<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.148093.1</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>Increased biofilm staining after deletion of 
                    <italic>sepA </italic>in enteroaggregative 
                    <italic>E. coli</italic> strains is not due to the lack of SepA</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 1; peer review: 1 approved with reservations, 1 not approved]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Van Nederveen</surname>
                        <given-names>Viktoria A</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <uri content-type="orcid">https://orcid.org/0009-0008-2882-7815</uri>
                    <xref ref-type="aff" rid="a1">1</xref>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Johnson</surname>
                        <given-names>Yuliya Seldina</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Soc</surname>
                        <given-names>Anthony</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Melton-Celsa</surname>
                        <given-names>Angela R</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-3653-662X</uri>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Microbiology &amp; Immunology, Uniformed Services University, Bethesda, MD, 20814, USA</aff>
                <aff id="a2">
                    <label>2</label>Henry M Jackson Foundation for the Advancement of Military Medicine Inc, Bethesda, Maryland, USA</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:angela.melton-celsa@usuhs.edu">angela.melton-celsa@usuhs.edu</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>3</day>
                <month>6</month>
                <year>2024</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2024</year>
            </pub-date>
            <volume>13</volume>
            <elocation-id>562</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>21</day>
                    <month>5</month>
                    <year>2024</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2024 Van Nederveen VA et al.</copyright-statement>
                <copyright-year>2024</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/13-562/pdf"/>
            <abstract>
                <sec>
                    <title>Background</title>
                    <p>Enteroaggregative 
                        <italic toggle="yes">E. coli</italic> (EAEC) is associated with acute and chronic diarrhea worldwide. EAEC is thought to form thick biofilms on the intestinal mucosa. Epidemiological data suggest that SepA, a serine protease autotransporter of 
                        <italic toggle="yes">Enterobacteriaceae</italic> (SPATE), is important for EAEC disease. The genes for SepA, and some proteins that are important for EAEC biofilm formation and aggregative adherence, are encoded by the pAA plasmid.</p>
                </sec>
                <sec>
                    <title>Methods</title>
                    <p>We deleted 
                        <italic toggle="yes">sepA</italic>
                        <sub>49-4043</sub> from six EAEC clinical isolates and inserted a chloramphenicol resistance gene (
                        <italic toggle="yes">cat</italic>) in place of the 
                        <italic toggle="yes">sepA</italic> coding sequence. 
                        <italic toggle="yes">In vitro</italic> biofilm formation was assessed after growth in 96-well plates. Complementation studies were conducted with genetic and protein-based techniques. We moved the pAA plasmid from EAEC strains into a commensal 
                        <italic toggle="yes">E. coli.</italic> Finally, we sequenced the pAA of several strains.</p>
                </sec>
                <sec>
                    <title>Results</title>
                    <p>All of the wild-type EAEC strains secreted similar amounts of SepA as assessed by Western blot analysis. Four of the six mutant EAEC strains exhibited increased biofilm staining when 
                        <italic toggle="yes">sepA</italic> was deleted. Additionally, we found that introduction of pAA&#x0394;
                        <italic toggle="yes">sepA</italic>
                        <sub>K261</sub> into a nalidixic acid resistant commensal 
                        <italic toggle="yes">E. coli</italic> strain, (HSNal
                        <sup>R</sup>) resulted in significantly increased biofilm staining relative to HSNal
                        <sup>R</sup> (pAA
                        <sub>K261</sub>). Therefore, pAA&#x0394;
                        <italic toggle="yes">sepA</italic>
                        <sub>K261</sub> alone was sufficient to confer the elevated biofilm phenotype onto HSNal
                        <sup>R</sup>.</p>
                    <p>However, introduction of 
                        <italic toggle="yes">sepA</italic> via a plasmid or on the pAA did not restore biofilm staining to wild-type levels in the &#x0394;
                        <italic toggle="yes">sepA</italic> mutant strains that showed elevated biofilm staining. Furthermore, the addition of exogenous SepA to the biofilm 
                        <italic toggle="yes">in vitro</italic> did not reduce biofilm staining.</p>
                </sec>
                <sec>
                    <title>Conclusions</title>
                    <p>Taken together, our results suggest that deletion of 
                        <italic toggle="yes">sepA</italic> causes elevated biofilm formation in some EAEC strains, but that the increased biofilm staining is not directly due to the loss of SepA.</p>
                </sec>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>Escherichia coli</kwd>
                <kwd>enteroaggregative</kwd>
                <kwd>SepA</kwd>
                <kwd>biofilm</kwd>
            </kwd-group>
            <funding-group>
                <award-group id="fund-1">
                    <funding-source>Uniformed Services University</funding-source>
                    <award-id>MIC-73-12977andMIC-73-3373toARMCandT0granttoVAV.</award-id>
                </award-group>
                <funding-statement>This work was funded by the following awards: T0 Grant from Uniformed Services University of the Health Sciences (USUHS) MIC-73-10758 to VAV; USUHS MIC-73-12977 and MIC-73-3373 to ARMC. </funding-statement>
                <funding-statement>
                    <italic>The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.</italic>
                </funding-statement>
            </funding-group>
        </article-meta>
    </front>
    <body>
        <sec id="sec5" sec-type="intro">
            <title>Introduction</title>
            <p>Enteroaggregative 
                <italic toggle="yes">Escherichia coli</italic> (EAEC) is associated with acute and chronic diarrhea worldwide as well as travelers&#x2019; diarrhea.
                <sup>
                    <xref ref-type="bibr" rid="ref1">1</xref>
                </sup>
                <sup>&#x2013;</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref10">10</xref>
                </sup> Populations strongly affected by EAEC include children in developing countries and deployed military personnel.
                <sup>
                    <xref ref-type="bibr" rid="ref1">1</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref9">9</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref11">11</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref12">12</xref>
                </sup> Globally, diarrhea is the second leading cause of death in children under five.
                <sup>
                    <xref ref-type="bibr" rid="ref13">13</xref>
                </sup> Among deployed military personnel, EAEC is the second most common cause of travelers&#x2019; diarrhea, a condition that is the primary generator of lost person-hours and reduced operational readiness.
                <sup>
                    <xref ref-type="bibr" rid="ref8">8</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref9">9</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref14">14</xref>
                </sup>
                <sup>&#x2013;</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref16">16</xref>
                </sup> EAEC creates thick biofilms on the intestinal mucosa.
                <sup>
                    <xref ref-type="bibr" rid="ref1">1</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref17">17</xref>
                </sup>
                <sup>&#x2013;</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref20">20</xref>
                </sup> Biofilm formation is thought to be necessary for EAEC to cause diarrhea.
                <sup>
                    <xref ref-type="bibr" rid="ref1">1</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref17">17</xref>
                </sup>
                <sup>&#x2013;</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref20">20</xref>
                </sup> EAEC was first characterized by a stacked-brick pattern of adherence and aggregation on HEp-2 cells.
                <sup>
                    <xref ref-type="bibr" rid="ref17">17</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref19">19</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref21">21</xref>
                </sup> Currently EAEC are identified by screening for the gene for the positive regulator of virulence genes, 
                <italic toggle="yes">aggR</italic>, and genes such as those for the aggregative adherence fimbriae (AAF).
                <sup>
                    <xref ref-type="bibr" rid="ref22">22</xref>
                </sup>
                <sup>&#x2013;</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref24">24</xref>
                </sup> EAEC strains are heterogeneous, and may have a variety of virulence genes.</p>
            <p>In addition to 
                <italic toggle="yes">aggR</italic> and genes for AAF, EAEC usually encodes one or more serine protease autotransporter of 
                <italic toggle="yes">Enterobacteriaceae</italic> (SPATE).
                <sup>
                    <xref ref-type="bibr" rid="ref25">25</xref>
                </sup> SepA is a SPATE that is found in 21-60% of EAEC, depending on the study.
                <sup>
                    <xref ref-type="bibr" rid="ref5">5</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref26">26</xref>
                </sup>
                <sup>&#x2013;</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref30">30</xref>
                </sup> Epidemiological data indicate that SepA may be important for disease caused by EAEC. For example, data from Mali collected during the MAL-ED study showed that 
                <italic toggle="yes">sepA</italic> was the EAEC gene most strongly associated with diarrheal cases among children under five years of age.
                <sup>
                    <xref ref-type="bibr" rid="ref26">26</xref>
                </sup> In a similar analysis of Gambian data, 
                <italic toggle="yes">sepA</italic> was also associated with childhood diarrheal cases.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>
                </sup> A study in Thailand on EAEC-mediated diarrhea in children found that 
                <italic toggle="yes">sepA</italic> was one of the genes detected in significantly more cases than controls.
                <sup>
                    <xref ref-type="bibr" rid="ref31">31</xref>
                </sup> A study in Iran on EAEC-mediated diarrhea in children found that isolates positive by PCR for 
                <italic toggle="yes">agg4A</italic> (AAF type 4), and the SPATE genes 
                <italic toggle="yes">pic</italic> and 
                <italic toggle="yes">sepA</italic> formed stronger biofilm 
                <italic toggle="yes">in vitro</italic> than strains without those genes.
                <sup>
                    <xref ref-type="bibr" rid="ref32">32</xref>
                </sup> The AAF are important for EAEC biofilm formation and adherence.
                <sup>
                    <xref ref-type="bibr" rid="ref21">21</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref28">28</xref>
                </sup>
                <sup>,</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref33">33</xref>
                </sup>
                <sup>&#x2013;</sup>
                <sup>
                    <xref ref-type="bibr" rid="ref37">37</xref>
                </sup>
            </p>
            <p>Despite the implications of these epidemiological studies, little is known about the function of SepA. All SPATEs mediate their own secretion, contain a secreted serine protease domain, and are thought to have a unique protease target. Currently, the target of the serine proteinase activity of SepA for EAEC is unknown.
                <sup>
                    <xref ref-type="bibr" rid="ref38">38</xref>
                </sup> In 
                <italic toggle="yes">Shigella</italic>, deletion of 
                <italic toggle="yes">sepA</italic> reduces fluid accumulation in the rabbit ligated ileal loop model.
                <sup>
                    <xref ref-type="bibr" rid="ref39">39</xref>
                </sup> However, unlike 
                <italic toggle="yes">Shigella</italic>, EAEC is not an invasive pathogen; therefore, SepA may play a different role in EAEC pathogenesis than it does for 
                <italic toggle="yes">Shigella.</italic>
            </p>
            <p>In our collection of EAEC isolates from the Trial Evaluating Ambulatory Therapy of Travelers&#x2019; Diarrhea (TrEAT-TD) study, which investigated travelers&#x2019; diarrhea in UK and US military personnel deployed in Kenya, Djibouti, Afghanistan, and Honduras,
                <sup>
                    <xref ref-type="bibr" rid="ref40">40</xref>
                </sup> 23% of the strains positive for AAF were positive for 
                <italic toggle="yes">sepA.</italic> To investigate the role of SepA in EAEC pathogenesis, we deleted 
                <italic toggle="yes">sepA</italic> from EAEC strain K261. We found that K261&#x0394;
                <italic toggle="yes">sepA</italic> exhibited increased biofilm staining 
                <italic toggle="yes">in vitro.</italic> Therefore, we deleted 
                <italic toggle="yes">sepA</italic> from several additional strains. For some strains the 
                <italic toggle="yes">sepA</italic>
                <sub>49-4043</sub> deletion caused increased biofilm staining, but for others the 
                <italic toggle="yes">sepA</italic> mutant strain had equivalent biofilm to the wild-type (wt) parental strain. Ultimately, complementation of the 
                <italic toggle="yes">sepA</italic> mutation, either genetically or by adding SepA exogenously, did not restore wt biofilm staining. Our results suggest that the reason for the elevated biofilm in some EAEC 
                <italic toggle="yes">sepA</italic> mutant strains is not directly related to the lack of SepA.</p>
        </sec>
        <sec id="sec6" sec-type="methods">
            <title>Methods</title>
            <sec id="sec7">
                <title>Bacterial strains and constructs used in this study</title>
                <p>Bacterial strains used in this study are listed in 
                    <xref ref-type="table" rid="T1">Table 1</xref>. We selected 
                    <italic toggle="yes">sepA</italic>-positive strains from our collection of EAEC clinical isolates obtained from the Trial Evaluating Ambulatory Therapy of Travelers&#x2019; Diarrhea (TrEAT-TD) study, which investigated travelers&#x2019; diarrhea in UK and US military personnel deployed in Kenya, Djibouti, Afghanistan, and Honduras.
                    <sup>
                        <xref ref-type="bibr" rid="ref28">28</xref>
                    </sup>
                    <sup>,</sup>
                    <sup>
                        <xref ref-type="bibr" rid="ref40">40</xref>
                    </sup> For an 
                    <italic toggle="yes">agg5A-</italic>positive, 
                    <italic toggle="yes">sepA-</italic>positive strain, we used D5613 (C267-15), a strain isolated from a pediatric case in Mozambique.
                    <sup>
                        <xref ref-type="bibr" rid="ref29">29</xref>
                    </sup> HS is a commensal 
                    <italic toggle="yes">E. coli</italic> strain.
                    <sup>
                        <xref ref-type="bibr" rid="ref41">41</xref>
                    </sup>
                    <sup>,</sup>
                    <sup>
                        <xref ref-type="bibr" rid="ref42">42</xref>
                    </sup> We defined EAEC as having both 
                    <italic toggle="yes">aggR</italic> (EAEC virulence gene regulator
                    <sup>
                        <xref ref-type="bibr" rid="ref43">43</xref>
                    </sup>
                    <sup>&#x2013;</sup>
                    <sup>
                        <xref ref-type="bibr" rid="ref46">46</xref>
                    </sup>) and the genes for production of an AAF. The constructs used for this study are listed in 
                    <xref ref-type="table" rid="T2">Table 2</xref>.</p>
                <table-wrap id="T1" orientation="portrait" position="float">
                    <label>Table 1. </label>
                    <caption>
                        <title>Selected virulence factor genes
                            <sup>
                                <xref ref-type="table-fn" rid="tfn1">#</xref>
                            </sup> of wt strains used in this study.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="2" valign="top">Strain</th>
                                <th align="left" colspan="3" rowspan="1" valign="top">Aggregative adherence fimbriae (AAF)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Adhesin</th>
                                <th align="left" colspan="2" rowspan="1" valign="top">Dispersin
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn2">&#x2020;</xref>
                                    </sup>
                                </th>
                                <th align="left" colspan="2" rowspan="1" valign="top">Regulators</th>
                                <th align="left" colspan="1" rowspan="2" valign="top">
                                    <italic toggle="yes">aaiC</italic>
                                    <sup>
                                        <xref ref-type="table-fn" rid="tfn3">&#x2021;</xref>
                                    </sup>
                                </th>
                                <th align="left" colspan="3" rowspan="1" valign="top">SPATEs</th>
                            </tr>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">aggA</italic> AAF1</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">agg4A</italic> AAF4</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">agg5A</italic> AAF5</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">hra1</italic>
                                </th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">aap</italic>
                                </th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">aatA</italic>
                                </th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">aar</italic>
                                </th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">aggR</italic>
                                </th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">pic</italic>
                                </th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">sat</italic>
                                </th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">sepA</italic>
                                </th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">P433</td>
                                <td colspan="1" rowspan="1"/>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td colspan="1" rowspan="1"/>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td colspan="1" rowspan="1"/>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td colspan="1" rowspan="1"/>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">K261</td>
                                <td colspan="1" rowspan="1"/>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td colspan="1" rowspan="1"/>
                                <td colspan="1" rowspan="1"/>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td colspan="1" rowspan="1"/>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">E161</td>
                                <td colspan="1" rowspan="1"/>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td colspan="1" rowspan="1"/>
                                <td colspan="1" rowspan="1"/>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td colspan="1" rowspan="1"/>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">K411</td>
                                <td colspan="1" rowspan="1"/>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td colspan="1" rowspan="1"/>
                                <td colspan="1" rowspan="1"/>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td colspan="1" rowspan="1"/>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td colspan="1" rowspan="1"/>
                                <td colspan="1" rowspan="1"/>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">E131</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td colspan="1" rowspan="1"/>
                                <td colspan="1" rowspan="1"/>
                                <td colspan="1" rowspan="1"/>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td colspan="1" rowspan="1"/>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">D5613</td>
                                <td colspan="1" rowspan="1"/>
                                <td colspan="1" rowspan="1"/>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td colspan="1" rowspan="1"/>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                                <td align="center" colspan="1" rowspan="1" valign="middle">+</td>
                            </tr>
                        </tbody>
                    </table>
                    <table-wrap-foot>
                        <fn-group content-type="footnotes">
                            <fn id="tfn1">
                                <label>
                                    <sup>#</sup>
                                </label>
                                <p>Whole genome sequence contigs published in
                                    <sup>
                                        <xref ref-type="bibr" rid="ref28">28</xref>
                                    </sup>
                                    <sup>,</sup>
                                    <sup>
                                        <xref ref-type="bibr" rid="ref29">29</xref>
                                    </sup> were queried with the Center for Genomic Epidemiology&#x2019;s online Virulence Finder, Serotype Finder, and Plasmid Finder platforms. In this table, only virulence genes found in one or more strains are shown.</p>
                            </fn>
                            <fn id="tfn2">
                                <label>
                                    <sup>&#x2020;</sup>
                                </label>
                                <p>Aap is an anti-aggregation protein &amp; 
                                    <italic toggle="yes">aatPABCD</italic> encodes the transporter for Aap
                                    <sup>
                                        <xref ref-type="bibr" rid="ref65">65</xref>
                                    </sup>
                                    <sup>,</sup>
                                    <sup>
                                        <xref ref-type="bibr" rid="ref66">66</xref>
                                    </sup>
                                </p>
                            </fn>
                            <fn id="tfn3">
                                <label>
                                    <sup>&#x2021;</sup>
                                </label>
                                <p>
                                    <italic toggle="yes">aaiC</italic>, located on the chromosome, encodes a secreted type VI secretion system effector protein.
                                    <sup>
                                        <xref ref-type="bibr" rid="ref72">72</xref>
                                    </sup>
                                </p>
                            </fn>
                        </fn-group>
                    </table-wrap-foot>
                </table-wrap>
                <table-wrap id="T2" orientation="portrait" position="float">
                    <label>Table 2. </label>
                    <caption>
                        <title>List of constructs for this study.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Name</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Description</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Source</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">pKD46
                                    <sub>spec</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">A 
                                    <italic toggle="yes">repA101</italic> plasmid that confers temperature sensitivity and spectinomycin resistance with L-arabinose-inducible lambda Red protein expression under control of the 
                                    <italic toggle="yes">araBAD</italic> promoter. Generated from pKD46amp.
                                    <sup>
                                        <xref ref-type="bibr" rid="ref47">47</xref>
                                    </sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <sup>
                                        <xref ref-type="bibr" rid="ref48">48</xref>
                                    </sup>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">pAA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Name for the EAEC virulence plasmid</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">This study</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">pAA&#x0394;
                                    <italic toggle="yes">sepA</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">The EAEC virulence plasmid with 
                                    <italic toggle="yes">sepA</italic>
                                    <sub>49-4043</sub> deleted and replaced with 
                                    <italic toggle="yes">cat</italic>, &#x0394;
                                    <italic toggle="yes">sepA::cat</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">This study</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="bottom">pAA
                                    <sub>P433</sub>-&#x0394;
