<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="data-paper" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.174230.1</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Data Note</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>A guide to selecting high-performing antibodies for GCase (UniProt ID: P04062) for use in western blot, immunoprecipitation, and immunofluorescence</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 1; peer review: 2 approved]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Worrall</surname>
                        <given-names>Donovan</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <uri content-type="orcid">https://orcid.org/0000-0001-5676-5473</uri>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Alende</surname>
                        <given-names>Charles</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <uri content-type="orcid">https://orcid.org/0009-0005-4611-6134</uri>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Fothouhi</surname>
                        <given-names>Maryam</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Mole&#x00f3;n</surname>
                        <given-names>Vera Ru&#x00ed;z</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <uri content-type="orcid">https://orcid.org/0000-0003-3728-3158</uri>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Bol&#x00ed;var</surname>
                        <given-names>Sara Gonz&#x00e1;lez</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-4299-8281</uri>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Ayoubi</surname>
                        <given-names>Riham</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Francis</surname>
                        <given-names>Vincent</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0009-0000-7535-8718</uri>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Laflamme</surname>
                        <given-names>Carl</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0001-5906-025X</uri>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>McPherson</surname>
                        <given-names>Peter S.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Neuroscience and Neurosurgery, Montreal Neurological Institute-Hospital, Montreal, Qu&#x00e9;bec, Canada</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:carl.laflamme@mcgill.ca">carl.laflamme@mcgill.ca</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>For this project, the authors developed partnerships with leading antibody manufacturers and KO cell line providers. The partners provide antibodies and KO cell lines to this project at no cost. These partners include: Abcam, ABCD antibodies, ABclonal, Addgene, Aviva Systems Biology, BioTechne, Cell Signaling Technology, Developmental Studies Hybridoma Bank, GeneTex, Horizon Discovery, Institute for Protein Innovation, MilliporeSigma, Proteintech, Synaptic Systems, Thermo Fisher Scientific.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>15</day>
                <month>12</month>
                <year>2025</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2025</year>
            </pub-date>
            <volume>14</volume>
            <elocation-id>1400</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>1</day>
                    <month>12</month>
                    <year>2025</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2025 Worrall D et al.</copyright-statement>
                <copyright-year>2025</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/14-1400/pdf"/>
            <abstract>
                <p>The human 
                    <italic toggle="yes">GBA1</italic> gene encodes glucocerebrosidase (GCase), a lysosomal enzyme that hydrolyzes glucosylceramides. Variants in 
                    <italic toggle="yes">GBA1</italic> and reduced GCase activity have been linked to Parkinson&#x2019;s disease and Gaucher&#x2019;s disease. Here we have characterized twenty-four GCase commercial antibodies for western blot, immunoprecipitation, and immunofluorescence using a standardized experimental protocol based on comparing read-outs in knockout cell lines and isogenic parental controls. These studies are part of a larger, collaborative initiative seeking to address antibody reproducibility issues by characterizing commercially available antibodies for human proteins and publishing the results openly as a resource for the scientific community. While the use of antibodies and protocols vary between laboratories, we encourage readers to use this report as a guide to select the most appropriate antibodies for their specific needs.</p>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>P04062</kwd>
                <kwd>GBA1</kwd>
                <kwd>GCase</kwd>
                <kwd>antibody characterization</kwd>
                <kwd>antibody validation</kwd>
                <kwd>western blot</kwd>
                <kwd>immunoprecipitation</kwd>
                <kwd>immunofluorescence</kwd>
            </kwd-group>
            <funding-group>
                <award-group id="fund-1">
                    <funding-source>The Hilary &amp; Galen Weston Foundation, Silverstein Foundation, and J. Sebastian van Berkom and Ghislaine Saucier</funding-source>
                </award-group>
                <award-group id="fund-2">
                    <funding-source>Minist&#x00e8;re de l&#x2019;&#x00c9;conomie, de l&#x2019;Innovation et de l&#x2019;&#x00c9;nergie du Qu&#x00e9;bec</funding-source>
                </award-group>
                <funding-statement>This research was partly funded by the G-Can (GBA1-Canada) initiative, an open-science collaboration dedicated to advancing research on Parkinson's disease associated with GBA1 mutations. G-Can is supported by The Hilary &amp; Galen Weston Foundation, Silverstein Foundation, and J. Sebastian van Berkom and Ghislaine Saucier. This work was also supported by the Quebec Consortium for Drug Discovery (CQDM), a grant from the Minist&#x00e8;re de l&#x2019;&#x00c9;conomie, de l&#x2019;Innovation et de l&#x2019;&#x00c9;nergie du Qu&#x00e9;bec.</funding-statement>
                <funding-statement>
                    <italic>The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.</italic>
                </funding-statement>
            </funding-group>
        </article-meta>
    </front>
    <body>
        <sec id="sec1" sec-type="intro">
            <title>Introduction</title>
            <p>Variants in 
                <italic toggle="yes">GBA1</italic>, which encodes the lysosomal hydrolase glucocerebrosidase (GCase), represent one of the most common genetic risk factors for Parkinson&#x2019;s disease.
                <sup>
                    <xref ref-type="bibr" rid="ref1">1</xref>
                </sup> Biallelic mutations in 
                <italic toggle="yes">GBA1</italic> are also causative of Gaucher&#x2019;s disease, a lysosomal storage disorder.
                <sup>
                    <xref ref-type="bibr" rid="ref2">2</xref>
                </sup> GCase is responsible for the hydrolysis of glucosylceramide, and mutations in 
                <italic toggle="yes">GBA1</italic> can impair the enzyme&#x2019;s structure, leading to reduced activity, stability, and protein levels.
