<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.172631.2</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>The Impact of Promoter Variants in Interleukin-18 on Susceptibility to Ankylosing Spondylitis in a Sample of Iraqi Patients</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 2; peer review: 2 approved, 1 approved with reservations]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Jasim</surname>
                        <given-names>Ibtehal Kadhim</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Software</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <uri content-type="orcid">https://orcid.org/0009-0008-7264-4899</uri>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Saud</surname>
                        <given-names>Asmaa Mohammed</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="corresp" rid="c2">b</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Biotechnology, University of Baghdad, Baghdad, Baghdad Governorate, Iraq</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:ibtehal.kazem1706b@sc.uobaghdad.edu.iq">ibtehal.kazem1706b@sc.uobaghdad.edu.iq</email>
                </corresp>
                <corresp id="c2">
                    <label>b</label>
                    <email xlink:href="mailto:asmaa.saud@sc.uobaghdad.edu.iq">asmaa.saud@sc.uobaghdad.edu.iq</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>14</day>
                <month>5</month>
                <year>2026</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2025</year>
            </pub-date>
            <volume>14</volume>
            <elocation-id>1399</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>6</day>
                    <month>5</month>
                    <year>2026</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2026 Jasim IK and Saud AM</copyright-statement>
                <copyright-year>2026</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/14-1399/pdf"/>
            <abstract>
                <sec>
                    <title>Background</title>
                    <p>Ankylosing spondylitis (AS) is a chronic inflammatory illness mainly influencing the axial skeleton. It is a multifactorial illness in which environmental and genetic parameters contribute to its cause, one of which is interleukins, including interleukin-18 (IL-18). Therefore, this study aimed to investigate the association between single nucleotide polymorphism (SNP) rs549908 and serum levels of IL-18 in Iraqi patients with AS.</p>
                </sec>
                <sec>
                    <title>Methods</title>
                    <p>During the period of November 2024 and January 2025, a total of 100 individuals were enrolled in the present work, including 50 patients with AS and 50 healthy controls (HC), were obtained from Baghdad Teaching Hospital. Using enzyme-linked immunosorbent assay (ELISA) and TaqMan real-time polymerase chain reaction (PCR), serum levels and rs549908 genotyping of IL-18 were estimated.</p>
                </sec>
                <sec>
                    <title>Results</title>
                    <p>Significantly, levels of IL-18 in serum were raised in patients with AS compared to HC (235.7060 
                        <italic toggle="yes">vs.</italic> 151.10 pg/mL, p &lt; 0.001). Genetically, T allele frequency (69.0% vs. 49.0%, 
                        <italic toggle="yes">p =</italic> 0.006) and TT genotype frequency (53.1% vs. 23.5%, 
                        <italic toggle="yes">p =</italic> 0.004) were significantly greater in patients with AS compared to HC. Analysis under the model of dominant (TG + GG 
                        <italic toggle="yes">vs.</italic> TT) demonstrated significant association between status of illness and genotype (OR = 0.29, 
                        <italic toggle="yes">p =</italic> 0.007).</p>
                </sec>
                <sec>
                    <title>Conclusions</title>
                    <p>These outcomes suggest rs549908 SNP and serum levels of IL-18, are related with increased susceptibility to AS in the Iraqi population.</p>
                </sec>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>Keywords: Ankylosing spondylitis</kwd>
                <kwd>Interleukin-18</kwd>
                <kwd>rs549908 Polymorphism</kwd>
                <kwd>IL-18 serum levels</kwd>
                <kwd>Genetic Susceptibilities.</kwd>
            </kwd-group>
            <funding-group>
                <funding-statement>The author(s) declared that no grants were involved in supporting this work.</funding-statement>
            </funding-group>
        </article-meta>
        <notes>
            <sec sec-type="version-changes">
                <label>Revised</label>
                <title>Amendments from Version 1</title>
                <p>In this second version, the manuscript has been revised to improve linguistic clarity and technical accuracy. Key updates include correcting the English terminology (e.g., 'disease activity' instead of 'illness activity'), clarifying the Hardy&#x2013;Weinberg Equilibrium (HWE) statistical reporting, and enhancing the ROC curve analysis with additional diagnostic metrics (sensitivity, specificity, and cut-off points). The discussion section has also been expanded to incorporate recent relevant literature.</p>
            </sec>
        </notes>
    </front>
    <body>
        <sec id="sec5" sec-type="intro">
            <title>Introduction</title>
            <p>Ankylosing spondylitis (AS) is a chronic, inflammatory illness that largely impacts the axial joints, like the peripheral joints, sacroiliac joints, entheses and spine.
                <sup>
                    <xref ref-type="bibr" rid="ref1">1</xref>
                </sup> In AS, ankylosis, or the growth of new bone, causes long-term impairment, decreased mobility and spinal fusion.
                <sup>
                    <xref ref-type="bibr" rid="ref2">2</xref>
                </sup> It's still unclear what exactly causes AS. It has been proposed that the interplay among genetic and environmental factors serves a vital purpose.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>,
                    <xref ref-type="bibr" rid="ref4">4</xref>
                </sup> Proinflammatory cytokines such as TNF-alpha and other interleukins mediate a variety of inflammatory illnesses and are important modulators of inflammatory processes in the setting of AS.
                <sup>
                    <xref ref-type="bibr" rid="ref5">5</xref>
                </sup> Adaptive and innate immune responses are regulated by the pleiotropic, pro-inflammatory cytokine interleukin-18.
                <sup>
                    <xref ref-type="bibr" rid="ref6">6</xref>
                </sup> Interleukin-18 is primarily produced by neutrophils, dendritic cells, chondrocytes, keratinocytes, osteoblasts, and macrophages. It is a member of the interleukin 1 (IL-1) family. Through the caspase-1 proteolytic enzyme actions, the 23 kDa protein is transformed into the 18 kDa protein.
                <sup>
                    <xref ref-type="bibr" rid="ref7">7</xref>
                </sup> Depending on the inflammatory setting, IL-18 have an effective function in both Th1 and Th2 immune responses. Together with IL-12, IL-18 induces the formation of interferon-gamma, which strengthens the Th1-mediated immune response. When IL-12 is absent, IL-18 activates Th2 immune responses.
                <sup>
                    <xref ref-type="bibr" rid="ref8">8</xref>
                </sup> IL-18, as a pleiotropic and pro-inflammatory cytokine, can be generated in substantial amounts following infection and involved in innate and acquired immunity, inflammatory responses, and tumorigenesis.
                <sup>
                    <xref ref-type="bibr" rid="ref9">9</xref>
                </sup> Dysregulation of IL-18 has the potential to precipitate inflammatory or autoimmune pathologies that pertain to host defense mechanisms, oncogenesis, allergic reactions, immune responses, and arthritic conditions, among others.
                <sup>
                    <xref ref-type="bibr" rid="ref10">10</xref>
                </sup> Furthermore, IL-18 may serve as a pivotal relation among systemic inflammation and aberrant bone remodeling in arthritic conditions, by promoting osteoclast production and accelerating bone resorption.
                <sup>
                    <xref ref-type="bibr" rid="ref11">11</xref>
                </sup> It may have an effective function in the initiation of AS. With the advancement of molecular biological methodologies, single nucleotide polymorphisms (SNPs) within genes have increasingly become prevalent method for investigating illness susceptibilities.
                <sup>
                    <xref ref-type="bibr" rid="ref12">12</xref>
                </sup> Production of IL-18 protein is controlled via the 
                <italic toggle="yes">IL-18</italic> gene.
                <sup>
                    <xref ref-type="bibr" rid="ref13">13</xref>
                </sup> The human 
                <italic toggle="yes">IL-18</italic> gene, carried on chromosome 11q22.2&#x2013;q22.3, comprises six exons and contains various single nucleotide polymorphisms (SNPs). Among these, the rs549908 polymorphism is the focus of the current study.
                <sup>
                    <xref ref-type="bibr" rid="ref14">14</xref>
                </sup> Several 
                <italic toggle="yes">IL-18</italic> gene polymorphisms have been demonstrated to be related to raised IL-18 levels in immune-mediated disorders.
                <sup>
                    <xref ref-type="bibr" rid="ref15">15</xref>
                </sup> This study aimed to investigate the association between IL-18 rs549908 and the concentrations of IL-18 in the Iraqi patients with AS, and to assess their potential functions as genetic and inflammatory indicators in this population.</p>
        </sec>
        <sec id="sec6" sec-type="methods">
            <title>Methods</title>
            <sec id="sec7">
                <title>Subjects</title>
                <p>In the work, 50 patients diagnosed with AS and 50 HC were chosen and obtained from Baghdad Teaching Hospital, Medical City, Baghdad, Iraq, between November 2024 and January 2025. Information on lifestyles, particularly smoking habits, clinical diagnoses, and histories of administered therapy, was obtained from patients with AS. The AS diagnosis was confirmed in accordance with the criteria of spondylarthritis International Society (ASAS) 2009 classification for axial spondylarthritis.
                    <sup>
                        <xref ref-type="bibr" rid="ref16">16</xref>
                    </sup> Patients with AS measured their activity of illness through the Bath AS Disease activity index (BASDAI).
                    <sup>
                        <xref ref-type="bibr" rid="ref17">17</xref>
                    </sup>
                </p>
            </sec>
            <sec id="sec8">
                <title>Included criteria</title>
                <p>The range of age of patients with AS was 20 to 63 years. The HC were age- and sex-matched to the cases, with no previous history of autoimmune or inflammatory disorders.</p>
            </sec>
            <sec id="sec9">
                <title>Excluded criteria</title>
                <p>Individuals younger than 20 years or older than 63 years were excluded. Patients or controls with comorbidities, as well as those with autoimmune or inflammatory diseases such as inflammatory bowel disease, psoriasis, or rheumatoid arthritis, were also excluded.</p>
            </sec>
            <sec id="sec10">
                <title>Collection of blood samples</title>
                <p>A volume of 3 mL of peripheral blood was obtained from each participant into 5 mL EDTA tubes for extraction of DNA. In addition, 3 mL of blood was collected into gel tubes and placed in centrifuge for 15 minutes at 3000 rpm. The resultant serum were aliquoted and preserved at &#x2212;20&#x00b0;C till the time of immunological analysis.</p>
            </sec>
            <sec id="sec11">
                <title>Immunological assay</title>
                <p>Serum levels of IL-18 were measured using ELISA kit (FineTest, Wuhan Fine Biotech Co., Ltd., China; Cat. No. EH0011), in accordance with the manufacturer's instructions. Optical density was assessed at 450 nm with a microplate reader (HumaReader HS, Human GmbH, Germany).</p>
            </sec>
            <sec id="sec12">
                <title>Genotyping determination</title>
                <p>

