<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="data-paper" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.169966.1</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Data Note</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>A guide to selecting high-performing antibodies for Optineurin (UniProt ID: Q96CV9) for use in western blot, immunoprecipitation, and immunofluorescence</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 1; peer review: 2 approved]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Mole&#x00f3;n</surname>
                        <given-names>Vera Ru&#x00ed;z</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <uri content-type="orcid">https://orcid.org/0000-0003-3728-3158</uri>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Ayoubi</surname>
                        <given-names>Riham</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Alende</surname>
                        <given-names>Charles</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <uri content-type="orcid">https://orcid.org/0009-0005-4611-6134</uri>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Fothouhi</surname>
                        <given-names>Maryam</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Ryan</surname>
                        <given-names>Joel</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Bol&#x00ed;var</surname>
                        <given-names>Sara Gonz&#x00e1;lez</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-4299-8281</uri>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Worrall</surname>
                        <given-names>Donovan</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <uri content-type="orcid">https://orcid.org/0000-0001-5676-5473</uri>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Durcan</surname>
                        <given-names>Thomas M</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Brown</surname>
                        <given-names>Claire M</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Francis</surname>
                        <given-names>Vincent</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0009-0000-7535-8718</uri>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>McPherson</surname>
                        <given-names>Peter S.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Laflamme</surname>
                        <given-names>Carl</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0001-5906-025X</uri>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Neuroscience and Neurosurgery, McGill University, Montreal, Qu&#x00e9;bec, Canada</aff>
                <aff id="a2">
                    <label>2</label>Advanced BioImaging Facility, McGill University, Montreal, Qu&#x00e9;bec, Canada</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:carl.laflamme@mcgill.ca">carl.laflamme@mcgill.ca</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>For this project, the authors developed partnerships with leading antibody manufacturers and KO cell line providers. The partners provide antibodies and KO cell lines to this project at no cost. These partners include: Abcam, ABCD antibodies, ABclonal, Addgene, Aviva Systems Biology, BioTechne, Cell Signaling Technology, Developmental Studies Hybridoma Bank, GeneTex, Horizon Discovery, Institute for Protein Innovation, MilliporeSigma, Proteintech, Synaptic Systems, Thermo Fisher Scientific.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>17</day>
                <month>10</month>
                <year>2025</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2025</year>
            </pub-date>
            <volume>14</volume>
            <elocation-id>1137</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>2</day>
                    <month>9</month>
                    <year>2025</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2025 Mole&#x00f3;n VR et al.</copyright-statement>
                <copyright-year>2025</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/14-1137/pdf"/>
            <abstract>
                <p>Optineurin (OPTN) is a multifunctional cytoplasmic adaptor protein implicated in maintaining neuronal homeostasis through its roles in selective autophagy, vesicle trafficking, and regulation of inflammatory signaling. Mutations in the 
                    <italic toggle="yes">OPTN</italic> gene are causally linked to several neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS) and primary open-angle glaucoma. Here we have eight optineurin commercial antibodies for western blot, immunoprecipitation, and immunofluorescence using a standardized experimental protocol based on comparing read-outs in knockout cell lines and isogenic parental controls. These studies are part of a larger, collaborative initiative seeking to address antibody reproducibility issues by characterizing commercially available antibodies for human proteins and publishing the results openly as a resource for the scientific community. While the use of antibodies and protocols vary between laboratories, we encourage readers to use this report as a guide to select the most appropriate antibodies for their specific needs.</p>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>Q96CV9</kwd>
                <kwd>OPTN</kwd>
                <kwd>optineurin</kwd>
                <kwd>antibody characterization</kwd>
                <kwd>antibody validation</kwd>
                <kwd>western blot</kwd>
                <kwd>immunoprecipitation</kwd>
                <kwd>immunofluorescence</kwd>
            </kwd-group>
            <funding-group>
                <award-group id="fund-1" xlink:href="https://doi.org/10.13039/100015751">
                    <funding-source>Qu&#x00e9;bec Consortium for Drug Discovery</funding-source>
                </award-group>
                <award-group id="fund-2" xlink:href="https://doi.org/10.13039/100000971">
                    <funding-source>ALS Association</funding-source>
                </award-group>
                <award-group id="fund-3" xlink:href="https://doi.org/10.13039/100009017">
                    <funding-source>ALS Society of Canada</funding-source>
                </award-group>
                <award-group id="fund-4" xlink:href="https://doi.org/10.13039/501100000406">
                    <funding-source>Motor Neurone Disease Association</funding-source>
                </award-group>
                <funding-statement>This work was supported in part by a grant from the ALS-Reproducible Antibody Platform (ALS-RAP). ALS-RAP was created as a public-private partnership by three leading ALS charities: the ALS Association (USA), the Motor Neurone Disease Association (UK), and the ALS Society of Canada. This work was also supported by the Government of Canada through Genome Canada, Genome Quebec, and Ontario Genomics (grant no. OGI-210). RA is supported by a Mitacs fellowship.&#13;
This work was supported by the CQDM (by a grant from the Minist&#x00e8;re de l&#x2019;&#x00c9;conomie, de l&#x2019;Innovation et de&#13;
l&#x2019;&#x00c9;nergie du Qu&#x00e9;bec).</funding-statement>
                <funding-statement>
                    <italic>The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.</italic>
                </funding-statement>
            </funding-group>
        </article-meta>
    </front>
    <body>
        <sec id="sec1" sec-type="intro">
            <title>Introduction</title>
            <p>Optineurin (OPTN) is a multifunctional cytoplasmic adaptor protein implicated in maintaining neuronal homeostasis through its roles in selective autophagy, vesicle trafficking, and regulation of inflammatory signaling.
                <sup>
                    <xref ref-type="bibr" rid="ref1">1</xref>
                </sup> Mutations in the 
                <italic toggle="yes">OPTN</italic> gene are causally linked to several neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS) and primary open-angle glaucoma.