                <sup>
                    <xref ref-type="bibr" rid="ref1">1</xref>
                </sup> The scientific community would benefit from specific and renewable GCase antibodies to investigate how disease-related mutations affect the protein&#x2019;s biochemical and cellular characteristics.</p>
            <p>This research is part of a broader collaborative initiative in which academics, funders and commercial antibody manufacturers are working together to address antibody reproducibility issues by characterizing commercial antibodies for human proteins using standardized protocols, and openly sharing the data.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>
                </sup> It consists of identifying human cell lines with adequate target protein expression and the development/contribution of equivalent knockout (KO) cell lines, followed by antibody characterization procedures using most commercially available renewable antibodies against the corresponding protein.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>
                </sup> Here we characterized twenty-four commercial GCase antibodies, selected and donated by participant antibody manufacturers, for use in western blot, immunoprecipitation, and immunofluorescence (also referred to as immunocytochemistry), enabling biochemical and cellular assessment of GCase properties and function.</p>
            <p>The authors do not engage in result analysis or offer explicit antibody recommendations. Our primary aim is to deliver top-tier data to the scientific community, grounded in Open Science principles. This empowers experts to interpret the characterization data independently, enabling them to make informed choices regarding the most suitable antibodies for their specific experimental needs. Guidelines on how to interpret antibody characterization data found in this study are featured on the YCharOS gateway
                <sup>
                    <xref ref-type="bibr" rid="ref4">4</xref>
                </sup> and in 
                <xref ref-type="table" rid="T4">
Table 4</xref> of this data note.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>
                </sup>
            </p>
            <table-wrap id="T1" orientation="portrait" position="float">
                <label>
Table 1. </label>
                <caption>
                    <title>Summary of the cell lines used.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="left" colspan="1" rowspan="1" valign="top">Institution</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Catalog number</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">RRID (Cellosaurus)</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Cell line</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">
Genotype</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Horizon Discovery</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">C631</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.cellosaurus.org/CVCL_Y019">CVCL_Y019</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">HAP1</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">WT</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Horizon Discovery</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">HZGHC004541c001</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.cellosaurus.org/CVCL_SP63">CVCL_SP63</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">HAP1</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <italic toggle="yes">GBA1</italic> KO</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Abcam</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">ab255448</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.cellosaurus.org/CVCL_0030">CVCL_0030</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">HeLa</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">WT</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Abcam</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">ab265038</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.cellosaurus.org/CVCL_B1SQ">CVCL_B1SQ</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">HeLa</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <italic toggle="yes">GBA1</italic> KO</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">ATCC</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">HTB-14</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.cellosaurus.org/CVCL_0022">CVCL_0022</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">U-87 MG</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">WT</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">ATCC</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">CRL-4000</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.cellosaurus.org/CVCL_4388">CVCL_4388</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">RPE-1</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">WT</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Academic partner</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">-</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">-</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">RPE-1</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <italic toggle="yes">GBA1</italic> KO</td>
                        </tr>
                    </tbody>
                </table>
            </table-wrap>
            <table-wrap id="T2" orientation="portrait" position="float">
                <label>
Table 2. </label>
                <caption>
                    <title>Summary of the GCase antibodies tested.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="left" colspan="1" rowspan="1" valign="top">Company</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Catalog number</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Lot number</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">RRID (Antibody registry)</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Clonality</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Clone ID</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Host</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Concentration (&#x03bc;g/&#x03bc;L)</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">
Vendors recommended applications</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Abcam</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">ab125065
                                <xref ref-type="table-fn" rid="tfn1">**</xref>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1003589-3</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_10973982">AB_10973982</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">recombinant mono</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">EPR5142</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">rabbit</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.10</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Wb</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Abcam</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">ab128879
                                <xref ref-type="table-fn" rid="tfn1">**</xref>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1048619-1</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_11144121">AB_11144121</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">recombinant mono</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">EPR5143(3)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">rabbit</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.23</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Wb</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Abcam</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">ab309228
                                <xref ref-type="table-fn" rid="tfn1">**</xref>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1089805-5</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_3105954">AB_3105954</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">recombinant mono</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">EPR26755-29</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">rabbit</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.02</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">other</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Abcam</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">ab309229
                                <xref ref-type="table-fn" rid="tfn1">**</xref>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1089807-5</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_3105953">AB_3105953</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">recombinant mono</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">EPR26755-42</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">rabbit</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.02</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">other</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Abcam</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">ab55080
                                <xref ref-type="table-fn" rid="tfn2">*</xref>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1035295-1</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_2109076">AB_2109076</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">monoclonal</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">200</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">mouse</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.00</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Wb, IF</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">-</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">2020A4849
                                <xref ref-type="table-fn" rid="tfn2">*</xref>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">20231009</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">AB_3696746</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">monoclonal</td>
                            <td align="char" char="&#x00d7;" colspan="1" rowspan="1" valign="top">1/17 (MJFF request)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">mouse</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.00</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">NA</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">-</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">P1AM1914-001-28
                                <xref ref-type="table-fn" rid="tfn2">*</xref>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">20.02.2024</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">AB_3696747</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">monoclonal</td>
                            <td align="char" char="&#x00d7;" colspan="1" rowspan="1" valign="top">1/23 (MJFF request)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">mouse</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.00</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">NA</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">ABCD Antibodies</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">ABCD_AR148
                                <xref ref-type="table-fn" rid="tfn1">**</xref>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">11/15/2024</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_3076343">AB_3076343</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">recombinant mono</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">2D4</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">rabbit</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.05</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">NA</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">ABCD Antibodies</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">ABCD_AR150
                                <xref ref-type="table-fn" rid="tfn1">**</xref>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">11/15/2024</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_3076344">AB_3076344</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">recombinant mono</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">2L18</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">rabbit</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.02</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">NA</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">ABclonal</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">A19057
                                <xref ref-type="table-fn" rid="tfn1">**</xref>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">4000000500</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_2862550">AB_2862550</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">recombinant mono</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">ARC0500</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">rabbit</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.51</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Wb</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Bio-Techne (Novus Biologicals)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">NBP2-66871
                                <xref ref-type="table-fn" rid="tfn1">**</xref>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">HO0913</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">NA</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">recombinant mono</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">JM10-76</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">rabbit</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.00</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Wb, IF</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Bio-Techne (R&amp;D Systems)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">MAB7410
                                <xref ref-type="table-fn" rid="tfn2">*</xref>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">CHEF0422011</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_2938856">AB_2938856</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">monoclonal</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">812201</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">mouse</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.50</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Wb, IF</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Cell Signaling Technology</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">88162