                    <bold>DNA extraction</bold>
                </p>
                <p>From peripheral blood, genomic DNA was isolated and collected in EDTA-containing tubes utilizing the EasyPureBlood Genomic DNA Kit (TransGen Biotech, Beijing, China; Cat. No. EE121), depending to the manufacturer's guidelines. The purified DNA was eluted in 50 &#x03bc;L of elution buffer and stored at &#x2212;20 &#x00b0;C until further analysis.</p>
                <p>

                    <bold>SNP genotyping</bold>
                </p>
                <p>To amplify IL-18 SNPs (rs549908), TaqMan real-time polymerase chain reaction (RT-PCR) was utilised. Single reverse and single forward primers in addition to couple of probes were utilised and listed in 
                    <xref ref-type="table" rid="T1">
Table 1</xref>. The primers and probes were custom-synthesized by Synbio Technologies (China). PCR mix (total volume: 20 &#x03bc;L) consisted of 5 &#x03bc;L nuclease-free water, 6 &#x03bc;L SuperMix, 1.5 &#x03bc;L forward primer, 1 &#x03bc;L of each probe, 4 &#x03bc;L DNA, and 1.5 &#x03bc;L reverse primer. The mix was transferred to a PCR program (TransGen Biotech SuperMix/China). Amplification was performed under standard conditions: an initial denaturation cycle 95&#x00b0;C for 2 min, followed by 30 cycles of of denaturation 95&#x00b0;C for 30 sec, annealing 58&#x00b0;C for 1 min and extension 72&#x00b0;C for 30 sec. Amplification products were additionally verified by 1.5% agarose gel electrophoresis.</p>
                <table-wrap id="T1" orientation="portrait" position="float">
                    <label>
Table 1. </label>
                    <caption>
                        <title>Primer and probe sequences used for genotyping IL-18 gene rs549908 SNP.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Name</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Sequence (5&#x2032;&#x2192;3&#x2032;)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Length (base)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
Dye</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Forward Primer</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CTTATGACTGATAATTTAGATTCAAG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">26</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Reverse Primer</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">ATTGTAGCTACTTCTGGAACAG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">23</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">-</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Probe 1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TTGCCAAAGTAATCTGATTCCAGGTTTTCT</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">30</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">FAM</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Probe 2</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TTGCCAAAGTAATCGGATTCCAGGTTTTCT</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">30</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">HEX</td>
                            </tr>
                        </tbody>
                    </table>
                    <table-wrap-foot>
                        <p>FAM: Fluorescein amidite; HEX: Hexachlorofluorescein.</p>
                    </table-wrap-foot>
                </table-wrap>
            </sec>
            <sec id="sec13">
                <title>Statistical analysis</title>
                <p>Statistical analyses were carried out utilising SPSS software, version 20.0 (IBM Corp., Armonk, NY, USA). Descriptive statistics, including median, standard deviation, mean, percentage, and frequency, were used to describe clinical and demographic data. The Shapiro-Wilk test was utilised for the distribution of continuous variables. Normally distributed variables were analyzed using the independent samples t-test, while non-normally distributed variables were analyzed using the Mann-Whitney U test. Categorical variables, including genotype and allele frequencies, were analyzed using the chi-square test. Hardy-Weinberg equilibrium was assessed using chi-square analysis. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated using WinPepi software. Values p &lt; 0.05 were regarded as statistically significant.</p>
            </sec>
        </sec>
        <sec id="sec14" sec-type="results">
            <title>Results</title>
            <p>Based on the results in 
                <xref ref-type="table" rid="T2">
Table 2</xref>, the mean age of patients with AS was greater (39.9000 &#x00b1; 11.23815 years) than that of the control group (31.0600 &#x00b1; 10.46356 years), though the variation did not reach statistical significance (p = 0.059). Similarly, there was no significant variation in body mass index (BMI) among the AS group (28.2360 &#x00b1; 5.18683 kg/m
                <sup>2</sup>) and HC (26.7920 &#x00b1; 3.80541 kg/m
                <sup>2</sup>; p = 0.060). Sex distribution revealed a greater proportion of males among patients with AS (72%) compared to controls (60%), which was statistically significant (p &lt; 0.001). A notable finding was the presence of a family history of AS in 22% of patients, while none of the controls reported a positive family history (p &lt; 0.001), indicating a potential genetic predisposition in the patient group. Regarding inflammatory markers, erythrocyte sedimentation rate (ESR) was significantly elevated in patients with AS (18.62 &#x00b1; 16.52937 mm/hr) compared to controls (8.28 &#x00b1; 5.05092 mm/hr; p &lt; 0.001), supporting an ongoing inflammatory state. C-reactive protein (CRP) was positive in 28% of patients with AS and negative in all control subjects (p &lt; 0.001), further corroborating the presence of systemic inflammation in the AS group. Assessment of disease activity using the Bath Ankylosing Spondylitis Disease activity index (BASDAI) showed a mean score of 4.90 &#x00b1; 1.00 in patients, while all healthy controls had a BASDAI of 0.00 (p &lt; 0.001). Among patients with AS, 80% were classified as having moderate disease activity, and 20% had severe illness, whereas no disease activity was reported in the control group (p &lt; 0.001).</p>
            <table-wrap id="T2" orientation="portrait" position="float">
                <label>
Table 2. </label>
                <caption>
                    <title>Demographic and clinical characteristics of AS and HC.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="left" colspan="2" rowspan="1" valign="top">Parameter</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">AS (n = 50)</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">HC (n = 50)</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">

                                <italic toggle="yes">p-</italic>value</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td align="left" colspan="2" rowspan="1" valign="top">
                                <bold>Age (mean &#x00b1; S.D.) year</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">39.9000 &#x00b1; 11.23815</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">31.0600 &#x00b1; 10.46356</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.059 NS</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="2" valign="top">
                                <bold>Sex N (%)</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>Male</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">36 (72%)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">30 (60.0%)</td>
                            <td align="left" colspan="1" rowspan="2" valign="top">&lt;0.001
                                <xref ref-type="table-fn" rid="tfn2">**</xref>
                            </td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>Female</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">14 (28%)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">20 (40.0%)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="2" valign="top">
                                <bold>Family history N (%)</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>Yes</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">11 (22%)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0 (0.0%)</td>
                            <td align="left" colspan="1" rowspan="2" valign="top">&lt;0.001
                                <xref ref-type="table-fn" rid="tfn2">**</xref>
                            </td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>No</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">39 (78%)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">50 (100.0%)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="2" valign="top">
                                <bold>Activity of illness N (%)</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>Moderate</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">40 (80.0%)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0 (0.0%)</td>
                            <td align="left" colspan="1" rowspan="2" valign="top">&lt;0.001
                                <xref ref-type="table-fn" rid="tfn2">**</xref>
                            </td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>Severe</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">10 (20.0%)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0 (0.0%)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="2" valign="top">
                                <bold>CRP N (%)</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>Negative</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">36 (72%)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">50 (100.0%)</td>
                            <td align="left" colspan="1" rowspan="2" valign="top">&lt;0.001
                                <xref ref-type="table-fn" rid="tfn2">**</xref>
                            </td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>Positive</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">14 (28%)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0 (0.0%)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="2" rowspan="1" valign="top">
                                <bold>ESR (Mean &#x00b1; S.D.) mm/hr</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">18.6200 &#x00b1; 16.52937</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">8.2800 &#x00b1; 5.05092</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">&lt;0.001
                                <xref ref-type="table-fn" rid="tfn2">**</xref>
                            </td>
                        </tr>
                        <tr>
                            <td align="left" colspan="2" rowspan="1" valign="top">
                                <bold>BMI (mean &#x00b1; S. D.) kg/m</bold>
                                <sup>