                <sup>
                    <xref ref-type="bibr" rid="ref2">2</xref>
                </sup> In the nervous system, OPTN functions as a selective autophagy receptor, mediating the clearance of damaged mitochondria and protein aggregates by interacting with LC3 and ubiquitinated substrates.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>
                </sup> It also suppresses NF-&#x03ba;B signaling by sequestering polyubiquitin chains, thereby dampening neuroinflammation.
                <sup>
                    <xref ref-type="bibr" rid="ref4">4</xref>
                </sup>
            </p>
            <p>Loss-of-function or pathogenic mutations in OPTN disrupt these critical pathways, leading to protein accumulation, mitochondrial dysfunction, and chronic inflammatory responses that contribute to neuronal death.
                <sup>
                    <xref ref-type="bibr" rid="ref5">5</xref>
                </sup> Moreover, OPTN interacts with kinases such as TBK1, further linking it to the regulation of innate immune signaling in neurons and glial cells.
                <sup>
                    <xref ref-type="bibr" rid="ref6">6</xref>
                </sup> These findings highlight OPTN as a central node in neurodegenerative pathophysiology, making it a promising target for therapeutic intervention in diseases marked by impaired proteostasis and neuroinflammation.</p>
            <p>This research is part of a broader collaborative initiative in which academics, funders and commercial antibody manufacturers are working together to address antibody reproducibility issues by characterizing commercial antibodies for human proteins using standardized protocols, and openly sharing the data.
                <sup>
                    <xref ref-type="bibr" rid="ref7">7</xref>
                </sup> It consists of identifying human cell lines with adequate target protein expression and the development/contribution of equivalent knockout (KO) cell lines, followed by antibody characterization procedures using most commercially available renewable antibodies against the corresponding protein.
                <sup>
                    <xref ref-type="bibr" rid="ref7">7</xref>
                </sup> Here we characterized commercial optineurin antibodies, selected and donated by participant antibody manufacturers, for use in western blot, immunoprecipitation, and immunofluorescence (also referred to as immunocytochemistry), enabling biochemical and cellular assessment of optineurin properties and function. The platform for antibody characterization used to carry out this study was endorsed by a committee of industry academic representatives. The standardized consensus antibody characterization protocols are openly available on Protocol Exchange.
                <sup>
                    <xref ref-type="bibr" rid="ref7">7</xref>
                </sup>
            </p>
            <p>The authors do not engage in result analysis or offer explicit antibody recommendations. Our primary aim is to deliver top-tier data to the scientific community, grounded in Open Science principles. This empowers experts to interpret the characterization data independently, enabling them to make informed choices regarding the most suitable antibodies for their specific experimental needs. Guidelines on how to interpret antibody characterization data found in this study are featured on the YCharOS gateway
                <sup>
                    <xref ref-type="bibr" rid="ref8">8</xref>
                </sup> and in 
                <xref ref-type="table" rid="T4">
Table 4</xref> of this data note.
                <sup>
                    <xref ref-type="bibr" rid="ref7">7</xref>
                </sup>
            </p>
            <table-wrap id="T1" orientation="portrait" position="float">
                <label>
Table 1. </label>
                <caption>
                    <title>Summary of the cell lines used.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="left" colspan="1" rowspan="1" valign="top">Institution</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Catalog number</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">RRID (Cellosaurus)</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Cell line</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">
Genotype</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">ATCC</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">HTB-96</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="http://cvcl_0042">CVCL_0042</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">U2OS</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">WT</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Montreal Neurological Institute</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">-</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="http://cvcl_a6ln">CVCL_A6LN</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">U2OS</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <italic toggle="yes">OPTN</italic> KO</td>
                        </tr>
                    </tbody>
                </table>
            </table-wrap>
            <table-wrap id="T2" orientation="portrait" position="float">
                <label>
Table 2. </label>
                <caption>
                    <title>Summary of the optineurin antibodies tested.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="left" colspan="1" rowspan="1" valign="top">
Company</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">
Catalog number</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">
Lot number</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">RRID (Antibody Registry)</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Clonality</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">
Clone ID</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Host</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Concentration (&#x03bc;g/&#x03bc;l)</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">
Vendors recommended applications</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Abcam</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">ab213556
                                <xref ref-type="table-fn" rid="tfn1">**</xref>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1028905-1</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="http://ab_2890221">AB_2890221</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">recombinantmono</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">EPR20654</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">rabbit</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.5</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Wb,IP</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Abcam</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">ab242146
                                <xref ref-type="table-fn" rid="tfn1">**</xref>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">GR108770-5</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="http://ab_2890222">AB_2890222</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">recombinantmono</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">EPR23059124</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">rabbit</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.5</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Wb</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Bio-Techne
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">NBP3-19900
                                <xref ref-type="table-fn" rid="tfn1">**</xref>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">230464</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="http://ab_3073768">AB_3073768</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">recombinantmono</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">S01-2C5</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">rabbit</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.3</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Wb</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Cell Signaling Technology</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">70928
                                <xref ref-type="table-fn" rid="tfn1">**</xref>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="http://ab_3073769">AB_3073769</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">recombinantmono</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">E4P8C</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">rabbit</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.2</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Wb,IP,IF</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Proteintech</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">60293-1-Ig
                                <xref ref-type="table-fn" rid="tfn2">*</xref>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">10001751</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="http://ab_2881408">AB_2881408</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">monoclonal</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">6C1H4</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">mouse</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.7</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Wb,IF</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Structural Genomics Consortium</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Z-OPTN-10