                                <xref ref-type="table-fn" rid="tfn1">**</xref>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">NA</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">recombinant mono</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">E2R1L</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">rabbit</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.08</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Wb</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">GeneTex</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">GTX101267</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">43817</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_1950346">AB_1950346</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">polyclonal</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">-</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">rabbit</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.73</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Wb, IF</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">GeneTex</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">GTX114073</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">43677</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_10620339">AB_10620339</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">polyclonal</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">-</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">rabbit</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.78</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Wb</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">MilliporeSigma</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">G4171</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0000181205</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_1078958">AB_1078958</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">polyclonal</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">-</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">rabbit</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.00</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Wb</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Proteintech</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">20622-1-AP</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">00013380</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_10696317">AB_10696317</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">polyclonal</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">-</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">rabbit</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.45</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">IF</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Proteintech</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">27972-1-AP</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">00059099</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_2881024">AB_2881024</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">polyclonal</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">-</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">rabbit</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.60</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Wb</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Thermo Fisher Scientific</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">MA5-26589
                                <xref ref-type="table-fn" rid="tfn2">*</xref>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">YE3914194</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_2724337">AB_2724337</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">monoclonal</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">OTI1D12</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">mouse</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.00</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Wb</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Thermo Fisher Scientific</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">MA5-26591
                                <xref ref-type="table-fn" rid="tfn2">*</xref>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">YE3914195</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_2724339">AB_2724339</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">monoclonal</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">OTI4G4</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">mouse</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.00</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Wb</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Thermo Fisher Scientific</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">MA5-32591
                                <xref ref-type="table-fn" rid="tfn1">**</xref>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">YE3913381A</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_2809868">AB_2809868</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">recombinant mono</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">JM10-76</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">rabbit</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.00</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Wb</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Thermo Fisher Scientific</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">MA5-35236
                                <xref ref-type="table-fn" rid="tfn1">**</xref>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">YE3913567</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_2849139">AB_2849139</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">recombinant mono</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">ARC0500</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">rabbit</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.40</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Wb</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Thermo Fisher Scientific</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">MA5-38382
                                <xref ref-type="table-fn" rid="tfn1">**</xref>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">YE3914005</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_2898296">AB_2898296</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">recombinant mono</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">4H4</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">rabbit</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.40</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Wb</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Thermo Fisher Scientific</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">MA5-52914
                                <xref ref-type="table-fn" rid="tfn1">**</xref>
                            </td>
                            <td align="left" colspan="1" rowspan="1" valign="top">ZJ4492612</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_3249389">AB_3249389</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">recombinant mono</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">23GB5775</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">rabbit</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">NA</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Wb</td>
                        </tr>
                    </tbody>
                </table>
                <table-wrap-foot>
                    <p>Wb = Western blot; IF = Immunofluorescence; IP = Immunoprecipitation.</p>
                    <fn-group content-type="footnotes">
                        <fn id="tfn1">
                            <label>**</label>
                            <p>= Recombinant antibody,</p>
                        </fn>
                        <fn id="tfn2">
                            <label>*</label>
                            <p>= Monoclonal antibody, NA = Not available.</p>
                        </fn>
                    </fn-group>
                </table-wrap-foot>
            </table-wrap>
            <table-wrap id="T3" orientation="portrait" position="float">
                <label>
Table 3. </label>
                <caption>
                    <title>
Table of secondary antibodies used.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="left" colspan="1" rowspan="1" valign="top">
Company</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">
Secondary antibody</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">
Catalog number</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">
RRID (Antibody registry)</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">
Clonality</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">
Concentration (&#x03bc;g/&#x03bc;L)</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">
Working concentration (&#x03bc;g/mL)</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Thermo Fisher Scientific</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">HRP-Goat Anti-Rabbit Antibody (H+L)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">65-6120</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_2533967">AB_2533967</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">polyclonal</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.0</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.2</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Thermo Fisher Scientific</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">HRP-Goat Anti-Mouse Antibody (H+L)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">62-6520</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_2533947">AB_2533947</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">polyclonal</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.5</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.75</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Cell Signaling Technology</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Protein A, HRP conjugate</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">12291</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">NA</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">polyclonal</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.125</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.5</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Thermo Fisher Scientific</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Alexa Fluor&#x2122; 555-Goat anti-Rabbit IgG (H+L)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">A-21429</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_2535850">AB_2535850</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">polyclonal</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">2.0</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.5</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">Thermo Fisher Scientific</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">Alexa Fluor&#x2122; 555-Goat anti-Mouse IgG (H+L)</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">A-21424</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <ext-link ext-link-type="uri" xlink:href="https://www.antibodyregistry.org/AB_141780">AB_141780</ext-link>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">polyclonal</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">2.0</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.5</td>
                        </tr>
                    </tbody>
                </table>
            </table-wrap>
            <table-wrap id="T4" orientation="portrait" position="float">
                <label>
Table 4. </label>
                <caption>
                    <title>Illustrations to assess antibody performance in all western blot, immunoprecipitation and immunofluorescence.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="left" colspan="1" rowspan="1" valign="top">Western blot</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Immunoprecipitation</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Immunofluorescence</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <graphic id="gr7" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/192114/102a4d68-2f48-4589-98a0-cad02d05d050_Graphical3.gif"/>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <graphic id="gr6" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/192114/102a4d68-2f48-4589-98a0-cad02d05d050_Graphical2.gif"/>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <graphic id="gr5" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/192114/102a4d68-2f48-4589-98a0-cad02d05d050_Graphical1.gif"/>
</td>
                        </tr>
                    </tbody>
                </table>
                <table-wrap-foot>
                    <p>This table has been reproduced with permission from Ayoubi et al., Elife, 2023.
                        <sup>
                            <xref ref-type="bibr" rid="ref7">7</xref>
                        </sup>
                    </p>
                </table-wrap-foot>
            </table-wrap>
        </sec>
        <sec id="sec2" sec-type="results|discussion">
            <title>Results and discussion</title>
            <p>Our standard protocol involves comparing readouts from wild type (WT) and KO cells.
                <sup>
                    <xref ref-type="bibr" rid="ref5">5</xref>,
                    <xref ref-type="bibr" rid="ref6">6</xref>
                </sup> The first step was to identify a cell line(s) that expresses sufficient levels of a given protein to generate a measurable signal using antibodies. To this end, we examined the DepMap (Cancer Dependency Map Portal, RRID:SCR_017655) transcriptomics database to identify all cell lines that express the target at levels greater than 2.5 log
                <sub>2</sub> (transcripts per million &#x201c;TPM&#x201d; + 1), which we have found to be a suitable cut-off.