                                    <bold>2</bold>
                                </sup>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">28.2360 &#x00b1; 5.18683</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">26.7920 &#x00b1; 3.80541</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.060 NS</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="2" rowspan="1" valign="top">
                                <bold>BASDAI Mean &#x00b1; S.D.</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">4.90 &#x00b1; 1.00</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.00 &#x00b1; 0.000</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">&lt;0.001
                                <xref ref-type="table-fn" rid="tfn2">**</xref>
                            </td>
                        </tr>
                    </tbody>
                </table>
                <table-wrap-foot>
                    <p>AS: Ankylosing spondylitis; HC: Healthy control; p: Probability; S. D.; Standard deviation; %: Percentage; Min: Minimum; max: Maximum; N: Number in each parameter; CRP: C-reactive protein; ESR: Erythrocyte sedimentation rate; BMI: Body mass index; BASDAI: Bath AS Disease activity index; NS: Non-significant.</p>
                    <fn-group content-type="footnotes">
                        <fn id="tfn2">
                            <label>**</label>
                            <p>Highly significant.</p>
                        </fn>
                    </fn-group>
                </table-wrap-foot>
            </table-wrap>
            <p>As displayed in 
                <xref ref-type="table" rid="T3">
Table 3</xref>, serum IL-18 levels were significantly greater in patients with AS (median of 235.7060, range (23-485.78)) compared to HC (median 151.10, range (102.04-250.19)), with highly significant variations (p &lt; 0.001).</p>
            <table-wrap id="T3" orientation="portrait" position="float">
                <label>
Table 3. </label>
                <caption>
                    <title>Interleukin-18 level of patients with AS in comparison with HC.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="left" colspan="1" rowspan="1" valign="top">Group</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">No. of subject</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">IL-18 (pg/ml) Median (min-max)</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">
P-value
</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>AS</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">50</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">235.7060 (23-485.78)</td>
                            <td align="left" colspan="1" rowspan="2" valign="top">&lt;0.001**</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>HC</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">50</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">151.10 (102.04-250.19)</td>
                        </tr>
                    </tbody>
                </table>
                <table-wrap-foot>
                    <p>
AS: Ankylosing spondylitis; HC: Healthy control; p: Probability; N: Number in each parameter; IL: Interleukin; pg/ml: Picograms per milliliter.</p>
                </table-wrap-foot>
            </table-wrap>
            <p>
                <xref ref-type="table" rid="T4">
Table 4</xref> illustrates the correlation analysis between serum IL-18 levels with clinical and inflammatory parameters in patients with ankylosing spondylitis. In particular, IL-18 revealed no significant correlation with BASDAI (p = 0.843), ESR (p = 0.915) or BMI (p = 0.884).</p>
            <table-wrap id="T4" orientation="portrait" position="float">
                <label>
Table 4. </label>
                <caption>
                    <title>Correlations of interleukin-18 levels with clinical and inflammatory parameters in patients with Ankylosing Spondylitis.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="left" colspan="1" rowspan="1" valign="top"/>
                            <th align="left" colspan="1" rowspan="1" valign="top">BASDAI</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">ESR</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">IL-18</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">
BMI</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>BASDAI</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.255</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.029</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">-0.086</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>P-value
</bold>
</td>
                            <td colspan="1" rowspan="1"/>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.074</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.843</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.553</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>ESR</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.255</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">-0.015</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.254</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>P-value
</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.074</td>
                            <td colspan="1" rowspan="1"/>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.915</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.075</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>IL-18</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.029</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">-0.015</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">-0.021</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>P-value
</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.843</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.915</td>
                            <td colspan="1" rowspan="1"/>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.884</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>BMI</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">-0.086</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.254</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">-0.021</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>P-value
</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.553</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.075</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.884</td>
                            <td colspan="1" rowspan="1"/>
                        </tr>
                    </tbody>
                </table>
                <table-wrap-foot>
                    <p>BASDAI: Bath ankylosing spondylitis disease activity index; Index; IL: Interleukin; P-value: Probability; ESR: Erythrocyte sedimentation rate; BMI: Body mass index.</p>
                </table-wrap-foot>
            </table-wrap>
            <p>To evaluate the diagnostic value of IL-18, a ROC curve was generated (
                <xref ref-type="fig" rid="f1">
Figure 1</xref>). The analysis showed an AUC of 0.943 (p &lt; 0.001), At a criterion value &gt;185.97, sensitivity and specificity were 96.0% and 92.0%, respectively, which reflected excellent diagnostic accuracy. These results suggested that IL-18 has strong potential as a biomarker for differentiating AS patients from healthy individuals.</p>
            <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                <label>Figure 1. </label>
                <caption>
                    <title>Receiver Operating Characteristic (ROC) curve of IL-18 for predicting susceptibility to ankylosing spondylitis.</title>
                </caption>
                <graphic id="gr1" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/200795/61debc28-83c4-4f2c-ba74-67d0fd1831a6_figure1.gif"/>
            </fig>
            <p>
                <xref ref-type="table" rid="T5">
Table 5</xref>, showed the frequencies of alleles and genotype of the IL-18 rs549908 polymorphism for both patients and HC. The results revealed that there was a significant relation among TT genotype and patients compared to HC (OR = 3.52, p 
                <italic toggle="yes">=</italic> 0.004). In contrast, the TG and GG genotypes showed no statistically significant variations among groups (p 
                <italic toggle="yes">=</italic> 0.15 and p 
                <italic toggle="yes">=</italic> 0.21). The study found that the T allele was significantly more prevalent among patients with AS than in HC (OR = 2.32, p 
                <italic toggle="yes">=</italic> 0.006). Conversely, G exhibited a relatively low frequency in patients, compared to HC (OR = 0.43, p 
                <italic toggle="yes">=</italic> 0.006).</p>
            <table-wrap id="T5" orientation="portrait" position="float">
                <label>
Table 5. </label>
                <caption>
                    <title>Frequencies of alleles and genotype of the rs549908 of gene in AS and HC.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="left" colspan="1" rowspan="2" valign="top">Genotype and Allele Frequencies</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">AS (n= 50)</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">HC (n= 50)</th>
                            <th align="left" colspan="1" rowspan="2" valign="top">OR</th>
                            <th align="left" colspan="1" rowspan="2" valign="top">95%CI</th>
                            <th align="left" colspan="1" rowspan="2" valign="top">
P-value
</th>
                        </tr>
                        <tr>
                            <th align="left" colspan="1" rowspan="1" valign="top">N (%)</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">N (%)</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>TT</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">26 (0.531)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">12 (0.235)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">3.52</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.51-8.19</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.004</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>TG</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">17 (0.347)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">25 (0.490)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.54</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.24-1.19</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.15</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>GG</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">7 (0.140)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">13 (0.275)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.46</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.17-1.27</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.21</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>T</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">69 (0.69)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">49 (0.49)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">2.32</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.36-4.27</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.006</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>G</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">31 (0.31)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">51 (0.51)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.43</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.24-0.77</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.006</td>
                        </tr>
                    </tbody>
                </table>
                <table-wrap-foot>
                    <p>AS: Ankylosing spondylitis; HC: Healthy control; OR: Odd ratio; C.I.: Confidence Interval.</p>
                </table-wrap-foot>
            </table-wrap>
            <p>The amplification plot illustrates the fluorescence intensity versus the PCR cycles for all samples in 
                <xref ref-type="fig" rid="f2">Figure 2</xref>. Each curve represents a single sample, showing successful amplification of IL-18 rs549908. The exponential phase was clearly visible after cycle 20, confirming the validity of the genotyping assay.</p>
            <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                <label>Figure 2. </label>
                <caption>
                    <title>SNPs genotyping amplification plots of IL-18 rs549908.</title>
                </caption>
                <graphic id="gr2" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/200795/61debc28-83c4-4f2c-ba74-67d0fd1831a6_figure2.gif"/>
            </fig>
            <p>In 
                <xref ref-type="fig" rid="f3">
Figure 3</xref>, the dual-color scatter plot displayed distinct separation of the genotypes. Samples were clearly distributed into three well-defined clusters corresponding to the TT, TG, and GG genotypes. Each point represented an individual sample, and the separation of the clusters provided clear discrimination between homozygous and heterozygous alleles.</p>
            <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                <label>Figure 3. </label>
                <caption>
                    <title>SNPs genotyping amplification plots showing fluorescence signals that indicate the alleles A and B in homozygous and heterozygous genotypes of IL-18 rs549908.</title>
                </caption>
                <graphic id="gr3" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/200795/61debc28-83c4-4f2c-ba74-67d0fd1831a6_figure3.gif"/>
            </fig>
            <p>To test Hardy-Weinberg equilibrium (HWE) for the IL-18 rs549908 polymorphism, a chi-squared test was conducted. As presented in 
                <xref ref-type="table" rid="T6">
Table 6</xref>, the genotype distribution in both the AS patient group (&#x03c7;
                <sup>2</sup> = 2.10, p 
                <italic toggle="yes">=</italic> 0.14) and the control group (&#x03c7;
                <sup>2</sup> = 8.006 &#x00d7; 10
                <sup>&#x2212;6</sup>, p 
                <italic toggle="yes">=</italic> 0.99) showed no significant deviation from HWE. These outcomes demonstrated that genotype distributions were consistent with Hardy-Weinberg in both groups.</p>
            <table-wrap id="T6" orientation="portrait" position="float">
                <label>
Table 6. </label>
                <caption>
                    <title>Hardy-Weinberg equilibrium of the rs549908 of gene in the patients and HC.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="left" colspan="1" rowspan="1" valign="top">HWE</th>
                            <th align="left" colspan="2" rowspan="1" valign="top">AS (n = 50)</th>
                            <th align="left" colspan="2" rowspan="1" valign="top">HC (n = 50)</th>
                        </tr>
                        <tr>
                            <th align="left" colspan="1" rowspan="1" valign="top">Genotypes</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Observed</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Expected</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Observed</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">
Expected</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">TT</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">26</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">23.8</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">12</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">12.0</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">TG</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">17</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">21.4</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">25</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">25.0</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">GG</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">7</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">4.8</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">13</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">13.0</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">X
                                <sup>2</sup> value</td>
                            <td align="left" colspan="2" rowspan="1" valign="top">2.10</td>
                            <td align="left" colspan="2" rowspan="1" valign="top">8.006 &#x00d7; 10
                                <sup>&#x2212;6</sup>
                            </td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <italic toggle="yes">p-</italic>value</td>
                            <td align="left" colspan="2" rowspan="1" valign="top">0.14</td>
                            <td align="left" colspan="2" rowspan="1" valign="top">0.99</td>
                        </tr>
                    </tbody>
                </table>
                <table-wrap-foot>
                    <p>AS: Ankylosing spondylitis; HC: Healthy control; HWE: Hardy-Weinberg equilibrium; O: Observed; E: Expected; p: Probability; &#x03c7;
                        <sup>2</sup>: Chi-squared.</p>
                </table-wrap-foot>
            </table-wrap>
            <p>Based on the analysis of the genetic model provided in 
                <xref ref-type="table" rid="T7">
Table 7</xref>, the possible mode of inheritance of the polymorphism rs549908 regarding illness risk was assessed. In the dominant model, the combination of the TG and GG genotypes demonstrated a significant relationship with a protective effect against the illness (OR = 0.29, p 
                <italic toggle="yes">=</italic> 0.007) in comparison to the TT genotype. On the contrary, the recessive model, which compared the GG genotype with the combined TG and TT genotypes, showed no statistically significant relation (OR = 0.46, p 
                <italic toggle="yes">=</italic> 0.21). Likewise, the over-dominant model that compared TG genotypes with the combined TT and GG genotypes showed no significant relation (OR = 0.49, p 
                <italic toggle="yes">=</italic> 0.10).</p>
            <table-wrap id="T7" orientation="portrait" position="float">
                <label>
Table 7. </label>
                <caption>
                    <title>Genetic model action of the 
                        <italic toggle="yes">IL-18</italic> gene.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="left" colspan="1" rowspan="1" valign="top">Genetic model</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Genotypes</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Patients (n = 50)</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">HC (n = 50)</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">OR</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">95% C.I.</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">
P-value
</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td align="left" colspan="1" rowspan="2" valign="top">
                                <bold>Dominant</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>TG+GG</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">17/7</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">25/13</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.29</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.13-0.68</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.007</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>TT (Ref.)</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">26</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">12</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="2" valign="top">
                                <bold>Recessive</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>TG+TT (Ref.)</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">17/26</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">25/12</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>GG</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">7</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">13</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.46</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.17-1.27</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.21</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="2" valign="top">
                                <bold>Over-dominant
</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>TT+GG (Ref.)</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">26/7</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">12/13</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>TG</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">17</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">25</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.49</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.22-1.09</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.1</td>
                        </tr>
                    </tbody>
                </table>
                <table-wrap-foot>
                    <p>AS: Ankylosing spondylitis; HC: Healthy control; OR: Odd ratio; C.I.: Confidence Interval; P: Probability.</p>
                </table-wrap-foot>
            </table-wrap>
            <p>The relationship among IL-18 levels and rs549908 genotypes in both patients and HC with different disease activity was presented in 
                <xref ref-type="table" rid="T8">
Table 8</xref>. According to the outcomes, in the control group, IL-18 levels exhibited a significant level of consistency for different genotypes. In individuals with moderate disease activity, IL-18 concentration was elevated across all the genotypes, with GG (268.42 pg/mL), TT (239.06 pg/mL), and TG (222.26 pg/mL) genotypes having mean values that were greater when compared to the control group. Likewise, IL-18 was elevated in individuals with severe disease activity GG (251.52 pg/mL), TG (249.25 pg/mL), TT (231.03 pg/mL). There were statistically significant variations in the IL-18 levels in serum among the genotypes and activity of the illness (p 
                <italic toggle="yes">=</italic> 0.001).</p>
            <table-wrap id="T8" orientation="portrait" position="float">
                <label>
Table 8. </label>
                <caption>
                    <title>Relationship among rs549908 genotypes and serum IL-18 levels according to disease activity in patients and HC.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="left" colspan="1" rowspan="1" valign="top">Activity</th>
                            <th align="left" colspan="1" rowspan="1" valign="top"/>
                            <th align="left" colspan="1" rowspan="1" valign="top">rs549908</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">n</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">
IL-18</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td align="left" colspan="2" rowspan="3" valign="top">
                                <bold>HC</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>GG</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>13</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">153.218 (134.11-185.97)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>TG</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>25</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">142.7650 (131.00-175.10)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>TT</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>12</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">162.7315 (150.39-185.32)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="6" valign="top">
                                <bold>AS</bold>
</td>
                            <td align="left" colspan="1" rowspan="3" valign="top">
                                <bold>Moderate</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>GG</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>5</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">268.4210 (169.55-279.02)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>TG</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>11</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">222.2640 (187.09-391.88)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>TT</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>23</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">239.0620 (178.77-485.78)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="3" valign="top">
                                <bold>severe</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>GG</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>2</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">251.5230 (245.45-257.59)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>TG</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>6</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">249.2480 (205.66-333.46)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>TT</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>3</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">231.0290 (216.31-249.57)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>