                                <xref ref-type="table-fn" rid="tfn1">**</xref>,
                                <sup>a</sup>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">YSOPTNA-c001</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">-</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">recombinantmono</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">YSOPTNA-c001</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">human</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.0</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">IP</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Thermo Fisher Scientific</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">702766
                                <xref ref-type="table-fn" rid="tfn1">**</xref>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">2248017</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="http://ab_2723432">AB_2723432</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">recombinantmono</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">22H12L20</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">rabbit</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.5</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Wb,IF</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Thermo Fisher Scientific</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">711879
                                <xref ref-type="table-fn" rid="tfn1">**</xref>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">2226080</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="http://ab_2723433">AB_2723433</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Recombinantpoly</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">-</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">rabbit</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.5</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Wb,IF</td>
                        </tr>
                    </tbody>
                </table>
                <table-wrap-foot>
                    <p>Wb = western blot; IF = immunofluorescence; IP = immunoprecipitation.</p>
                    <fn-group content-type="footnotes">
                        <fn id="tfn1">
                            <label>** </label>
                            <p>= recombinant antibody.</p>
                        </fn>
                        <fn id="tfn2">
                            <label>* </label>
                            <p>= monoclonal antibody, NA = not available.</p>
                        </fn>
                    </fn-group>
                </table-wrap-foot>
            </table-wrap>
            <table-wrap id="T3" orientation="portrait" position="float">
                <label>
Table 3. </label>
                <caption>
                    <title>
Table of secondary antibodies used.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="left" colspan="1" rowspan="1" valign="top">
Company</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">
Secondary antibody</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">
Catalog number</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">
RRID (Antibody Registry)</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">
Clonality</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">
Concentration (&#x03bc;g/&#x03bc;L)</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">
Working concentration (&#x03bc;g/mL)</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Proteintech</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">HRP-Goat Anti-Rabbit Antibody (H+L)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">RGAR001</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_3073505">AB_3073505</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">recombinant polyclonal</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.0</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.05</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Proteintech</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">HRP-Goat Anti-Mouse Antibody (H+L)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">RGAM001</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_3068333">AB_3068333</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">recombinant polyclonal</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.0</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.5</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Cell Signaling Technology</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Protein A, HRP conjugate</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">12291</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">NA</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">polyclonal</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.125</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.5</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Millipore Sigma</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Peroxidase-conjugated monoclonal anti-Flag M2</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">A8592</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="http://ab_439702">AB_439702</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">monoclonal</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.1</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.5</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Millipore Sigma</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Cy3-conjugated monoclonal anti-Flag M2</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">A9594</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="http://ab_439700">AB_439700</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">monoclonal</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.1</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.5</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Thermo Fisher Scientific</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Alexa Fluor&#x2122; 555-Goat anti-Rabbit IgG (H+L)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">A-21429</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_2535850">AB_2535850</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">polyclonal</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">2.0</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.5</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Thermo Fisher Scientific</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Alexa Fluor&#x2122; 555-Goat anti-Mouse IgG (H+L)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">A-21424</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_141780">AB_141780</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">polyclonal</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">2.0</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.5</td>
                        </tr>
                    </tbody>
                </table>
            </table-wrap>
            <table-wrap id="T4" orientation="portrait" position="float">
                <label>
Table 4. </label>
                <caption>
                    <title>Illustrations to assess antibody performance in all western blot, immunoprecipitation and immunofluorescence.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="left" colspan="1" rowspan="1" valign="top">
Western blot</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">
Immunoprecipitation</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">
Immunofluorescence</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <graphic id="gr4" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/187366/18ecf7a8-a5a1-4c8e-bd55-14bb5da9e4b4_Graphical1.gif"/>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <graphic id="gr5" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/187366/18ecf7a8-a5a1-4c8e-bd55-14bb5da9e4b4_Graphical2.gif"/>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <graphic id="gr6" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/187366/18ecf7a8-a5a1-4c8e-bd55-14bb5da9e4b4_Graphical3.gif"/>
</td>
                        </tr>
                    </tbody>
                </table>
                <table-wrap-foot>
                    <p>This table has been reproduced with permission from Ayoubi et al., Elife, 2023.
                        <sup>
                            <xref ref-type="bibr" rid="ref11">11</xref>
                        </sup>
                    </p>
                </table-wrap-foot>
            </table-wrap>
        </sec>
        <sec id="sec2" sec-type="results|discussion">
            <title>Results and discussion</title>
            <p>Our standard protocol involves comparing readouts from wild type (WT) and KO cell lines.
                <sup>
                    <xref ref-type="bibr" rid="ref9">9</xref>,
                    <xref ref-type="bibr" rid="ref10">10</xref>
                </sup> The first step was to identify a cell line(s) that expresses sufficient levels of a given protein to generate a measurable signal using antibodies. To this end, we examined the DepMap (Cancer Dependency Map Portal, RRID:SCR_017655) transcriptomics database to identify all cell lines that express the target at levels greater than 2.5 log
                <sub>2</sub> (transcripts per million &#x201c;TPM&#x201d; + 1), which we have found to be a suitable cut-off.