                <sup>
                    <xref ref-type="bibr" rid="ref7">7</xref>
                </sup> The HAP1 expresses the 
                <italic toggle="yes">GBA1</italic> transcript at 3.5 log
                <sub>2</sub> TPM+1. A 
                <italic toggle="yes">GBA1</italic> KO HAP1 cell line was obtained from Horizon Discovery (
                <xref ref-type="table" rid="T1">
Table 1</xref>). Moreover, as seen on DepMap, the HAP1 does not carry mutations in the 
                <italic toggle="yes">GBA1</italic> that could affect antibody&#x2013;epitope binding.</p>
            <p>To screen all twenty-four by western blot, WT and 
                <italic toggle="yes">GBA1</italic> KO protein lysates were ran on SDS-PAGE, transferred onto nitrocellulose membranes, and then probed with twenty-four GCase antibodies in parallel (
                <xref ref-type="fig" rid="f1">
Figure 1</xref>). HeLa expresses the 
                <italic toggle="yes">GBA1</italic> transcript at 5.4 log
                <sub>2</sub> TPM+1, and a HeLa 
                <italic toggle="yes">GBA1</italic> KO is commercially available at Abcam. Protein expression of GCase was evaluated by western blot in the two cell types HAP1 and HeLa in addition to WT U-87 MG and RPE-1 (
                <xref ref-type="fig" rid="f2">
Figure 2</xref>).</p>
            <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                <label>
Figure 1. </label>
                <caption>
                    <title>GCase antibody screening by western blot.</title>
                    <p>Lysates of HAP1 WT and 
                        <italic toggle="yes">GBA1</italic> KO were prepared, and 30 &#x03bc;g of protein were processed for western blot with the indicated GCase antibodies. The Ponceau stained transfers of each blot are presented to show equal loading of WT and KO lysates and protein transfer efficiency from the acrylamide gels to the nitrocellulose membrane. Antibody dilutions were chosen according to the recommendations of the antibody supplier. Antibody dilutions used: ab125065** at 1/100, ab128879** at 1/1000, ab309228** at 1/200, ab309229** at 1/200, ab55080* at 1/500, 2020A4849* at 1/1000, P1AM1914-001-28* at 1/1000, ABCD_AR148** 1/50 (1 &#x03bc;g/mL), ABCD_AR150** at 1/20, A19057** at 1/1000, NBP2-66871** at 1/500, MAB7410* at 1/500, 88162** at 1/100, GTX101267 at 1/100, GTX114073 at 1/1000, G4171 at 1/1000, 20622-1-AP at 1/100, 27972-1-AP at 1/1000, MA5-26589* at 1/100, MA5-26591* at 1/100, MA5-32591** at 1/1000, MA5-35236** at 1/1000, MA5-38382** at 1/1000, and MA5-52914** at 1/1000. Predicted band size: 59.7 kDa. **= recombinant antibody, *= monoclonal antibody.</p>
                </caption>
                <graphic id="gr1" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/192114/102a4d68-2f48-4589-98a0-cad02d05d050_figure1.gif"/>
            </fig>
            <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                <label>
Figure 2. </label>
                <caption>
                    <title>GCase western blot on various cell lysates.</title>
                    <p>Lysates were prepared from WT and 
                        <italic toggle="yes">GBA1</italic> KOs in HAP1, neural progenitor cells and HeLa as well as WT U-87 MG and RPE-1. 30 &#x03bc;g of protein were processed for western blot with anti-GCase A19057** diluted at 1/1000. Predicted band size: 59.7 kDa. **= recombinant antibody.</p>
                </caption>
                <graphic id="gr2" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/192114/102a4d68-2f48-4589-98a0-cad02d05d050_figure2.gif"/>
            </fig>
            <p>We then assessed the capability of all twenty-four antibodies to capture GCase from HAP1 protein extracts using immunoprecipitation techniques, followed by western blot analysis. For the immunoblot step, a specific GCase antibody identified previously (refer to 
                <xref ref-type="fig" rid="f1">
Figure 1</xref>) was selected. Equal amounts of the starting material (SM) and the unbound fractions (UB), as well as the whole immunoprecipitate (IP) eluates were separated by SDS-PAGE (
                <xref ref-type="fig" rid="f3">
Figure 3</xref>).</p>
            <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                <label>
Figure 3. </label>
                <caption>
                    <title>GCase antibody screening by immunoprecipitation on HAP1 lysates.</title>
                    <p>HAP1 lysates were prepared, and immunoprecipitation was performed using 1 mg of lysate and 2.0 &#x03bc;g of the indicated GCase antibodies pre-coupled to Dynabeads protein A or protein G. Samples were washed and processed for western blot with the anti-GCase ab55080* diluted at 1/500 or A19057** at 1/1000. The Ponceau stained transfers of each blot are shown. SM=4% starting material; UB=4% unbound fraction; IP=immunoprecipitate, HC= antibody heavy chain. **= recombinant antibody, *= monoclonal antibody.</p>
                </caption>
                <graphic id="gr3" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/192114/102a4d68-2f48-4589-98a0-cad02d05d050_figure3.gif"/>
            </fig>
            <p>Based on the assessment of GCase expression in 
                <xref ref-type="fig" rid="f2">
Figure 2</xref>, the highest expressing RPE-1 cells were selected for antibody screening in immunofluorescence. A KO cell line was generated by an academic partner in RPE-1 using CRISPR/Cas9. For immunofluorescence, twenty-two antibodies were screened using a mosaic strategy. First, RPE-1 WT and 
                <italic toggle="yes">GBA1</italic> KO cells were labelled with different fluorescent dyes in order to distinguish the two cell lines, and the GCase antibodies were evaluated. Both WT and KO lines imaged in the same field of view to reduce staining, imaging and image analysis bias (
                <xref ref-type="fig" rid="f4">
Figure 4</xref>). Quantification of immunofluorescence intensity in hundreds of WT and KO cells was performed for each antibody tested, and the images presented in 
                <xref ref-type="fig" rid="f4">
Figure 4</xref> are representative of this analysis.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>
                </sup>
            </p>
            <fig fig-type="figure" id="f4" orientation="portrait" position="float">
                <label>
Figure 4. </label>
                <caption>
                    <title>GCase antibody screening by immunofluorescence in RPE-1 cells.</title>
                    <p>RPE-1 WT and 
                        <italic toggle="yes">GBA1</italic> KO cells were labelled with a green or a far-red fluorescent dye, respectively. WT and KO cells were mixed and plated to a 1:1 ratio on coverslips. Cells were stained with the indicated GCase antibodies and with the corresponding Alexa-fluor 555 coupled secondary antibody including DAPI. Acquisition of the blue (nucleus-DAPI), green (WT), red (antibody staining) and far-red (KO) channels was performed. Representative images of the merged blue and red (grayscale) channels are shown. WT and KO cells are outlined with green and magenta dashed line, respectively. When an antibody was recommended for immunofluorescence by the supplier, we tested it at the recommended dilution. The rest of the antibodies were tested at 1 and 2 &#x03bc;g/ml, and the final concentration was selected based on the detection range of the microscope used and a quantitative analysis not shown here. Antibody dilutions used: ab125065** at 1/50, ab128879** at 1/200, ab309228** at 1/500, ab309229** at 1/500, ab55080* at 1/1000, 2020A4849* at 1/500, P1AM1914-001-28* at 1/500, ABCD_AR148** 1/100, ABCD_AR150** at 1/100, A19057** at 1/500, NBP2-66871** at 1/1000, MAB7410* at 1/500, 88162** at 1/500, GTX101267 at 1/100, GTX114073 at 1/700, G4171 at 1/1000, 27972-1-AP at 1/300, MA5-26589* at 1/1000, MA5-26591* at 1/1000, MA5-32591** at 1/1000, MA5-35236** at 1/400, and MA5-38382** at 1/200. Bars = 10 &#x03bc;m. **= recombinant antibody, *= monoclonal antibody.</p>
                </caption>
                <graphic id="gr4" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/192114/102a4d68-2f48-4589-98a0-cad02d05d050_figure4.gif"/>
            </fig>
            <p>This study confirms the utility of the mouse monoclonal antibodies clones 1/17 and 1/23 for immunoprecipitation and immunofluorescence,
                <sup>
                    <xref ref-type="bibr" rid="ref8">8</xref>
                </sup> and identifies rabbit recombinant antibodies suitable across multiple applications. The availability of both mouse- and rabbit-specific GCase antibodies enables multiplexing experiments and supports the development of antibody pairs for applications such as ELISA assays.</p>
            <p>In conclusion, we have screened twenty-four GCase commercial antibodies by western blot, immunoprecipitation, and immunofluorescence by comparing the signal produced by the antibodies in human HAP1 and RPE-1 WT and 
                <italic toggle="yes">GBA1</italic> KO cells. To assist users in interpreting antibody performanyce, 
                <xref ref-type="table" rid="T4">
Table 4</xref> outlines various scenarios in which antibodies may perform in all three applications.
