is the serum/plasma dilution for testing the samples in the assay? Also, does biological replicates and technical replicates combine to determine  the S/N ratio for each group.

Figure 3 does not appear to have any statistical analyses performed.

While the blood cell count and biochemistry data are interesting, there does not appear to be any statistical comparisons between readouts.

One benefit of vaccine adjuvants is the ability to modulate the type of antigen-specific immune response, this manuscript lacks a thorough characterization of vaccine-induced immunity despite the authors referencing other literature reports that described vaccine-induced antibody isotypes and T cell cytokine responses.

Is the work clearly and accurately presented and does it cite the current literature?

Partly

If applicable, is the statistical analysis and its interpretation appropriate?

No

Are all the source data underlying the results available to ensure full reproducibility?

Partly

Is the study design appropriate and is the work technically sound?

No

Are the conclusions drawn adequately supported by the results?

Partly

Are sufficient details of methods and analysis provided to allow replication by others?

No

Reviewer Expertise:

Vaccines, immunology, adjuvants, allergy

I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.

 10.5256/f1000research.159757.r297823 Reviewer response for version 1 Lu Fengmin 1 Referee Department of Microbiology, Peking University, Beijing, Beijing, China

Competing interests: No competing interests were disclosed.

 16 7 2024 Copyright: © 2024 Lu F 2024 This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. recommendation approve-with-reservations

ADEDJOBI et.al found the co-administration of the HBV vaccine with CpG ODN 2395 induces high immune responses compared to the HBV vaccine alone. This is interesting research, but I have some questions may need to be addressed and suggestions to the authors.

The sample size of mice in each group is too few for the current study. Please explicitly state the number of independent experimental replicates used to generate the data in all relevant figures.

Why mice immunized with CpG ODNs alone generated HBsAb? Does the vaccine with CpG-ODN provide better protection?

Why is there a decrease in neutrophils in the peripheral blood of the vaccine group？

How do you determine the dosage of 0.67μM to administer?

There are studies have reported that the immune cells of male and female react differently to pathogens, do male mice produce the same results?

Is the work clearly and accurately presented and does it cite the current literature?

Partly

If applicable, is the statistical analysis and its interpretation appropriate?

I cannot comment. A qualified statistician is required.

Are all the source data underlying the results available to ensure full reproducibility?

Yes

Is the study design appropriate and is the work technically sound?

Partly

Are the conclusions drawn adequately supported by the results?

Yes

Are sufficient details of methods and analysis provided to allow replication by others?

Partly

Reviewer Expertise:

Microbiology

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

 10.5256/f1000research.159757.r292789 Reviewer response for version 1 Gerlich Wolfram H 1 Referee Institute of Medical Virology, Justus Liebig University Giessen, Giessen, Germany

Competing interests: No competing interests were disclosed.

 5 7 2024 Copyright: © 2024 Gerlich WH 2024 This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. recommendation reject

General comment

The subject of this paper is principally interesting. The immunogenicity of current hepatitis B vaccines is not optimal and insufficient for recipients with impaired immune system. While the composition of the HBV surface antigen in the vaccines is virtually unchanged for 40 years, some new adjuvants have been introduced for problematic recipients, e.g., an CpG ODN for the vaccine Heplisav-B.

This paper does not deal directly with development of a vaccine for use in human recipients and does not discuss this aspect in the introduction or discussion. Instead, a search for an optimally active CpG ODN as adjuvant for the conventional hepatitis B vaccine Engerix B from GSK was undertaken using mice for immunization. The experiments could have been potentially useful, but, unfortunately, the study design and the assays for the immune response, i.e. antiHBs and the cytokines, are inadequate as pointed out below.

Specific comments

The abbrev. KEMRI should be once explained: Kenya Medical Research Institute.

At least once the composition of Engerix B should be explained: 20 microgram HBsAg /ml expressed in yeast and 0.5 mg Al-Ions as aluminumhydroxide.

Is injection of the CpG alone an immunization? CpGs are not antigens!

The authors used a qualitative assay for the antiHBs level without any standardized reference sample. State of the art is to measure and report antiHBs levels in mIU/mL using calibrated assays.

The antiHBs assay is problematic and possibly nonspecific.

Since calibration in mIU/mL antiHBs is missing, at least a curve between the OD and increasing dilutions of an arbitrary antiHBs standard should have been done as in ref. 26.

Are data on the limit of detection and the range of semi-quantitation of this Mouse HBV Surface Antibody (HBsAb) Qualitative test kit ELISA assay available?

Does this assay detect only mouse antiHBs?

How are positive and negative results distinguished if no cutoff is mentioned in the results? See also point 8.

Does the assay detect all immunoglobulin classes (IgG and IgM)?

The quantification of the RNA encoding TNF-alpha, IL-6 and HPRT1 is suboptimal and not calibrated with quantitative standard samples.

Results. This sentence contains an error: Moreover, the findings demonstrated that the CpG 18281-1, CpG 18281-2, CpG 18289, and CpG 1826 supplemented groups exhibited 1.2, 1.8, 1.1, and 1.6-fold increases respectively with signal-to-noise ratio values (2.5, 3.8, 2.2 and 3.3 respectively) compared to vaccine group only (S/N = 2.1).” It should be 2.2 : 2.1 = 1.047, i.e., 1.0 and not 1.1. Irrespectively, both the ratio of 1.1 or 1.047 are not at all a notable increase.

In contrast, following this sentence, it should be mentioned that the S/N for CpG2395Vac was significantly lower than for the vaccine alone. Here, this ODN seems to inhibit the antiHBs response.

Figure 1 and 2. Which S/N value corresponds to a cutoff between positive and negative?

The PBS control obviously does not provide a valid control because the two CpGs in fig. 1 without vaccine generate higher S/N signals than the vaccine alone.

In fig. 2 CpG 18281-2 alone generates an as high S/N of ca. 3 as the vaccine alone. Obviously, an S/N of 3 does not indicate specific antiHBs antibody since an adjuvant without antigen cannot induce a specific antibody.

It should also be noted that the obviously nonspecific S/N signals for the CpGs alone between 1- 3 did not change much from the first to the second blood sampling.

9. Ref. 19 from the authors of this manuscript, Adedjobi TKSN, Kariuki D, Kimotho J, contains exactly the same data as here. Is this compatible to this submission?

10. Refs. 21 and 22 cannot be found without additional data.

11. The authors should have followed the experimental approach described 26 years ago in J Immunol. (ref. 26).

Is the work clearly and accurately presented and does it cite the current literature?

Partly

If applicable, is the statistical analysis and its interpretation appropriate?

Partly

Are all the source data underlying the results available to ensure full reproducibility?

No source data required

Is the study design appropriate and is the work technically sound?

No

Are the conclusions drawn adequately supported by the results?

No

Are sufficient details of methods and analysis provided to allow replication by others?

Partly

Reviewer Expertise:

Medical Virology, Hepatitis B vaccines and diagnostics

I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.