                <sup>
                    <xref ref-type="bibr" rid="ref11">11</xref>
                </sup> U2OS expresses the protein optineuron transcript at 0.89 log
                <sub>2</sub> TPM+1 and was identified as a suitable cell line and was modified with CRISPR/Cas9 to KO the corresponding 
                <italic toggle="yes">OPTN</italic> gene (
                <xref ref-type="table" rid="T1">
Table 1</xref>).</p>
            <p>To screen all eight antibodies by western blot, U2OS WT and 
                <italic toggle="yes">OPTN</italic> KO protein lysates were ran on SDS-PAGE, transferred onto nitrocellulose membranes, and then probed with eight antibodies in parallel (
                <xref ref-type="fig" rid="f1">
Figure 1</xref>).</p>
            <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                <label>
Figure 1. </label>
                <caption>
                    <title>optineurin antibody screening by western blot.</title>
                    <p>Lysates of U2OS WT and 
                        <italic toggle="yes">OPTN</italic> KO were prepared, and 35 &#x03bc;g of protein were processed for western blot with the indicated optineurin antibodies. The Ponceau stained transfers of each blot are presented to show equal loading of WT and KO lysates and protein transfer efficiency from the 4-20% Tris-Glycine polyacrylamide gels to the nitrocellulose membrane. Antibody dilutions were chosen according to the recommendations of the antibody supplier. Antibody dilutions used: ab213556** at 1/5000, ab242146** at 1/1000, NBP3-19900** at 1/1000, 70928** at 1/1000, 60293-1-Ig* at 1/5000, Z-OPTN-10** at 1/1000, 702766** at 1/200, 711879** at 1/5000, were titrated as the signal was too weak or too strong when following the supplier&#x2019;s recommendations. Predicted band size: 66 kDa. ** = recombinant antibody, * = monoclonal antibody.</p>
                </caption>
                <graphic id="gr1" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/187366/18ecf7a8-a5a1-4c8e-bd55-14bb5da9e4b4_figure1.gif"/>
            </fig>
            <p>We then assessed the capability of all eight antibodies to capture optineurin from U2OS protein extracts using immunoprecipitation techniques, followed by western blot analysis. For the immunoblot step, a specific optineurin antibody identified previously (refer to 
                <xref ref-type="fig" rid="f1">
Figure 1</xref>) was selected. Equal amounts of the starting material (SM) and the unbound fractions (UB), as well as the whole immunoprecipitate (IP) eluates were separated by SDS-PAGE (
                <xref ref-type="fig" rid="f2">
Figure 2</xref>).</p>
            <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                <label>
Figure 2. </label>
                <caption>
                    <title>optineurin antibody screening by immunoprecipitation.</title>
                    <p>U2OS lysates were prepared, and immunoprecipitation was performed using 1 mg of lysate and 2.0 &#x03bc;g of the indicated optineurin antibodies pre-coupled to Dynabeads protein A or protein G or Flag-M2 magnetic beads. Samples were washed and processed for western blot with the optineurin antibody ab242146** used at 1/1000. The Ponceau stained transfers of each blot are shown. SM = 4% starting material; UB = 4% unbound fraction; IP = immunoprecipitate, HC = antibody heavy chain, LC = antibody light chain. ** = recombinant antibody, * = monoclonal antibody.</p>
                </caption>
                <graphic id="gr2" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/187366/18ecf7a8-a5a1-4c8e-bd55-14bb5da9e4b4_figure2.gif"/>
            </fig>
            <p>For immunofluorescence, eight antibodies were screened using a mosaic strategy. First, U2OS WT and 
                <italic toggle="yes">OPTN</italic> KO cells were labelled with different fluorescent dyes in order to distinguish the two cell lines, and the optineurin antibodies were evaluated. Both WT and KO lines imaged in the same field of view to reduce staining, imaging and image analysis bias (
                <xref ref-type="fig" rid="f3">
Figure 3</xref>). Quantification of immunofluorescence intensity in hundreds of WT and KO cells was performed for each antibody tested, and the images presented in 
                <xref ref-type="fig" rid="f3">
Figure 3</xref> are representative of this analysis.
                <sup>
                    <xref ref-type="bibr" rid="ref7">7</xref>
                </sup>
            </p>
            <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                <label>
Figure 3. </label>
                <caption>
                    <title>optineurin antibody screening by immunofluorescence.</title>
                    <p>U2OS WT and OPTN KO cells were labelled with a green or a far-red fluorescent dye, respectively. WT and KO cells were mixed and plated to a 1:1 ratio on coverslips. Cells were stained with the indicated optineurin antibodies and with the corresponding Alexa-fluor 555 coupled secondary antibody including DAPI. Acquisition of the blue (nucleus-DAPI), green (WT), red (antibody staining) and far-red (KO) channels was performed. Representative images of the blue and red (grayscale) channels are shown. WT and KO cells are outlined with green and magenta dashed line, respectively. When an antibody was recommended for immunofluorescence by the supplier, we tested it at the recommended dilution. The rest of the antibodies were tested at 1 and 2 &#x03bc;g/ml, and the final concentration was selected based on the detection range of the microscope used and a quantitative analysis not shown here. Antibody dilutions used: Antibody dilution used: ab213556** at 1/500, ab242146** at 1/1000, NBP3-19900** at 1/300, 70928** at 1/400, 60293-1-Ig* at 1/1500, Z-OPTN-10** at 1/1500, 702766** at 1/500, 711879** at 1/250. Bars = 10 &#x03bc;m. ** = recombinant antibody, * = monoclonal antibody.</p>
                </caption>
                <graphic id="gr3" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/187366/18ecf7a8-a5a1-4c8e-bd55-14bb5da9e4b4_figure3.gif"/>
            </fig>
            <p>In conclusion, we have screened eight optineurin commercial antibodies by western blot, immunoprecipitation, and immunofluorescence by comparing the signal produced by the antibodies in human U2OS WT and 
                <italic toggle="yes">OPTN</italic> KO cells. To assist users in interpreting antibody performanyce, 
                <xref ref-type="table" rid="T4">
Table 4</xref> outlines various scenarios in which antibodies may perform in all three applications.