                                    <italic toggle="yes">sepA</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="bottom">As above, the &#x0394;
                                    <italic toggle="yes">sepA::cat</italic> mutation was made in the P433 strain background.</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">This study</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">pAA-&#x0394;
                                    <italic toggle="yes">sepA::cat</italic>
                                    <sub>rev</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">The EAEC virulence plasmid with 
                                    <italic toggle="yes">sepA</italic>
                                    <sub>4-4091</sub> deleted, retaining only the start and stop codons and 
                                    <italic toggle="yes">cat</italic> inserted with the promoter in the opposite direction from the 
                                    <italic toggle="yes">sepA</italic> promoter.</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">This study</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">pTrcHis2::
                                    <italic toggle="yes">sepA</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">The wt passenger domain of 
                                    <italic toggle="yes">sepA</italic> from K261 in the inducible vector pTrcHis2c. Expression of SepA from this plasmid would result in a SepA passenger domain with six histidines added at the N terminus.</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">This study</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">pTrcHis2::
                                    <italic toggle="yes">sepA</italic>*</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">The passenger domain of 
                                    <italic toggle="yes">sepA</italic> with the S267A mutation in the inducible vector pTrcHis2c. Expression of SepA* from this plasmid would result in a SepA* passenger domain with six histidines added at the N terminus.</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">This study</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">TOPO::
                                    <italic toggle="yes">sepA</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">pCR2.1TOPO, a high-copy number vector with wt K411 
                                    <italic toggle="yes">sepA</italic> and 500 bp upstream</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">This study</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">TOPO::
                                    <italic toggle="yes">sepA</italic>*</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">As above but with the active site of SepA inactivated by a S267A mutation (a799g &amp; g800c)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">This study</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">TOPO::
                                    <italic toggle="yes">sepA</italic>
                                    <sub>5251A&gt;V</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">pCR2.1TOPO with the wt P433 
                                    <italic toggle="yes">sepA</italic> and 500 bp upstream. Note that 
                                    <italic toggle="yes">sepA</italic>
                                    <sub>P433</sub> has a A5251V mutation respective to K261 and K411</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">This study</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">TOPO&#x0394;
                                    <italic toggle="yes">lacZ</italic>::
                                    <italic toggle="yes">sepA</italic> kan</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">pCR2.1TOPO with the PCR product for lambda Red-mediated replacement of 
                                    <italic toggle="yes">lacZ</italic> with wt 
                                    <italic toggle="yes">sepA</italic> and kan</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">This study</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">pACYC177</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">A low copy number vector previously described</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <sup>
                                        <xref ref-type="bibr" rid="ref73">73</xref>
                                    </sup>
                                    <sup>,</sup>
                                    <sup>
                                        <xref ref-type="bibr" rid="ref74">74</xref>
                                    </sup>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">pACYC177:
                                    <italic toggle="yes">sepA</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">sepA</italic> and 500bp upstream of the start codon (from K261) from TOPO::
                                    <italic toggle="yes">sepA</italic> digested with BamHI and inserted in the low copy vector pACYC177</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">This study</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">sepA</italic>-kan pAA
                                    <sub>K261</sub>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">The K261 pAA with kan resistance gene inserted 200 bp downstream of 
                                    <italic toggle="yes">sepA</italic>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">This study</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">pAA
                                    <sub>K411</sub>-revertant</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">sepA</italic>
                                    <sub>K261</sub>-kan was inserted into pAA
                                    <sub>K411</sub>-&#x0394;
                                    <italic toggle="yes">sepA</italic> to create K411&#x0394;
                                    <italic toggle="yes">cat</italic>:: 
                                    <italic toggle="yes">sepA</italic>
                                    <sub>K261</sub>-kan</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">This study</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">TOPO::t&#x2019;ase-
                                    <italic toggle="yes">sepA</italic>-t&#x2019;ase</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">pCR2.1TOPO with a 6,590 bp region of 
                                    <italic toggle="yes">sepA</italic> including the putative transposases (t&#x2019;ase) upstream and downstream that were conserved for K261, K411, P433</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">This study</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">TOPO::t&#x2019;ase-&#x0394;
                                    <italic toggle="yes">sepA::cat</italic>-t&#x2019;ase</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">pCR2.1TOPO with the corresponding 3,360bp region of &#x0394;
                                    <italic toggle="yes">sepA::cat</italic> including the putative transposase upstream and downstream that were conserved for K261, K411, P433</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">This study</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
            </sec>
            <sec id="sec8">
                <title>Biofilm assay in 96-well plates and on disks</title>
                <p>Bacterial cultures were grown in a shaking incubator at 37&#x00b0;C with appropriate antibiotics, and diluted in Dulbecco&#x2019;s Modified Eagle Medium (DMEM) with high glucose and L-glutamine (Genesee Scientific 25-501) to 10
                    <sup>7</sup> CFU/mL as estimated by optical density (OD). For those assays, 180 &#x03bc;L of the culture was added to a 96-well flat-bottom untreated plate (VWR 82050-760). DMEM was used as the control for each plate. After covering the plate with a lid, the plate was incubated at 37&#x00b0;C without shaking for the time indicated in the figure legend. After growth, the media on top of the biofilm was removed, and the biofilm was washed once with phosphate-buffered saline (PBS) (Fisher Scientific 70-011-044) before fixing with ethanol for 10 minutes. The dry biofilm plate was stained by immersing in a mixture of 3 mM crystal violet (Sigma Aldrich C0775), 5% ethanol, and water for 30 minutes then rinsed in tap water and dried. The bound crystal violet was eluted with 100 &#x03bc;L ethanol in each well, and the absorbance read at 590 nm. The control DMEM-only well values were subtracted from the absorbance values for all other wells.</p>
                <p>To assess biofilm formation on glass disks, a single sterilized glass coverslip (Fisher 12-545-81P) was placed at the bottom of each well of a 24-well plate. Each well was then inoculated with 500 &#x03bc;L of 10
                    <sup>7</sup> CFU/mL bacteria in DMEM, and then otherwise treated identically to the 96-well plate biofilm method. After fixing and crystal violet staining, each disk was removed and glued to a glass slide with Cytoseal XYL (Thermo Scientific 8312-4) for imaging at 100&#x00d7; with oil immersion using an Olympus BX60F-3.</p>
                <p>To test addition of components to the biofilm media, we supplemented the DMEM at the start of growth to 1 mg/ml DNase (Sigma Aldrich DN-25), 1 mg/ml chymotrypsin (Sigma Aldrich C4129), or 0.8 mM - 2.5 mM sodium metaperiodate (Fluka Analytical 71859). Another set of wells had the equivalent volume of vehicle control (PBS) added. For biofilm media with 2 mM phenylmethylsulfonyl fluoride (PMSF) (Sigma Aldrich P7626) we made a stock of 100 mM in isopropanol and added the equivalent volume of isopropanol to a set of control wells.</p>
                <p>To make DMEM with M9 levels of magnesium (10 mM Mg
                    <sup>2+</sup>), we grew biofilms in regular DMEM or DMEM with an extra 9.2 mM magnesium sulfate (Acros Organics 42390500).</p>
            </sec>
            <sec id="sec9">
                <title>Making gene deletions, PCR, and vector construction</title>
                <p>Virulence gene deletion strains were constructed by lambda Red-mediated recombination with the pKD46
                    <sub>spec</sub> plasmid.
                    <sup>
                        <xref ref-type="bibr" rid="ref47">47</xref>
                    </sup>
                    <sup>,</sup>
                    <sup>
                        <xref ref-type="bibr" rid="ref48">48</xref>
                    </sup> In most cases, the entire gene was replaced with a kanamycin (kan), gentamicin, or chloramphenicol (
                    <italic toggle="yes">cat</italic>) resistance gene. Briefly, PCR primers, listed in 
                    <xref ref-type="table" rid="T3">Table 3</xref>, with approximately 50 nucleotides of homology to the wt gene were used to amplify the resistance gene. The PCR product was gel-purified following kit directions (Qiagen 28506) and electroporated into EAEC induced for expression of the lambda Red system (1 mM arabinose; Chem-Impex 01654), using a MicroPulser Electroporator set to 1.8 kilovolts with 200-ohm resistance (BioRad 1652100).
                    <sup>
                        <xref ref-type="bibr" rid="ref49">49</xref>
                    </sup> After electroporation, the EAEC were incubated at 37&#x00b0;C for one hour to allow the recombination (based on homology to the primer regions) to proceed and for expression of the antibiotic resistance. Growth at 37&#x00b0;C also promotes loss of the pKD plasmid.
                    <sup>
                        <xref ref-type="bibr" rid="ref48">48</xref>
                    </sup> Gene deletions were confirmed by PCR with specific screening primers listed in 
                    <xref ref-type="table" rid="T3">Table 3</xref>. We also confirmed, by plasmid sequencing, that the &#x0394;
                    <italic toggle="yes">sepA</italic>::
                    <italic toggle="yes">cat</italic> mutation was the only genetic change in pAA
                    <sub>K261</sub>-&#x0394;
                    <italic toggle="yes">sepA</italic> as compared to pAA
                    <sub>K261</sub> and for pAA
                    <sub>P433</sub>-&#x0394;
                    <italic toggle="yes">sepA</italic> relative to pAA
                    <sub>P433</sub>, and that the sequence of revertant (pAA
                    <sub>K411</sub>-revertant) was correct.</p>
                <table-wrap id="T3" orientation="portrait" position="float">
                    <label>Table 3. </label>
                    <caption>
                        <title>List of PCR primers.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Name</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Primer sequence</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Description</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">K261
                                    <italic toggle="yes">sepA</italic>KO_F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CTATATGAACAAAATATATTATCTTAAGTATTGCCATATAACCAAAAGCCTGGTTGATCGGCACGTAAG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">For 
                                    <italic toggle="yes">sepA</italic>
                                    <sub>49-4043</sub> deletion and insertion of 
                                    <italic toggle="yes">cat</italic>, &#x0394;
                                    <italic toggle="yes">sepA::cat</italic>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">K261
                                    <italic toggle="yes">sepA</italic>KO_R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CGTCAGAAAACATAACGGAAGTTGGCGTTTATCGCATTATCCACATTATATTTCTTACGCCCCGCCCTGCCAC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">For 
                                    <italic toggle="yes">sepA</italic>
                                    <sub>49-4043</sub> deletion and insertion of 
                                    <italic toggle="yes">cat</italic>, &#x0394;
                                    <italic toggle="yes">sepA::cat</italic>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">sep catR F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CCATCCACATCCTATGTAATTAATCTTTGTCAAAATTAGGTTGATGTTTCTATATGTTACGCCCCGCCCTGCCAC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Primers for 
                                    <italic toggle="yes">sepA</italic> deletion, retains only the start and stop codons and replaces 
                                    <italic toggle="yes">sepA</italic> with 
                                    <italic toggle="yes">cat</italic> in the opposite orientation as the 
                                    <italic toggle="yes">sepA</italic> promoter.</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">sep catR R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CACGGAGTTCTTTCAGAAAAAGGCCTGCCGGATGGCAGGCCTATCCCATTCGTCAAGTTGATCGGCACGTAAG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Primers to make the 
                                    <italic toggle="yes">sepA</italic> deletion, retains only the start and stop codons and replaces 
                                    <italic toggle="yes">sepA</italic> with 
                                    <italic toggle="yes">cat</italic> in the opposite orientation as the 
                                    <italic toggle="yes">sepA</italic> promoter.</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">SepA R23</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAAGGCTCAGAGTCAGATCAAGTC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&#x0394;
                                    <italic toggle="yes">sepA</italic>
                                    <sub>rev</sub> screening primer</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CM R2</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GCACCTTGTCGCCTTGC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&#x0394;
                                    <italic toggle="yes">sepA</italic> screening primers</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">sepA</italic>12F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CGGACTGCTCCATCCACATC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&#x0394;
                                    <italic toggle="yes">sepA</italic> screening primers</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">sepA</italic> 11F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CCGCCCTGAACGGCC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">WT 
                                    <italic toggle="yes">sepA</italic> screening primers</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">sepA</italic> 11R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AGGTCTCCCGGCGCTC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">WT 
                                    <italic toggle="yes">sepA</italic> screening primers</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">lacIF</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAATACGCAAACCGCCTCTC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Screen for &#x0394;
                                    <italic toggle="yes">lac</italic>::
                                    <italic toggle="yes">sepA</italic>, this primer is upstream of 
                                    <italic toggle="yes">lacZ</italic> and used with a 
                                    <italic toggle="yes">sepA</italic> internal primer</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">LacSep22R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GTACATAATGGATTTCCTTACGCGAAATACGGGCAGACATGGCCTGCCCGGTTATACCGCCATTCATACCCTGAATC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Generate &#x0394;
                                    <italic toggle="yes">lacZ</italic>::
                                    <italic toggle="yes">sepA</italic>-kan for lambda Red</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">LacsepPvuF</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCTCGATCGCAGGCCGAGCTGGAACTACA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Generate &#x0394;
                                    <italic toggle="yes">lacZ</italic>::
                                    <italic toggle="yes">sepA</italic>-kan for lambda Red</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">parB</italic>genF</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">ATGATTATGCCTGTAACGAAGTGTGAACCAGAAACCACCCGCAAAGCAAGCCGCGGTCTGCGTTGTC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Generate &#x0394;
                                    <italic toggle="yes">parB</italic>::gentamicin for lambda Red</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">parB</italic> genR4</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AACCCAGTGGTTGTCTTTCATATGGTGCTCTGCATGTTCAGCCGCATCACCGCTTAATCAGTGAGG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Generate &#x0394;
                                    <italic toggle="yes">parB</italic>::gentamicin for lambda Red</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">LpxM_gent_F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TCTGAATAAAACAGTAATGATAATTTTGGTAGAGGCATTCGCACTAAATACGGTCTGCGTTGTC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Generate &#x0394;
                                    <italic toggle="yes">lpxM</italic>::gentamicin for lambda Red</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">LpxM_gent_R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CTGTACGCTTACAAACAACTAGTGGAAATACTTGTACTTTATAATTTCAAGCTTAATCAGTGAGG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Generate &#x0394;
                                    <italic toggle="yes">lpxM</italic>::gentamicin for lambda Red</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">gentR5</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CCCATACTTGAGCCACCTAA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Screen for gentamicin resistance gene insertion</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">&#x0394;
                                    <italic toggle="yes">umuC</italic> F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CGGCCCGCTCTGCATACTGAACAACAGCCTGGTGCATGGCATCTTTGTCTGTTGATCGGCACGTAAG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Generate &#x0394;
                                    <italic toggle="yes">umuC</italic>-
                                    <italic toggle="yes">yccA</italic>::
                                    <italic toggle="yes">cat</italic> for lambda Red</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">&#x0394;
                                    <italic toggle="yes">ychA</italic> R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GTCACGGAACATCACACCTGTTCCTGGCATACAGCCATACACTGCCTTCTGTTACGCCCCGCCCTGCCAC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Generate &#x0394;
                                    <italic toggle="yes">umuC</italic>-
                                    <italic toggle="yes">yccA</italic>::
                                    <italic toggle="yes">cat</italic> for lambda Red</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">finO</italic> KO F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CTCATCAAGCACGGCCTGAAGTTCTGCCTTTATCCGGTTCTGGCGGCGGGTTGATCGGCACGTAAG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Generate &#x0394;
                                    <italic toggle="yes">finO</italic>::
                                    <italic toggle="yes">cat</italic> for lambda Red</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">finO</italic> KO R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GCAGAACACAGCATGACAGAGCAGAAGCGACCGGTACTGACACTGAAGCGTTACGCCCCGCCCTGCCAC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Generate &#x0394;
                                    <italic toggle="yes">finO</italic>::
                                    <italic toggle="yes">cat</italic> for lambda Red</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">PsiBcmF</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GATACCGTGATGAAAACTGAACTGACCCTGAATGTATTACAGACCATGAGCGCACTTGATCGGCACGTAAG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Generate &#x0394;
                                    <italic toggle="yes">psiB-orf8</italic>::
                                    <italic toggle="yes">cat</italic> for lambda Red</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Orf8cmR</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CTGAGCAACGCGAAGGCGTCAGCTACGATGTTCCGGGGACTGCTGATCAGCCCCTGTTACGCCCCGCCCTGCCAC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Generate &#x0394;
                                    <italic toggle="yes">psiB-orf8</italic>::
                                    <italic toggle="yes">cat</italic> for lambda Red</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">SepAS211F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CTGAATATGGGGGACGCCGGCTCCCCCCTGTTTG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">For SOE PCR to inactivate SepA (a799g &amp; g800c), leads to a 267S&gt;A mutation in the SepA active site</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">SepAS211R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAAACAGGGGGGAGCCGGCGTCCCCCATATTCAG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">For SOE PCR to inactivate SepA (a799g &amp; g800c), leads to a 267S&gt;A mutation in the SepA active site</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">IgrF</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CCTGCCATCCGGCAGGCCTTTTTCTGAAAGAACTCCGTGAGCCTGTTTAACCGGAATTGCCAGCTG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">To insert a kanamycin (kan) resistance gene after 
                                    <italic toggle="yes">sepA</italic>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">IgrR</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CGGTGACCGCCTGGACGGTCACTTCTGAGAAAAGGCATTTACACAGAATCTCAGAAGAACTCGTCAAG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">To insert kan resistance gene after 
                                    <italic toggle="yes">sepA</italic>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">IgrConR</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CTGAATCAATGAATGCCATC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Confirmation of 
                                    <italic toggle="yes">sepA</italic>-kan</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">KOkanR</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GAATGGGCAGGTAGCCGGATCAAGC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Screen for kan mutants</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">K261
                                    <italic toggle="yes">aatA</italic>KO_F2</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GGAAAGATCGAGTGAGACGCATATTATACTCATTTCTTGCACTAAATGCTTATCCCGGAATTGCCAGCTG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Generate &#x0394;
                                    <italic toggle="yes">aatA</italic>::kan for lambda Red</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">K261
                                    <italic toggle="yes">aatA</italic>KO_R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GTAGTTATCACATACCCCCTTTATTGGAAAGGTGCTGCAGAAGAAAATAATGTCAGAAGAACTCGTCAAG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Generate &#x0394;
                                    <italic toggle="yes">aatA</italic>::kan for lambda Red</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">aatA</italic>conF</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CATAGAGTCATTAATAATGTTGAGCGTATGTCTG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Confirm 
                                    <italic toggle="yes">aatA</italic> knockout. Anneals about 228bp from ATG</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">K261
                                    <italic toggle="yes">agg4A</italic>_F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GATATGAAGATTAAGAATATAGTGATTATTGGCGGTCTTATTTCTGGCATGCCGGAATTGCCAGCTG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Make &#x0394;
                                    <italic toggle="yes">agg4A</italic>::kan for lambda Red</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">K261
                                    <italic toggle="yes">agg4A</italic>_R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GAATTAATTACTCCAAGTGGTCAAGTTGAATGTCGTTTGATAAACTCCAGTCAGAAGAACTCGTCAAG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Make &#x0394;
                                    <italic toggle="yes">agg4A</italic>::kan for lambda Red</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">K261aggKOconF</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GACGGGAATCAGCAGGTTCAACCTGG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Confirm 
                                    <italic toggle="yes">agg4A</italic> deletion. Anneals 138 bp upstream of 
                                    <italic toggle="yes">agg4A</italic> ATG</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">K261_