                                    <italic toggle="yes">p-</italic>value</bold>
</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.001</td>
                        </tr>
                    </tbody>
                </table>
                <table-wrap-foot>
                    <p>
AS: Ankylosing spondylitis; HC: Healthy control; p: Probability; N: Number in each parameter; IL: Interleukin; pg/ml: Picograms per milliliter.</p>
                </table-wrap-foot>
            </table-wrap>
        </sec>
        <sec id="sec15" sec-type="discussion">
            <title>Discussion</title>
            <p>This study investigated the relation among the IL-18 rs549908 polymorphism and susceptibilities to ankylosing spondylitis (AS) in an Iraqi population by analyzing the distribution of genotypes and alleles, as well as evaluating serum IL-18 levels as a potential inflammatory biomarker. The IL-18 rs549908 polymorphism appeared to have a genetic component to, susceptibilities, since the investigation found significant variations in frequencies of alleles and genotype among patients with AS and healthy controls. Serum IL-18 levels were also noticeably greater in patients with AS, confirming the substance's function as an important inflammatory marker in the illness.
                <sup>
                    <xref ref-type="bibr" rid="ref18">18</xref>
                </sup> In this investigation, ankylosing spondylitis patients had considerably greater serum IL-18 concentrations (235.7060 pg/mL) than healthy controls (151.10 pg/mL; p = 0.001). Furthermore, the correlation between the serum IL-18 and clinical parameters, such as BASDAI, ESR, and BMI, in the patients with AS, was examined, and no statistically significant correlations were observed. These findings were consistent with previous reports, which indicated that although IL-18 levels were increased in AS patients, they did not significantly associate with clinical activity measures, suggesting that IL-18 may reflect disease susceptibility rather than activity.
                <sup>
                    <xref ref-type="bibr" rid="ref19">19</xref>
                </sup> Chromosome 11q22.2&#x2013;22.3 contains the IL18 gene, and a number of variants in its promoter area have been linked to a raised risk of developing a number of inflammatory and autoimmune illnesses.
                <sup>
                    <xref ref-type="bibr" rid="ref15">15</xref>
                </sup> There was a strong correlation among the TT genotype and heightened vulnerability to ankylosing spondylitis (AS), according to the study of the IL-18 rs549908 genotype distribution. With an odds ratio (OR) of 3.52 (p = 0.004), 53.1% of patients with AS and 23.5% of healthy controls were found to have the TT genotype. On the other hand, the frequency of the G allele was 31.0% in individuals and 51.0% in controls (OR = 0.43, p = 0.006), suggesting a possible protective impact. In the Iraqi population under study, these results imply that the TT genotype could operate as a genetic predisposing factor for AS. A synonymous polymorphism found in the IL18 gene's exon region, the rs549908 variation had been linked in the past to a number of autoimmune disorders, such as atrophic conditions, systemic lupus erythematosus (SLE), and rheumatoid arthritis (RA).
                <sup>
                    <xref ref-type="bibr" rid="ref20">20</xref>
                </sup> In line with these outcomes, Abdulridha 
                <italic toggle="yes">et al.</italic> found that immune-regulatory gene polymorphisms were substantially linked to a greater risk of autoimmune illnesses.
                <sup>
                    <xref ref-type="bibr" rid="ref21">21</xref>
                </sup> Notably, Kirkik et al. demonstrated a significant association between the TLR4 rs41426344 polymorphism and disease activity in Turkish patients with ankylosing spondylitis, emphasizing the importance of immune-regulatory gene variants in AS pathogenesis across different populations.
                <sup>
                    <xref ref-type="bibr" rid="ref22">22</xref>
                </sup> These results provide more credence to the theory that rs549908 played a role in the genetic vulnerability that underlies AS. Although this study focused specifically on the IL-18 rs549908 polymorphism. The outcomes aligned with broader research emphasizing the role of genetic variation in immune-regulatory pathways underlying autoimmune illness susceptibilities. Genetic model analysis indicated a significant dominant inheritance pattern, where individuals carrying TG or GG genotypes exhibited a markedly reduced risk of developing ankylosing spondylitis compared to TT homozygotes (OR = 0.29, p = 0.007). This suggested that the presence of the G allele might have conferred a protective effect against AS. Comparable relations were observed in studies of other immune-related disorders, where variants within immune-modulating genes were similarly linked to illness risk under dominant genetic models. These outcomes reinforced the notion that polymorphisms influencing immune function contributed to immune dysregulation and supported the multifactorial etiology of autoimmune illnesses.
                <sup>
                    <xref ref-type="bibr" rid="ref23">23</xref>,
                    <xref ref-type="bibr" rid="ref24">24</xref>
                </sup> Serum IL-18 levels were further analyzed in relation to IL-18 rs549908 genotypes and disease activity scores in individuals with ankylosing spondylitis. Across all genotypes, patients with AS exhibited significantly greater IL-18 concentrations compared to healthy controls (p = 0.001). Among individuals with moderate disease activity, the highest serum IL-18 levels were observed in individuals with the GG genotype (268.42 pg/mL), followed by those with TT and TG genotypes. A similar trend was noted in patients with severe disease activity, although the absolute IL-18 values were slightly lower than in the moderate group. These outcomes suggest that while the TT genotype was associated with increased susceptibility to AS, serum IL-18 levels did not correlate directly with genotype. This indicates that IL-18 levels may be regulated by additional factors beyond genetic variation at rs549908. Similar observations were reported by Doss 
                <italic toggle="yes">et al.</italic>, who found no significant variations in serum IL-18 concentrations among different IL-18 genotypes in individuals with cutaneous lichen planus.
                <sup>
                    <xref ref-type="bibr" rid="ref25">25</xref>
                </sup> The markedly elevated serum IL-18 levels in AS patients, it was crucial to account for potential confounding factors such as biologic therapy, disease duration, and co-infections, which may affect IL-18 concentrations independently of genotype, demonstrating the need for caution in the interpretation of these elevated cytokine levels. Limited samples in GG genotype group may be considered as the cause for immune differences between people and the extent of illness, which will affect the cytokine level instead of genotype. Nevertheless, even though the sample size was limited and affected the generality of the results, this study is the first study where the genotype was associated with AS development among the Iraqi population. Further studies need to investigate the polymorphisms in rs549908 in other autoimmune diseases among the Middle East populations in order to increase the knowledge about immune system-related genes in the region. Currently, the study has shown that some IL-18 polymorphisms are statistically associated with AS resistance. Actually, the genotypes GT and the protective allele were found to have a reduced susceptibility even after adjusting for other potential confounders. This finding agrees with those of other previously conducted studies that reported an inverse relationship between the genotypes GC (rs187238) and AG (rs360719) with the occurrence of inflammation. Hence, it can be concluded that the presence of these IL-18 polymorphisms has a protective effect on AS. These results align with and expand upon previous investigations of IL-18 polymorphisms in immune-mediated and inflammatory conditions. For example, Liang 
                <italic toggle="yes">et al.</italic> reported associations of rs187238 and rs1946518 with biliary atresia, supporting the concept that IL-18 variants can alter disease risk in diverse contexts.
                <sup>
                    <xref ref-type="bibr" rid="ref26">26</xref>
                </sup> Similarly, Lando 
                <italic toggle="yes">et al</italic> and Aboraia 
                <italic toggle="yes">et al.</italic> identified rs549908 as a variant associated with total IgE levels in asthma patients across European populations, further reinforcing its involvement in immune dysregulation.
                <sup>
                    <xref ref-type="bibr" rid="ref27">27</xref>,
                    <xref ref-type="bibr" rid="ref28">28</xref>
                </sup> However, at times, contrary findings have been found in connection with the differences in genetics and environment. This is illustrated in a study by Eitan et al., where none of rs187238, rs1946518, or rs549908 were associated with alopecia areata among Jordanians.
                <sup>
                    <xref ref-type="bibr" rid="ref29">29</xref>
                </sup> Similarly, Mazurek-Mochol et al. found that there was no significant relationship between SNP rs187238 and the predisposition towards periodontitis, despite a difference in IL-18 gene expression existing amongst individuals with differing genotypes.
                <sup>
                    <xref ref-type="bibr" rid="ref13">13</xref>
                </sup> Such contradictions made it clear that IL-18 plays a rather complicated role as a pro-inflammatory cytokine and, under certain circumstances, may act as a possible protective agent against disease. The outcomes of the study are especially important due to the fact that they demonstrate that the polymorphism of the IL-18 gene resulted in a lower probability of AS appearance. In its turn, it is well-known that according to the data of multiple studies related to various other diseases, some mutations resulted in higher chances of pathology development. Thus, it may be assumed that for the AS case, there is a particular allele that can avoid inflammation. Supporting this, de Almeida Viana 
                <italic toggle="yes">et al.</italic> showed that rs187238 influenced lipid metabolism in COVID-19 patients, suggesting pleiotropic effects of IL-18 polymorphisms beyond classical inflammation.
                <sup>
                    <xref ref-type="bibr" rid="ref30">30</xref>
                </sup> Taken together, these findings imply that the biological effect of IL-18 variants may be disease and tissue-specific.</p>
        </sec>
        <sec id="sec16" sec-type="conclusion">
            <title>Conclusion</title>
            <p>This pilot study demonstrated that serum levels of IL-18 were significantly elevated in patients with ankylosing spondylitis (AS), suggesting a potential role of this cytokine in disease pathogenesis. Moreover, the T allele and TT genotype of the IL-18 rs549908 SNP were associated with an increased susceptibility to AS in the Iraqi population, whereas the G allele, particularly in the GG and TG genotypes, appeared to confer a protective effect under a dominant genetic model. However, these findings should be interpreted with caution. The relatively small study population limits the generalizability of the results, and the observed associations must therefore be considered preliminary and exploratory in nature. Larger studies across diverse populations are required to validate these findings and to clarify the functional impact of IL-18 gene polymorphisms in the onset and progression of AS.</p>
        </sec>
        <sec id="sec17">
            <title>Ethical considerations</title>
            <p>Ethical approval was obtained from the Biotechnology Department Ethics Committee at the College of Science, University of Baghdad (No. CSEC/0725/0086 on July 12, 2025). Every participant gave written informed consent before they enrolled.</p>
        </sec>
    </body>
    <back>
        <sec id="sec20" sec-type="data-availability">
            <title>Data availability</title>
            <p>Zenodo. The Impact of Promoter Variants in Interleukin-18 on Susceptibility to Ankylosing Spondylitis in a sample of Iraqi Patients 
                <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.5281/zenodo.17716124">https://doi.org/10.5281/zenodo.17716124</ext-link> (Ibtehal et al., 2025).
                <sup>
                    <xref ref-type="bibr" rid="ref31">31</xref>
                </sup>
            </p>
            <p>This project comprises the following underlying data:
                <list list-type="bullet">
                    <list-item>
                        <label>&#x2022;</label>
                        <p>STROBE_checklist.pdf (Completed STROBE checklist for this study).</p>
                    </list-item>
                    <list-item>
                        <label>&#x2022;</label>
                        <p>Raw_Data.xlsx (Individual raw data underlying all means, standard deviations, figures, and tables reported in the article).</p>
                    </list-item>
                </list>
            </p>
            <p>The data is available under the 
                <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution 4.0 International</ext-link> (CC-BY 4.0) license.</p>
            <p>The assay kits utilized in this investigation are commercially available. The manufacturer procedures are accessible via the following links:
                <list list-type="bullet">
                    <list-item>
                        <label>&#x2022;</label>
                        <p>EasyPure
                            <sup>&#x00ae;</sup> Blood Genomic DNA Kit (TransGen Biotech): 
                            <ext-link ext-link-type="uri" xlink:href="https://www.transgenbiotech.com/genomic_dna_purification/easypure_blood_genomic_dna_kit.html">https://www.transgenbiotech.com/genomic_dna_purification/easypure_blood_genomic_dna_kit.html</ext-link>
                        </p>
                    </list-item>
                    <list-item>
                        <label>&#x2022;</label>
                        <p>Human IL-18 ELISA Kit (Cat. No. EH0011, FineTest): 
                            <ext-link ext-link-type="uri" xlink:href="https://www.fn-test.com/product/eh0011">https://www.fn-test.com/product/eh0011</ext-link>
                        </p>
                    </list-item>
                </list>
            </p>
            <sec id="sec21">
                <title>Reporting guidelines</title>
                <p>This observational study was conducted in accordance with the STROBE (Strengthening the Reporting of Observational Studies in Epidemiology) reporting guidelines.</p>
            </sec>
        </sec>
        <ack>
            <title>Acknowledgments</title>
            <p>Appreciation is expressed to the University of Baghdad, College of Sciences, Department of Biotechnology, and the Rheumatology Unit of Baghdad Teaching Hospital.</p>
        </ack>
        <ref-list>
            <title>References</title>
            <ref id="ref1">
                <label>1</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Pishgahi</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Abolhasan</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Danaii</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Immunological and oxidative stress biomarkers in ankylosing spondylitis patients with or without metabolic syndrome.</article-title>
                    <source>