                <sup>
                    <xref ref-type="bibr" rid="ref11">11</xref>
                </sup> High-quality and renewable antibodies that successfully detect optineurin were identified in all applications. Researchers who wish to study optineurin in a different species are encouraged to select high-quality antibodies, based on the results of this study, and investigate the predicted species reactivity of the manufacturer before extending their research.</p>
            <sec id="sec3">
                <title>Limitations</title>
                <p>Inherent limitations are associated with the antibody characterization platform used in this study. Firstly, the YCharOS project focuses on renewable (recombinant and monoclonal) antibodies and does not test all commercially available optineurin antibodies. YCharOS partners provide approximately 80% of all renewable antibodies, but some top-cited polyclonal antibodies may not be available through these partners. We encourage readers to consult vendor documentation to identify the specific antigen each antibody is raised against, where such information is available.</p>
                <p>Secondly, the YCharOS effort employs a non-biased approach that is agnostic to the protein for which antibodies have been characterized. The aim is to provide objective data on antibody performance without preconceived notions about how antibodies should perform or the molecular weight that should be observed in western blot. As the authors are not experts in oprineurin, only a brief overview of the protein&#x2019;s function and its relevance in disease is provided. Optineurin experts are invited to analyze and interpret observed banding patterns in western blots and subcellular localization in immunofluorescence.</p>
                <p>Thirdly, YCharOS experiments are not performed in replicates primarily due to the use of multiple antibodies targeting various epitopes. Once a specific antibody is identified, it validates the protein expression of the intended target in the selected cell line, confirms the lack of protein expression in the KO cell line and supports conclusions regarding the specificity of the other antibodies. Moreover, the same antibody clones are donated by 2-3 manufacturers (cross-licensed antibodies), effectively serving as replicates and enabling the validation of test reproducibility. All experiments are performed using master mixes, and meticulous attention is paid to sample preparation and experimental execution. In IF, the use of two different concentrations serves to evaluate antibody specificity and can aid in assessing assay reliability. In instances where antibodies yield no signal, a repeat experiment is conducted following titration. Additionally, our independent data is performed subsequently to the antibody manufacturers internal validation process, therefore making our characterization process a repeat.</p>
                <p>Lastly, as comprehensive and standardized procedures are respected, any conclusions remain confined to the experimental conditions and cell line used for this study. The use of a single cell type for evaluating antibody performance poses as a limitation, as factors such as target protein abundance significantly impact results. Additionally, the use of cancer cell lines containing gene mutations poses a potential challenge, as these mutations may be within the epitope coding sequence or other regions of the gene responsible for the intended target. Such alterations can impact the binding affinity of antibodies. This represents an inherent limitation of any approach that employs cancer cell lines.</p>
            </sec>
        </sec>
        <sec id="sec4" sec-type="methods">
            <title>Method</title>
            <p>The standardized protocols used to carry out this KO cell line-based antibody characterization platform was established and approved by a collaborative group of academics, industry researchers and antibody manufacturers. The detailed materials and step-by-step protocols used to characterize antibodies in western blot, immunoprecipitation and immunofluorescence are openly available on Protocols.io (
                <ext-link ext-link-type="uri" xlink:href="https://www.protocols.io/view/a-consensus-platform-for-antibody-characterization-3byl49oxrgo5/v1">protocols.io/view/a-consensus-platform-for-antibody-characterization
</ext-link>).
                <sup>
                    <xref ref-type="bibr" rid="ref7">7</xref>
                </sup> Brief descriptions of the experimental setup used to carry out this study can be found below.</p>
            <sec id="sec5">
                <title>Cell lines and antibodies</title>
                <p>The cell lines, primary and secondary antibodies used in this study are listed in 
                    <xref ref-type="table" rid="T1">
Table 1</xref>, 
                    <xref ref-type="table" rid="T2">2</xref>, and 
                    <xref ref-type="table" rid="T3">3</xref>, respectively. To ensure consistency with manufacturer recommendations and account for proprietary formulations (where antibody concentrations are not disclosed), antibody usage is reported as dilution ratios rather than absolute concentrations. To facilitate proper citation and unambiguous identification, all cell lines and antibodies are referenced with their corresponding Research Resource Identifiers (RRIDs).
                    <sup>
                        <xref ref-type="bibr" rid="ref12">12</xref>,
                        <xref ref-type="bibr" rid="ref13">13</xref>
                    </sup> U2OS KO clone corresponding to the 
                    <italic toggle="yes">OPTN</italic> was generated with low passage cells at Source. Two guide RNAs were used to induce a stop codon in the 
                    <italic toggle="yes">U2OS</italic> gene (sequence guide 1: CUAAAUAAUCAAGCCAUGAA, sequence guide 2: GAGAAAUUGAAGGAAGAGCU). All cell lines used in this study were regularly tested for mycoplasma contamination and were confirmed to be mycoplasma-free.</p>
            </sec>
            <sec id="sec6">
                <title>Antibody screening by western blot</title>
                <p>U2OS WT and 
                    <italic toggle="yes">OPTN</italic> KO cells were collected in RIPA buffer (25 mM Tris-HCl pH 7.6, 150mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS) (Thermo Fisher Scientific, cat. number 89901) supplemented with 1x protease inhibitor cocktail mix (MilliporeSigma, cat. number P8340). Lysates were sonicated briefly and incubated 30 min on ice. Lysates were spun at ~110,000 
                    <italic toggle="yes">x g</italic> for 15 min at 4&#x00b0;C and equal protein aliquots of the supernatants were analyzed by SDS-PAGE and western blot. BLUelf prestained protein ladder (GeneDireX, cat. number PM008-0500) was used.</p>