                                    <italic toggle="yes">aggR</italic>KO_F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GATATGAAATTAAAACAAAATATAGAAAAAGAGATTATAAAAATTAACAATATCCCGGAATTGCCAGCTG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Make &#x0394;
                                    <italic toggle="yes">aggR</italic>::kan for lambda Red</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">K261_
                                    <italic toggle="yes">aggR</italic>KO_R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CATTGGCTTTTAAAATAAGTCAAAAATTGTTTTGGTGTTACGCCAAAGTGTCAGAAGAACTCGTCAAG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Make &#x0394;
                                    <italic toggle="yes">aggR</italic>::kan for lambda Red</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">SepAhisF</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TTTGGATCCTGCAACGGTCAGTGCA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Amplify the passenger domain region to clone 
                                    <italic toggle="yes">sepA</italic> into pTrcHis2c and add a BamHI cut site</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">SepAhisR</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">ATAGTCGACCTCTGTAAGGAAGGAC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Amplify the passenger domain region to clone 
                                    <italic toggle="yes">sepA</italic> into pTrcHis2c and add a SalI cut site</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">SepAT'aseF</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GGTACACCCTGATGCGAGA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Amplify region encompassing 
                                    <italic toggle="yes">sepA</italic> and one upstream and one downstream putative transposase.</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">SepAT'aseR</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TGAGCCGGCCCCTTGAAA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Amplify region encompassing 
                                    <italic toggle="yes">sepA</italic> and one upstream and one downstream putative transposase.</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">aaiC F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TGGTGACTACTTTGATGGACATTGT</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Chromosomal EAEC gene 
                                    <italic toggle="yes">aaiC</italic> screening primer</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">aaiC R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GACACTCTCTTCTGGGGTAAACGA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Chromosomal EAEC gene 
                                    <italic toggle="yes">aaiC</italic> screening primer</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">aggR F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GCAATCAGATTAARCAGCGATACA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Screening primer for 
                                    <italic toggle="yes">aggR</italic> located on the pAA plasmid</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">aggR R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CATTCTTGATTGCATAAGGATCTGG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Screening primer for 
                                    <italic toggle="yes">aggR</italic> located on the pAA plasmid</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <p>To amplify PCR products larger than 4 kb, we used Platinum SuperFi II PCR Master mix (Invitrogen 12368010). For PCR products less than 4 kb, we used PfuUltra II Fusion HS Master mix (Agilent Technologies 600852). For confirmatory PCR from colonies, we used colony &#x201c;boils&#x201d; (one colony was added to 50 uL of water with a sterile toothpick and incubated for 12 min at 95&#x00b0;C), and the GoTaq Green Master mix kit (Fisher PRM7123).</p>
                <p>To insert PCR products into pCR2.1TOPO (TOPO), we followed manufacturer guidelines (Invitrogen K280020). PCR products were purified using the QIAquick PCR &amp; Gel Cleanup kit (Qiagen 28506). Plasmids were purified using the QIAprep Spin Miniprep kit (Qiagen 27106X4). To purify larger quantities of the pAA plasmid, we increased the yield of this large, low-copy vector by adding extra yeast extract to the Luria-Bertani (LB) broth (final concentration of 24 g/L yeast extract), as described by Wood 
                    <italic toggle="yes">et al.</italic>
                    <sup>
                        <xref ref-type="bibr" rid="ref50">50</xref>
                    </sup> To move inserts into pACYC177, we digested the 
                    <italic toggle="yes">sepA</italic> inserts from the TOPO clones with BamHI (NEB R3136), then ligated the inserts into pACYC177. Primers were sourced from Integrated DNA Technologies and are listed in 
                    <xref ref-type="table" rid="T3">Table 3</xref>.</p>
                <p>To allow the selection of colonies with 
                    <italic toggle="yes">sepA</italic> inserted into 
                    <italic toggle="yes">lacZ</italic>, we first added a kan resistance gene 200 bp downstream of 
                    <italic toggle="yes">sepA</italic> prior to amplification of the entire region for lambda Red-mediated replacement of the 
                    <italic toggle="yes">lacZ</italic> gene. We confirmed that addition of kan after 
                    <italic toggle="yes">sepA</italic> had no effect on biofilm staining in the wt strains (data not shown).</p>
                <p>For the larger PCR construct, &#x0394;
                    <italic toggle="yes">lacZ</italic>::
                    <italic toggle="yes">sepA</italic>-kan, after amplification using K261 pAA-kan as a template, the construct was first inserted into TOPO per manufacturer instructions. The plasmid was then digested with NotI (NEB R3189) and BamHI (NEB R3136) and gel-purified to yield 500 ng of insert DNA and added to 100uL of electrocompetent cells for lambda Red recombination. The revertant strain (K411&#x0394;
                    <italic toggle="yes">cat</italic>::
                    <italic toggle="yes">sepA</italic>-kan) was identified by screening for loss of chloramphenicol resistance after recombineering with the &#x0394;
                    <italic toggle="yes">lacZ</italic>::
                    <italic toggle="yes">sepA</italic>-kan PCR (
                    <xref ref-type="table" rid="T3">Table 3</xref>). We confirmed the localization of SepA in the supernatant using Western blot analysis (data not shown).</p>
            </sec>
            <sec id="sec10">
                <title>Transfer of pAA to HSNal
                    <sup>R</sup>
                </title>
                <p>We selected a spontaneous nalidixic acid resistant (Nal
                    <sup>R</sup>) derivative of commensal 
                    <italic toggle="yes">E. coli</italic> HS
                    <sup>
                        <xref ref-type="bibr" rid="ref41">41</xref>
                    </sup>
                    <sup>,</sup>
                    <sup>
                        <xref ref-type="bibr" rid="ref42">42</xref>
                    </sup> by growth on LB agar with 15 &#x03bc;g/mL nalidixic acid (Sigma Aldrich N4382). We moved the K261 pAA into HSNal
                    <sup>R</sup> by centrifuging overnight cultures of both strains, resuspending the pellets in PBS, and mixing them (HSNal
                    <sup>R</sup> and K261) at 1:1 v:v. After 5 minutes of incubation at room temperature, 75 &#x03bc;L of the cell mixture was spotted onto agar without any antibiotics and incubated for three hours. The mix was then inoculated onto MacConkey agar with 15 &#x03bc;g/mL nalidixic acid to select for HSNal
                    <sup>R</sup> and 15 &#x03bc;g/mL tetracycline (Sigma Aldrich 37919) to select for pAA
                    <sub>K261</sub> and grown overnight.</p>
                <p>To get pAA
                    <sub>P433</sub>&#x0394;
                    <italic toggle="yes">sepA</italic>, pAA
                    <sub>K261</sub>&#x0394;
                    <italic toggle="yes">sepA</italic>, and pAA
                    <sub>P433</sub> into HSNal
                    <sup>R</sup>, the plasmids were purified as described above using extra yeast extract in the LB broth medium, then 1 &#x03bc;g of the plasmid was transformed into electrocompetent HSNal
                    <sup>R</sup> cells. The transformed HSNal
                    <sup>R</sup> was grown at 37&#x00b0;C overnight before plating on LB agar with 30 &#x03bc;g/mL chloramphenicol (Calbiochem 220551) to select for uptake of the pAAs with &#x0394;
                    <italic toggle="yes">sepA</italic> or 100 &#x03bc;g/mL ampicillin (Corning 61-238-RH) agar for pAA
                    <sub>P433</sub>.</p>
                <p>In all cases, single colonies were screened by PCR to confirm the presence of 
                    <italic toggle="yes">aggR</italic> (pAA marker) and the absence of 
                    <italic toggle="yes">aaiC</italic> (EAEC chromosomal marker) to confirm uptake of the pAA plasmid.</p>
            </sec>
            <sec id="sec11">
                <title>Protein production</title>
                <p>A mutation in the active site of the SepA passenger domain (
                    <italic toggle="yes">sepA</italic>*) (
                    <xref ref-type="table" rid="T2">Table 2</xref>) was generated by splicing by overlap extension (SOE) PCR using primers SepAS211F and SepAS211R (
                    <xref ref-type="table" rid="T3">Table 3</xref>) to create the following changes: a799g &amp; g800c in 
                    <italic toggle="yes">sepA</italic> which result in replacement of the serine at position 267 with an alanine. Next, the coding region for the passenger domains of K411 
                    <italic toggle="yes">sepA</italic> and 
                    <italic toggle="yes">sepA</italic>* were amplified by PCR from TOPO::
                    <italic toggle="yes">sepA</italic>* and TOPO::
                    <italic toggle="yes">sepA</italic> to add BamHI and SalI cut sites, and ligated into the inducible vector pTrcHis2c (Invitrogen V36520) (
                    <xref ref-type="table" rid="T2">Table 2</xref>). The expression of SepA (or SepA
                    <sub>S267A</sub>*) from these plasmids would result in SepA with a hexahistidine (His
                    <sub>6</sub>) tag added at the N terminus. We chose to use the His tag for purification purposes because both Scott-Tucker 
                    <italic toggle="yes">et al</italic>. and Charbonneau 
                    <italic toggle="yes">et al.</italic> showed that the serine protease activity of a SPATE passenger domain is retained even with an N-terminal hexahistidine-tag.
                    <sup>
                        <xref ref-type="bibr" rid="ref51">51</xref>
                    </sup>
                    <sup>,</sup>
                    <sup>
                        <xref ref-type="bibr" rid="ref52">52</xref>
                    </sup> After optimizing SepA expression from TOP10 pTrcHis2c with 1 mM IPTG (isopropyl &#x03b2;-D-1-thiogalactopyranoside) (Sigma Aldrich I6758), the bacterial cells were lysed with BugBuster Master mix (Novagen 71456). The protein was then purified with a HisTrap HP nickel column according to the manufacturer&#x2019;s protocol (GE Healthcare 95056-204). The purity of fractions collected from the nickel column was evaluated on a 4-12% Bis-Tris gel (Invitrogen NP0324). The fractions with the 110 kDa His-SepA protein band were concentrated with an Amicon Ultra-15 centrifugal concentrator 50,000 MW (Fisher Scientific UFC905008). The same type of centrifugal concentrator was used for buffer exchange with PBS to remove the imidazole.</p>
            </sec>
            <sec id="sec12">
                <title>Concentrated protein in supernatants</title>
                <p>For harvesting K411 wt or K411&#x0394;
                    <italic toggle="yes">sepA</italic> supernatant, cultures were grown in DMEM high glucose, with L-glutamine (Genesee Scientific 25-501) at 37&#x00b0;C shaking for five hours prior to centrifugation. The supernatants were filtered with a 0.22 &#x03bc;m filter (Genesee Scientific 25-227) before concentrating 2,000-fold with an Amicon 50 kDa cutoff spin column (Fisher UFC905008). The concentrated supernatant was then added to the biofilm media at the start of incubation. For TOPO::
                    <italic toggle="yes">sepA</italic> or TOPO::
                    <italic toggle="yes">sepA</italic>* supernatants, the plasmid was grown in TOP10 cells (Invitrogen C404010) and harvested identically to the EAEC strains.</p>
            </sec>
            <sec id="sec13">
                <title>Anti-SepA rabbit polyclonal antibody</title>
                <p>A peptide (K261 SepA
                    <sub>891-913</sub>) from the exposed regions of the passenger domain of SepA was selected to generate a rabbit anti-SepA polyclonal antibody. Pacific Immunology (Ramona, CA) made rabbit polyclonal antibodies by immunizing two rabbits with the peptide at day 0 with complete Freund&#x2019;s adjuvant and then again on days 21, 42, and 70 with incomplete Freund&#x2019;s adjuvant. On day 77, 25 ml of serum was collected and affinity purified. This animal protocol was approved by IACUC-designated member review on August 12, 2019 from Pacific Immunology (SOP-1).</p>
            </sec>
            <sec id="sec14">
                <title>Western blot analysis</title>
                <p>Bacterial strains (listed in the figure legends) were grown at 37&#x00b0;C for four hours in DMEM with shaking for liquid culture conditions or without shaking for static biofilm cultures. The supernatants from those cultures were collected after centrifugation and precipitated with an equal volume of ethanol overnight at -20&#x00b0;C. Samples were denatured with NuPAGE
                    <sup>&#x00ae;</sup> sample buffer (Invitrogen NP0008) and electrophoresed on a 4-12% Bis-Tris gel (Invitrogen NP0324). The proteins were transferred using an iBlot nitrocellulose transfer stack (Invitrogen IB301002) to nitrocellulose. The nitrocellulose blot was incubated for two hours at room temperature in PBS with 0.1% Tween (Fisher Scientific 424592500) with 5% nonfat dry skim milk (Lab Scientific M0841). After the blocking step, the nitrocellulose was incubated overnight at 4&#x00b0;C with the anti-SepA antibody, at a dilution of 1:4,000 or 1:7,000 (listed in the figure legend), in PBS-Tween-milk, then washed three times with PBS-Tween. Next, the blot was incubated with a 1:10,000 dilution of the secondary antibody (goat anti-rabbit HRP conjugate; Bio-Rad 1706515) in PBS-Tween at room temperature for two hours. The nitrocellulose blot was washed once with PBS-Tween and twice with PBS. The nitrocellulose blot was incubated with ECL Western Blotting Detection reagent according to the manufacturer&#x2019;s instructions (GE Healthcare 45-002-401) and imaged with a GE Amersham 680 Blot Imager. Blot images were cropped but otherwise not manipulated.</p>
            </sec>
            <sec id="sec15">
                <title>Sequencing pAA and other plasmids</title>
                <p>To purify pAA DNA we used the Plasmid Midi Kit (Qiagen 12143) following the manufacturer&#x2019;s published protocol.
                    <sup>
                        <xref ref-type="bibr" rid="ref53">53</xref>
                    </sup> Sequencing of the DNA for pAA
                    <sub>P433</sub>, pAA
                    <sub>K261</sub>-&#x0394;
                    <italic toggle="yes">sepA</italic>, pAA
                    <sub>P433</sub>-&#x0394;
                    <italic toggle="yes">sepA</italic>, and pAA
                    <sub>K411</sub>-revertant was done by Plasmidsaurus (Eugene, OR). Additional DNA sequences were taken from published work.
                    <sup>
                        <xref ref-type="bibr" rid="ref28">28</xref>
                    </sup>
                    <sup>,</sup>
                    <sup>
                        <xref ref-type="bibr" rid="ref29">29</xref>
                    </sup> A draft assembly was done with the Minimap2 plug-in
                    <sup>
                        <xref ref-type="bibr" rid="ref54">54</xref>
                    </sup> with Geneious Prime 2023.0.4
                    <sup>
                        <xref ref-type="bibr" rid="ref55">55</xref>
                    </sup> then further refined by re-aligning all reads in Geneious Prime. Remaining ambiguous bases were resolved manually by a comparison of the sequence quality among the sequencing reads provided.</p>
            </sec>
            <sec id="sec16">
                <title>Statistical analysis</title>
                <p>GraphPad Prism 10.0.3
                    <sup>
                        <xref ref-type="bibr" rid="ref56">56</xref>
                    </sup> was used to test significance of three or more biological replicates by unpaired 
                    <italic toggle="yes">t</italic> test for two groups or an ordinary one-way analysis of variance (ANOVA) with a correction for multiple comparisons. *
                    <italic toggle="yes">P</italic>&#x2264;0.05; **
                    <italic toggle="yes">P</italic>&#x2264;0.01; ***
                    <italic toggle="yes">P</italic>&#x2264;0.001; ****
                    <italic toggle="yes">P</italic>&#x2264;0.0001.</p>
            </sec>
        </sec>
        <sec id="sec17" sec-type="results">
            <title>Results</title>
            <sec id="sec18">
                <title>Biofilm phenotypes of six 
                    <italic toggle="yes">sepA</italic>-positive strains and the corresponding &#x0394;
                    <italic toggle="yes">sepA</italic> derivative strains</title>
                <p>In our EAEC isolate collection from the TrEAT-TD study,
                    <sup>
                        <xref ref-type="bibr" rid="ref40">40</xref>
                    </sup> all of the typical EAEC strains positive by PCR for the 
                    <italic toggle="yes">sepA</italic> gene were also positive for either the 
                    <italic toggle="yes">aggA</italic> or 
                    <italic toggle="yes">agg4A</italic> AAF major subunit gene. We selected six of the recently isolated clinical strains that were positive for 
                    <italic toggle="yes">sepA</italic> for this study (
                    <xref ref-type="table" rid="T1">Table 1</xref>). The virulence gene profiles of these strains are found in 
                    <xref ref-type="table" rid="T1">Table 1</xref>. We deleted 
                    <italic toggle="yes">sepA</italic> in these strains by replacing 
                    <italic toggle="yes">sepA</italic>
                    <sub>49-4043</sub> with a chloramphenicol resistance gene (
                    <italic toggle="yes">cat</italic>). We found that two EAEC strains exhibited increased biofilm staining after the deletion of 
                    <italic toggle="yes">sepA</italic> (
                    <xref ref-type="fig" rid="f1">Figure 1</xref>). Based on that finding, we initially hypothesized that the proteolytic activity of SepA modulated biofilm formation in a subset of EAEC by either cleaving a protein on the surface of the EAEC or protein(s) within the biofilm. Although four of the strains tested were positive for 
                    <italic toggle="yes">agg4A</italic>, we also tested an 
                    <italic toggle="yes">aggA</italic>
                    <sup>+</sup> strain, E131, and an 
                    <italic toggle="yes">agg5A</italic>
                    <sup>+</sup> clinical strain, D5613
                    <sup>
                        <xref ref-type="bibr" rid="ref29">29</xref>
                    </sup> (
                    <xref ref-type="table" rid="T1">Table 1</xref>). Neither the 
                    <italic toggle="yes">aggA</italic>
                    <sup>+</sup> nor the 
                    <italic toggle="yes">agg5A</italic>
                    <sup>+</sup> &#x0394;
                    <italic toggle="yes">sepA</italic> strains showed a significant difference in biofilm staining (
                    <xref ref-type="fig" rid="f1">Figure 1</xref>). These results suggested that SepA may only affect the biofilm of some 
                    <italic toggle="yes">agg4A</italic>-positive strains. We confirmed that no growth defects were present in a selection of four of the strains (
                    <xref ref-type="fig" rid="f2">Figure 2</xref>).</p>
                <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                    <label>Figure 1. </label>
                    <caption>
                        <title>Biofilm formation by EAEC isolates and the corresponding &#x0394;
                            <italic toggle="yes">sepA</italic> mutant strains.</title>
                        <p>Symbols in pink represent the values for the wt parental strain and in blue represent the corresponding &#x0394;
                            <italic toggle="yes">sepA</italic> strain. Each symbol shows the mean of four biofilm technical replicates grown for 23 hours. Error bars indicate standard error of the mean (SEM). Significance was determined using unpaired 
                            <italic toggle="yes">t</italic> tests for independent experiments done for each wt-mutant pair. ****
                            <italic toggle="yes">P</italic>&#x2264;0.0001.</p>
                    </caption>
                    <graphic id="gr1" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/162361/473b367f-2620-4db9-942e-fc23c504f6cd_figure1.gif"/>
                </fig>
                <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                    <label>Figure 2. </label>
                    <caption>
                        <title>Growth curves of selected wt and corresponding &#x0394;
                            <italic toggle="yes">sepA</italic> mutant strains.</title>
                        <p>Each strain was grown in DMEM high glucose with L-glutamine with shaking in 250mL flasks with the appropriate antibiotic. The wt strain values are shown as pink squares and the corresponding &#x0394;
                            <italic toggle="yes">sepA</italic> strain with blue circles. The CFU and optical density, OD
                            <sub>600</sub>, were measured every hour. Bars indicate standard deviation (SD) for n=3 or range for n=2. The number of biological replicates is written below each graph.</p>
                    </caption>
                    <graphic id="gr2" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/162361/473b367f-2620-4db9-942e-fc23c504f6cd_figure2.gif"/>
                </fig>
            </sec>
            <sec id="sec19">
                <title>Biofilms grown for five hours show increased biofilm staining for &#x0394;
                    <italic toggle="yes">sepA</italic> derivative strain</title>
                <p>In 
                    <xref ref-type="fig" rid="f1">Figure 1</xref>, four isolates had a non-significant increase in biofilm staining for the &#x0394;
                    <italic toggle="yes">sepA</italic> mutant strain as compared to the wt parental strain. Because the overall biofilm levels were relatively high for all of the strains, we reasoned that we might be able to detect a significant difference between the wt and the &#x0394;
                    <italic toggle="yes">sepA</italic> derivative strains if we reduced the amount of time that the biofilms were allowed to develop. Therefore, we assessed when we could detect the elevated biofilm staining phenotype by testing shorter growth times for biofilm growth for K261 and K261&#x0394;
                    <italic toggle="yes">sepA</italic> (
                    <xref ref-type="fig" rid="f3">Figure 3</xref>). We found that the increased biofilm staining by K261&#x0394;
                    <italic toggle="yes">sepA</italic> relative to K261 was apparent after five hours of biofilm growth and remained differentiated up to the typical 23-hour time point we used for longer biofilm assays (
                    <xref ref-type="fig" rid="f3">Figure 3</xref>). We also observed a linear relationship between increased growth time and increased biofilm staining for each strain as predicted by a linear regression model, although the lines were not perfectly parallel (
                    <xref ref-type="fig" rid="f3">Figure 3</xref>). The best separation in biofilm staining for K261 compared to K261&#x0394;
                    <italic toggle="yes">sepA</italic> was found for biofilms grown for less than nine hours (
                    <xref ref-type="fig" rid="f3">Figure 3</xref>). Based on these results, we decreased the growth time of the biofilm to five to eight hours and re-tested the EAEC strain pairs for differences in biofilm staining. With the shorter biofilm growth time, we observed a statistically significant difference in staining for E131 and E161 as compared to the corresponding &#x0394;
                    <italic toggle="yes">sepA</italic>-derivative strains when we controlled for variability by normalization (
                    <xref ref-type="fig" rid="f4">Figure 4</xref>). E131 has the 
                    <italic toggle="yes">aggA</italic> AAF gene (
                    <xref ref-type="table" rid="T1">Table 1</xref>), so these results demonstrate that the &#x0394;
                    <italic toggle="yes">sepA</italic> biofilm phenotype is not limited to strains with the 
                    <italic toggle="yes">agg4A</italic> gene. Strains P433&#x0394;
                    <italic toggle="yes">sepA</italic> (
                    <italic toggle="yes">agg4A</italic>) and D5613&#x0394;
                    <italic toggle="yes">sepA</italic> (
                    <italic toggle="yes">agg5A</italic>) did not show a statistically significant change in staining compared to the wt parental strain under these conditions (
                    <xref ref-type="fig" rid="f4">Figure 4</xref>).</p>
                <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                    <label>Figure 3. </label>
                    <caption>
                        <title>Effect of growth time on crystal violet staining of K261 and K261&#x0394;
                            <italic toggle="yes">sepA</italic> biofilms.</title>
                        <p>Biofilm results from 96-well plate assays. Pink symbols represent K261 and blue symbols the K261&#x0394;
                            <italic toggle="yes">sepA</italic> strain. Each symbol represents a biological replicate. The lines are a simple linear regression determined in GraphPad Prism.</p>
                    </caption>
                    <graphic id="gr3" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/162361/473b367f-2620-4db9-942e-fc23c504f6cd_figure3.gif"/>