                <sup>
                    <xref ref-type="bibr" rid="ref7">7</xref>
                </sup> Several high-quality and renewable antibodies that successfully detect GCase were identified in all applications. Researchers who wish to study GCase in a different species are encouraged to select high-quality antibodies, based on the results of this study, and investigate the predicted species reactivity of the manufacturer before extending their research.</p>
        </sec>
        <sec id="sec3">
            <title>Limitations</title>
            <p>Inherent limitations are associated with the antibody characterization platform used in this study. Firstly, the YCharOS project focuses on renewable (recombinant and monoclonal) antibodies and does not test all commercially available GCase antibodies. YCharOS partners provide approximately 80% of all renewable antibodies, but some top-cited polyclonal antibodies may not be available through these partners. We encourage readers to consult vendor documentation to identify the specific antigen each antibody is raised against, where such information is available.</p>
            <p>Secondly, the YCharOS effort employs a non-biased approach that is agnostic to the protein for which antibodies have been characterized. The aim is to provide objective data on antibody performance without preconceived notions about how antibodies should perform or the molecular weight that should be observed in western blot. As the authors are not experts in GCase, only a brief overview of the protein&#x2019;s function and its relevance in disease is provided. GCase experts are invited to analyze and interpret observed banding patterns in western blots and subcellular localization in immunofluorescence.</p>
            <p>Thirdly, YCharOS experiments are not performed in replicates primarily due to the use of multiple antibodies targeting various epitopes. Once a specific antibody is identified, it validates the protein expression of the intended target in the selected cell line, confirms the lack of protein expression in the KO cell line and supports conclusions regarding the specificity of the other antibodies. All experiments are performed using master mixes, and meticulous attention is paid to sample preparation and experimental execution. In IF, the use of two different concentrations serves to evaluate antibody specificity and can aid in assessing assay reliability. In instances where antibodies yield no signal, a repeat experiment is conducted following titration. Additionally, our independent data is performed subsequently to the antibody manufacturers internal validation process, therefore making our characterization process a repeat.</p>
            <p>Lastly, as comprehensive and standardized procedures are respected, any conclusions remain confined to the experimental conditions and cell line used for this study. The use of a single cell type for evaluating antibody performance poses as a limitation, as factors such as target protein abundance significantly impact results. Additionally, the use of cancer cell lines containing gene mutations poses a potential challenge, as these mutations may be within the epitope coding sequence or other regions of the gene responsible for the intended target. Such alterations can impact the binding affinity of antibodies. This represents an inherent limitation of any approach that employs cancer cell lines.</p>
        </sec>
        <sec id="sec4" sec-type="methods">
            <title>Method</title>
            <p>The standardized protocols used to carry out this KO cell line-based antibody characterization platform was established and approved by a collaborative group of academics, industry researchers and antibody manufacturers. The detailed materials and step-by-step protocols used to characterize antibodies in western blot, immunoprecipitation and immunofluorescence are openly available on Protocols.io (
                <ext-link ext-link-type="uri" xlink:href="https://www.protocols.io/view/a-consensus-platform-for-antibody-characterization-3byl49oxrgo5/v1">protocols.io/view/a-consensus-platform-for-antibody-characterization
</ext-link>).
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>
                </sup> Brief descriptions of the experimental setup used to carry out this study can be found below.</p>
            <sec id="sec5">
                <title>Cell lines and antibodies</title>
                <p>The cell lines, primary and secondary antibodies used in this study are listed in 
                    <xref ref-type="table" rid="T1">
Tables 1</xref>, 
                    <xref ref-type="table" rid="T2">2</xref>, and 
                    <xref ref-type="table" rid="T3">3</xref>, respectively. To ensure consistency with manufacturer recommendations and account for proprietary formulations (where antibody concentrations are not disclosed), antibody usage is reported as dilution ratios rather than absolute concentrations. To facilitate proper citation and unambiguous identification, all cell lines and antibodies are referenced with their corresponding Research Resource Identifiers (RRIDs).