                <p>Western blots were performed with precast midi 4-20% Tris-Glycine polyacrylamide gels (Thermo Fisher Scientific, cat. number WXP42012BOX) ran with Tris/Glycine/SDS buffer (Bio-Rad, cat. number 1610772), loaded in Laemmli loading sample buffer (Thermo Fisher Scientific, cat. number AAJ61337AD) and transferred on nitrocellulose membranes. Proteins on the blots were visualized with Ponceau S staining (Thermo Fisher Scientific, cat. number BP103-10) which is scanned to show together with individual western blot. Blots were blocked with 5% milk for 1 hr, and antibodies were incubated O/N at 4&#x00b0;C with 5% milk in TBS with 0,1% Tween 20 (TBST) (Cell Signalling Technology, cat. number 9997). Following three washes with TBST, the peroxidase conjugated secondary antibody was incubated at a dilution of ~0.2 &#x03bc;g/ml in TBST with 5% milk for 1 hr at room temperature followed by three washes with TBST. Membranes were incubated with Pierce ECL (Thermo Fisher Scientific, cat. number 32106) prior to detection with iBright&#x2122; CL1500 Imaging System (Thermo Fisher Scientific, cat. number A44240).</p>
            </sec>
            <sec id="sec7">
                <title>Antibody screening by immunoprecipitation</title>
                <p>Antibody-bead conjugates were prepared by adding 2 &#x03bc;g to 500 &#x03bc;l of Pierce IP Lysis Buffer from Thermo Fisher Scientific (cat. number 87788) in a microcentrifuge tube, together with 30 &#x03bc;l of Dynabeads protein A- (for rabbit antibodies) or protein G- (for mouse and rat goat antibodies) (Thermo Fisher Scientific, cat. number 10002D and 10004D, respectively) or anti-Flag M2 magnetic beads (MilliporeSigma, cat. number M8823). Tubes were rocked for ~1 h at 4&#x00b0;C followed by two washes to remove unbound antibodies.</p>
                <p>U2OS WT lysates were collected in Pierce IP buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40 and 5% glycerol) supplemented with protease inhibitor. Lysates were rocked 30 min at 4&#x00b0;C and spun at 110,000 
                    <italic toggle="yes">x g</italic> for 15 min at 4&#x00b0;C. 0.5 ml aliquots at 1 mg/ml of lysate were incubated with an antibody-bead conjugate for ~1 h at 4&#x00b0;C. The unbound fractions were collected, and beads were subsequently washed three times with 1.0 ml of IP buffer and processed for SDS-PAGE and western blot on precast midi 4-20% Tris-Glycine polyacrylamide gels. Protein A: HRP was used as a secondary detection system at a concentration of 2.0 &#x03bc;g/ml.</p>
            </sec>
            <sec id="sec8">
                <title>Antibody screening by immunofluorescence</title>
                <p>U2OS WT and 
                    <italic toggle="yes">OPTN</italic> KO cells were labelled with a green and a far-red fluorescence dye, respectively (Thermo Fisher Scientific, cat. number C2925 and C34565). The nuclei were labelled with DAPI (Thermo Fisher Scientific, cat. Number D3571) fluorescent stain. WT and KO cells were plated on 96-well plate with optically clear flat-bottom (Perkin Elmer, cat. number 6055300) as a mosaic and incubated for 24 hrs in a cell culture incubator at 37
                    <sup>o</sup>C, 5% CO
                    <sub>2</sub>. Cells were fixed in 4% paraformaldehyde (PFA) (VWR, cat. number 100503-917) in phosphate buffered saline (PBS) (Wisent, cat. number 311-010-CL). Cells were permeabilized in PBS with 0,1% Triton X-100 (Thermo Fisher Scientific, cat. number BP151-500) for 10 min at room temperature and blocked with PBS with 5% BSA, 5% goat serum (Gibco, cat. number 16210-064) and 0.01% Triton X-100 for 30 min at room temperature. Cells were incubated with IF buffer (PBS, 5% BSA, 0,01% Triton X-100) containing the primary optineurin antibodies overnight at 4&#x00b0;C. Cells were then washed 3 &#x00d7; 10 min with IF buffer and incubated with corresponding Alexa Fluor 555-conjugated secondary antibodies in IF buffer at a dilution of 1.0 &#x03bc;g/ml for 1 hr at room temperature with DAPI. Cells were washed 3 &#x00d7; 10 min with IF buffer and once with PBS.</p>
                <p>Images were acquired on an ImageXpress micro confocal high-content microscopy system (Molecular Devices), using a 20x NA 0.95 water immersion objective and scientific CMOS cameras, equipped with 395, 475, 555 and 635 nm solid state LED lights (lumencor Aura III light engine) and bandpass filters to excite DAPI, Cellmask Green, Alexa-555 and Cellmask Red, respectively. Images had pixel sizes of 0.68 x 0.68 microns, and a z-interval of 4 microns. For analysis and visualization, shading correction (shade only) was carried out for all images. Then, maximum intensity projections were generated using 3 z-slices. Segmentation was carried out separately on maximum intensity projections of Cellmask channels using CellPose 1.0, and masks were used to generate outlines and for intensity quantification.
                    <sup>
                        <xref ref-type="bibr" rid="ref14">14</xref>
                    </sup> Figures were assembled with Adobe Illustrator.</p>
            </sec>
        </sec>
    </body>
    <back>
        <sec id="sec11" sec-type="data-availability">
            <title>Data availability</title>
            <sec id="sec12">
                <title>Underlying data</title>
                <p>Zenodo: Dataset for the optineurin antibody screening study 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.5281/zenodo.7776013">https://doi.org/10.5281/zenodo.7776013</ext-link>.</p>
                <p>Data are available under the terms of the 
                    <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution 4.0 International license</ext-link> (CC-BY 4.0).</p>
            </sec>
        </sec>
        <ack>
            <title>Acknowledgment</title>
            <p>We would like to thank the NeuroSGC/YCharOS/EDDU collaborative group for their important contribution to the creation of an open scientific ecosystem of antibody manufacturers and KO cell line suppliers, for the development of community-agreed protocols, and for their shared ideas, resources, and collaboration. Members of the group can be found below. We would also like to thank the Advanced BioImaging Facility (ABIF) consortium for their image analysis pipeline development and conduction (RRID:SCR_017697). Members of each group can be found below.</p>
            <p>NeuroSGC/YCharOS/EDDU collaborative group: Thomas M. Durcan, Aled M. Edwards, Peter S. McPherson, Chetan Raina and Wolfgang Reintsch.</p>
            <p>ABIF consortium: Claire M. Brown and Joel Ryan.</p>
            <p>Thank you to the Structural Genomics Consortium, a registered charity (no. 1097737), for your support on this project. The Structural Genomics Consortium receives funding from Bayer AG, Boehringer Ingelheim, Bristol-Myers Squibb, Genentech, Genome Canada through Ontario Genomics Institute (grant no. OGI-196), the EU and EFPIA through the Innovative Medicines Initiative 2 Joint Undertaking (EUbOPEN grant no. 875510), Janssen, Merck KGaA (also known as EMD in Canada and the United States), Pfizer and Takeda.</p>
        </ack>
        <ref-list>
            <title>References</title>
            <ref id="ref1">
                <label>1</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ryan</surname>
                            <given-names>TA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tumbarello</surname>
                            <given-names>DA</given-names>
                        </name>
</person-group>:
                    <article-title>Optineurin: A Coordinator of Membrane-Associated Cargo Trafficking and Autophagy.</article-title>
                    <source>

                        <italic toggle="yes">Front. Immunol.</italic>
</source>
                    <year>2018</year>;<volume>9</volume>:<fpage>1024</fpage>.