                </fig>
                <fig fig-type="figure" id="f4" orientation="portrait" position="float">
                    <label>Figure 4. </label>
                    <caption>
                        <title>Normalized biofilm staining of EAEC isolates and the corresponding &#x0394;
                            <italic toggle="yes">sepA</italic> mutant strains grown for five to eight hours.</title>
                        <p>The biofilm absorbance for the mutant strains was normalized to that of the wt strain. Pink symbols represent the wt parental strain and blue symbols indicate the corresponding &#x0394;
                            <italic toggle="yes">sepA</italic> strain. Each symbol represents the mean of four technical replicates. Significance was determined using an unpaired 
                            <italic toggle="yes">t</italic> test for independent experiments performed for each mutant-wt pair. *
                            <italic toggle="yes">P</italic>&#x2264;0.05; **
                            <italic toggle="yes">P</italic>&#x2264;0.01.</p>
                    </caption>
                    <graphic id="gr4" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/162361/473b367f-2620-4db9-942e-fc23c504f6cd_figure4.gif"/>
                </fig>
            </sec>
            <sec id="sec20">
                <title>K411 with 
                    <italic toggle="yes">sepA</italic>
                    <sub>4-4091</sub> deleted also showed elevated biofilm staining</title>
                <p>Since the original 
                    <italic toggle="yes">sepA</italic> deletion strategy left 96 nucleotides of the 
                    <italic toggle="yes">sepA</italic> coding region, we next made a deletion that left only the start and stop codons, and reversed the orientation of 
                    <italic toggle="yes">cat</italic> gene (
                    <italic toggle="yes">cat</italic>
                    <sub>rev</sub>) relative to 
                    <italic toggle="yes">sepA.</italic> K411&#x0394;
                    <italic toggle="yes">sepA::cat</italic>
                    <sub>rev</sub> exhibited increased biofilm staining compared to the wt parental strain (
                    <xref ref-type="fig" rid="f5">Figure 5</xref>). This result indicates that the increased biofilm staining after deletion of 
                    <italic toggle="yes">sepA</italic> was not an artifact of the original mutation strategy.</p>
                <fig fig-type="figure" id="f5" orientation="portrait" position="float">
                    <label>Figure 5. </label>
                    <caption>
                        <title>Biofilm staining of K411&#x0394;
                            <italic toggle="yes">sepA::cat</italic>
                            <sub>rev</sub> normalized to K411.</title>
                        <p>Biofilm results from 23 hour 96-well plate assays. Pink symbols indicate the wt parental strain, and blue symbols are for the corresponding &#x0394;
                            <italic toggle="yes">sepA::cat</italic>
                            <sub>rev</sub> strain. Each symbol represents the mean biofilm staining of four technical replicates. Error bars indicate SEM. 
                            <italic toggle="yes">P</italic>-value from unpaired 
                            <italic toggle="yes">t</italic> test *
                            <italic toggle="yes">P</italic>&#x2264;0.05.</p>
                    </caption>
                    <graphic id="gr5" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/162361/473b367f-2620-4db9-942e-fc23c504f6cd_figure5.gif"/>
                </fig>
            </sec>
            <sec id="sec21">
                <title>Analysis of 
                    <italic toggle="yes">sepA</italic> from several EAEC strains identified predicted amino acid polymorphisms</title>
                <p>We hypothesized that there might be an expression level difference or an amino acid difference within SepA among different EAEC strains that prevented a SepA-mediated reduction in biofilm staining in the wt strains. We found no nucleotide differences in the 185 bp upstream of 
                    <italic toggle="yes">sepA</italic>, a region that includes the binding region for the EAEC virulence regulator AggR,
                    <sup>
                        <xref ref-type="bibr" rid="ref57">57</xref>
                    </sup>
                    <sup>,</sup>
                    <sup>
                        <xref ref-type="bibr" rid="ref58">58</xref>
                    </sup> for any of the strains in this study. This finding demonstrates that the 
                    <italic toggle="yes">sepA</italic> promoter is the same for all of the strains. Next, we compared the predicted amino acid sequences of SepA among the EAEC used in this study. There were several amino acid polymorphisms with respect to the predicted protein consensus derived from all strains combined: (K411: A51V), (K261: S905N), (E131: I183V, G194E, D1049N), (D5613: D1049N, H671N), (P433 &amp; E161: A1277V). However, we observed no common amino acid change in SepA among the strains that showed a difference in biofilm staining when 
                    <italic toggle="yes">sepA</italic> was deleted compared to those that did not (P433 and D5613). The most interesting change identified was A1277V in E161 and P433. The A1277V change is in the predicted autotransporter beta domain, which is necessary for secretion of the proteolytic passenger domain into the supernatant. In other SPATEs, mutations in this domain can inhibit secretion of the SPATE.
                    <sup>
                        <xref ref-type="bibr" rid="ref51">51</xref>
                    </sup>
                    <sup>,</sup>
                    <sup>
                        <xref ref-type="bibr" rid="ref59">59</xref>
                    </sup>
                    <sup>&#x2013;</sup>
                    <sup>
                        <xref ref-type="bibr" rid="ref62">62</xref>
                    </sup> Accordingly, we examined SepA secretion into the supernatant from a subset of EAEC in this study, shown below.</p>
            </sec>
            <sec id="sec22">
                <title>SepA is found in the supernatant irrespective of amino acid polymorphisms</title>
                <p>To investigate whether the increased biofilm staining observed when 
                    <italic toggle="yes">sepA</italic> is deleted from some EAEC but not others is related to SepA secretion levels, we performed Western blot analysis on EAEC culture supernatants. We were particularly interested in whether the amino acid substitution found only in E161 and P433 (A1277V) had an impact on secretion. We observed the same apparent SepA band in all the wt strains examined, and all the strains tested appeared to have approximately equal levels of SepA (
                    <xref ref-type="fig" rid="f6">Figure 6</xref>). This finding was true for EAEC with (K411, K261, and E161) or without (P433) a difference in biofilm staining when 
                    <italic toggle="yes">sepA</italic> was deleted. We also examined the supernatants from statically-grown biofilms of K261 and P433 for SepA. Similar SepA bands were observed from the supernatant harvested from the biofilms of K161 and P433 (
                    <xref ref-type="fig" rid="f6">Figure 6</xref>). There was no visible SepA band identified from the bacteria contained in the cell pellet from the biofilm-grown bacteria; therefore, we inferred that SepA was efficiently exported into the supernatant for both K261 and P433 (
                    <xref ref-type="fig" rid="f6">Figure 6</xref>).</p>
                <fig fig-type="figure" id="f6" orientation="portrait" position="float">
                    <label>Figure 6. </label>
                    <caption>
                        <title>Western blot analysis of SepA from culture supernatants and bacterial pellets.</title>
                        <p>Supernatants from shaking (shake) cultures, a static biofilm culture (biofilm), or cell pellets are shown. The black triangle (&#x25c2;) denotes the band corresponding to the SepA passenger domain, at approximately 110 kDa
                            <sup>
                                <xref ref-type="bibr" rid="ref39">39</xref>
                            </sup> while the open triangle (&#x22b2;) represents an unknown breakdown product. The first lane is the MagicMark XP standard (Invitrogen LC5602) with the 50 kDa band indicated. E171 is a wt 
                            <italic toggle="yes">sepA</italic>+ EAEC strain that is genetically identical to E161
                            <sup>
                                <xref ref-type="bibr" rid="ref28">28</xref>
                            </sup> (not used elsewhere in this study).
                            <sup>
                                <xref ref-type="bibr" rid="ref28">28</xref>
                            </sup> 1:4,000 anti-SepA antibody.</p>
                    </caption>
                    <graphic id="gr6" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/162361/473b367f-2620-4db9-942e-fc23c504f6cd_figure6.gif"/>
                </fig>
                <p>We also tested the impact of deletion of the EAEC virulence gene regulator, 
                    <italic toggle="yes">aggR</italic> (K261&#x0394;
                    <italic toggle="yes">aggR</italic>) on SepA secretion. AggR is known to positively regulate 
                    <italic toggle="yes">sepA</italic> expression via an AggR-binding site.
                    <sup>
                        <xref ref-type="bibr" rid="ref57">57</xref>
                    </sup>
                    <sup>,</sup>
                    <sup>
                        <xref ref-type="bibr" rid="ref58">58</xref>
                    </sup> We found that some SepA was still secreted when 
                    <italic toggle="yes">aggR</italic> was deleted (
                    <xref ref-type="fig" rid="f6">Figure 6</xref>). We also found that SepA was efficiently secreted by a laboratory strain carrying a high-copy plasmid containing the K261 
                    <italic toggle="yes">sepA</italic> gene (which was inserted in the opposite orientation as the 
                    <italic toggle="yes">lac</italic> promoter), without AggR (TOPO::
                    <italic toggle="yes">sepA</italic>). This plasmid was later used as a part of our complementation work.</p>
            </sec>
            <sec id="sec23">
                <title>Visual changes between wt and &#x0394;
                    <italic toggle="yes">sepA</italic> strain biofilms</title>
                <p>To visualize the biofilm after 
                    <italic toggle="yes">sepA</italic> was deleted, EAEC were grown on glass disks under the same conditions used for the 96-well biofilm assay (
                    <xref ref-type="fig" rid="f7">Figure 7</xref>). We examined K261 (showed elevated biofilm staining as measured by OD when 
                    <italic toggle="yes">sepA</italic> was deleted) and P433 (no change in biofilm staining OD when 
                    <italic toggle="yes">sepA</italic> was deleted). We observed that the &#x0394;
                    <italic toggle="yes">sepA</italic> strain biofilm patterns were different than found in the wt strains. Both P433 and K261 appeared to be packed closer together than the respective &#x0394;
                    <italic toggle="yes">sepA</italic> strains (
                    <xref ref-type="fig" rid="f7">Figure 7</xref>). However, this difference in biofilm appearance does not correlate to the quantitative amount of crystal violet staining, for reasons that are not clear.</p>
                <fig fig-type="figure" id="f7" orientation="portrait" position="float">
                    <label>Figure 7. </label>
                    <caption>
                        <title>Images of two sets of wt and &#x0394;
                            <italic toggle="yes">sepA</italic> biofilms.</title>
                        <p>Biofilms were grown for five hours on glass disks and stained with crystal violet. Representative images from two independent experiments are shown at 100&#x00d7; magnification.</p>
                    </caption>
                    <graphic id="gr7" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/162361/473b367f-2620-4db9-942e-fc23c504f6cd_figure7.gif"/>
                </fig>
            </sec>
            <sec id="sec24">
                <title>Bacterial counts from the biofilms of K261 and P433 and &#x0394;
                    <italic toggle="yes">sepA</italic> derivative strains</title>
                <p>We next sought to determine whether the differences in biofilm crystal violet staining for K261 and K261&#x0394;
                    <italic toggle="yes">sepA</italic> were due to differences in the bacterial numbers in the biofilm. We checked both the biofilm and biofilm supernatant for K261 and, for comparison, P433 as well as the corresponding &#x0394;
                    <italic toggle="yes">sepA</italic> strains. No differences in CFU were identified (
                    <xref ref-type="fig" rid="f8">Figure 8</xref>). As the CFU from biofilms for K261, P433, and the &#x0394;
                    <italic toggle="yes">sepA</italic> derivative strains did not deviate, the staining differences were not due to reductions in bacterial numbers.</p>
                <fig fig-type="figure" id="f8" orientation="portrait" position="float">
                    <label>Figure 8. </label>
                    <caption>
                        <title>CFU from biofilm and biofilm supernatant after 5 hours.</title>
                        <p>Biofilms were grown as usual in 96-well plates for five hours. Subsequently, 100 &#x03bc;L of supernatant was collected for CFU enumeration (supernatant). After washing the biofilm once with PBS, the biofilm was removed by scraping and resuspended in 100 &#x03bc;L of PBS and vortexed (biofilm). To confirm separation of bacterial aggregates after vortexing, we checked the mixture by microscopy (data not shown). Crystal violet staining after biofilm removal confirmed that no biofilm remained in the wells after scraping. Each symbol represents the mean of two technical replicates. Error bars indicate SEM. ns, no significant differences were found using 1-way analysis of variance (ANOVA) with Tukey&#x2019;s test.</p>
                    </caption>
                    <graphic id="gr8" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/162361/473b367f-2620-4db9-942e-fc23c504f6cd_figure8.gif"/>
                </fig>
            </sec>
            <sec id="sec25">
                <title>Transfer of pAA
                    <sub>K261</sub>&#x0394;
                    <italic toggle="yes">sepA</italic> confers biofilm-forming capacity to a commensal 
                    <italic toggle="yes">E. coli</italic>
                </title>
                <p>To identify the genes that might be responsible for the increased biofilm staining for K261&#x0394;
                    <italic toggle="yes">sepA</italic>, but not for P433&#x0394;
                    <italic toggle="yes">sepA</italic>, we transferred the pAAs from those strains into the commensal 
                    <italic toggle="yes">E. coli</italic> HSNal
                    <sup>R</sup> which does not have the capacity to make biofilm. We successfully transferred pAA
                    <sub>K261</sub> into HSNal
                    <sup>R</sup>
                    <italic toggle="yes">.</italic> We found that the K261 pAA did not confer biofilm formation on HSNal
                    <sup>R</sup> (
                    <xref ref-type="fig" rid="f9">Figure 9</xref>). That result is similar to those of Alves 
                    <italic toggle="yes">et al.</italic> who reported that the wt pAA plasmid from EAEC strain 042 does not confer the capacity to form biofilm to an 
                    <italic toggle="yes">E. coli</italic> K12 strain.
                    <sup>
                        <xref ref-type="bibr" rid="ref63">63</xref>
                    </sup> In contrast, HSNal
                    <sup>R</sup>pAA
                    <sub>K261</sub>&#x0394;
                    <italic toggle="yes">sepA</italic> demonstrated significantly increased biofilm staining (
                    <xref ref-type="fig" rid="f9">Figure 9</xref>). This latter result indicated that the target of SepA is likely on the K261 pAA. We also put pAA
                    <sub>p433</sub> and pAA
                    <sub>P433</sub>&#x0394;
                    <italic toggle="yes">sepA</italic> (does not confer elevated biofilm to P433) into HSNal
                    <sup>R</sup>. Biofilm staining was not increased in HSNal
                    <sup>R</sup> with either pAA
                    <sub>P433</sub> or pAA
                    <sub>P433</sub>&#x0394;
                    <italic toggle="yes">sepA</italic> (
                    <xref ref-type="fig" rid="f9">Figure 9</xref>). We also found that 
                    <italic toggle="yes">sepA</italic> alone or &#x0394;
                    <italic toggle="yes">sepA</italic>::
                    <italic toggle="yes">cat</italic> alone did not confer the capacity to form a biofilm on HSNal
                    <sup>R</sup> (data not shown). Therefore, we concluded that the &#x0394;
                    <italic toggle="yes">sepA</italic>::
                    <italic toggle="yes">cat</italic> mutation alone is not sufficient to cause the increased biofilm staining of HSNal
                    <sup>R</sup> that had pAA
                    <sub>K261</sub>&#x0394;
                    <italic toggle="yes">sepA.</italic>
                </p>
                <fig fig-type="figure" id="f9" orientation="portrait" position="float">
                    <label>Figure 9. </label>
                    <caption>
                        <title>Biofilm formation by HSNal
                            <sup>R</sup> with the pAA from wt or &#x0394;
                            <italic toggle="yes">sepA</italic> EAEC strains.</title>
                        <p>Biofilms were grown for 4.5 hours. Pink bars represent HSNal
                            <sup>R</sup> with a wt pAA. Blue bars indicate HSNal
                            <sup>R</sup> with a pAA&#x0394;
                            <italic toggle="yes">sepA.</italic> Each symbol represents the mean of four technical replicates. Error bars indicate SEM. Significance was tested using 1-way ANOVA with Tukey&#x2019;s test. ****
                            <italic toggle="yes">P</italic>&#x2264;0.0001.</p>
                    </caption>
                    <graphic id="gr9" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/162361/473b367f-2620-4db9-942e-fc23c504f6cd_figure9.gif"/>
                </fig>
                <p>Because it is likely that the target of SepA is encoded on the K261 pAA, and we predicted that deleting the gene for a target of SepA would result in a significant change in biofilm staining, we searched for genetic differences in the pAA
                    <sub>P433</sub> as compared to pAA
                    <sub>K261</sub>. From that search, we found that the pAA
                    <sub>P433</sub> lacks most of the 
                    <italic toggle="yes">tra</italic> (plasmid transfer) genes. Therefore, we deleted the 
                    <italic toggle="yes">tra</italic> region from pAA
                    <sub>K261</sub> (pAA&#x0394;
                    <italic toggle="yes">psiB-orf8</italic>) and assessed biofilm formation (
                    <xref ref-type="fig" rid="f10">Figure 10</xref>). Because we found no significant difference in biofilm staining between K261 and K261pAA&#x0394;
                    <italic toggle="yes">psiB-orf8</italic>, we concluded that the target for SepA was not encoded within the deleted region. Other gene deletions made in pAA
                    <sub>K411</sub>, &#x0394;
                    <italic toggle="yes">umuC</italic>-
                    <italic toggle="yes">yccA</italic>, &#x0394;
                    <italic toggle="yes">finO</italic>, &#x0394;
                    <italic toggle="yes">parB</italic> similarly had no impact on biofilm staining (data not shown). We also searched for genes (excluding transposes) on the pAA for predicted amino acid differences found only in P433 and D5613. Excluding the previously deleted genes and mobile genetic elements, we identified 
                    <italic toggle="yes">lpxM</italic> (Lipid A biosynthesis myristoyltransferase)
                    <sup>
                        <xref ref-type="bibr" rid="ref64">64</xref>
                    </sup> for which there were predicted amino acid differences between K261 and P433. However, because we found no impact of 
                    <italic toggle="yes">lpxM</italic> deletion on biofilm staining of K261 (
                    <xref ref-type="fig" rid="f10">Figure 10B</xref>), we concluded that LpxM is not the target of SepA.</p>
                <fig fig-type="figure" id="f10" orientation="portrait" position="float">
                    <label>Figure 10. </label>
                    <caption>
                        <title>Biofilm formation after deleting the genes for potential targets of SepA.</title>
                        <p>Biofilms were grown for 5-8 hours. Each symbol represents the mean of four technical replicates. Significance tested by 1-way ANOVA with &#x0160;&#x00ed;d&#x00e1;k correction. *
                            <italic toggle="yes">P</italic>&#x2264;0.05; **
                            <italic toggle="yes">P</italic>&#x2264;0.01; ***
                            <italic toggle="yes">P</italic>&#x2264;0.001; ****
                            <italic toggle="yes">P</italic>&#x2264;0.0001.</p>
                    </caption>
                    <graphic id="gr10" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/162361/473b367f-2620-4db9-942e-fc23c504f6cd_figure10.gif"/>
                </fig>
                <p>Next, because deletion of the gene for dispersin (
                    <italic toggle="yes">aap</italic>) increases biofilm staining for EAEC strain 042,
                    <sup>
                        <xref ref-type="bibr" rid="ref65">65</xref>
                    </sup>
                    <sup>,</sup>
                    <sup>
                        <xref ref-type="bibr" rid="ref66">66</xref>
                    </sup> we tested a strain with a deletion of both 
                    <italic toggle="yes">aatA</italic> (encodes the dispersin transporter) and 
                    <italic toggle="yes">sepA.</italic> The positively-charged Aap protein is thought to help the AAF extend from the surface of the bacteria.
                    <sup>
                        <xref ref-type="bibr" rid="ref65">65</xref>
                    </sup>
                    <sup>,</sup>
                    <sup>
                        <xref ref-type="bibr" rid="ref66">66</xref>
                    </sup> In 
                    <xref ref-type="fig" rid="f7">Figure 7</xref> we noted that &#x0394;
                    <italic toggle="yes">sepA</italic> bacteria in the biofilm were less compactly spaced than the wt, so we predicted that preventing export of dispersin would have the opposite effect. However, we found that biofilm formation for K261&#x0394;
                    <italic toggle="yes">sepA</italic>&#x0394;
                    <italic toggle="yes">aatA</italic> was increased, a result that suggests that dispersin is not a target for SepA (
                    <xref ref-type="fig" rid="f10">Figure 10C</xref>). Next, we deleted 
                    <italic toggle="yes">agg4A</italic>, the gene that encodes the AAF major pilin subunit in the wt and &#x0394;
                    <italic toggle="yes">sepA</italic> background of K261 (
                    <xref ref-type="fig" rid="f10">Figure 10C</xref>). We measured a significant reduction in biofilm staining for both strains, as would be predicted for loss of the AAF.
                    <sup>
                        <xref ref-type="bibr" rid="ref35">35</xref>
                    </sup> Because biofilm formation by the K261&#x0394;
                    <italic toggle="yes">agg4A</italic>&#x0394;
                    <italic toggle="yes">sepA</italic> double deletion strain was indistinguishable from K261&#x0394;
                    <italic toggle="yes">agg4A</italic>, we cannot determine whether SepA has an impact on the AAF by this method. However, because the predicted amino acid sequence of Agg4A from K261 and P433 are identical, we hypothesized that Agg4A is not the target of SepA for K261. We next moved on to other strategies to identify how SepA affects biofilm staining in some of our strains.</p>
            </sec>
            <sec id="sec26">
                <title>Cytochrome 
                    <italic toggle="yes">c</italic> binding and growth with DNase, sodium metaperiodate, chymotrypsin, PMSF or extra magnesium</title>
                <p>We conducted several additional experiments to investigate potential mechanisms by which biofilm staining was increased after deletion of 
                    <italic toggle="yes">sepA.</italic> Because Arenas 
                    <italic toggle="yes">et al.</italic> showed that deletion of a SPATE in 
                    <italic toggle="yes">Neisseria</italic> led to increased biofilm via a surface charge change and eDNA (extracellular DNA) production,
                    <sup>
                        <xref ref-type="bibr" rid="ref67">67</xref>
                    </sup> we asked if a surface charge difference could be observed in the EAEC strains that showed differential biofilm formation. In contrast to Arenas 
                    <italic toggle="yes">et al</italic>. we found that differences in cytochrome 
                    <italic toggle="yes">c</italic> binding (a proxy for surface charge) did not correlate with biofilm staining levels (
                    <xref ref-type="fig" rid="f11">Figure 11</xref>). For example, K261&#x0394;
                    <italic toggle="yes">sepA</italic> had decreased cytochrome 
                    <italic toggle="yes">c</italic> binding compared to K261, but K411 and K411&#x0394;
                    <italic toggle="yes">sepA</italic> had no significant difference in cytochrome 
                    <italic toggle="yes">c</italic> binding (
                    <xref ref-type="fig" rid="f11">Figure 11</xref>). For our next set of experiments, we attempted to manipulate the biofilm by addition of various compounds to the medium, 
                    <xref ref-type="fig" rid="f12">Figure 12</xref>. (