                    <sup>
                        <xref ref-type="bibr" rid="ref9">9</xref>,
                        <xref ref-type="bibr" rid="ref10">10</xref>
                    </sup> HAP1 KO clone corresponding to the 
                    <italic toggle="yes">GBA1</italic> was generated with low passage cells at Horizon Discovery. Guide RNA (CCCATCCAGGCTAATCACAC) were used to induce a 23bp deletion in the exon 3 of 
                    <italic toggle="yes">GBA1</italic> gene. All cell lines used in this study were regularly tested for mycoplasma contamination and were confirmed to be mycoplasma-free.</p>
            </sec>
            <sec id="sec6">
                <title>Antibody screening by western blot</title>
                <p>HAP1 WT and 
                    <italic toggle="yes">GBA1</italic> KO cells were collected in RIPA buffer (25mM Tris-HCl pH 7.6, 150mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS) (Thermo Fisher Scientific, cat. number 89901) supplemented with 1x protease inhibitor cocktail mix (MilliporeSigma, cat. number P8340). Lysates were sonicated briefly and incubated 30 min on ice. Lysates were spun at ~110,000 
                    <italic toggle="yes">x g</italic> for 15 min at 4&#x00b0;C and equal protein aliquots of the supernatants were analyzed by SDS-PAGE and western blot. BLUelf prestained protein ladder (GeneDireX, cat. number PM008-0500) was used.</p>
                <p>Western blots were performed with precast midi 4-20% Tris-Glycine polyacrylamide gels (Thermo Fisher Scientific, cat. number WXP42012BOX) ran with Tris/Glycine/SDS buffer (Bio-Rad, cat. number 1610772), loaded in Laemmli loading sample buffer (Thermo Fisher Scientific, cat. number AAJ61337AD) and transferred on nitrocellulose membranes. Proteins on the blots were visualized with Ponceau S staining (Thermo Fisher Scientific, cat. number BP103-10) which is scanned to show together with individual western blot. Blots were blocked with 5% milk for 1 hr, and antibodies were incubated O/N at 4&#x00b0;C with 5% milk in TBS with 0,1% Tween 20 (TBST) (Cell Signalling Technology, cat. number 9997). Following three washes with TBST, the peroxidase conjugated secondary antibody was incubated at a dilution of ~0.2 &#x03bc;g/ml in TBST with 5% milk for 1 hr at room temperature followed by three washes with TBST. Membranes were incubated with Pierce ECL (Thermo Fisher Scientific, cat. number 32106) Or Clarity Western ECL Substrate (Bio-Rad, cat. number 1705061) prior to detection with the iBright&#x2122; CL1500 Imaging System (Thermo Fisher Scientific, cat. number A44240).</p>
            </sec>
            <sec id="sec7">
                <title>Antibody screening by immunoprecipitation</title>
                <p>Antibody-bead conjugates were prepared by adding 2 &#x03bc;g to 500 &#x03bc;l of Pierce IP Lysis Buffer from Thermo Fisher Scientific (cat. number 87788) in a microcentrifuge tube, together with 30 &#x03bc;l of Dynabeads protein A- (for rabbit antibodies) or protein G- (for mouse antibodies) (Thermo Fisher Scientific, cat. number 10002D and 10004D, respectively). Anti-GCase MA5-52914** was at an unknown concentration and thus 10 &#x03bc;l were tested in IP. All tubes were rocked for ~1 h at 4&#x00b0;C followed by two washes to remove unbound antibodies. HAP1 WT were collected in Pierce IP buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40 and 5% glycerol) supplemented with protease inhibitor. Lysates were rocked 30 min at 4&#x00b0;C and spun at 110,000 
                    <italic toggle="yes">x g</italic> for 15 min at 4&#x00b0;C. 0.5 ml aliquots at 1 mg/ml of lysate were incubated with an antibody-bead conjugate for ~1 h at 4&#x00b0;C. The unbound fractions were collected, and beads were subsequently washed three times with 1.0 ml of IP buffer and processed for SDS-PAGE and western blot on precast midi 4-20% Tris-Glycine polyacrylamide gels. Protein A:HRP was used as a secondary detection system at a concentration of 0.5 &#x03bc;g/ml.</p>
            </sec>
            <sec id="sec8">
                <title>Antibody screening by immunofluorescence</title>
                <p>RPE-1 WT and 
                    <italic toggle="yes">GBA1</italic> KO cells were labelled with a green and a far-red fluorescence dye, respectively (Thermo Fisher Scientific, cat. number C2925 and C34565). The nuclei were labelled with DAPI (Thermo Fisher Scientific, cat. Number D3571) fluorescent stain. WT and KO cells were plated on 96-well plate with optically clear flat-bottom (Perkin Elmer, cat. number 6055300) as a mosaic and incubated for 24 hrs in a cell culture incubator at 37
                    <sup>o</sup>C, 5% CO
                    <sub>2</sub>. Cells were fixed in 4% paraformaldehyde (PFA) (VWR, cat. number 100503-917) in phosphate buffered saline (PBS) (Wisent, cat. number 311-010-CL). Cells were permeabilized in PBS with 0,1% Triton X-100 (Thermo Fisher Scientific, cat. number BP151-500) for 10 min at room temperature and blocked with PBS with 5% BSA, 5% goat serum (Gibco, cat. number 16210-064) and 0.01% Triton X-100 for 30 min at room temperature. Cells were incubated with IF buffer (PBS, 5% BSA, 0,01% Triton X-100) containing the primary GCase antibodies overnight at 4&#x00b0;C. Cells were then washed 3 &#x00d7; 10 min with IF buffer and incubated with corresponding Alexa Fluor 555-conjugated secondary antibodies in IF buffer at a dilution of 1.0 &#x03bc;g/ml for 1 hr at room temperature with DAPI. Cells were washed 3 &#x00d7; 10 min with IF buffer and once with PBS.</p>
                <p>Images were acquired on an ImageXpress micro confocal high-content microscopy system (Molecular Devices), using a 20x NA 0.95 water immersion objective and scientific CMOS cameras, equipped with 395, 475, 555 and 635 nm solid state LED lights (lumencor Aura III light engine) and bandpass filters to excite DAPI, Cellmask Green, Alexa-555 and Cellmask Red, respectively. Images had pixel sizes of 0.68 x 0.68 microns, and a z-interval of 4 microns. For analysis and visualization, shading correction (shade only) was carried out for all images. Then, maximum intensity projections were generated using 3 z-slices. Segmentation was carried out separately on maximum intensity projections of Cellmask channels using CellPose 1.0, and masks were used to generate outlines and for intensity quantification.