                    <pub-id pub-id-type="pmid">29867991</pub-id>
                    <pub-id pub-id-type="doi">10.3389/fimmu.2018.01024</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5962687</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref2">
                <label>2</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Guo</surname>
                            <given-names>Q</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Weng</surname>
                            <given-names>Q</given-names>
                        </name>
</person-group>:
                    <article-title>The diverse role of optineurin in pathogenesis of disease.</article-title>
                    <source>

                        <italic toggle="yes">Biochem. Pharmacol.</italic>
</source>
                    <year>2020</year>;<volume>180</volume>:<fpage>114157</fpage>.
                    <pub-id pub-id-type="pmid">32687832</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.bcp.2020.114157</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref3">
                <label>3</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Qiu</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>H</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Emerging views of OPTN (optineurin) function in the autophagic process associated with disease.</article-title>
                    <source>

                        <italic toggle="yes">Autophagy.</italic>
</source>
                    <year>2022</year>;<volume>18</volume>(<issue>1</issue>):<fpage>73</fpage>&#x2013;<lpage>85</lpage>.
                    <pub-id pub-id-type="pmid">33783320</pub-id>
                    <pub-id pub-id-type="doi">10.1080/15548627.2021.1908722</pub-id>
                    <pub-id pub-id-type="pmcid">PMC8865304</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref4">
                <label>4</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Zhao</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Chen</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>An</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Optineurin overexpression ameliorates neurodegeneration through regulating neuroinflammation and mitochondrial quality in a murine model of amyotrophic lateral sclerosis.</article-title>
                    <source>

                        <italic toggle="yes">Front. Aging Neurosci.</italic>
</source>
                    <year>2025</year>;<volume>17</volume>:<fpage>1522073</fpage>.
                    <pub-id pub-id-type="pmid">39990107</pub-id>
                    <pub-id pub-id-type="doi">10.3389/fnagi.2025.1522073</pub-id>
                    <pub-id pub-id-type="pmcid">PMC11842329</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref5">
                <label>5</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Feng</surname>
                            <given-names>SM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Che</surname>
                            <given-names>CH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Feng</surname>
                            <given-names>SY</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Novel mutation in optineurin causing aggressive ALS+/-frontotemporal dementia.</article-title>
                    <source>

                        <italic toggle="yes">Ann. Clin. Transl. Neurol.</italic>
</source>
                    <year>2019</year>;<volume>6</volume>(<issue>12</issue>):<fpage>2377</fpage>&#x2013;<lpage>2383</lpage>.
                    <pub-id pub-id-type="pmid">31838784</pub-id>
                    <pub-id pub-id-type="doi">10.1002/acn3.50928</pub-id>
                    <pub-id pub-id-type="pmcid">PMC6917321</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref6">
                <label>6</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Xie</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Structural insights into the interaction and disease mechanism of neurodegenerative disease-associated optineurin and TBK1 proteins.</article-title>
                    <source>

                        <italic toggle="yes">Nat. Commun.</italic>
</source>
                    <year>2016</year>;<volume>7</volume>:<fpage>12708</fpage>.
                    <pub-id pub-id-type="pmid">27620379</pub-id>
                    <pub-id pub-id-type="doi">10.1038/ncomms12708</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5027247</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref7">
                <label>7</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ayoubi</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ryan</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Gonzalez Bolivar</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>A consensus platform for antibody characterization.</article-title>
                    <source>

                        <italic toggle="yes">Nat. Protoc.</italic>
</source>
                    <year>2024</year>.</mixed-citation>
            </ref>
            <ref id="ref8">
                <label>8</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Biddle</surname>
                            <given-names>MS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Virk</surname>
                            <given-names>HS</given-names>
                        </name>
</person-group>:
                    <article-title>YCharOS open antibody characterisation data: Lessons learned and progress made.</article-title>
                    <source>

                        <italic toggle="yes">F1000Res.</italic>
</source>
                    <year>2023</year>;<volume>12</volume>:<fpage>1344</fpage>.
                    <pub-id pub-id-type="pmid">37854875</pub-id>
                    <pub-id pub-id-type="doi">10.12688/f1000research.141719.1</pub-id>
                    <pub-id pub-id-type="pmcid">PMC10579855</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref9">
                <label>9</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Laflamme</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>McKeever</surname>
                            <given-names>PM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kumar</surname>
                            <given-names>R</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Implementation of an antibody characterization procedure and application to the major ALS/FTD disease gene C9ORF72.</article-title>
                    <source>

                        <italic toggle="yes">elife.</italic>
</source>
                    <year>2019</year>;<volume>8</volume>:<fpage>8</fpage>.
                    <pub-id pub-id-type="doi">10.7554/eLife.48363</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref10">
                <label>10</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Alshafie</surname>
                            <given-names>W</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Fotouhi</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Shlaifer</surname>
                            <given-names>I</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Identification of highly specific antibodies for Serine/threonine-protein kinase TBK1 for use in immunoblot, immunoprecipitation and immunofluorescence.</article-title>
                    <source>

                        <italic toggle="yes">F1000Res.</italic>
</source>
                    <year>2022</year>;<volume>11</volume>:<fpage>977</fpage>.