                        <italic toggle="yes">Cytokine.</italic>
</source>
                    <year>2020</year>;<volume>128</volume>:<fpage>155002</fpage>.
                    <pub-id pub-id-type="doi">10.1016/j.cyto.2020.155002</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref2">
                <label>2</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Voruganti</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bowness</surname>
                            <given-names>P</given-names>
                        </name>
</person-group>:
                    <article-title>New developments in our understanding of ankylosing spondylitis pathogenesis.</article-title>
                    <source>

                        <italic toggle="yes">Immunology.</italic>
</source>
                    <year>2020</year>;<volume>161</volume>(<issue>2</issue>):<fpage>94</fpage>&#x2013;<lpage>102</lpage>.
                    <pub-id pub-id-type="pmid">32696457</pub-id>
                    <pub-id pub-id-type="doi">10.1111/imm.13242</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7496782</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref3">
                <label>3</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Salem</surname>
                            <given-names>IA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Al-Najar</surname>
                            <given-names>AF</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Joda</surname>
                            <given-names>AT</given-names>
                        </name>
</person-group>:
                    <article-title>Evaluation of Apelin and Tartrate-Resistant Acid Phosphatase-5b in Ankylosing Spondylitis Male Patients With and Without Osteoporosis.</article-title>
                    <source>

                        <italic toggle="yes">Iraqi J. Sci.</italic>
</source>
                    <year>2019</year>;<volume>60</volume>(<issue>3</issue>):<fpage>426</fpage>&#x2013;<lpage>431</lpage>.</mixed-citation>
            </ref>
            <ref id="ref4">
                <label>4</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sharip</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kunz</surname>
                            <given-names>J</given-names>
                        </name>
</person-group>:
                    <article-title>Understanding the pathogenesis of spondyloarthritis.</article-title>
                    <source>