                    <sup>
                        <xref ref-type="bibr" rid="ref11">11</xref>
                    </sup> Figures were assembled with Adobe Illustrator.</p>
            </sec>
        </sec>
    </body>
    <back>
        <sec id="sec11" sec-type="data-availability">
            <title>Data availability</title>
            <sec id="sec12">
                <title>Underlying data</title>
                <p>Zenodo: Dataset for the GCase antibody screening study (
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.5281/zenodo.17693514">https://doi.org/10.5281/zenodo.17693514</ext-link>)</p>
                <p>Data are available under the terms of 
                    <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/deed.en">the Creative Commons Attribution 4.0 International license (CC-BY 4.0</ext-link>).</p>
            </sec>
        </sec>
        <ack>
            <title>Acknowledgment</title>
            <p>We would like to thank the NeuroSGC/YCharOS/EDDU collaborative group for their important contribution to the creation of an open scientific ecosystem of antibody manufacturers and KO cell line suppliers, for the development of community-agreed protocols, and for their shared ideas, resources, and collaboration. Members of the group can be found below. We would also like to thank the Advanced BioImaging Facility (ABIF) consortium for their image analysis pipeline development and conduction (RRID:SCR_017697). Members of each group can be found below.</p>
            <p>NeuroSGC/YCharOS/EDDU collaborative group: Thomas M. Durcan, Aled M. Edwards, Peter S. McPherson, Chetan Raina and Wolfgang Reintsch</p>
            <p>ABIF consortium: Claire M. Brown and Joel Ryan</p>
            <p>Thank you to the Structural Genomics Consortium, a registered charity (no. 1097737), for your support on this project. The Structural Genomics Consortium receives funding from Bayer AG, Boehringer Ingelheim, Bristol-Myers Squibb, Genentech, Genome Canada through Ontario Genomics Institute (grant no. OGI-196), the EU and EFPIA through the Innovative Medicines Initiative 2 Joint Undertaking (EUbOPEN grant no. 875510), Janssen, Merck KGaA (also known as EMD in Canada and the United States), Pfizer and Takeda.</p>
        </ack>
        <ref-list>
            <title>References</title>
            <ref id="ref1">
                <label>1</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Parlar</surname>
                            <given-names>SC</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Grenn</surname>
                            <given-names>FP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kim</surname>
                            <given-names>JJ</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Classification of GBA1 Variants in Parkinson&#x2019;s Disease: The GBA1-PD Browser.</article-title>
                    <source>

                        <italic toggle="yes">Mov. Disord.</italic>
</source>
                    <year>2023</year>;<volume>38</volume>(<issue>3</issue>):<fpage>489</fpage>&#x2013;<lpage>495</lpage>.
                    <pub-id pub-id-type="pmid">36598340</pub-id>
                    <pub-id pub-id-type="doi">10.1002/mds.29314</pub-id>
                    <pub-id pub-id-type="pmcid">PMC10033371</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref2">
                <label>2</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Orvisky</surname>
                            <given-names>E</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Park</surname>
                            <given-names>JK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Parker</surname>
                            <given-names>A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The identification of eight novel glucocerebrosidase (GBA) mutations in patients with Gaucher disease.</article-title>
                    <source>

                        <italic toggle="yes">Hum. Mutat.</italic>
</source>
                    <year>2002</year>;<volume>19</volume>(<issue>4</issue>):<fpage>458</fpage>&#x2013;<lpage>459</lpage>.
                    <pub-id pub-id-type="pmid">11933202</pub-id>
                    <pub-id pub-id-type="doi">10.1002/humu.9024</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref3">
                <label>3</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ayoubi</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ryan</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Gonzalez Bolivar</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>A consensus platform for antibody characterization.</article-title>
                    <source>

                        <italic toggle="yes">Nat. Protoc.</italic>
</source>
                    <year>2024</year>.</mixed-citation>
            </ref>
            <ref id="ref4">
                <label>4</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Biddle</surname>
                            <given-names>MS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Virk</surname>
                            <given-names>HS</given-names>
                        </name>
</person-group>:
                    <article-title>YCharOS open antibody characterisation data: Lessons learned and progress made.</article-title>
                    <source>

                        <italic toggle="yes">F1000Res.</italic>
</source>
                    <year>2023</year>;<volume>12</volume>:<fpage>1344</fpage>.
                    <pub-id pub-id-type="pmid">37854875</pub-id>
                    <pub-id pub-id-type="doi">10.12688/f1000research.141719.1</pub-id>
                    <pub-id pub-id-type="pmcid">PMC10579855</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref5">
                <label>5</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Laflamme</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>McKeever</surname>
                            <given-names>PM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kumar</surname>
                            <given-names>R</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Implementation of an antibody characterization procedure and application to the major ALS/FTD disease gene C9ORF72.</article-title>
                    <source>

                        <italic toggle="yes">elife.</italic>
</source>
                    <year>2019</year>;<volume>8</volume>.
                    <pub-id pub-id-type="pmid">31612854</pub-id>
                    <pub-id pub-id-type="doi">10.7554/eLife.48363</pub-id>
                    <pub-id pub-id-type="pmcid">PMC6794092</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref6">
                <label>6</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Alshafie</surname>
                            <given-names>W</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Fotouhi</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Shlaifer</surname>
                            <given-names>I</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Identification of highly specific antibodies for Serine/threonine-protein kinase TBK1 for use in immunoblot, immunoprecipitation and immunofluorescence.</article-title>
                    <source>

                        <italic toggle="yes">F1000Res.</italic>
</source>
                    <year>2022</year>;<volume>11</volume>:<fpage>977</fpage>.
                    <pub-id pub-id-type="doi">10.12688/f1000research.124632.1</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref7">
                <label>7</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ayoubi</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ryan</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Biddle</surname>
                            <given-names>MS</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Scaling of an antibody validation procedure enables quantification of antibody performance in major research applications.</article-title>
                    <source>

                        <italic toggle="yes">elife.</italic>
</source>
                    <year>2023</year>;<volume>12</volume>:<fpage>12</fpage>.
                    <pub-id pub-id-type="doi">10.7554/eLife.91645.2</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref8">
                <label>8</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Jong</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Gehrlein</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sidransky</surname>
                            <given-names>E</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Characterization of Novel Human beta-glucocerebrosidase Antibodies for Parkinson&#x2019;s Disease Research.</article-title>
                    <source>

                        <italic toggle="yes">J. Parkinsons Dis.</italic>
</source>
                    <year>2024</year>;<volume>14</volume>(<issue>1</issue>):<fpage>65</fpage>&#x2013;<lpage>78</lpage>.
                    <pub-id pub-id-type="pmid">38251062</pub-id>
                    <pub-id pub-id-type="doi">10.3233/JPD-230295</pub-id>
                    <pub-id pub-id-type="pmcid">PMC10836542</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref9">
                <label>9</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Bandrowski</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Pairish</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Eckmann</surname>
                            <given-names>P</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The Antibody Registry: ten years of registering antibodies.</article-title>
                    <source>

                        <italic toggle="yes">Nucleic Acids Res.</italic>
</source>
                    <year>2023</year>;<volume>51</volume>(<issue>D1</issue>):<fpage>D358</fpage>&#x2013;<lpage>D367</lpage>.