                    <bold>A</bold>) To pursue the hypothesis that there might be increased eDNA present in the biofilm of strains with elevated biofilm staining, we tested the impact of DNase I on biofilm formation. We could detect no impact on biofilm staining when biofilms were grown with 1 mg/ml DNase I (
                    <xref ref-type="fig" rid="f12">Figure 12A</xref>). (
                    <bold>B</bold>) Next, we asked whether treatment of the biofilm with an exogenous serine protease, chymotrypsin, would alter biofilm formation. We used a serine protease because SepA is a serine protease and we reasoned that it was possible that a broad-spectrum serine protease might be able to act similarly to SepA. However, no impact on the biofilm staining was observed in the strains that were treated with chymotrypsin (
                    <xref ref-type="fig" rid="f12">Figure 12B</xref>). (
                    <bold>C</bold>) We tested the effects of sodium metaperiodate, a carbohydrate cleaving agent. Sodium metaperiodate had no impact on biofilm staining (
                    <xref ref-type="fig" rid="f12">Figure 12C</xref>). (
                    <bold>D</bold>) Because SepA is a serine protease, we added phenylmethylsulfonyl fluoride (PMSF), a protease inhibitor, to the biofilm. We did not observe an impact on biofilm staining when 2mM PMSF was added to the biofilm compared to the vehicle control (isopropanol) (
                    <xref ref-type="fig" rid="f12">Figure 12D</xref>). This may be because PMSF is neutralized by other biofilm components over four hours, because the protease activity of SepA is not responsible for the &#x0394;
                    <italic toggle="yes">sepA</italic> phenotype, or because PMSF does not inhibit SepA under the conditions tested. (
                    <bold>E</bold>) Because we observed increased biofilm staining (data not shown) when EAEC were grown in M9 medium (has higher levels of magnesium than DMEM) and because magnesium affects the expression of genes on the large plasmid in 
                    <italic toggle="yes">Shigella,</italic>
                    <sup>
                        <xref ref-type="bibr" rid="ref64">64</xref>
                    </sup> we supplemented DMEM to magnesium levels (10 mM Mg
                    <sup>2+</sup>) equivalent to that in M9. However, as shown in 
                    <xref ref-type="fig" rid="f12">Figure 12E</xref>, Mg
                    <sup>2+</sup> supplementation did not change biofilm staining significantly. Nor did magnesium lower the increased biofilm staining of K261&#x0394;
                    <italic toggle="yes">sepA</italic> (
                    <xref ref-type="fig" rid="f12">Figure 12E</xref>). In summary, we did not observe a difference in biofilm response between the wt and &#x0394;
                    <italic toggle="yes">sepA</italic> strains for any of the tested treatments.</p>
                <fig fig-type="figure" id="f11" orientation="portrait" position="float">
                    <label>Figure 11. </label>
                    <caption>
                        <title>Cytochrome 
                            <italic toggle="yes">c</italic> binding as a proxy for surface charge.</title>
                        <p>The percentage of cytochrome 
                            <italic toggle="yes">c</italic> bound for each strain was calculated as previously described.
                            <sup>
                                <xref ref-type="bibr" rid="ref75">75</xref>
                            </sup> Each bar represents the mean of three biological replicates. Error bars indicate SEM. Significance tested by 1-way ANOVA with &#x0160;&#x00ed;d&#x00e1;k correction. ***
                            <italic toggle="yes">P</italic>&#x2264;0.001; ****
                            <italic toggle="yes">P</italic>&#x2264;0.0001.</p>
                    </caption>
                    <graphic id="gr11" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/162361/473b367f-2620-4db9-942e-fc23c504f6cd_figure11.gif"/>
                </fig>
                <fig fig-type="figure" id="f12" orientation="portrait" position="float">
                    <label>Figure 12. </label>
                    <caption>
                        <title>Biofilms grown with DNase, chymotrypsin, sodium metaperiodate, PMSF or magnesium.</title>
                        <p>Biofilm results from a five hour 96-well plate assay grown in DMEM media supplemented with (A) 1 mg/ml DNase, (B) 1 mg/ml chymotrypsin, (C) 0.8 mM &#x2013; 2.5 mM sodium metaperiodate, (D) 2 mM PMSF, or (E) 10 mM Mg
                            <sup>2+</sup> as compared to DMEM (0.8 mM Mg
                            <sup>2+</sup>). Pink symbols indicate K261, blue symbols K261&#x0394;
                            <italic toggle="yes">sepA</italic>, purple symbols P433, and green symbols P433&#x0394;
                            <italic toggle="yes">sepA.</italic> Square symbols represent strains with the vehicle control added to the biofilm, and circles the biofilms with supplemented media. Each symbol represents the mean of four technical replicates. Error bars indicate SEM. Significance was tested by 1-way ANOVA with &#x0160;&#x00ed;d&#x00e1;k correction. *
                            <italic toggle="yes">P</italic>&#x2264;0.05; **
                            <italic toggle="yes">P</italic>&#x2264;0.01; ***
                            <italic toggle="yes">P</italic>&#x2264;0.001; ****
                            <italic toggle="yes">P</italic>&#x2264;0.0001.</p>
                    </caption>
                    <graphic id="gr12" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/162361/473b367f-2620-4db9-942e-fc23c504f6cd_figure12.gif"/>
                </fig>
            </sec>
            <sec id="sec27">
                <title>Growth of mixed biofilms</title>
                <p>We hypothesized that a SepA-secreting strain should reduce the biofilm staining of K261&#x0394;
                    <italic toggle="yes">sepA</italic> to K261 levels. We therefore inoculated a biofilm plate with a mixture of K261&#x0394;
                    <italic toggle="yes">sepA</italic> and P433 (SepA secreter) or P433&#x0394;
                    <italic toggle="yes">sepA</italic> as a control. We selected P433 as the SepA-secreting strain because P433 and P433&#x0394;
                    <italic toggle="yes">sepA</italic> showed identical staining. Co-culture of P433 with K261&#x0394;
                    <italic toggle="yes">sepA</italic> did not significantly lower biofilm staining as compared to the P433&#x0394;
                    <italic toggle="yes">sepA</italic> (SepA non-secretor) (
                    <xref ref-type="fig" rid="f13">Figure 13</xref>). There are several possible explanations for this observation. One, SepA only acts quite close to the surface of the bacteria, or similarly, is trapped within the biofilm. Second, that SepA is rapidly inactivated in the biofilm media, or, lastly, that SepA is not responsible for the increased crystal violet staining observed in K261&#x0394;
                    <italic toggle="yes">sepA.</italic>
                </p>
                <fig fig-type="figure" id="f13" orientation="portrait" position="float">
                    <label>Figure 13. </label>
                    <caption>
                        <title>Biofilm staining from strains grown together.</title>
                        <p>Equal volumes of the indicated strains were grown for five hours in a biofilm. Each symbol represents the mean of four technical replicates. Significance was tested using 1-way ANOVA with &#x0160;&#x00ed;d&#x00e1;k correction. *
                            <italic toggle="yes">P</italic>&#x2264;0.05.</p>
                    </caption>
                    <graphic id="gr13" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/162361/473b367f-2620-4db9-942e-fc23c504f6cd_figure13.gif"/>
                </fig>
            </sec>
            <sec id="sec28">
                <title>Addition of SepA or SepA* to the biofilm</title>
                <p>We next added SepA directly to the biofilm. The SepA passenger domain is abundantly secreted into the supernatant for both EAEC and lab 
                    <italic toggle="yes">E. coli</italic> strains (
                    <xref ref-type="fig" rid="f6">Figure 6</xref> and Ref. 
                    <xref ref-type="bibr" rid="ref39">39</xref>). We chose K411 as the donor for the supernatant because it contains only one SPATE, SepA. We observed a significant reduction in staining for the K261&#x0394;
                    <italic toggle="yes">sepA</italic> biofilm grown with K411 supernatant (
                    <xref ref-type="fig" rid="f14">Figure 14A</xref>). These results suggested that exogenously added SepA could reduce biofilm staining. Although the K411&#x0394;
                    <italic toggle="yes">sepA</italic> supernatant also slightly reduced K261&#x0394;
                    <italic toggle="yes">sepA</italic> biofilm staining (
                    <xref ref-type="fig" rid="f14">Figure 14A</xref>), the reduction was not statistically significant. It may be that there were other factors present in the concentrated supernatant from K411&#x0394;
                    <italic toggle="yes">sepA</italic>, including waste products, which may impact biofilm growth.</p>
                <fig fig-type="figure" id="f14" orientation="portrait" position="float">
                    <label>Figure 14. </label>
                    <caption>
                        <title>Biofilm formation after the addition of concentrated supernatant with SepA or SepA*.</title>
                        <p>(A) Concentrated supernatants from either K411 or K411&#x0394;
                            <italic toggle="yes">sepA</italic> were added to the growing biofilm of K261 or K261&#x0394;
                            <italic toggle="yes">sepA</italic> at the start of incubation (5-hour biofilm). (B) Concentrated supernatant from TOP10 cells with either TOPO::
                            <italic toggle="yes">sepA</italic> or TOPO::
                            <italic toggle="yes">sepA</italic>* was added to the growing biofilm. Absorbance was normalized to that of the untreated &#x0394;
                            <italic toggle="yes">sepA</italic> strain. Each symbol represents the mean of four technical replicates. Error bars indicate SEM. Significance tested by 1-way ANOVA with &#x0160;&#x00ed;d&#x00e1;k correction. *
                            <italic toggle="yes">P</italic>&#x2264;0.05; **
                            <italic toggle="yes">P</italic>&#x2264;0.01.</p>
                    </caption>
                    <graphic id="gr14" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/162361/473b367f-2620-4db9-942e-fc23c504f6cd_figure14.gif"/>
                </fig>
                <p>To eliminate the possible influence of other EAEC elements within the supernatants, we concentrated the supernatant fraction from laboratory 
                    <italic toggle="yes">E. coli</italic> TOP10 cells that carried TOPO::
                    <italic toggle="yes">sepA</italic> (wt SepA protein) or TOPO::
                    <italic toggle="yes">sepA</italic>* (catalytically inactive SepA). The concentrated supernatant fractions were then added to the growing biofilms as before. The presence of the supernatant from the TOPO::
                    <italic toggle="yes">sepA</italic> construct did not lead to a statistically significant reduction in biofilm staining (
                    <xref ref-type="fig" rid="f14">Figure 14B</xref>), despite the abundant presence of SepA in supernatants from that construct as shown by Western blot (
                    <xref ref-type="fig" rid="f6">Figure 6</xref>).</p>
                <p>As the concentrated supernatant from the TOP10 cells with either TOPO::
                    <italic toggle="yes">sepA</italic> or TOPO::
                    <italic toggle="yes">sepA</italic>* did not reduce biofilm formation, but the concentrated supernatant from K411 did, we next asked whether purified SepA protein could function to reduce biofilm staining for K261&#x0394;
                    <italic toggle="yes">sepA.</italic> We expressed the His-tagged SepA passenger domain (His-SepA) as previously described for other SPATEs.
                    <sup>
                        <xref ref-type="bibr" rid="ref25">25</xref>
                    </sup>
                    <sup>,</sup>
                    <sup>
                        <xref ref-type="bibr" rid="ref68">68</xref>
                    </sup>
                    <sup>,</sup>
                    <sup>
                        <xref ref-type="bibr" rid="ref69">69</xref>
                    </sup> The catalytically inactive form of the SepA passenger domain (SepA*) was used as a control. The vehicle control (PBS), His-SepA, or His-SepA* was added to K261&#x0394;
                    <italic toggle="yes">sepA</italic> at the start of inoculation for the biofilm and again one hour before fixing the biofilm. As shown in 
                    <xref ref-type="fig" rid="f15">Figure 15</xref>, no impact on biofilm staining was observed. This result, taken with mixed biofilm data, further suggested that the SepA protein may not be responsible for the difference between wt and &#x0394;
                    <italic toggle="yes">sepA</italic> biofilm staining. We were unable to measure the enzymatic activity of the His-SepA in this study due to the lack of a known substrate for the EAEC SepA. However, the utilized purification process has successfully been used in other studies to yield functional SPATEs.
                    <sup>
                        <xref ref-type="bibr" rid="ref51">51</xref>
                    </sup>
                    <sup>,</sup>
                    <sup>
                        <xref ref-type="bibr" rid="ref52">52</xref>
                    </sup>
                    <sup>,</sup>
                    <sup>
                        <xref ref-type="bibr" rid="ref68">68</xref>
                    </sup> Following the outcomes of these studies, we next utilized a genetic approach to test SepA.</p>
                <fig fig-type="figure" id="f15" orientation="portrait" position="float">
                    <label>Figure 15. </label>
                    <caption>
                        <title>Effect of purified His-SepA on K261&#x0394;
                            <italic toggle="yes">sepA</italic> biofilm formation.</title>
                        <p>Biofilm results from a five hour 96-well plate biofilm assay are shown. Protein or PBS vehicle control was added at the time of biofilm inoculation and again one hour before biofilm fixation. Each symbol represents the mean of four technical replicates. Significance tested by a 1-way ANOVA with Tukey&#x2019;s test. **
                            <italic toggle="yes">P</italic>&#x2264;0.01; ***
                            <italic toggle="yes">P</italic>&#x2264;0.001.</p>
                    </caption>
                    <graphic id="gr15" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/162361/473b367f-2620-4db9-942e-fc23c504f6cd_figure15.gif"/>
                </fig>
            </sec>
            <sec id="sec29">
                <title>Complementation</title>
                <p>To complement the &#x0394;
                    <italic toggle="yes">sepA</italic> mutation genetically, we transformed K261&#x0394;
                    <italic toggle="yes">sepA</italic> and K411&#x0394;
                    <italic toggle="yes">sepA</italic> with pACYC177::
                    <italic toggle="yes">sepA</italic> for complementation (
                    <xref ref-type="fig" rid="f16">Figure 16</xref>). We confirmed SepA expression in the supernatant from pACYC177::
                    <italic toggle="yes">sepA</italic> (
                    <xref ref-type="fig" rid="f17">Figure 17</xref>) and that there was no growth defect for &#x0394;
                    <italic toggle="yes">sepA</italic> strains with pACYC177::
                    <italic toggle="yes">sepA</italic> (data not shown). However, this construct failed to reduce biofilm staining of K261&#x0394;
                    <italic toggle="yes">sepA</italic> and K411&#x0394;
                    <italic toggle="yes">sepA</italic> as compared to the parental strains (
                    <xref ref-type="fig" rid="f16">Figure 16</xref>).</p>
                <fig fig-type="figure" id="f16" orientation="portrait" position="float">
                    <label>Figure 16. </label>
                    <caption>
                        <title>Biofilm formation following complementation with low copy plasmid.</title>
                        <p>Biofilms were grown for 23 hours in a 96-well plate. Each symbol represents the mean of four technical replicates. Error bars indicate SEM. Significance was tested by 1-way ANOVA with &#x0160;&#x00ed;d&#x00e1;k correction. *
                            <italic toggle="yes">P</italic>&#x2264;0.05; **
                            <italic toggle="yes">P</italic>&#x2264;0.01; ***
                            <italic toggle="yes">P</italic>&#x2264;0.001; ****
                            <italic toggle="yes">P</italic>&#x2264;0.0001.</p>
                    </caption>
                    <graphic id="gr16" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/162361/473b367f-2620-4db9-942e-fc23c504f6cd_figure16.gif"/>
                </fig>
                <fig fig-type="figure" id="f17" orientation="portrait" position="float">
                    <label>Figure 17. </label>
                    <caption>
                        <title>Western blot of supernatant from TOP10 cultures with pACYC177::
                            <italic toggle="yes">sepA.</italic>
                        </title>
                        <p>Supernatants from four hour shaking cultures of the indicated strains. 1:7,000 dilution of the SepA antibody. Black triangle (&#x25c2;) points to the SepA passenger domain band. Open triangle (&#x22b2;) indicates an unknown breakdown product band also seen in 
                            <xref ref-type="fig" rid="f6">Figure 6</xref>.</p>
                    </caption>
                    <graphic id="gr17" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/162361/473b367f-2620-4db9-942e-fc23c504f6cd_figure17.gif"/>
                </fig>
                <p>Since the plasmid-based methods failed to complement the altered biofilm-staining phenotype in the &#x0394;
                    <italic toggle="yes">sepA</italic> strains, we next introduced 
                    <italic toggle="yes">sepA</italic> into the chromosome of K411&#x0394;
                    <italic toggle="yes">sepA</italic>, in the 
                    <italic toggle="yes">lacZ</italic> locus. However, we did not observe a reduction in biofilm staining of K411&#x0394;
                    <italic toggle="yes">sepA</italic>&#x0394;
                    <italic toggle="yes">lacZ</italic>::
                    <italic toggle="yes">sepA</italic> (
                    <xref ref-type="fig" rid="f18">Figure 18</xref>). In our last attempt at complementation, we created a &#x201c;revertant&#x201d; strain in which 
                    <italic toggle="yes">sepA</italic> was inserted back onto the pAA in place of the deleted 
                    <italic toggle="yes">sepA.</italic> The revertant strain had equivalent biofilm staining as found for the &#x0394;
                    <italic toggle="yes">sepA</italic> strain (
                    <xref ref-type="fig" rid="f18">Figure 18</xref>), a finding that demonstrated that the reason for the elevated biofilm staining in this strain is not due to the 
                    <italic toggle="yes">sepA</italic> deletion. Collectively, these data suggest that the lack of SepA did not cause the increase in the biofilm formation in the &#x0394;
                    <italic toggle="yes">sepA</italic> strains.</p>
                <fig fig-type="figure" id="f18" orientation="portrait" position="float">
                    <label>Figure 18. </label>
                    <caption>
                        <title>Biofilm staining for the K411&#x0394;
                            <italic toggle="yes">sepA</italic> revertant and &#x0394;
                            <italic toggle="yes">lacZ</italic>::
                            <italic toggle="yes">sepA</italic> strains.</title>
                        <p>Biofilm results from a five hour 96-well plate assay. Each symbol represents the mean of four technical replicates. Error bars indicate SEM. Significance was tested by 1-way ANOVA with &#x0160;&#x00ed;d&#x00e1;k correction. **
                            <italic toggle="yes">P</italic>&#x2264;0.01.</p>
                    </caption>
                    <graphic id="gr18" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/162361/473b367f-2620-4db9-942e-fc23c504f6cd_figure18.gif"/>
                </fig>
            </sec>
        </sec>
        <sec id="sec30" sec-type="discussion">
            <title>Discussion</title>
            <p>To assess the contribution of the SPATE SepA to the virulence of EAEC, we deleted 
                <italic toggle="yes">sepA</italic> from a set of six clinical EAEC strains and assessed biofilm formation. We were surprised to find that four of the &#x0394;
                <italic toggle="yes">sepA</italic> strains demonstrated increased 
                <italic toggle="yes">in vitro</italic> biofilm staining compared with the wt controls. We hypothesized that the serine protease activity of SepA was cleaving either an EAEC surface protein or a biofilm component in the wt strains, such that when 
                <italic toggle="yes">sepA</italic> was deleted that component was no longer cleaved, and biofilm staining increased. Ultimately, we did not find a direct connection between biofilm staining and SepA because we were unable to complement the mutation. However, we did find that the &#x0394;
                <italic toggle="yes">sepA</italic> EAEC were spread further out from each other than wt EAEC in images of biofilms. This latter finding was true both for &#x0394;
                <italic toggle="yes">sepA</italic> strains in which we observed elevated biofilm staining and for those for which we did not find elevated biofilm staining. Taken together these findings suggest that deletion of 
                <italic toggle="yes">sepA</italic> does alter the biofilm to a degree, but that the effect of SepA is best observed microscopically, and is likely indirect.</p>
            <p>We did find that pAA&#x0394;
                <italic toggle="yes">sepA</italic> conferred biofilm-forming capacity to a commensal 
                <italic toggle="yes">E. coli.</italic> This result shows that increased biofilm staining is mediated solely by pAA&#x0394;
                <italic toggle="yes">sepA.</italic> We also confirmed that &#x0394;
                <italic toggle="yes">sepA</italic>::
                <italic toggle="yes">cat</italic> alone could not confer biofilm-forming capacity to HSNal
                <sup>R</sup>. Taken together our results suggest for the phenotype of elevated biofilm staining the pAA&#x0394;
                <italic toggle="yes">sepA</italic> is necessary and sufficient.</p>
            <p>As we investigated the effect of the 
                <italic toggle="yes">sepA</italic> mutation, we found the following: a) all wt strains secreted similar amounts of SepA, b) all wt and &#x0394;
                <italic toggle="yes">sepA</italic> strains had similar biofilm CFU counts, c) targeting of eDNA, protein, and carbohydrate did not alter biofilm staining levels for K261, d) deletion of the pAA 
                <italic toggle="yes">tra</italic> region, as well as 
                <italic toggle="yes">umuC</italic>-
                <italic toggle="yes">yccA</italic>, 
                <italic toggle="yes">finO</italic>, 
                <italic toggle="yes">lpxM</italic>, 
                <italic toggle="yes">parB</italic> did not impact biofilm staining, and, e) increased biofilm staining for K261&#x0394;
                <italic toggle="yes">sepA</italic> was dependent on the ability to form a biofilm.</p>
            <p>During this investigation, we tried to complement the &#x0394;
                <italic toggle="yes">sepA</italic>-enhanced biofilm-staining phenotype through both exogenously added protein and by genetic means. Neither crude SepA preparations or purified SepA were able to reduce biofilm staining in the mutant strain background in most cases. We did observe, curiously, that the concentrated supernatant of K411 wt decreased biofilm staining. However, neither 
                <italic toggle="yes">cis-</italic> nor 
                <italic toggle="yes">trans-</italic>addition of 
                <italic toggle="yes">sepA</italic> reduced biofilm staining in the mutant strain background back to wt levels.</p>
            <p>Because we ultimately realized that the increased biofilm staining found for &#x0394;
                <italic toggle="yes">sepA</italic> EAEC strains is not due to the lack of SepA, we hypothesize that the increased biofilm staining is due to a change in the expression of other genes involved in biofilm formation on the pAA. These genes could include those for AAF expression, dispersin or dispersin transport, yet unidentified biofilm genes, or other genes involved in fimbrial gene expression, such as 
                <italic toggle="yes">aggR.</italic> Another regulatory factor for EAEC is Aar, which is a repressor of 
                <italic toggle="yes">aggR</italic> expression and also encoded on the pAA plasmid. However, the presence or absence of 
                <italic toggle="yes">aar</italic> did not correlate with increased biofilm staining in &#x0394;
                <italic toggle="yes">sepA</italic> strains in this study. Alternatively, it is possible that the 
                <italic toggle="yes">cat</italic> insertion into 
                <italic toggle="yes">sepA</italic> caused an unintended effect on the downstream AAF operon or on expression of other pAA genes. However, because 
                <italic toggle="yes">sepA</italic> is located on the pAA separated from other genes by insertion elements, we do not think that deletion of 
                <italic toggle="yes">sepA</italic> perturbs the expression of other genes directly.</p>
            <p>Our data suggest that there is more work to be done on the regulation of EAEC biofilm formation/genes and the ways in which the pAA contributes to the biofilm.</p>
        </sec>
        <sec id="sec31">
            <title>Ethics and consent</title>
            <p>Ethical approval and consent were not required.</p>
        </sec>
    </body>
    <back>
        <sec id="sec34" sec-type="data-availability">
            <title>Data availability</title>
            <p>The sequences of the following plasmids were deposited in GenBank.
                <sup>