                        <italic toggle="yes">Biomolecules.</italic>
</source>
                    <year>2020</year>;<volume>10</volume>(<issue>10</issue>):<fpage>1461</fpage>.
                    <pub-id pub-id-type="pmid">33092023</pub-id>
                    <pub-id pub-id-type="doi">10.3390/biom10101461</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7588965</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref5">
                <label>5</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kany</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Vollrath</surname>
                            <given-names>JT</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Relja</surname>
                            <given-names>B</given-names>
                        </name>
</person-group>:
                    <article-title>Cytokines in inflammatory disease.</article-title>
                    <source>

                        <italic toggle="yes">Int. J. Mol. Sci.</italic>
</source>
                    <year>2019</year>;<volume>20</volume>(<issue>23</issue>):<fpage>6008</fpage>.
                    <pub-id pub-id-type="pmid">31795299</pub-id>
                    <pub-id pub-id-type="doi">10.3390/ijms20236008</pub-id>
                    <pub-id pub-id-type="pmcid">PMC6929211</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref6">
                <label>6</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Zheng</surname>
                            <given-names>B</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yu</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Liu</surname>
                            <given-names>H</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Anti-osteoporosis is imperative in prevention of progress of ankylosing spondylitis.</article-title>
                    <source>

                        <italic toggle="yes">Int. J. Gen. Med.</italic>
</source>
                    <year>2025</year>;<volume>18</volume>:<fpage>291</fpage>&#x2013;<lpage>297</lpage>.
                    <pub-id pub-id-type="pmid">39850326</pub-id>
                    <pub-id pub-id-type="doi">10.2147/IJGM.S509296</pub-id>
                    <pub-id pub-id-type="pmcid">PMC11756905</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref7">
                <label>7</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Waszczykowski</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bednarski</surname>
                            <given-names>I</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Narbutt</surname>
                            <given-names>J</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Interleukin-18, interleukin-20, and matrix metalloproteinases (MMP-1, MMP-3) as markers of psoriatic arthritis disease severity and their correlations with biomarkers of inflammation and turnover of joint cartilage.</article-title>
                    <source>

                        <italic toggle="yes">Postepy Dermatol. Alergol.</italic>
</source>
                    <year>2020</year>;<volume>37</volume>(<issue>6</issue>):<fpage>823</fpage>&#x2013;<lpage>831</lpage>.</mixed-citation>
            </ref>
            <ref id="ref8">
                <label>8</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Said</surname>
                            <given-names>EM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Soliman</surname>
                            <given-names>MS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Shousha</surname>
                            <given-names>HI</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Interleukin-18 and its gene single nucleotide polymorphisms (SNPs) influence chronic hepatitis C progression.</article-title>
                    <source>

                        <italic toggle="yes">J. Infect. Dev. Ctries.</italic>
</source>
                    <year>2018</year>;<volume>12</volume>(<issue>4</issue>):<fpage>257</fpage>&#x2013;<lpage>264</lpage>.
                    <pub-id pub-id-type="pmid">31851635</pub-id>
                    <pub-id pub-id-type="doi">10.3855/jidc.9813</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref9">
                <label>9</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ju</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>Z</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jia</surname>
                            <given-names>X</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Interleukin-18 in chronic pain: Focus on pathogenic mechanisms and potential therapeutic targets.</article-title>
                    <source>

                        <italic toggle="yes">Pharmacol. Res.</italic>
</source>
                    <year>2024</year>;<volume>201</volume>:<fpage>107089</fpage>.
                    <pub-id pub-id-type="pmid">38295914</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.phrs.2024.107089</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref10">
                <label>10</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Wu</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zhang</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wu</surname>
                            <given-names>D</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Evaluation of causal associations between interleukin-18 levels and immune-mediated inflammatory diseases: a Mendelian randomization study.</article-title>
                    <source>

                        <italic toggle="yes">BMC Med. Genet.</italic>
</source>
                    <year>2023</year>;<volume>16</volume>:<fpage>306</fpage>.
                    <pub-id pub-id-type="pmid">38031150</pub-id>
                    <pub-id pub-id-type="doi">10.1186/s12920-023-01744-z</pub-id>
                    <pub-id pub-id-type="pmcid">PMC10685486</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref11">
                <label>11</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Shimizu</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Takei</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mori</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Pathogenic roles and diagnostic utility of interleukin-18 in autoinflammatory diseases.</article-title>
                    <source>

                        <italic toggle="yes">Front. Immunol.</italic>
</source>
                    <year>2022</year>;<volume>13</volume>:<fpage>951535</fpage>.
                    <pub-id pub-id-type="pmid">36211331</pub-id>
                    <pub-id pub-id-type="doi">10.3389/fimmu.2022.951535</pub-id>
                    <pub-id pub-id-type="pmcid">PMC9537046</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref12">
                <label>12</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Buraczynska</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ksiazek</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Baranowicz-Gaszczyk</surname>
                            <given-names>I</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Interleukin-18 gene polymorphism and risk of cardiovascular disease in older patients with type 2 diabetes mellitus.</article-title>
                    <source>

                        <italic toggle="yes">Diabetes Res. Clin. Pract.</italic>
</source>
                    <year>2016</year>;<volume>121</volume>:<fpage>178</fpage>&#x2013;<lpage>183</lpage>.
                    <pub-id pub-id-type="pmid">27741477</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.diabres.2016.09.021</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref13">
                <label>13</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Mazurek-Mochol</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Brzeska</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Serwin</surname>
                            <given-names>K</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>IL-18 gene rs187238 and rs1946518 polymorphisms and expression in gingival tissue in individuals with periodontitis.</article-title>
                    <source>

                        <italic toggle="yes">Biomedicine.</italic>
</source>
                    <year>2022</year>;<volume>10</volume>(<issue>10</issue>):<fpage>2367</fpage>.</mixed-citation>
            </ref>
            <ref id="ref14">
                <label>14</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>WY</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Fu</surname>
                            <given-names>FL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>WB</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Genetic variants of interleukin-18 are associated with reduced risk of atrial fibrillation in a population from Northeast China.</article-title>
                    <source>

                        <italic toggle="yes">Gene.</italic>
</source>
                    <year>2017</year>;<volume>626</volume>:<fpage>269</fpage>&#x2013;<lpage>274</lpage>.
                    <pub-id pub-id-type="pmid">28526653</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.gene.2017.05.034</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref15">
                <label>15</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Jung</surname>
                            <given-names>JH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jeong</surname>
                            <given-names>HS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Choi</surname>
                            <given-names>SJ</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Associations between interleukin-18 gene polymorphisms and susceptibility to vasculitis: A meta-analysis.</article-title>
                    <source>

                        <italic toggle="yes">Sarcoidosis Vasc. Diffuse Lung Dis.</italic>
</source>
                    <year>2020</year>;<volume>37</volume>(<issue>2</issue>):<fpage>203</fpage>&#x2013;<lpage>209</lpage>.</mixed-citation>
            </ref>
            <ref id="ref16">
                <label>16</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Rudwaleit</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Van Der Heijde</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Landew&#x00e9;</surname>
                            <given-names>R</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The development of Assessment of SpondyloArthritis international Society classification criteria for axial spondyloarthritis (part II): validation and final selection.</article-title>
                    <source>

                        <italic toggle="yes">Ann. Rheum. Dis.</italic>
</source>
                    <year>2009</year>;<volume>68</volume>(<issue>6</issue>):<fpage>777</fpage>&#x2013;<lpage>783</lpage>.
                    <pub-id pub-id-type="pmid">19297344</pub-id>
                    <pub-id pub-id-type="doi">10.1136/ard.2009.108233</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref17">
                <label>17</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Popescu</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Trandafir</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>B&#x0103;dic&#x0103;</surname>
                            <given-names>AM</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Ankylosing spondylitis functional and activity indices in clinical practice.</article-title>
                    <source>

                        <italic toggle="yes">J. Med. Life.</italic>
</source>
                    <year>2014</year>;<volume>7</volume>(<issue>1</issue>):<fpage>78</fpage>&#x2013;<lpage>83</lpage>.
                    <pub-id pub-id-type="pmid">24653763</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref18">
                <label>18</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Rex</surname>
                            <given-names>DAB</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Agarwal</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Prasad</surname>
                            <given-names>TSK</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>A comprehensive pathway map of IL-18-mediated signalling.</article-title>
                    <source>

                        <italic toggle="yes">J. Cell Commun. Signal.</italic>
</source>
                    <year>2020</year>;<volume>14</volume>(<issue>2</issue>):<fpage>257</fpage>&#x2013;<lpage>266</lpage>.
                    <pub-id pub-id-type="pmid">31863285</pub-id>
                    <pub-id pub-id-type="doi">10.1007/s12079-019-00544-4</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7272533</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref19">
                <label>19</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Przepiera-B&#x0119;dzak</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Fischer</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Brzosko</surname>
                            <given-names>M</given-names>
                        </name>
</person-group>:
                    <article-title>Serum interleukin-18, fetuin-A, soluble intercellular adhesion molecule-1, and endothelin-1 in ankylosing spondylitis, psoriatic arthritis, and SAPHO syndrome.</article-title>
                    <source>

                        <italic toggle="yes">Int. J. Mol. Sci.</italic>
</source>
                    <year>2016</year>;<volume>17</volume>(<issue>8</issue>):<fpage>1255</fpage>.
                    <pub-id pub-id-type="pmid">27527149</pub-id>
                    <pub-id pub-id-type="doi">10.3390/ijms17081255</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5000653</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref20">
                <label>20</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kang</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jeong</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Woo</surname>
                            <given-names>K</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Association between interleukin-18 polymorphisms and alopecia areata in Koreans.</article-title>
                    <source>