                    <pub-id pub-id-type="pmid">36370112</pub-id>
                    <pub-id pub-id-type="doi">10.1093/nar/gkac927</pub-id>
                    <pub-id pub-id-type="pmcid">PMC9825422</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref10">
                <label>10</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Bairoch</surname>
                            <given-names>A</given-names>
                        </name>
</person-group>:
                    <article-title>The Cellosaurus, a Cell-Line Knowledge Resource.</article-title>
                    <source>

                        <italic toggle="yes">J. Biomol. Tech.</italic>
</source>
                    <year>2018</year>;<volume>29</volume>(<issue>2</issue>):<fpage>25</fpage>&#x2013;<lpage>38</lpage>.
                    <pub-id pub-id-type="pmid">29805321</pub-id>
                    <pub-id pub-id-type="doi">10.7171/jbt.18-2902-002</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5945021</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref11">
                <label>11</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Stringer</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Michaelos</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Cellpose: a generalist algorithm for cellular segmentation.</article-title>
                    <source>

                        <italic toggle="yes">Nat. Methods.</italic>
</source>
                    <year>2021</year>;<volume>18</volume>(<issue>1</issue>):<fpage>100</fpage>&#x2013;<lpage>106</lpage>.
                    <pub-id pub-id-type="pmid">33318659</pub-id>
                    <pub-id pub-id-type="doi">10.1038/s41592-020-01018-x</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report446553">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.192114.r446553</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Bowman</surname>
                        <given-names>Karen</given-names>
                    </name>
                    <xref ref-type="aff" rid="r446553a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0009-0002-9288-7106</uri>
                </contrib>
                <aff id="r446553a1">
                    <label>1</label>University of Leicester, Leicester, England, UK</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>13</day>
                <month>1</month>
                <year>2026</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2026 Bowman K</copyright-statement>
                <copyright-year>2026</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport446553" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.174230.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>The study involved characterisation of twenty-four commercial antibodies, from several different companies, for the&#x00a0;human glucocerebrosidase (GCase) protein for use in western blot, immunoprecipitation, and immunofluorescence. The study formed part of the wider YCharOS collaboration to characterise commercial antibodies for human proteins using standardised protocols with the intention of improving antibody reproducibility issues. As a Data Note, it allows the direct comparison of the performance of commercially available antibodies to the GCase protein to aid scientists in choosing the most appropriate antibody for their studies. For example, in understanding how disease-related mutations affect the protein&#x2019;s biochemical and cellular characteristics. This comparison would be of particular use in the study of Parkinson&#x2019;s and Gaucher&#x2019;s disease.</p>
            <p> A committee of industry and academic representatives have endorsed the platform used, and the protocols are consistent with those in general use. The platform consisted of identification of human cell lines suitable for antibody characterisation studies i.e., with adequate levels of the GCase protein to generate a measurable signal. The final step was a series of antibody characterisation procedures, limited to the most common research uses of antibodies. They found that the commercially available HAP1 cell line expresses 
                <italic>GBA1</italic> transcript at a level above the average range for cancer cells analysed, and therefore, was a logical choice for their study. A further three cell lines (HeLa, WT U-87 MG and RPE-1) and neural progenitor cells, which also express 
                <italic>GBA1</italic> transcript at high levels, were evaluated by western blot to determine GCase expression levels. Knockdown of the target gene was used to provide appropriate negative control cells for each cell line (
                <italic>GBA1</italic> KO). Knockout cells were obtained from either commercial sources or, in the case of RPE-1 
                <italic>GBA1</italic> KO, from an academic partner utilising CRISPR/Cas9 technology. The antibodies were evaluated by western blot and immunoprecipitation in HAP1 wild type and HAP1 
                <italic>GBA1</italic> KO cells. However, the immunofluorescence studies were conducted in RPE-1 and RPE-1 
                <italic>GBA1</italic> KO cells as they exhibited the highest levels of GCase expression in a western blot comparison assay. The interpretation of the results is left to the reader, with the study providing unbiased guidance. However, it gave some indication of the optimum dilutions of commercial antibodies. Limitations of the study are clearly stated. The study indicates variability in the specificity of the antibodies within and between assays. It highlights the importance of selecting the most appropriate anti-GCase antibody for each specific assay. At face value, the use of the RPE-1 
                <italic>GBA1</italic> KO cell line to compare binding of the antibodies in the presence and absence of GCase protein is acceptible, but more information and a&#x00a0;reference and/or a link for the RPE-1 
                <italic>GBA1</italic> KO cells would help with interpretation of the results.</p>
            <p>Are sufficient details of methods and materials provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Is the rationale for creating the dataset(s) clearly described?</p>
            <p>Yes</p>
            <p>Are the datasets clearly presented in a useable and accessible format?</p>
            <p>Yes</p>
            <p>Are the protocols appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Drug development, cell biology</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report442397">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.192114.r442397</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Moshinsky</surname>
                        <given-names>Deborah</given-names>
                    </name>
                    <xref ref-type="aff" rid="r442397a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0009-0000-4909-7489</uri>
                </contrib>
                <aff id="r442397a1">
                    <label>1</label>Institute for Protein Innovation, Boston, Massachusetts, USA</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>10</day>
                <month>1</month>
                <year>2026</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2026 Moshinsky D</copyright-statement>
                <copyright-year>2026</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport442397" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.174230.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>The authors tested 24 commercially available antibodies to GCase for their ability to bind to antigen in Western Blotting, Immunoprecipitation, and Immunofluorescence.&#x00a0; Cell lines expressing the target at high levels were used and comparisons were made to knockouts.&#x00a0; Renewable antibodies that detect GCase were identified in all applications.&#x00a0; The authors present general guidance in data interpretation and state sufficient reasons for not engaging in full data interpretation.&#x00a0; They also clearly specify limitations of their studies.&#x00a0; Overall, this study should provide a great resource for those seeking validated antibodies for GCase in the applications tested using standardized and clearly defined protocols.&#x00a0; The authors are encouraged to perform a spell check, as an error was found (i.e. "performanyce").</p>
            <p>Are sufficient details of methods and materials provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Is the rationale for creating the dataset(s) clearly described?</p>
            <p>Yes</p>
            <p>Are the datasets clearly presented in a useable and accessible format?</p>
            <p>Yes</p>
            <p>Are the protocols appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Antibody Characterization and Validation</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
</article>