                    <xref ref-type="bibr" rid="ref70">70</xref>
</sup>
            </p>
            <p>

                <bold>pAA</bold>

                <sub>

                    <bold>P433</bold>
</sub>
            </p>
            <p>GenBank. plasmid_pAA_P433. Accession number 
                <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/nuccore/PP261911">PP261911</ext-link>.</p>
            <p>

                <bold>pAA</bold>

                <sub>

                    <bold>P433</bold>
</sub>
                <bold>-&#x0394;</bold>

                <italic toggle="yes">

                    <bold>sepA</bold>
</italic>
            </p>
            <p>GenBank. _plasmid_pAA_P433_delta-
                <italic toggle="yes">sepA</italic>::
                <italic toggle="yes">cat.</italic> Accession number 
                <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/nuccore/PP261912">PP261912</ext-link>
            </p>
            <p>

                <bold>pAA</bold>

                <sub>

                    <bold>K261</bold>
</sub>
            </p>
            <p>GenBank. plasmid_pAA_K261_virulence_plasmid. Accession number 
                <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/nuccore/PP261914">PP261914</ext-link>
            </p>
            <p>

                <bold>pAA</bold>

                <sub>

                    <bold>K261</bold>
</sub>
                <bold>-&#x0394;</bold>

                <italic toggle="yes">

                    <bold>sepA</bold>
</italic>
            </p>
            <p>GenBank. plasmid_pAA_K261_delta-
                <italic toggle="yes">sepA</italic>::
                <italic toggle="yes">cat.</italic> Accession number 
                <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/nuccore/PP261915">PP261915</ext-link>
            </p>
            <p>

                <bold>pAA</bold>

                <sub>

                    <bold>K411</bold>
</sub>
                <bold>-revertant</bold>
            </p>
            <p>GenBank. _plasmid_pAA_K411-revertant. Accession number 
                <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/nuccore/PP261916">PP261916</ext-link>
            </p>
            <p>

                <bold>A second plasmid from K261 (</bold>

                <italic toggle="yes">

                    <bold>aggR-negative
</bold>
</italic>

                <bold>)</bold>
            </p>
            <p>GenBank. K261_
                <italic toggle="yes">tra</italic>
_plasmid_EAEC_not_pAA. Accession number 
                <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/nuccore/PP261913">PP261913</ext-link>
            </p>
            <p>The other underlying data and raw uncropped images have been deposited in a Figshare collection.
                <sup>

                    <xref ref-type="bibr" rid="ref71">71</xref>
</sup>
            </p>
            <p>

                <bold>The numerical data for graphs</bold>
            </p>
            <p>DOI: 
                <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.25551933.v1">10.6084/m9.figshare.25551933.v1</ext-link>

                <sup>

                    <xref ref-type="bibr" rid="ref76">76</xref>
</sup>
            </p>
            <p>

                <bold>
Figure 6, uncropped Western blot image</bold>
            </p>
            <p>DOI: 
                <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.25551936.v1">10.6084/m9.figshare.25551936.v1</ext-link>

                <sup>

                    <xref ref-type="bibr" rid="ref77">77</xref>
</sup>
            </p>
            <p>

                <bold>
Figure 7, all biofilm photos</bold>
            </p>
            <p>DOI: 
                <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.25551939.v1">10.6084/m9.figshare.25551939.v1</ext-link>

                <sup>

                    <xref ref-type="bibr" rid="ref78">78</xref>
</sup>
            </p>
            <p>

                <bold>
Figure 17, uncropped Western blot image</bold>
            </p>
            <p>DOI: 
                <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.25551930.v1">10.6084/m9.figshare.25551930.v1</ext-link>

                <sup>

                    <xref ref-type="bibr" rid="ref79">79</xref>
</sup>
            </p>
            <p>Data are available under the terms of the 
                <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution 4.0 International license</ext-link> (CC-BY 4.0).</p>
        </sec>
        <ack>
            <title>Acknowledgments</title>
            <p>We thank Nadia Boisen from Statens Serum Institut (K&#x00f8;benhavn, Denmark) for D5613 (C267-15) EAEC strain. We acknowledge Giselle Usc (Department of Microbiology and Immunology, Uniformed Services University) for doing growth curves and Mary R Brockett (Department of Microbiology and Immunology, Uniformed Services University) for help with growing biofilms on glass disks.</p>
            <p>The opinions and assertions expressed herein are those of the authors and do not reflect the official policy or position of the Uniformed Services University of the Health Sciences or the Department of Defense. References to non-Federal entities or products do not constitute or imply a Department of Defense or Uniformed Services University of the Health Sciences endorsement. The opinions and assertions expressed herein are those of the authors and do not reflect the official policy or position of the Henry M. Jackson Foundation for the Advancement of Military Medicine, Inc. Neither the authors nor any family members have a financial interest in any commercial product, service, or organization providing financial support for this research.</p>
        </ack>
        <ref-list>
            <title>References</title>
            <ref id="ref1">
                <label>1</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hebbelstrup Jensen</surname>
                            <given-names>B</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Olsen</surname>
                            <given-names>KEP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Struve</surname>
                            <given-names>C</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Epidemiology and clinical manifestations of enteroaggregative 
                        <italic toggle="yes">Escherichia coli.</italic>
                    </article-title>
                    <source>

                        <italic toggle="yes">Clin. Microbiol. Rev.</italic>
</source>
                    <year>2014</year>;<volume>27</volume>:<fpage>614</fpage>&#x2013;<lpage>630</lpage>.
                    <pub-id pub-id-type="pmid">24982324</pub-id>
                    <pub-id pub-id-type="doi">10.1128/CMR.00112-13</pub-id>
                    <pub-id pub-id-type="pmcid">PMC4135892</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref2">
                <label>2</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Flores</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Okhuysen</surname>
                            <given-names>PC</given-names>
                        </name>
</person-group>:
                    <article-title>Enteroaggregative 
                        <italic toggle="yes">Escherichia coli</italic> infection.</article-title>
                    <source>

                        <italic toggle="yes">Curr. Opin. Gastroenterol.</italic>
</source>
                    <year>2009</year>;<volume>25</volume>:<fpage>8</fpage>&#x2013;<lpage>11</lpage>.
                    <pub-id pub-id-type="doi">10.1097/MOG.0b013e32831dac5e</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref3">
                <label>3</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ikumapayi</surname>
                            <given-names>UN</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Boisen</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hossain</surname>
                            <given-names>MJ</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Identification of subsets of enteroaggregative 
                        <italic toggle="yes">Escherichia coli</italic> associated with diarrheal disease among under 5 years of age children from rural Gambia.</article-title>
                    <source>

                        <italic toggle="yes">Am. J. Trop. Med. Hyg.</italic>
</source>
                    <year>2017</year>;<volume>97</volume>:<fpage>997</fpage>&#x2013;<lpage>1004</lpage>.
                    <pub-id pub-id-type="pmid">28820687</pub-id>
                    <pub-id pub-id-type="doi">10.4269/ajtmh.16-0705</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5637583</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref4">
                <label>4</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hebbelstrup Jensen</surname>
                            <given-names>B</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Stensvold</surname>
                            <given-names>CR</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Struve</surname>
                            <given-names>C</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Enteroaggregative 
                        <italic toggle="yes">Escherichia coli</italic> in daycare-a 1-year dynamic cohort study.</article-title>
                    <source>

                        <italic toggle="yes">Front. Cell. Infect. Microbiol.</italic>
</source>
                    <year>2016</year>;<volume>6</volume>:<fpage>75</fpage>.</mixed-citation>
            </ref>
            <ref id="ref5">
                <label>5</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Llorente</surname>
                            <given-names>MT</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Escudero</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ramiro</surname>
                            <given-names>R</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Enteroaggregative 
                        <italic toggle="yes">Escherichia coli</italic> as etiological agent of endemic diarrhea in Spain: A prospective multicenter prevalence study with molecular characterization of isolates.</article-title>
                    <source>

                        <italic toggle="yes">Front. Microbiol.</italic>
</source>
                    <year>2023</year>;<volume>14</volume>:<fpage>1120285</fpage>.
                    <pub-id pub-id-type="pmid">37065134</pub-id>
                    <pub-id pub-id-type="doi">10.3389/fmicb.2023.1120285</pub-id>
                    <pub-id pub-id-type="pmcid">PMC10100739</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref6">
                <label>6</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Modgil</surname>
                            <given-names>V</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Chaudhary</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bharti</surname>
                            <given-names>B</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Prevalence, virulence gene profiling, and characterization of enteroaggregative 
                        <italic toggle="yes">Escherichia coli</italic> from children with acute diarrhea, asymptomatic nourished, and malnourished children younger than 5 years of age in India.</article-title>
                    <source>

                        <italic toggle="yes">J. Pediatr.</italic>
</source>
                    <year>2021</year>;<volume>234</volume>:<fpage>106</fpage>&#x2013;<lpage>114.e5</lpage>.
                    <pub-id pub-id-type="pmid">33713662</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.jpeds.2021.03.010</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref7">
                <label>7</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Guiral</surname>
                            <given-names>E</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Quiles</surname>
                            <given-names>MG</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mu&#x00f1;oz</surname>
                            <given-names>L</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Emergence of resistance to quinolones and beta-lactam antibiotics in enteroaggregative and enterotoxigenic 
                        <italic toggle="yes">Escherichia coli</italic> causing traveler&#x2019;s diarrhea.</article-title>
                    <source>

                        <italic toggle="yes">Antimicrob. Agents Chemother.</italic>
</source>
                    <year>2019</year>;<volume>63</volume>.
                    <pub-id pub-id-type="pmid">30478165</pub-id>
                    <pub-id pub-id-type="doi">10.1128/AAC.01745-18</pub-id>
                    <pub-id pub-id-type="pmcid">PMC6355616</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref8">
                <label>8</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Walters</surname>
                            <given-names>WA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Reyes</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Soto</surname>
                            <given-names>GM</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Epidemiology and associated microbiota changes in deployed military personnel at high risk of traveler&#x2019;s diarrhea.</article-title>
                    <source>

                        <italic toggle="yes">PLoS One.</italic>
</source>
                    <year>2020</year>;<volume>15</volume>:<fpage>e0236703</fpage>.
                    <pub-id pub-id-type="pmid">32785284</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0236703</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7423091</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref9">
                <label>9</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Porter</surname>
                            <given-names>CK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Olson</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hall</surname>
                            <given-names>A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Travelers&#x2019; diarrhea: An update on the incidence, etiology, and risk in military deployments and similar travel populations.</article-title>
                    <source>

                        <italic toggle="yes">Mil. Med.</italic>
</source>
                    <year>2017</year>;<volume>182</volume>:<fpage>4</fpage>&#x2013;<lpage>10</lpage>.
                    <pub-id pub-id-type="pmid">28885918</pub-id>
                    <pub-id pub-id-type="doi">10.7205/MILMED-D-17-00064</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref10">
                <label>10</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Adachi</surname>
                            <given-names>JA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jiang</surname>
                            <given-names>Z</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mathewson</surname>
                            <given-names>JJ</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Enteroaggregative 
                        <italic toggle="yes">Escherichia coli</italic> as a major etiologic agent in traveler&#x2019;s diarrhea in 3 regions of the world.</article-title>
                    <source>

                        <italic toggle="yes">Clin. Infect. Dis.</italic>
</source>
                    <year>2001</year>;<volume>32</volume>:<fpage>1706</fpage>&#x2013;<lpage>1709</lpage>.
                    <pub-id pub-id-type="pmid">11360211</pub-id>
                    <pub-id pub-id-type="doi">10.1086/320756</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref11">
                <label>11</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Thapar</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sanderson</surname>
                            <given-names>IR</given-names>
                        </name>
</person-group>:
                    <article-title>Diarrhoea in children: An interface between developing and developed countries.</article-title>
                    <source>

                        <italic toggle="yes">Lancet.</italic>
</source>
                    <year>2004</year>;<volume>363</volume>:<fpage>641</fpage>&#x2013;<lpage>653</lpage>.
                    <pub-id pub-id-type="pmid">14987892</pub-id>
                    <pub-id pub-id-type="doi">10.1016/S0140-6736(04)15599-2</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref12">
                <label>12</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Lima</surname>
                            <given-names>IFN</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Boisen</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Silva</surname>
                            <given-names>JQ</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Prevalence of enteroaggregative 
                        <italic toggle="yes">Escherichia coli</italic> and its virulence-related genes in a case&#x2013;control study among children from north-eastern Brazil.</article-title>
                    <source>

                        <italic toggle="yes">J. Med. Microbiol.</italic>
</source>
                    <year>2013</year>;<volume>62</volume>:<fpage>683</fpage>&#x2013;<lpage>693</lpage>.
                    <pub-id pub-id-type="pmid">23429698</pub-id>
                    <pub-id pub-id-type="doi">10.1099/jmm.0.054262-0</pub-id>
                    <pub-id pub-id-type="pmcid">PMC3709657</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref13">
                <label>13</label>
                <mixed-citation publication-type="book">
                    <collab>UNICEF</collab>:
                    <source>

                        <italic toggle="yes">One is too many: Ending child deaths from pneumonia and diarrhoea.</italic>
</source>
                    <person-group person-group-type="editor">

                        <name name-style="western">
                            <surname>Mouzou</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Carvajal-V&#x00e9;lez</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tarekegn</surname>
                            <given-names>H</given-names>
                        </name>

                        <etal/>
</person-group>, editors.
                    <publisher-loc>New York, NY</publisher-loc>:
                    <publisher-name>UNICEF</publisher-name>;<year>2019</year>.</mixed-citation>
            </ref>
            <ref id="ref14">
                <label>14</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Monteville</surname>
                            <given-names>MR</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Riddle</surname>
                            <given-names>MS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Baht</surname>
                            <given-names>U</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Incidence, etiology, and impact of diarrhea among deployed US military personnel in support of operation Iraqi Freedom and operation Enduring Freedom.</article-title>
                    <source>

                        <italic toggle="yes">Am. J. Trop. Med. Hyg.</italic>
</source>
                    <year>2006</year>;<volume>75</volume>:<fpage>762</fpage>&#x2013;<lpage>767</lpage>.
                    <pub-id pub-id-type="pmid">17038708</pub-id>
                    <pub-id pub-id-type="doi">10.4269/ajtmh.2006.75.762</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref15">
                <label>15</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sebeny</surname>
                            <given-names>PJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Nakhla</surname>
                            <given-names>I</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Moustafa</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Hotel clinic-based diarrheal and respiratory disease surveillance in us service members participating in Operation Bright Star in Egypt, 2009.</article-title>
                    <source>

                        <italic toggle="yes">Am. J. Trop. Med. Hyg.</italic>
</source>
                    <year>2012</year>;<volume>87</volume>:<fpage>312</fpage>&#x2013;<lpage>318</lpage>.
                    <pub-id pub-id-type="pmid">22855764</pub-id>
                    <pub-id pub-id-type="doi">10.4269/ajtmh.2012.11-0318</pub-id>
                    <pub-id pub-id-type="pmcid">PMC3414570</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref16">
                <label>16</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Connor</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Porter</surname>
                            <given-names>CK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Swierczewski</surname>
                            <given-names>B</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Diarrhoea during military deployment: Current concepts and future directions.</article-title>
                    <source>

                        <italic toggle="yes">Curr. Opin. Infect. Dis.</italic>
</source>
                    <year>2012</year>;<volume>25</volume>:<fpage>546</fpage>&#x2013;<lpage>554</lpage>.
                    <pub-id pub-id-type="doi">10.1097/QCO.0b013e3283582ebc</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref17">
                <label>17</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Vial</surname>
                            <given-names>PA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Robins-Browne</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lior</surname>
                            <given-names>H</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Characterization of enteroadherent-aggregative 
                        <italic toggle="yes">Escherichia coli</italic>, a putative agent of diarrheal disease.</article-title>
                    <source>

                        <italic toggle="yes">J. Infect. Dis.</italic>
</source>
                    <year>1988</year>;<volume>158</volume>:<fpage>70</fpage>&#x2013;<lpage>79</lpage>.
                    <pub-id pub-id-type="pmid">2899125</pub-id>
                    <pub-id pub-id-type="doi">10.1093/infdis/158.1.70</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref18">
                <label>18</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Nataro</surname>
                            <given-names>JP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hicks</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Phillips</surname>
                            <given-names>AD</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>T84 cells in culture as a model for enteroaggregative 
                        <italic toggle="yes">Escherichia coli</italic> pathogenesis.</article-title>
                    <source>

                        <italic toggle="yes">Infect. Immun.</italic>
</source>
                    <year>1996</year>;<volume>64</volume>:<fpage>4761</fpage>&#x2013;<lpage>4768</lpage>.
                    <pub-id pub-id-type="pmid">8890237</pub-id>
                    <pub-id pub-id-type="doi">10.1128/iai.64.11.4761-4768.1996</pub-id>
                    <pub-id pub-id-type="pmcid">PMC174443</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref19">
                <label>19</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Nataro</surname>
                            <given-names>JP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Steiner</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Guerrant</surname>
                            <given-names>RL</given-names>
                        </name>
</person-group>:
                    <article-title>Enteroaggregative 
                        <italic toggle="yes">Escherichia coli.</italic>
                    </article-title>
                    <source>

                        <italic toggle="yes">Emerg. Infect. Dis.</italic>
</source>
                    <year>1998</year>;<volume>4</volume>:<fpage>251</fpage>&#x2013;<lpage>261</lpage>.
                    <pub-id pub-id-type="pmid">9621195</pub-id>
                    <pub-id pub-id-type="doi">10.3201/eid0402.980212</pub-id>
                    <pub-id pub-id-type="pmcid">PMC2640136</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref20">
                <label>20</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Tzipori</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Montanaro</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Robins-Browne</surname>
                            <given-names>RM</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Studies with enteroaggregative 
                        <italic toggle="yes">Escherichia coli</italic> in the gnotobiotic piglet gastroenteritis model.</article-title>
                    <source>

                        <italic toggle="yes">Infect. Immun.</italic>
</source>
                    <year>1992</year>;<volume>60</volume>:<fpage>5302</fpage>&#x2013;<lpage>5306</lpage>.
                    <pub-id pub-id-type="pmid">1452364</pub-id>
                    <pub-id pub-id-type="doi">10.1128/iai.60.12.5302-5306.1992</pub-id>
                    <pub-id pub-id-type="pmcid">PMC258311</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref21">
                <label>21</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Nataro</surname>
                            <given-names>JP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kaper</surname>
                            <given-names>JB</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Robins-Browne</surname>
                            <given-names>R</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Patterns of adherence of diarrheagenic 
                        <italic toggle="yes">Escherichia coli</italic> to HEp-2 cells.</article-title>
                    <source>

                        <italic toggle="yes">Pediatr. Infect. Dis. J.</italic>
</source>
                    <year>1987</year>;<volume>6</volume>:<fpage>829</fpage>&#x2013;<lpage>831</lpage>.
                    <pub-id pub-id-type="pmid">3313248</pub-id>
                    <pub-id pub-id-type="doi">10.1097/00006454-198709000-00008</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref22">
                <label>22</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Freire</surname>
                            <given-names>CA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rodrigues</surname>
                            <given-names>BO</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Elias</surname>
                            <given-names>WP</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Adhesin related genes as potential markers for the enteroaggregative 
                        <italic toggle="yes">Escherichia coli</italic> category.</article-title>
                    <source>

                        <italic toggle="yes">Front. Cell. Infect. Microbiol.</italic>
</source>
                    <year>2022</year>;<volume>12</volume>:<fpage>997208</fpage>.
                    <pub-id pub-id-type="pmid">36425788</pub-id>
                    <pub-id pub-id-type="doi">10.3389/fcimb.2022.997208</pub-id>
                    <pub-id pub-id-type="pmcid">PMC9679366</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref23">
                <label>23</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>J&#x00f8;nsson</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Struve</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Boll</surname>
                            <given-names>EJ</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>A novel pAA virulence plasmid encoding toxins and two distinct variants of the fimbriae of enteroaggregative 
                        <italic toggle="yes">Escherichia coli.</italic>
                    </article-title>
                    <source>

                        <italic toggle="yes">Front. Microbiol.</italic>
</source>
                    <year>2017</year>;<volume>8</volume>:<fpage>263</fpage>.</mixed-citation>
            </ref>
            <ref id="ref24">
                <label>24</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hebbelstrup Jensen</surname>
                            <given-names>B</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Poulsen</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hebbelstrup Rye Rasmussen</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Genetic virulence profile of enteroaggregative 
                        <italic toggle="yes">Escherichia coli</italic> strains isolated from Danish children with either acute or persistent diarrhea.</article-title>
                    <source>

                        <italic toggle="yes">Front. Cell. Infect. Microbiol.</italic>
</source>
                    <year>2017</year>;<volume>7</volume>:<fpage>230</fpage>.
                    <pub-id pub-id-type="pmid">28611957</pub-id>
                    <pub-id pub-id-type="doi">10.3389/fcimb.2017.00230</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5447714</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref25">
                <label>25</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ruiz-Perez</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Nataro</surname>
                            <given-names>JP</given-names>
                        </name>
</person-group>:
                    <article-title>Bacterial serine proteases secreted by the autotransporter pathway: Classification, specificity, and role in virulence.</article-title>
                    <source>

                        <italic toggle="yes">Cell. Mol. Life Sci.</italic>
</source>
                    <year>2014</year>;<volume>71</volume>:<fpage>745</fpage>&#x2013;<lpage>770</lpage>.
                    <pub-id pub-id-type="pmid">23689588</pub-id>
                    <pub-id pub-id-type="doi">10.1007/s00018-013-1355-8</pub-id>
                    <pub-id pub-id-type="pmcid">PMC3871983</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref26">
                <label>26</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Boisen</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Scheutz</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rasko</surname>
                            <given-names>DA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Genomic characterization of enteroaggregative 
                        <italic toggle="yes">Escherichia coli</italic> from children in Mali.</article-title>
                    <source>