                        <italic toggle="yes">J. Interf. Cytokine Res.</italic>
</source>
                    <year>2014</year>;<volume>34</volume>(<issue>9</issue>):<fpage>704</fpage>&#x2013;<lpage>709</lpage>.</mixed-citation>
            </ref>
            <ref id="ref21">
                <label>21</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Abdulridha</surname>
                            <given-names>RH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Saud</surname>
                            <given-names>AM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Alosami</surname>
                            <given-names>MH</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Assessment of miR-146a Gene Polymorphisms in individuals with Systemic Lupus Erythematosus.</article-title>
                    <source>

                        <italic toggle="yes">Iraqi J. Sci.</italic>
</source>
                    <year>2023</year>;<volume>64</volume>(<issue>3</issue>):<fpage>573</fpage>&#x2013;<lpage>582</lpage>.
                    <pub-id pub-id-type="doi">10.24996/ijs.2023.64.2.7</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref22">
                <label>22</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kirkik</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kalkanli Tas</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Dogantekin</surname>
                            <given-names>B</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The Impact of TLR4 rs41426344 Polymorphism on Ankylosing Spondylitis Disease Activity: A Study in Turkish Patients.</article-title>
                    <source>

                        <italic toggle="yes">Int. J. Immunogenet.</italic>
</source>
                    <year>2026</year>;<volume>53</volume>(<issue>1</issue>):<fpage>54</fpage>&#x2013;<lpage>62</lpage>.</mixed-citation>
            </ref>
            <ref id="ref23">
                <label>23</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Saud</surname>
                            <given-names>AM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jebur</surname>
                            <given-names>MS</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Strong Association of STIP1 Gene rs2236647 Polymorphism and Serum Magnesium Level with Bronchial Asthma in a Population from Iraq.</article-title>
                    <source>

                        <italic toggle="yes">J. Biosci. Appl. Res.</italic>
</source>
                    <year>2024</year>; (<issue>3</issue>):<fpage>328</fpage>&#x2013;<lpage>337</lpage>.
                    <pub-id pub-id-type="doi">10.21608/jbaar.2024.292204.1048</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref24">
                <label>24</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ratib</surname>
                            <given-names>BA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Saud</surname>
                            <given-names>AM</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Relationship between Toll-like Receptors and pathogenesis of Systemic Lupus Erythematosus.</article-title>
                    <source>

                        <italic toggle="yes">Revis Bionatura.</italic>
</source>
                    <year>2023</year>;<volume>8</volume>(<issue>2</issue>):<fpage>1</fpage>&#x2013;<lpage>35</lpage>.
                    <pub-id pub-id-type="doi">10.21931/RB/2023.08.02.28</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref25">
                <label>25</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Doss</surname>
                            <given-names>RW</given-names>
                        </name>

                        <name name-style="western">
                            <surname>El-Rifaie</surname>
                            <given-names>AA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Roshdy</surname>
                            <given-names>AN</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Assessment of interleukin-18 gene polymorphism and serum levels in cutaneous lichen planus.</article-title>
                    <source>

                        <italic toggle="yes">Eur. J. Med. Res.</italic>
</source>
                    <year>2024</year>;<volume>29</volume>(<issue>1</issue>):<fpage>345</fpage>.
                    <pub-id pub-id-type="pmid">38918874</pub-id>
                    <pub-id pub-id-type="doi">10.1186/s40001-024-01846-z</pub-id>
                    <pub-id pub-id-type="pmcid">PMC11202336</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref26">
                <label>26</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Liang</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wen</surname>
                            <given-names>Z</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zhao</surname>
                            <given-names>J</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Association of IL18 genetic polymorphisms with increased risk of biliary atresia susceptibility in Southern Chinese children.</article-title>
                    <source>

                        <italic toggle="yes">Gene.</italic>
</source>
                    <year>2018</year>;<volume>677</volume>:<fpage>228</fpage>&#x2013;<lpage>231</lpage>.
                    <pub-id pub-id-type="pmid">30059753</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.gene.2018.07.071</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref27">
                <label>27</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Lando</surname>
                            <given-names>V</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Calciano</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Minelli</surname>
                            <given-names>C</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>IL18 gene polymorphism is associated with total IgE in adult subjects with asthma.</article-title>
                    <source>

                        <italic toggle="yes">J. Clin. Med.</italic>
</source>
                    <year>2023</year>;<volume>12</volume>(<issue>12</issue>):<fpage>3963</fpage>.
                    <pub-id pub-id-type="pmid">37373658</pub-id>
                    <pub-id pub-id-type="doi">10.3390/jcm12123963</pub-id>
                    <pub-id pub-id-type="pmcid">PMC10299306</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref28">
                <label>28</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Aboraia</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Abdelaleem</surname>
                            <given-names>OO</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Abd El-Rahman</surname>
                            <given-names>AT</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Interleukins gene polymorphism in alopecia areata patients: a systematic review.</article-title>
                    <source>

                        <italic toggle="yes">Fayoum Univ. Med. J.</italic>
</source>
                    <year>2025</year>;<volume>15</volume>(<issue>1</issue>):<fpage>34</fpage>&#x2013;<lpage>44</lpage>.
                    <pub-id pub-id-type="doi">10.21608/fumj.2025.326668.1404</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref29">
                <label>29</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Eitan</surname>
                            <given-names>LN</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Alghamdi</surname>
                            <given-names>MA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Al Momani</surname>
                            <given-names>RO</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Genetic association between interleukin genes and alopecia areata in Jordanian patients.</article-title>
                    <source>

                        <italic toggle="yes">Oman Med. J.</italic>
</source>
                    <year>2022</year>;<volume>37</volume>(<issue>5</issue>):<fpage>e421</fpage>.
                    <pub-id pub-id-type="pmid">36188885</pub-id>
                    <pub-id pub-id-type="doi">10.5001/omj.2022.92</pub-id>
                    <pub-id pub-id-type="pmcid">PMC9449993</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref30">
                <label>30</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Almeida</surname>
                            <given-names>VG</given-names>
                            <prefix>de</prefix>
                        </name>

                        <name name-style="western">
                            <surname>Silva</surname>
                            <given-names>ME</given-names>
                            <prefix>da</prefix>
                        </name>

                        <name name-style="western">
                            <surname>Duque</surname>
                            <given-names>BR</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Serum IL-18 and rs187238 single nucleotide polymorphism are associated with high-density lipoprotein changes in COVID-19 outpatients.</article-title>
                    <source>

                        <italic toggle="yes">Int. Immunopharmacol.</italic>
</source>
                    <year>2023</year>;<volume>122</volume>:<fpage>110645</fpage>.</mixed-citation>
            </ref>
            <ref id="ref31">
                <label>31</label>
                <mixed-citation publication-type="data">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Jasim</surname>
                            <given-names>IK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Saud</surname>
                            <given-names>AM</given-names>
                        </name>
</person-group>:
                    <data-title>The Impact of Promoter Variants in Interleukin-18 on Susceptibility to Ankylosing Spondylitis in a sample of Iraqi Patients.</data-title>[Dataset].
                    <source>