                    <pub-id pub-id-type="doi">10.12688/f1000research.124632.1</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref11">
                <label>11</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ayoubi</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ryan</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Biddle</surname>
                            <given-names>MS</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Scaling of an antibody validation procedure enables quantification of antibody performance in major research applications.</article-title>
                    <source>

                        <italic toggle="yes">elife.</italic>
</source>
                    <year>2023</year>;<volume>12</volume>:<fpage>12</fpage>.
                    <pub-id pub-id-type="doi">10.7554/eLife.91645.2</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref12">
                <label>12</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Bandrowski</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Pairish</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Eckmann</surname>
                            <given-names>P</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The Antibody Registry: ten years of registering antibodies.</article-title>
                    <source>

                        <italic toggle="yes">Nucleic Acids Res.</italic>
</source>
                    <year>2023</year>;<volume>51</volume>(<issue>D1</issue>):<fpage>D358</fpage>&#x2013;<lpage>D367</lpage>.
                    <pub-id pub-id-type="pmid">36370112</pub-id>
                    <pub-id pub-id-type="doi">10.1093/nar/gkac927</pub-id>
                    <pub-id pub-id-type="pmcid">PMC9825422</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref13">
                <label>13</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Bairoch</surname>
                            <given-names>A</given-names>
                        </name>
</person-group>:
                    <article-title>The Cellosaurus, a Cell-Line Knowledge Resource.</article-title>
                    <source>

                        <italic toggle="yes">J. Biomol. Tech.</italic>
</source>
                    <year>2018</year>;<volume>29</volume>(<issue>2</issue>):<fpage>25</fpage>&#x2013;<lpage>38</lpage>.
                    <pub-id pub-id-type="pmid">29805321</pub-id>
                    <pub-id pub-id-type="doi">10.7171/jbt.18-2902-002</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5945021</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref14">
                <label>14</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Stringer</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Michaelos</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Cellpose: a generalist algorithm for cellular segmentation.</article-title>
                    <source>

                        <italic toggle="yes">Nat. Methods.</italic>
</source>
                    <year>2021</year>;<volume>18</volume>(<issue>1</issue>):<fpage>100</fpage>&#x2013;<lpage>106</lpage>.
                    <pub-id pub-id-type="pmid">33318659</pub-id>
                    <pub-id pub-id-type="doi">10.1038/s41592-020-01018-x</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report425570">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.187366.r425570</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Buchanan</surname>
                        <given-names>Andrew</given-names>
                    </name>
                    <xref ref-type="aff" rid="r425570a1">1</xref>
                    <xref ref-type="aff" rid="r425570a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-5191-7682</uri>
                </contrib>
                <aff id="r425570a1">
                    <label>1</label>Stealth Biotech, Cambridge, Cambridgeshire, UK</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>17</day>
                <month>2</month>
                <year>2026</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2026 Buchanan A</copyright-statement>
                <copyright-year>2026</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport425570" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.169966.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>This is a clear and well set put example of antibody quality control for a range of experiments. The data is straight forward to interpret from the figures and tables. This enables the reader to have a well informed choice of what antibody to take into their experimental setting for further validation.</p>
            <p> </p>
            <p> A minor point is that for DepMap the authors say &gt;&#x00a0;2.5 log2 is a suitable cut-off, but they choose U2OS with 0.89 log2 TPM+1. However there was enough protein expression for the validation work.</p>
            <p>Are sufficient details of methods and materials provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Is the rationale for creating the dataset(s) clearly described?</p>
            <p>Yes</p>
            <p>Are the datasets clearly presented in a useable and accessible format?</p>
            <p>Yes</p>
            <p>Are the protocols appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Therapeutic antibody discovery and early development</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report440395">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.187366.r440395</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Moshinsky</surname>
                        <given-names>Deborah</given-names>
                    </name>
                    <xref ref-type="aff" rid="r440395a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0009-0000-4909-7489</uri>
                </contrib>
                <aff id="r440395a1">
                    <label>1</label>Institute for Protein Innovation, Boston, Massachusetts, USA</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>30</day>
                <month>12</month>
                <year>2025</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2025 Moshinsky D</copyright-statement>
                <copyright-year>2025</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport440395" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.169966.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>The authors tested 8 commercially available antibodies against optineurin (OPTN) for activity in Western Blot, Immunoprecipitation, and Immunofluorescence as part of a larger ongoing effort to address antibody reproducibility issues in Science.&#x00a0; They first made knockout cells using a cell line that was shown to express the target.&#x00a0; Then they ran bespoke assays using each of the 8 antibodies.&#x00a0; Results were shown clearly.&#x00a0; The authors describe briefly why they do not engage in result interpretation but did provide general guidance on interpreting data in their assays.&#x00a0; Readers can surmise from the data which antibodies should work well in their applications of choice.</p>
            <p> </p>
            <p> For the choice of cell line, it is stated that&#x00a0;cell lines that express the target at levels greater than 2.5 log
                <sub>2</sub>&#x00a0;(transcripts per million &#x201c;TPM&#x201d; + 1) have been found to be a suitable cut-off.&#x00a0; However,&#x00a0;U2OS expresses the protein optineuron transcript at less than 2.5 (0.89 log
                <sub>2</sub>&#x00a0;TPM+1).&#x00a0; Please explain or note that this is an outlier.&#x00a0; Also, as minor points 2 typos were identified in the article.&#x00a0; "performanyce" is present in the paragraph starting with 'In conclusion' after Figure 3.&#x00a0; Also, in the abstract, the word 'tested' is missing from the sentence, "Here we have eight optineurin commercial antibodies for western blot..."</p>
            <p>Are sufficient details of methods and materials provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Is the rationale for creating the dataset(s) clearly described?</p>
            <p>Yes</p>
            <p>Are the datasets clearly presented in a useable and accessible format?</p>
            <p>Yes</p>
            <p>Are the protocols appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Antibody characterization and validation</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
</article>