                        <italic toggle="yes">J. Infect. Dis.</italic>
</source>
                    <year>2012</year>;<volume>205</volume>:<fpage>431</fpage>&#x2013;<lpage>444</lpage>.
                    <pub-id pub-id-type="pmid">22184729</pub-id>
                    <pub-id pub-id-type="doi">10.1093/infdis/jir757</pub-id>
                    <pub-id pub-id-type="pmcid">PMC3256949</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref27">
                <label>27</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Boisen</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ruiz-Perez</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Scheutz</surname>
                            <given-names>F</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Short report: High prevalence of serine protease autotransporter cytotoxins among strains of enteroaggregative 
                        <italic toggle="yes">Escherichia coli.</italic>
                    </article-title>
                    <source>

                        <italic toggle="yes">Am. J. Trop. Med. Hyg.</italic>
</source>
                    <year>2009</year>;<volume>80</volume>:<fpage>294</fpage>&#x2013;<lpage>301</lpage>.
                    <pub-id pub-id-type="pmid">19190229</pub-id>
                    <pub-id pub-id-type="doi">10.4269/ajtmh.2009.80.294</pub-id>
                    <pub-id pub-id-type="pmcid">PMC2660206</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref28">
                <label>28</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Petro</surname>
                            <given-names>CD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Duncan</surname>
                            <given-names>JK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Seldina</surname>
                            <given-names>YI</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Genetic and virulence profiles of enteroaggregative 
                        <italic toggle="yes">Escherichia coli</italic> (EAEC) isolated from deployed military personnel (DMP) with travelers&#x2019; diarrhea.</article-title>
                    <source>

                        <italic toggle="yes">Front. Cell. Infect. Microbiol.</italic>
</source>
                    <year>2020</year>;<volume>10</volume>:<fpage>200</fpage>.
                    <pub-id pub-id-type="pmid">32509590</pub-id>
                    <pub-id pub-id-type="doi">10.3389/fcimb.2020.00200</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7251025</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref29">
                <label>29</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Boisen</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>&#x00d8;sterlund</surname>
                            <given-names>MT</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Joensen</surname>
                            <given-names>KG</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Redefining enteroaggregative 
                        <italic toggle="yes">Escherichia coli</italic> (EAEC): Genomic characterization of epidemiological EAEC strains.</article-title>
                    <source>

                        <italic toggle="yes">PLoS Negl. Trop. Dis.</italic>
</source>
                    <year>2020</year>;<volume>14</volume>:<fpage>e0008613</fpage>.
                    <pub-id pub-id-type="pmid">32898134</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pntd.0008613</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7500659</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref30">
                <label>30</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Restieri</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Garriss</surname>
                            <given-names>G</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Locas</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Autotransporter-encoding sequences are phylogenetically distributed among 
                        <italic toggle="yes">Escherichia coli</italic> clinical isolates and reference strains.</article-title>
                    <source>

                        <italic toggle="yes">Appl. Environ. Microbiol.</italic>
</source>
                    <year>2007</year>;<volume>73</volume>:<fpage>1553</fpage>&#x2013;<lpage>1562</lpage>.
                    <pub-id pub-id-type="pmid">17220264</pub-id>
                    <pub-id pub-id-type="doi">10.1128/AEM.01542-06</pub-id>
                    <pub-id pub-id-type="pmcid">PMC1828755</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref31">
                <label>31</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Oralak</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ladaporn</surname>
                            <given-names>B</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Panida</surname>
                            <given-names>N</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Distribution and molecular characterization of enteroaggregative 
                        <italic toggle="yes">Escherichia coli</italic> isolated from children in a case-control study of acute diarrhea in Thailand.</article-title>
                    <source>

                        <italic toggle="yes">Clin Microbio.</italic>
</source>
                    <year>2017</year>;<volume>6</volume>:<fpage>297</fpage>.</mixed-citation>
            </ref>
            <ref id="ref32">
                <label>32</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Nezarieh</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Shakibaie</surname>
                            <given-names>MR</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hosseini Nave</surname>
                            <given-names>H</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Distribution of virulence genes, enterotoxin and biofilm formation among enteroaggregative 
                        <italic toggle="yes">Escherichia coli</italic> (EAEC) strains isolated from stools of children with diarrhea in South East Iran.</article-title>
                    <source>

                        <italic toggle="yes">Arch. Pediatr. Infect. Dis.</italic>
</source>
                    <year>2015</year>;<volume>3</volume>:<fpage>e29745</fpage>.
                    <pub-id pub-id-type="doi">10.5812/pedinfect.29745v2</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref33">
                <label>33</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Nagy</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Xu</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bauchan</surname>
                            <given-names>GR</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Aggregative adherence fimbriae I (AAF/I) mediate colonization of fresh produce and abiotic surface by Shiga toxigenic enteroaggregative 
                        <italic toggle="yes">Escherichia coli</italic> O104:H4.</article-title>
                    <source>

                        <italic toggle="yes">Int. J. Food Microbiol.</italic>
</source>
                    <year>2016</year>;<volume>229</volume>:<fpage>44</fpage>&#x2013;<lpage>51</lpage>.
                    <pub-id pub-id-type="pmid">27099984</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.ijfoodmicro.2016.04.007</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref34">
                <label>34</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Schiller</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kn&#x00f6;dler</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Berger</surname>
                            <given-names>P</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The superior adherence phenotype of 
                        <italic toggle="yes">E. coli</italic> O104:H4 is directly mediated by the aggregative adherence fimbriae type I.</article-title>
                    <source>

                        <italic toggle="yes">Virulence.</italic>
</source>
                    <year>2021</year>;<volume>12</volume>:<fpage>346</fpage>&#x2013;<lpage>359</lpage>.
                    <pub-id pub-id-type="pmid">33356871</pub-id>
                    <pub-id pub-id-type="doi">10.1080/21505594.2020.1868841</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7834096</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref35">
                <label>35</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Boisen</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Struve</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Scheutz</surname>
                            <given-names>F</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>New adhesin of enteroaggregative 
                        <italic toggle="yes">Escherichia coli</italic> related to the Afa/Dr/AAF family.</article-title>
                    <source>

                        <italic toggle="yes">Infect. Immun.</italic>
</source>
                    <year>2008</year>;<volume>76</volume>:<fpage>3281</fpage>&#x2013;<lpage>3292</lpage>.
                    <pub-id pub-id-type="pmid">18443096</pub-id>
                    <pub-id pub-id-type="doi">10.1128/IAI.01646-07</pub-id>
                    <pub-id pub-id-type="pmcid">PMC2446688</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref36">
                <label>36</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>J&#x00f8;nsson</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Struve</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Boisen</surname>
                            <given-names>N</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Novel aggregative adherence fimbria variant of enteroaggregative 
                        <italic toggle="yes">Escherichia coli.</italic>
                    </article-title>
                    <source>

                        <italic toggle="yes">Infect. Immun.</italic>
</source>
                    <year>2015</year>;<volume>83</volume>:<fpage>1396</fpage>&#x2013;<lpage>1405</lpage>.
                    <pub-id pub-id-type="pmid">25624357</pub-id>
                    <pub-id pub-id-type="doi">10.1128/IAI.02820-14</pub-id>
                    <pub-id pub-id-type="pmcid">PMC4363450</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref37">
                <label>37</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Berry</surname>
                            <given-names>AA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yang</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Pakharukova</surname>
                            <given-names>N</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Structural insight into host recognition by aggregative adherence fimbriae of enteroaggregative 
                        <italic toggle="yes">Escherichia coli.</italic>
                    </article-title>
                    <source>

                        <italic toggle="yes">PLoS Pathog.</italic>
</source>
                    <year>2014</year>;<volume>10</volume>:<fpage>e1004404</fpage>.
                    <pub-id pub-id-type="pmid">25232738</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.ppat.1004404</pub-id>
                    <pub-id pub-id-type="pmcid">PMC4169507</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref38">
                <label>38</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ayala-Lujan</surname>
                            <given-names>JL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Vijayakumar</surname>
                            <given-names>V</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Gong</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Broad spectrum activity of a lectin-like bacterial serine protease family on human leukocytes.</article-title>
                    <source>

                        <italic toggle="yes">PLoS One.</italic>
</source>
                    <year>2014</year>;<volume>9</volume>:<fpage>e107920</fpage>.
                    <pub-id pub-id-type="pmid">25251283</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0107920</pub-id>
                    <pub-id pub-id-type="pmcid">PMC4176022</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref39">
                <label>39</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Benjelloun-Touimi</surname>
                            <given-names>Z</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sansonetti</surname>
                            <given-names>PJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Parsot</surname>
                            <given-names>C</given-names>
                        </name>
</person-group>:
                    <article-title>SepA, the major extracellular protein of 
                        <italic toggle="yes">Shigella flexneri</italic>: Autonomous secretion and involvement in tissue invasion.</article-title>
                    <source>

                        <italic toggle="yes">Mol. Microbiol.</italic>
</source>
                    <year>1995</year>;<volume>17</volume>:<fpage>123</fpage>&#x2013;<lpage>135</lpage>.
                    <pub-id pub-id-type="pmid">7476198</pub-id>
                    <pub-id pub-id-type="doi">10.1111/j.1365-2958.1995.mmi_17010123.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref40">
                <label>40</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Riddle</surname>
                            <given-names>MS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Connor</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Fraser</surname>
                            <given-names>J</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Trial evaluating ambulatory therapy of travelers&#x2019; diarrhea (TrEAT TD) study: A randomized controlled trial comparing 3 single-dose antibiotic regimens with loperamide.</article-title>
                    <source>

                        <italic toggle="yes">Clin. Infect. Dis.</italic>
</source>
                    <year>2017</year>;<volume>65</volume>:<fpage>2008</fpage>&#x2013;<lpage>2017</lpage>.
                    <pub-id pub-id-type="pmid">29029033</pub-id>
                    <pub-id pub-id-type="doi">10.1093/cid/cix693</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5848251</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref41">
                <label>41</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>DuPont</surname>
                            <given-names>HL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Formal</surname>
                            <given-names>SB</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hornick</surname>
                            <given-names>RB</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Pathogenesis of 
                        <italic toggle="yes">Escherichia coli</italic> diarrhea.</article-title>
                    <source>

                        <italic toggle="yes">N. Engl. J. Med.</italic>
</source>
                    <year>1971</year>;<volume>285</volume>:<fpage>1</fpage>&#x2013;<lpage>9</lpage>.
                    <pub-id pub-id-type="pmid">4996788</pub-id>
                    <pub-id pub-id-type="doi">10.1056/NEJM197107012850101</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref42">
                <label>42</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Levine</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Nalin</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hornick</surname>
                            <given-names>R</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>
                        <italic toggle="yes">Escherichia coli</italic> strains that cause diarrh&#x0153;a but do not produce heat-labile or heat-stable enterotoxins and are non-invasive.</article-title>
                    <source>

                        <italic toggle="yes">Lancet.</italic>
</source>
                    <year>1978</year>;<volume>311</volume>:<fpage>1119</fpage>&#x2013;<lpage>1122</lpage>.
                    <pub-id pub-id-type="pmid">77415</pub-id>
                    <pub-id pub-id-type="doi">10.1016/S0140-6736(78)90299-4</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref43">
                <label>43</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Boisen</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Melton-Celsa</surname>
                            <given-names>AR</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hansen</surname>
                            <given-names>AM</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The role of the AggR regulon in the virulence of the Shiga toxin-producing enteroaggregative 
                        <italic toggle="yes">Escherichia coli</italic> epidemic O104:H4 strain in mice.</article-title>
                    <source>

                        <italic toggle="yes">Front. Microbiol.</italic>
</source>
                    <year>2019</year>;<volume>10</volume>:<fpage>1824</fpage>.
                    <pub-id pub-id-type="pmid">31456767</pub-id>
                    <pub-id pub-id-type="doi">10.3389/fmicb.2019.01824</pub-id>
                    <pub-id pub-id-type="pmcid">PMC6700298</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref44">
                <label>44</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Morin</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Santiago</surname>
                            <given-names>AE</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ernst</surname>
                            <given-names>RK</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Characterization of the AggR regulon in enteroaggregative 
                        <italic toggle="yes">Escherichia coli.</italic>
                    </article-title>
                    <source>

                        <italic toggle="yes">Infect. Immun.</italic>
</source>
                    <year>2013</year>;<volume>81</volume>:<fpage>122</fpage>&#x2013;<lpage>132</lpage>.
                    <pub-id pub-id-type="pmid">23090962</pub-id>
                    <pub-id pub-id-type="doi">10.1128/IAI.00676-12</pub-id>
                    <pub-id pub-id-type="pmcid">PMC3536136</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref45">
                <label>45</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Morin</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tirling</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ivison</surname>
                            <given-names>SM</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Autoactivation of the AggR regulator of enteroaggregative 
                        <italic toggle="yes">Escherichia coli in vitro</italic> and 
                        <italic toggle="yes">in vivo.</italic>
                    </article-title>
                    <source>

                        <italic toggle="yes">FEMS Immunol. Med. Microbiol.</italic>
</source>
                    <year>2010</year>;<volume>58</volume>:<fpage>344</fpage>&#x2013;<lpage>355</lpage>.
                    <pub-id pub-id-type="pmid">20132305</pub-id>
                    <pub-id pub-id-type="doi">10.1111/j.1574-695X.2009.00645.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref46">
                <label>46</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Nataro</surname>
                            <given-names>JP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yikang</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yingkang</surname>
                            <given-names>D</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>AggR, a transcriptional activator of aggregative adherence fimbria I expression in enteroaggregative 
                        <italic toggle="yes">Escherichia coli.</italic>
                    </article-title>
                    <source>

                        <italic toggle="yes">J. Bacteriol.</italic>
</source>
                    <year>1994</year>;<volume>176</volume>:<fpage>4691</fpage>&#x2013;<lpage>4699</lpage>.
                    <pub-id pub-id-type="pmid">7913930</pub-id>
                    <pub-id pub-id-type="doi">10.1128/jb.176.15.4691-4699.1994</pub-id>
                    <pub-id pub-id-type="pmcid">PMC196291</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref47">
                <label>47</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Datsenko</surname>
                            <given-names>KA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wanner</surname>
                            <given-names>BL</given-names>
                        </name>
</person-group>:
                    <article-title>One-step inactivation of chromosomal genes in 
                        <italic toggle="yes">Escherichia coli</italic> K-12 using PCR products.</article-title>
                    <source>

                        <italic toggle="yes">PNAS.</italic>
</source>
                    <year>2000</year>;<volume>97</volume>:<fpage>6640</fpage>&#x2013;<lpage>6645</lpage>.
                    <pub-id pub-id-type="pmid">10829079</pub-id>
                    <pub-id pub-id-type="doi">10.1073/pnas.120163297</pub-id>
                    <pub-id pub-id-type="pmcid">PMC18686</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref48">
                <label>48</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Tyler</surname>
                            <given-names>JS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Beeri</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Reynolds</surname>
                            <given-names>JL</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Prophage induction is enhanced and required for renal disease and lethality in an ehec mouse model.</article-title>
                    <source>

                        <italic toggle="yes">PLoS Pathog.</italic>
</source>
                    <year>2013</year>;<volume>9</volume>:<fpage>e1003236</fpage>.
                    <pub-id pub-id-type="pmid">23555250</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.ppat.1003236</pub-id>
                    <pub-id pub-id-type="pmcid">PMC3610611</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref49">
                <label>49</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Murphy</surname>
                            <given-names>KC</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Campellone</surname>
                            <given-names>KG</given-names>
                        </name>
</person-group>:
                    <article-title>Lambda red-mediated recombinogenic engineering of enterohemorrhagic and enteropathogenic 
                        <italic toggle="yes">E. coli.</italic>
                    </article-title>
                    <source>

                        <italic toggle="yes">BMC Mol. Biol.</italic>
</source>
                    <year>2003</year>;<volume>4</volume>:<fpage>11</fpage>.
                    <pub-id pub-id-type="pmid">14672541</pub-id>
                    <pub-id pub-id-type="doi">10.1186/1471-2199-4-11</pub-id>
                    <pub-id pub-id-type="pmcid">PMC317293</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref50">
                <label>50</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Wood</surname>
                            <given-names>WN</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Smith</surname>
                            <given-names>KD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ream</surname>
                            <given-names>JA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Enhancing yields of low and single copy number plasmid DNAs from 
                        <italic toggle="yes">Escherichia coli</italic> cells.</article-title>
                    <source>

                        <italic toggle="yes">J. Microbiol. Methods.</italic>
</source>
                    <year>2017</year>;<volume>133</volume>:<fpage>46</fpage>&#x2013;<lpage>51</lpage>.
                    <pub-id pub-id-type="pmid">28024984</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.mimet.2016.12.016</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5286560</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref51">
                <label>51</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Charbonneau</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Janvore</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mourez</surname>
                            <given-names>M</given-names>
                        </name>
</person-group>:
                    <article-title>Autoprocessing of the 
                        <italic toggle="yes">Escherichia coli</italic> AIDA-I autotransporter: A new mechanism involving acidic residues in the junction region.</article-title>
                    <source>

                        <italic toggle="yes">J. Biol. Chem.</italic>
</source>
                    <year>2009</year>;<volume>284</volume>:<fpage>17340</fpage>&#x2013;<lpage>17351</lpage>.
                    <pub-id pub-id-type="pmid">19398552</pub-id>
                    <pub-id pub-id-type="doi">10.1074/jbc.M109.010108</pub-id>
                    <pub-id pub-id-type="pmcid">PMC2719369</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref52">
                <label>52</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Scott-Tucker</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Cooper</surname>
                            <given-names>LM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Desvaux</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The unusual extended signal peptide region of the type V secretion system is phylogenetically restricted.</article-title>
                    <source>

                        <italic toggle="yes">FEMS Microbiol. Immunol.</italic>
</source>
                    <year>2006</year>;<volume>264</volume>:<fpage>22</fpage>&#x2013;<lpage>30</lpage>.</mixed-citation>
            </ref>
            <ref id="ref53">
                <label>53</label>
                <mixed-citation publication-type="book">
                    <collab>QIAGEN</collab>:
                    <source>

                        <italic toggle="yes">Protocol: Very low-copy plasmid/cosmid purification using Qiagen-tip 100 or Qiagen-tip 500.</italic>
</source>
                    <publisher-loc>Germantown, MD</publisher-loc>:
                    <publisher-name>QIAGEN Press</publisher-name>;<year>2023</year>;<fpage>40</fpage>&#x2013;<lpage>47</lpage>.
                    <ext-link ext-link-type="uri" xlink:href="https://www.qiagen.com/us/resources/download.aspx?id=0bd0c5fb-c271-43e7-af43-32d539374fa9&amp;lang=en">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref54">
                <label>54</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>H</given-names>
                        </name>
</person-group>:
                    <article-title>Minimap2: Pairwise alignment for nucleotide sequences.</article-title>
                    <source>

                        <italic toggle="yes">Bioinformatics.</italic>
</source>
                    <year>2018</year>;<volume>34</volume>:<fpage>3094</fpage>&#x2013;<lpage>3100</lpage>.
                    <pub-id pub-id-type="pmid">29750242</pub-id>
                    <pub-id pub-id-type="doi">10.1093/bioinformatics/bty191</pub-id>
                    <pub-id pub-id-type="pmcid">PMC6137996</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref55">
                <label>55</label>
                <mixed-citation publication-type="other">
                    <collab>Geneious Prime</collab>:
                    <article-title>v.2023.2.1 (Dotmatics: RRID:SCR_010519).</article-title>
                    <year>2024</year>.
                    <ext-link ext-link-type="uri" xlink:href="https://www.geneious.com">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref56">
                <label>56</label>
                <mixed-citation publication-type="other">
                    <collab>GraphPad Prism</collab>:
                    <article-title>v.10.0.3 (GraphPad Software: RRID:SCR_002798).</article-title>
                    <year>2024</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.graphpad.com">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref57">
                <label>57</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Berger</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kn&#x00f6;dler</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>F&#x00f6;rstner</surname>
                            <given-names>KU</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The primary transcriptome of the 
                        <italic toggle="yes">Escherichia coli</italic> O104:H4 pAA plasmid and novel insights into its virulence gene expression and regulation.</article-title>
                    <source>

                        <italic toggle="yes">Sci. Rep.</italic>
</source>
                    <year>2016</year>;<volume>6</volume>:<fpage>35307</fpage>.
                    <pub-id pub-id-type="pmid">27748404</pub-id>
                    <pub-id pub-id-type="doi">10.1038/srep35307</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5066232</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref58">
                <label>58</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Yasir</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Icke</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Abdelwahab</surname>
                            <given-names>R</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Organization and architecture of AggR-dependent promoters from enteroaggregative 
                        <italic toggle="yes">Escherichia coli.</italic>
                    </article-title>
                    <source>

                        <italic toggle="yes">Mol. Microbiol.</italic>
</source>
                    <year>2019</year>;<volume>111</volume>:<fpage>534</fpage>&#x2013;<lpage>551</lpage>.
                    <pub-id pub-id-type="pmid">30485564</pub-id>
                    <pub-id pub-id-type="doi">10.1111/mmi.14172</pub-id>
                    <pub-id pub-id-type="pmcid">PMC6392122</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref59">
                <label>59</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Yen</surname>
                            <given-names>YT</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tsang</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Cameron</surname>
                            <given-names>TA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Importance of conserved residues of the serine protease autotransporter beta-domain in passenger domain processing and beta-barrel assembly.</article-title>
                    <source>