                        <italic toggle="yes">Zenodo.</italic>
</source>
                    <year>2025</year>.
                    <pub-id pub-id-type="doi">10.5281/zenodo.17716124</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report475867">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.190371.r475867</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Hussein</surname>
                        <given-names>Sahar m</given-names>
                    </name>
                    <xref ref-type="aff" rid="r475867a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-3556-1081</uri>
                </contrib>
                <aff id="r475867a1">
                    <label>1</label>Al-Nahrain University, Baghdad, Iraq</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>30</day>
                <month>4</month>
                <year>2026</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2026 Hussein Sm</copyright-statement>
                <copyright-year>2026</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport475867" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.172631.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>The study contributed suitable and methodical information on the correlation between IL-18 rs549908 polymorphism and serum IL-18 expression levels with susceptibility to ankylosing spondylitis in Iraqi subjects.</p>
            <p> The incorporation of genetic and immunological analysis is an evident strength and adds to the biological significance of the results. This study is well suited for its research objectives, and the methodologies used are appropriate and adequately described to ensure reproducibility.</p>
            <p> &#x00a0;&#x00a0; &#x00a0;&#x00a0;&#x00a0;Results are clearly presented and show statistically significant differences that validate the proposed role of IL-18 in inflammatory and immune pathways. ROC analysis was found to also reinforce the possible diagnostic potential of IL-18. The study also adds, regionally, useful data that add to the known genetic vulnerability of ankylosing spondylitis, and to more generalized findings of this disease, particularly among underrepresented populations.</p>
            <p> </p>
            <p> A Few points for Improvement.</p>
            <p> 1- Style: Language and scientific style: Some other language modifications could streamline the paper so that it is easier to read simply by removing the complex or repetitive structures.</p>
            <p> 2- Statistical clarity: The statistical quality is ok, however, slight improvement in the consistency of the terms and reporting would provide greater clarity.</p>
            <p> 3- ROC curve: This clinical association, such as it is in ROC, can be improved through diagnostic metrics (specific cut-off, sensitivity, and specificity) and these outcomes can also be integrated into that evaluation in the clinical literature.</p>
            <p> 4- Discussion enhancement: A few studies of immune-related genetic polymorphisms among individuals with ankylosing spondylitis from different populations would slightly supplement the discussion.</p>
            <p> </p>
            <p> &#x00a0;&#x00a0; Although the reported findings are strong and well-described, future studies with larger cohorts and multivariate analytical techniques would be instrumental to successful generalizability, including advancing a broader perspective regarding the independent role of IL-18 genetic variants to disease susceptibility.</p>
            <p> Finally: The manuscript is scientifically sound, and the conclusions are supported by the presented data. The suggested points are minor and intended to further enhance clarity and presentation. The work is suitable for indexing.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Yes</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>molecular biology, molecular genetics , genetics , bioinformatics</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
        <sub-article article-type="response" id="comment16118-475867">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>kadhim</surname>
                            <given-names>Ibtehal</given-names>
                        </name>
                        <aff>Biotechnology, University of Baghdad, Baghdad, Baghdad Governorate, Iraq</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>1</day>
                    <month>5</month>
                    <year>2026</year>
                </pub-date>
            </front-stub>
            <body>
                <p>Dear Reviewer,</p>
                <p> We sincerely thank you for your constructive and encouraging comments.</p>
                <p> The manuscript has been revised to improve language clarity and reduce repetition. Statistical reporting has been refined for better consistency.</p>
                <p> The ROC analysis has been clarified, and the discussion has been strengthened by incorporating additional relevant studies.</p>
                <p> We believe these revisions have improved the manuscript.</p>
                <p> Sincerely,</p>
                <p> The Authors</p>
            </body>
        </sub-article>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report475866">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.190371.r475866</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Hassan Hussein</surname>
                        <given-names>Raghad</given-names>
                    </name>
                    <xref ref-type="aff" rid="r475866a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-0546-9241</uri>
                </contrib>
                <aff id="r475866a1">
                    <label>1</label>Department of Medical laboratory Techniques, College of health and medical techniques, Middle Technical University, Baghdad, Iraq</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>25</day>
                <month>4</month>
                <year>2026</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2026 Hassan Hussein R</copyright-statement>
                <copyright-year>2026</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport475866" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.172631.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>This manuscript presents an&#x00a0; investigation into the association between the 
                <bold>I</bold>L-18 rs549908 polymorphism and ankylosing spondylitis (AS) in an Iraqi population. The study addresses an important gap in the literature by providing population-specific genetic and immunological data, which are currently underrepresented in this field.&#x00a0;The integration of molecular genetic analysis with serum cytokine quantification (ELISA) is a notable strength, offering a more comprehensive understanding of both genetic susceptibility and inflammatory status in AS. In conclusion, This study provides meaningful insights into the genetic and immunological factors underlying ankylosing spondylitis and represents a valuable contribution to the field, particularly in the context of Middle Eastern populations. .The manuscript would benefit from minor English editing to improve clarity and readability. For example: 
                <list list-type="bullet">
                    <list-item>
                        <p>Replace &#x201c;relations among&#x201d; with &#x201c;association between&#x201d;</p>
                    </list-item>
                    <list-item>
                        <p>Replace &#x201c;illness activity&#x201d; with &#x201c;disease activity&#x201d;</p>
                    </list-item>
                </list> These are minor issues and do not affect scientific content.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Yes</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Immunity and inflammation, immunogenetics</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
        <sub-article article-type="response" id="comment16117-475866">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>kadhim</surname>
                            <given-names>Ibtehal</given-names>
                        </name>
                        <aff>Biotechnology, University of Baghdad, Baghdad, Baghdad Governorate, Iraq</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>1</day>
                    <month>5</month>
                    <year>2026</year>
                </pub-date>
            </front-stub>
            <body>
                <p>Dear Reviewer,</p>
                <p> We thank you for your positive evaluation and helpful comments.</p>
                <p> The manuscript has been revised to improve clarity and readability. Terminology has been standardized throughout the text, including replacing &#x201c;relations among&#x201d; with &#x201c;association between&#x201d; and &#x201c;illness activity&#x201d; with &#x201c;disease activity&#x201d;.</p>
                <p> These revisions have improved the overall quality of the manuscript.</p>
                <p> Sincerely,</p>
                <p> The Authors</p>
            </body>
        </sub-article>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report445404">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.190371.r445404</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>K&#x0131;rk&#x0131;k</surname>
                        <given-names>Duygu</given-names>
                    </name>
                    <xref ref-type="aff" rid="r445404a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0003-1417-6915</uri>
                </contrib>
                <aff id="r445404a1">
                    <label>1</label>Hamidiye Faculty of Medicine, University of Health Sciences, Istanbul, Turkey</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>21</day>
                <month>1</month>
                <year>2026</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2026 K&#x0131;rk&#x0131;k D</copyright-statement>
                <copyright-year>2026</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport445404" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.172631.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>This study presents a unique and regionally valuable contribution by addressing the association between the IL-18 rs549908 polymorphism and serum IL-18 levels with ankylosing spondylitis (AS) in an Iraqi population. The combined evaluation of genetic analysis and biochemical measurements is a strength of the study. However, as it stands, the article requires significant revision in terms of language, methodological clarity, statistical consistency, and interpretation.</p>
            <p> </p>
            <p> The text contains significant problems with English language and style.</p>
            <p> </p>
            <p> Frequently used expressions:</p>
            <p> </p>
            <p> &#x201c;relations among&#x201d; &#x2192; &#x201c;association between&#x201d;</p>
            <p> </p>
            <p> &#x201c;raised susceptibilities&#x201d; &#x2192; &#x201c;increased susceptibility&#x201d;</p>
            <p> </p>
            <p> &#x201c;illness activity&#x201d; &#x2192; &#x201c;disease activity&#x201d;</p>
            <p> </p>
            <p> Many sentences are grammatically incorrect, long, and repetitive.</p>
            <p> </p>
            <p> Between the AS and control groups:</p>
            <p> </p>
            <p> Age difference was borderline significant (p = 0.059)</p>
            <p> </p>
            <p> Gender distribution was significantly different (p &lt; 0.001)</p>
            <p> </p>
            <p> However:</p>
            <p> </p>
            <p> Logistic regression or multivariate analysis was not performed</p>
            <p> </p>
            <p> ORs were not adjusted.</p>
            <p> </p>
            <p> HWE results:</p>
            <p> </p>
            <p> For the control group, &#x03c7;&#x00b2; = 8.006 and p = 0.99 are statistically inconsistent.</p>
            <p> </p>
            <p> Expressions such as &#x201c;extremely significant&#x201d; for p &lt; 0.01 are not recommended in scientific writing.</p>
            <p> </p>
            <p> ROC analysis:</p>
            <p> </p>
            <p> AUC = 0.923 &#x2192; very high</p>
            <p> </p>
            <p> However, cut-off, sensitivity, specificity, PPV/NPV are not provided</p>
            <p> </p>
            <p> The statistical analysis section should be restructured and the results simplified.</p>
            <p> </p>
            <p> The discussion could be further strengthened by incorporating recent population-based evidence supporting the role of innate immune&#x2013;related genetic variants in ankylosing spondylitis. In line with the present findings, growing evidence suggests that genetic variations in immune signaling pathways contribute not only to disease susceptibility but also to clinical heterogeneity and disease activity in AS.</p>
            <p> Notably, 
                <bold>Kirkik et al.</bold> demonstrated a significant association between the 
                <bold>TLR4 rs41426344 polymorphism and disease activity in Turkish patients with ankylosing spondylitis</bold>, emphasizing the importance of immune-regulatory gene variants in AS pathogenesis across different populations (
                <italic>International Journal of Immunogenetics</italic>, 2026) (Ref 1). Including this reference would provide valuable contextual support and reinforce the biological plausibility of the current genetic findings.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Yes</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Partly</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>immunogenetics, anklosing spondilitis, polymorphisms, vaccine</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
        <back>
            <ref-list>
                <title>References</title>
                <ref id="rep-ref-445404-1">
                    <label>1</label>
                    <mixed-citation publication-type="journal">
                        <person-group person-group-type="author"/>:
                        <article-title>The Impact of TLR4 rs41426344 Polymorphism on Ankylosing Spondylitis Disease Activity: A Study in Turkish Patients</article-title>.
                        <source>
                            <italic>International Journal of Immunogenetics</italic>
                        </source>.<year>2026</year>;<volume>53</volume>(<issue>1</issue>) :
                        <elocation-id>10.1111/iji.70027</elocation-id>
                        <fpage>54</fpage>-<lpage>62</lpage>
                        <pub-id pub-id-type="doi">10.1111/iji.70027</pub-id>
                    </mixed-citation>
                </ref>
            </ref-list>
        </back>
        <sub-article article-type="response" id="comment16116-445404">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>kadhim</surname>
                            <given-names>Ibtehal</given-names>
                        </name>
                        <aff>Biotechnology, University of Baghdad, Baghdad, Baghdad Governorate, Iraq</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>1</day>
                    <month>5</month>
                    <year>2026</year>
                </pub-date>
            </front-stub>
            <body>
                <p>Dear Reviewer,</p>
                <p> We sincerely thank you for your careful evaluation and valuable comments.</p>
                <p> The manuscript has been thoroughly revised to improve language clarity and style. Expressions such as &#x201c;relations among&#x201d; and &#x201c;illness activity&#x201d; have been corrected, and repetitive and complex sentences have been simplified.</p>
                <p> The statistical analysis section has been revised for clarity and consistency. The use of inappropriate terms such as &#x201c;extremely significant&#x201d; has been removed, and Hardy&#x2013;Weinberg equilibrium calculations have been rechecked.</p>
                <p> The ROC analysis has been clarified to better reflect its diagnostic relevance.</p>
                <p> As suggested, the discussion has been strengthened by incorporating recent evidence on immune-related genetic variants, including the study by Kirkik et al. (2026).</p>
                <p> We believe these revisions have substantially improved the manuscript and addressed all concerns raised.</p>
                <p> Sincerely,</p>
                <p> The Authors</p>
            </body>
        </sub-article>
    </sub-article>
</article>