                        <italic toggle="yes">Infect. Immun.</italic>
</source>
                    <year>2010</year>;<volume>78</volume>:<fpage>3516</fpage>&#x2013;<lpage>3528</lpage>.
                    <pub-id pub-id-type="pmid">20515934</pub-id>
                    <pub-id pub-id-type="doi">10.1128/IAI.00390-10</pub-id>
                    <pub-id pub-id-type="pmcid">PMC2916275</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref60">
                <label>60</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Yuan</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Johnson</surname>
                            <given-names>MD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zhang</surname>
                            <given-names>J</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Molecular basis for the folding of &#x03b2;-helical autotransporter passenger domains.</article-title>
                    <source>

                        <italic toggle="yes">Nat. Commun.</italic>
</source>
                    <year>2018</year>;<volume>9</volume>:<fpage>1395</fpage>.
                    <pub-id pub-id-type="pmid">29643377</pub-id>
                    <pub-id pub-id-type="doi">10.1038/s41467-018-03593-2</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5895577</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref61">
                <label>61</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Brockmeyer</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Spelten</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kuczius</surname>
                            <given-names>T</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Structure and function relationship of the autotransport and proteolytic activity of EspP from Shiga toxin-producing 
                        <italic toggle="yes">Escherichia coli.</italic>
                    </article-title>
                    <source>

                        <italic toggle="yes">PLoS One.</italic>
</source>
                    <year>2009</year>;<volume>4</volume>:<fpage>e6100</fpage>.
                    <pub-id pub-id-type="pmid">19568421</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0006100</pub-id>
                    <pub-id pub-id-type="pmcid">PMC2700255</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref62">
                <label>62</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kang&#x2019;ethe</surname>
                            <given-names>W</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bernstein</surname>
                            <given-names>HD</given-names>
                        </name>
</person-group>:
                    <article-title>Stepwise folding of an autotransporter passenger domain is not essential for its secretion.</article-title>
                    <source>

                        <italic toggle="yes">J. Biol. Chem.</italic>
</source>
                    <year>2013</year>;<volume>288</volume>:<fpage>35028</fpage>&#x2013;<lpage>35038</lpage>.
                    <pub-id pub-id-type="pmid">24165126</pub-id>
                    <pub-id pub-id-type="doi">10.1074/jbc.M113.515635</pub-id>
                    <pub-id pub-id-type="pmcid">PMC3853255</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref63">
                <label>63</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Alves</surname>
                            <given-names>JR</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Pereira</surname>
                            <given-names>ACM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Souza</surname>
                            <given-names>MC</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Iron-limited condition modulates biofilm formation and interaction with human epithelial cells of enteroaggregative 
                        <italic toggle="yes">Escherichia coli</italic> (EAEC).</article-title>
                    <source>

                        <italic toggle="yes">J. Appl. Microbiol.</italic>
</source>
                    <year>2010</year>;<volume>108</volume>:<fpage>246</fpage>&#x2013;<lpage>255</lpage>.
                    <pub-id pub-id-type="pmid">19566716</pub-id>
                    <pub-id pub-id-type="doi">10.1111/j.1365-2672.2009.04417.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref64">
                <label>64</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Goldman</surname>
                            <given-names>SR</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tu</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Goldberg</surname>
                            <given-names>MB</given-names>
                        </name>
</person-group>:
                    <article-title>Differential regulation by magnesium of the two MsbB paralogs of 
                        <italic toggle="yes">Shigella flexneri.</italic>
                    </article-title>
                    <source>

                        <italic toggle="yes">J. Bacteriol.</italic>
</source>
                    <year>2008</year>;<volume>190</volume>:<fpage>3526</fpage>&#x2013;<lpage>3537</lpage>.
                    <pub-id pub-id-type="pmid">18359815</pub-id>
                    <pub-id pub-id-type="doi">10.1128/JB.00151-08</pub-id>
                    <pub-id pub-id-type="pmcid">PMC2395013</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref65">
                <label>65</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Nishi</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sheikh</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mizuguchi</surname>
                            <given-names>K</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The export of coat protein from enteroaggregative 
                        <italic toggle="yes">Escherichia coli</italic> by a specific ATP-binding cassette transporter system.</article-title>
                    <source>

                        <italic toggle="yes">J. Biol. Chem.</italic>
</source>
                    <year>2003</year>;<volume>278</volume>:<fpage>45680</fpage>&#x2013;<lpage>45689</lpage>.
                    <pub-id pub-id-type="pmid">12933818</pub-id>
                    <pub-id pub-id-type="doi">10.1074/jbc.M306413200</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref66">
                <label>66</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Velarde</surname>
                            <given-names>JJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Varney</surname>
                            <given-names>KM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Inman</surname>
                            <given-names>KG</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Solution structure of the novel dispersin protein of enteroaggregative 
                        <italic toggle="yes">Escherichia coli.</italic>
                    </article-title>
                    <source>

                        <italic toggle="yes">Mol. Microbiol.</italic>
</source>
                    <year>2007</year>;<volume>66</volume>:<fpage>1123</fpage>&#x2013;<lpage>1135</lpage>.
                    <pub-id pub-id-type="pmid">17986189</pub-id>
                    <pub-id pub-id-type="doi">10.1111/j.1365-2958.2007.05985.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref67">
                <label>67</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Arenas</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Nijland</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rodriguez</surname>
                            <given-names>FJ</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Involvement of three meningococcal surface-exposed proteins, the heparin-binding protein NhbA, the &#x03b1;-peptide of IgA protease and the autotransporter protease NalP, in initiation of biofilm formation.</article-title>
                    <source>

                        <italic toggle="yes">Mol. Microbiol.</italic>
</source>
                    <year>2013</year>;<volume>87</volume>:<fpage>254</fpage>&#x2013;<lpage>268</lpage>.
                    <pub-id pub-id-type="pmid">23163582</pub-id>
                    <pub-id pub-id-type="doi">10.1111/mmi.12097</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref68">
                <label>68</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Dautin</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Barnard</surname>
                            <given-names>TJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Anderson</surname>
                            <given-names>DE</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Cleavage of a bacterial autotransporter by an evolutionarily convergent autocatalytic mechanism.</article-title>
                    <source>

                        <italic toggle="yes">EMBO J.</italic>
</source>
                    <year>2007</year>;<volume>26</volume>:<fpage>1942</fpage>&#x2013;<lpage>1952</lpage>.
                    <pub-id pub-id-type="pmid">17347646</pub-id>
                    <pub-id pub-id-type="doi">10.1038/sj.emboj.7601638</pub-id>
                    <pub-id pub-id-type="pmcid">PMC1847664</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref69">
                <label>69</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Dautin</surname>
                            <given-names>N</given-names>
                        </name>
</person-group>:
                    <article-title>Serine protease autotransporters of 
                        <italic toggle="yes">Enterobacteriaceae</italic> (SPATEs): Biogenesis and function.</article-title>
                    <source>

                        <italic toggle="yes">Toxins.</italic>
</source>
                    <year>2010</year>;<volume>2</volume>:<fpage>1179</fpage>&#x2013;<lpage>1206</lpage>.
                    <pub-id pub-id-type="pmid">22069633</pub-id>
                    <pub-id pub-id-type="doi">10.3390/toxins2061179</pub-id>
                    <pub-id pub-id-type="pmcid">PMC3153244</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref70">
                <label>70</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Clark</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Karsch-Mizrachi</surname>
                            <given-names>I</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lipman</surname>
                            <given-names>DJ</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Genbank.</article-title>
                    <source>

                        <italic toggle="yes">Nucleic Acids Res.</italic>
</source>
                    <year>2016</year>;<volume>44</volume>:<fpage>D67</fpage>&#x2013;<lpage>D72</lpage>.
                    <pub-id pub-id-type="pmid">26590407</pub-id>
                    <pub-id pub-id-type="doi">10.1093/nar/gkv1276</pub-id>
                    <pub-id pub-id-type="pmcid">PMC4702903</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref71">
                <label>71</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Van Nederveen</surname>
                            <given-names>VA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Johnson</surname>
                            <given-names>YS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Soc</surname>
                            <given-names>A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>SepA biofilm paper.</article-title>
                    <source>

                        <italic toggle="yes">Figshare.</italic>
</source>
                    <year>2024</year>.
                    <pub-id pub-id-type="doi">10.6084/m9.figshare.c.7168227.v1</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref72">
                <label>72</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Navarro-Garc&#x00ed;a</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ruiz-Perez</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Cataldi</surname>
                            <given-names>&#x00c1;</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Type VI secretion system in pathogenic 
                        <italic toggle="yes">Escherichia coli</italic>: Structure, role in virulence, and acquisition.</article-title>
                    <source>

                        <italic toggle="yes">Front. Microbiol.</italic>
</source>
                    <year>2019</year>;<volume>10</volume>:<fpage>1965</fpage>.
                    <pub-id pub-id-type="pmid">31543869</pub-id>
                    <pub-id pub-id-type="doi">10.3389/fmicb.2019.01965</pub-id>
                    <pub-id pub-id-type="pmcid">PMC6730261</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref73">
                <label>73</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Rose</surname>
                            <given-names>RE</given-names>
                        </name>
</person-group>:
                    <article-title>The nucleotide sequence of 
                        <italic toggle="yes">pACYC177.</italic>
                    </article-title>
                    <source>

                        <italic toggle="yes">Nucleic Acids Res.</italic>
</source>
                    <year>1988</year>;<volume>16</volume>:<fpage>356</fpage>.
                    <pub-id pub-id-type="pmid">3340534</pub-id>
                    <pub-id pub-id-type="doi">10.1093/nar/16.1.356</pub-id>
                    <pub-id pub-id-type="pmcid">PMC334640</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref74">
                <label>74</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Chang</surname>
                            <given-names>AC</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Cohen</surname>
                            <given-names>SN</given-names>
                        </name>
</person-group>:
                    <article-title>Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid.</article-title>
                    <source>

                        <italic toggle="yes">J. Bacteriol.</italic>
</source>
                    <year>1978</year>;<volume>134</volume>:<fpage>1141</fpage>&#x2013;<lpage>1156</lpage>.
                    <pub-id pub-id-type="pmid">149110</pub-id>
                    <pub-id pub-id-type="doi">10.1128/jb.134.3.1141-1156.1978</pub-id>
                    <pub-id pub-id-type="pmcid">PMC222365</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref75">
                <label>75</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Bayer</surname>
                            <given-names>AS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kupferwasser</surname>
                            <given-names>LI</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Brown</surname>
                            <given-names>MH</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Low-level resistance of 
                        <italic toggle="yes">Staphylococcus aureus</italic> to thrombin-induced platelet microbicidal protein 1 
                        <italic toggle="yes">in vitro</italic> associated with 
                        <italic toggle="yes">qacA</italic> gene carriage is independent of multidrug efflux pump activity.</article-title>
                    <source>

                        <italic toggle="yes">Antimicrob. Agents Chemother.</italic>
</source>
                    <year>2006</year>;<volume>50</volume>:<fpage>2448</fpage>&#x2013;<lpage>2454</lpage>.
                    <pub-id pub-id-type="pmid">16801425</pub-id>
                    <pub-id pub-id-type="doi">10.1128/AAC.00028-06</pub-id>
                    <pub-id pub-id-type="pmcid">PMC1489806</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref76">
                <label>76</label>
                <mixed-citation publication-type="data">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Melton-Celsa</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Van Nederveen</surname>
                            <given-names>V</given-names>
                        </name>
</person-group>:
                    <data-title>Raw_data_paper_1.xlsx. figshare.</data-title>[Dataset].<year>2024</year>.
                    <pub-id pub-id-type="doi">10.6084/m9.figshare.25551933.v1</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref77">
                <label>77</label>
                <mixed-citation publication-type="data">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Melton-Celsa</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Van Nederveen</surname>
                            <given-names>V</given-names>
                        </name>
</person-group>:
                    <data-title>Figure 6 RAW Western blot for SepA in supernatant.tif. figshare.</data-title>Figure.<year>2024</year>.
                    <pub-id pub-id-type="doi">10.6084/m9.figshare.25551936.v1</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref78">
                <label>78</label>
                <mixed-citation publication-type="data">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Melton-Celsa</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Van Nederveen</surname>
                            <given-names>V</given-names>
                        </name>
</person-group>:
                    <data-title>SepA-Biofilm-Photos.zip. figshare.</data-title>Figure.<year>2024</year>.
                    <pub-id pub-id-type="doi">10.6084/m9.figshare.25551939.v1</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref79">
                <label>79</label>
                <mixed-citation publication-type="data">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Melton-Celsa</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Van Nederveen</surname>
                            <given-names>V</given-names>
                        </name>
</person-group>:
                    <data-title>Figure 17 RAW Western blot of pACYC177sepA.tif. figshare.</data-title>Figure.<year>2024</year>.
                    <pub-id pub-id-type="doi">10.6084/m9.figshare.25551930.v1</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report323265">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.162361.r323265</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>C&#x00f4;t&#x00e9;</surname>
                        <given-names>Jean-Philippe</given-names>
                    </name>
                    <xref ref-type="aff" rid="r323265a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r323265a1">
                    <label>1</label>University of Sherbrooke, Sherbrooke, Qu&#x00e9;bec, Canada</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>9</day>
                <month>10</month>
                <year>2024</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2024 C&#x00f4;t&#x00e9; JP</copyright-statement>
                <copyright-year>2024</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport323265" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.148093.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>reject</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>This manuscript describes the role of SepA in biofilm formation of some EAEC strains. The authors observed that the deletion of sepA in some EAEC leads to increased biofilm in a crystal violet staining biofilm assay, but that this elevated crystal violet staining is not correlated with the presence of SepA as complementations or the addition of SepA in trans do not reduce the staining. However, when analyzing biofilms using microscopy of CFU counts, the deletion of sepA did not increase biofilm. While the initial observation is interesting, I think more work is needed to support the conclusions of the manuscript.</p>
            <p> </p>
            <p> Overall, the results show that the deletion of sepA increases crystal violet staining in a biofilm assay, and that, as the authors suggest, this phenotype is not dependent on SepA. The results suggest that the deletion of sepA affects something else on the pAA plasmid that is responsible for the observed phenotype.</p>
            <p> </p>
            <p> 
                <bold>Specific comments:</bold>
            </p>
            <p> </p>
            <p> 1- In fig 1, the variability of the biofilm assay is very big; for K261 strain for instance, some replicates didn&#x2019;t form biofilms while the OD590 is &gt;2 for other replicates. Are there any reasons that explain this variability in the assay? I think it is important because other assays to probe biofilms (microscopy, CFUs) did not give the same results and because in the &#x2206;sepA, it seems to be more homogenous. So, in microscopy and CFU experiments with K261, were the biofilms observed with the ~0 OD590 biofilm replicate or with the ~2 OD590 biofilm replicate? It is also worth noting that in Fig. 1, K261 forms on average more biofilms that P433, while the microscopy images suggest the opposite. Are the microscopy images really representative of the biofilm formation assay? I understand that the crystal violet and microscopy were done in different plates (96-well plates vs 24-well plates), is this the reason for the difference?</p>
            <p> From looking at Fig.1 and Fig.7, it seems that the sepA effect is on crystal violet staining, but not really on biofilm formation. I would revisit the microscopy experiment to explain why the difference in phenotype between the assays.</p>
            <p> </p>
            <p> The observation that the sepA mutants results in cells that are more spread is interesting, and most likely not associated with the increased crystal violet staining (as it is observed for K261 and P433). Do the complementations restore the WT phenotype under the microscope?</p>
            <p> </p>
            <p> 2- On the conclusion to figure 1, the text states : &#x2018;These results suggested that SepA may only affect the biofilm of some&#x00a0;
                <italic>agg4A</italic>-positive strains.&#x2019; More strains need to be tested before making this conclusion, as 2/4 agg4A strain showed the effect while only one strain of aggA+ and agg5A+ is not enough to be representative.</p>
            <p> </p>
            <p> 3- Modify figure 3. A regression is not suited to analyze only two time points. A bar graph is sufficient and more appropriate to show that the same effect can be observed at 5h and 20h.</p>
            <p> </p>
            <p> 4- Why show normalized data in figure 4? Because of the variability of the assay, it is difficult to compare with results in figure 1. Please also show the raw values. Figure 4 also needs to be more precise as to which samples were done in 5h and which in 8h.</p>
            <p> </p>
            <p> 5- In the paragraph describing the results showing that pAA is responsible for the effect, it states that : &#x2018;We also found that&#x00a0;
                <italic>sepA</italic>&#x00a0;alone or &#x0394;
                <italic>sepA</italic>::
                <italic>cat</italic>&#x00a0;alone did not confer the capacity to form a biofilm on HSNal
                <sup>R</sup>&#x00a0;(data not shown).&#x2019; 1- This results should be shown as it supports the conclusion that the target of SepA is on pAA. 2- I am not sure what &#x2018;&#x0394;
                <italic>sepA</italic>::
                <italic>cat</italic>&#x00a0;alone&#x2019; means. Please provide more details.</p>
            <p> </p>
            <p> 6- I appreciate the efforts to find a potential target for SepA in figure 10, but I think the double deletion approach is the right one. In addition, if SepA cleaves a target, the exogenous addition of SepA should complement the phenotype, as you tried. Have you considered the possibility that the deletion has another effect, since it does not complement? The fact that the &#x2018;revertant&#x2019; does not complement might actually suggest this; as I understand, the revertant possess a kanamycin resistance cassette &#x2013; so it complements the production of SepA (although WB would be required to see if this is true), but it does not &#x2018;recreate&#x2019; the sepA genomic context.</p>
            <p> </p>
            <p> 7- Figure 14 is confusing. I am not sure why the different colors or shapes used. Please describe what they mean.</p>
            <p> </p>
            <p> 8- Results from figure 14 use an interesting approach with an inactivated mutant of SepA. However, the supernatant assay does not complement the loss of sepA. Have you tried to replace sepA from K261 for this inactivated mutant? This would represent a good control to explore the mechanism for the increased crystal violet staining, but for this to work the revertant needs to be able to complement.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>I cannot comment. A qualified statistician is required.</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Partly</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Partly</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Partly</p>
            <p>Reviewer Expertise:</p>
            <p>Gram-negative bacteria, antibiotic resistance, secretion systems</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.</p>
        </body>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report298619">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.162361.r298619</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Moses</surname>
                        <given-names>Ikechukwu</given-names>
                    </name>
                    <xref ref-type="aff" rid="r298619a1">1</xref>
                    <xref ref-type="aff" rid="r298619a2">2</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r298619a1">
                    <label>1</label>Applied Microbiology, Ebonyi State University (Ringgold ID: 125795), Abakaliki, Ebonyi, Nigeria</aff>
                <aff id="r298619a2">
                    <label>2</label>Federal university of Sao Paulo, S&#x00e3;o Paulo, Brazil</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>24</day>
                <month>7</month>
                <year>2024</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2024 Moses I</copyright-statement>
                <copyright-year>2024</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport298619" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.148093.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>
                <bold>General comment: </bold>This study describes the impact of 
                <italic>sepA</italic> gene in biofilm formation and biofilm staining 
                <italic>in vitro</italic>. Authors demonstrated that the
                <bold> </bold>deletion of&#x00a0;
                <italic>sepA</italic>&#x00a0;causes elevated biofilm formation in EAEC strains, but that the increased biofilm staining is not directly due to the loss of 
                <italic>SepA</italic>. This research work is interesting as it attempted to describe the actual function of 
                <italic>sepA</italic> gene, especially with regards to biofilm formation. The manuscript was well-written; however, I have some major reservations as shown in my comments below:</p>
            <p> </p>
            <p> 
                <bold>Comment 1:</bold> Biofilm formation is a complex process which involves different arrays of genes (lasR, lecA, pelA, amongst others) and even operons. Authors indicated that four out of six mutant EAEC strains exhibited increased biofilm staining when&#x00a0;
                <italic>sepA</italic>&#x00a0;was deleted without investigating why the two mutant EAEC strains with deleted 
                <italic>sepA</italic> genes were different because these two mutant EAEC strains exhibited the same biofilm staining property similar to the wild-type (wt) parent strain as they didn&#x2019;t show any form of increased biofilm staining from the results. So, the results of this study is not definite as there is no uniformity in the aftermath of sepA deletion with regards to enhanced biofilm staining activity. I strongly believe that for this to be concrete, more isolates with sepA need to be included. Additionally, some hypotheses could have been tested such as possibly sequencing all the sepA genes in all the 6 tested EAEC strains to know if there are mutations in their gene sequences. A variation in sepA gene sequences of the EAEC strains could possibly point towards the biofilm expression level of this gene before its deletion. A qPCR could have been very helpful in understanding the expression level of sepA gene in all the 6 EAEC strains that were tested before their deletion.</p>
            <p> </p>
            <p> 
                <bold>Comment 2:</bold> Authors in their study demonstrated that deletion of&#x00a0;
                <italic>sepA</italic>&#x00a0;causes elevated biofilm formation in some EAEC strains, but that the increased biofilm staining is not directly due to the loss of SepA. Yes, many other factors are involved in biofilm formation but since this study is focused solely on sepA gene, I feel that authors need to show or explain the possible reason while the other two mutant strains did not exhibit increased biofilm staining when sepA gene was deleted.</p>
            <p> </p>
            <p> 
                <bold>Comment 3:</bold> Authors cited in the manuscript that sepA is involved in diarrhoea cases or strongly associated with diarrhoeal cases. They also indicated that 23% of the strains positive for AAF were positive for&#x00a0;
                <italic>sepA.</italic> This does not mean that sepA is strongly involved in biofilm formation. Authors showed some good work in demonstrating the correlation of sepA deletion and biofilm staining; however, results shown from their work does not indicate completeness of what they hypothesized as some tested strains with deleted sepA gene showed contrary results to other strains with the same deleted sepA gene. More investigations with regards to this need to be done in order to have a definitive idea of the actual function of sepA.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Partly</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Yes</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Partly</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Partly</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Microbiology</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
    </sub-article>
</article>
