F1000Research F1000Research 2046-1402 F1000 Research Limited London, UK 10.12688/f1000research.160839.2 Research Article Articles Vitamin D binding protein rs7041 and rs4588 gene polymorphisms in Ugandan tuberculosis patients and household contacts: A pilot study

[version 2; peer review: 2 approved, 1 approved with reservations]

 Ester Acen L. Conceptualization Data Curation Formal Analysis Funding Acquisition Investigation Methodology Project Administration Resources Validation Visualization Writing – Original Draft Preparation Writing – Review & Editing https://orcid.org/0000-0001-7048-4643 a 1 Moses Joloba L. Project Administration Supervision Validation Visualization Writing – Review & Editing 2 Akintola Ashraf Formal Analysis Methodology Resources Software Visualization Writing – Review & Editing 3 Begum Syed Nabi Rizwana Formal Analysis Investigation Visualization Writing – Review & Editing 4 Andia Biraro Irene Project Administration Resources Supervision Validation Writing – Review & Editing https://orcid.org/0000-0002-8303-6046 5 Worodria William Project Administration Supervision Validation Writing – Review & Editing 6 Okeng Alfred Formal Analysis Methodology Visualization Writing – Review & Editing 7 Bwambale Kelvin Methodology Software Visualization Writing – Review & Editing 8 Bbuye Mudarshiru Software Visualization Writing – Review & Editing 9 Patrick Kateete David Funding Acquisition Project Administration Supervision Validation Writing – Review & Editing 2 Department of Physiology, School of Biomedical Sciences, College of Health Sciences, Makerere University, Kampala, POBOX 7072, Uganda Department of Immunology and Molecular Biology, School of Biomedical Sciences, College of Health Sciences, Makerere University, Kampala, POBOX 7072, Uganda Department of Biomedical Convergence Science and Technology, School of Industrial Technology Advances, Kyungpook National University, Daegu, 41566, South Korea Department of Southern Area Crop Science, National Institute of Crop Science, Rural Development Administration, Miryang, 50424, South Korea Department of Internal Medicine, School of Medicine, College of Health Sciences Unit, Makerere University, Kampala, POBOX 7072, Uganda Department of Internal Medicine, Pulmonary Division, Mulago National Referral Hospital, Kampala, Uganda Department of Molecular Biology and Biotechnology, School of Bio-security and Laboratory Sciences, College of Veterinary Medicine, Makerere University, Kampala, POBOX 7072, Uganda Department of Biosecurity Ecosystems and Veterinary Public Health , School of Bio-security and Laboratory Sciences, College of Veterinary Medicine, Makerere University, Kampala, POBOX 7072, Uganda Makerere Lung Institute, College of Health Sciences, Makerere University College of Health Sciences, Kampala, POBOX 7072, Uganda mulamester82@gmail.com

No competing interests were disclosed.

 21 5 2025 2025 14 154 14 5 2025 Copyright: © 2025 Ester AL et al. 2025 This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Background

Tuberculosis remains a significant global public health concern. Genetic variants influence the distribution of vitamin D in circulation, leading to vitamin D deficiency. The two extensively studied non-synonymous D-binding protein nucleotide polymorphisms rs7041 and rs4588 were found in different populations. These polymorphisms result into three different genotypes, Gc1F (rs7041(A)- rs4588(G)), Gc1S (rs7041(C)- rs4588(G)) and Gc2 (rs7041(A)- rs4588(T)). These genotypes have configurational changes that differ and therefore cause variation in the binding affinity of the vitamin D metabolite. This study aimed to compare the frequency distribution of vitamin D binding protein gene polymorphisms in patients with active Ugandan tuberculosis, individuals with latent tuberculosis infection, and those with no tuberculosis infection.

 Methods

This pilot studyselected 102 samples, including 52 active tuberculosis patients, 23 latent tuberculosis individuals, and 27 individuals without tuberculosis infection, from a previous cross-sectional study. Vitamin D binding protein rs7041 and rs4588 SNPs were genotyped using Polymerase Chain Reaction and Sanger sequencing. Vitamin D binding protein gene polymorphisms were identified using BioEdit software. 7.2 ( http://www.mbio.ncsu.edu/BioEdit/bioedit.html)

Results

This study revealed no significant differences in DBP genetic polymorphisms among the study groups. The frequency distribution of the DBP gene has been reported to be 97% Gc1F, 2% Gc2, and 1% Gc1S. The frequency distribution among patients with TB was 96.2% for Gc1F, 0% for Gc1F, and 3.8% for Gc2. Among the LTBI cases, 95.7% were Gc1F, 4.3% were Gc1S, and 0%were Gc2. The Hardy-Weinberg equilibrium analysis was in equilibrium, D’= 0. P=0.2

 Conclusions

The Gc1F genotype was predominantly found in the study population, with no difference in the frequency distribution according to TB status.

 Vitamin D binding protein gene polymorphisms Tuberculosis The Africa Center of Excellence in Materials, Product Development and Nanotechnology (MAPRONANO ACE) Makerere University This work was funded by “The Africa Center of Excellence in Materials, Product Development and Nanotechnology (MAPRONANO ACE) Makerere University” under the World Bank project. The funding agencies did not play any role in the development of this study. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Amendments from Version 1

In the title we added the DBP SNPS to be more specific. In the abstract we added some details on the GCIF genotypes and their references. The recommendation was removed from the conclusion in the abstract. We have provided details of hypovitaminosis and sunshine exposure of the study population in the introduction section. In the methods section we have given details of the participant characteristics and enrolment period. The genotyping section was broken down in subsections to make it clearer for the readers. The name of the gene was italicised all through the article and the P values were lower cased. the statistical analysis section has an addition on why Fisher’s test was used. In the results section the social demographics section was reorganized for clarity. A section of the comparison of the DBP gene among male and female was added with Table 4 included. In the discussion a component the DBP genotypes and its affinity to vitamin D metabolite was added. More discussions on the comparison and contrast of our study have been added as well. The statement on minor alleles and their association to TB were removed, the recommendation was also removed from the conclusion.

 Introduction

Uganda remains among the high-burden TB/HIV countries reporting an incidence that ranges between 200-350 per 100 cases and a tuberculosis-HIV co-infection of 40%. Studies have reported vitamin D deficiency to be a risk factor for TB disease. Our previous study reported a high proportion of hypovitaminosis D among TB patients and household contacts, with the TB patients having significantly lower vitamin D levels compared to the household contacts. 1 This study reported that 42% of the participants had a sun exposure of 1-7 hrs, but 52% did not have a diet with vitamin D. According to another study in Uganda, despite all-round sunshine, a high prevalence of vitamin D deficiency was reported among adult TB patient. 2 Vitamin D Binding Protein (DBP), also known as group-specific component (Gc), is one of the most prevalent and significant carrier proteins of vitamin D metabolites, accounting for an estimated 85-90% of the total metabolite. 3– 6 The unbound fraction, which is the free fraction, was estimated to be less than 1%, whereas the albumin-bound fraction was approximately 10-15%. 7 DBP, a member of the albumin family, is synthesized in the liver. 8 This protein is considered responsible for vitamin D deficiency in target cells, as the bound fraction has a minimal impact on target cells. 8, 9 Other functions of DBP include actin scavenging, macrophage activation, and fatty acid transport. 3

The highly polymorphic DBP gene is located at 4q12-q13, with over 120 variants. 10 These genetic variations, affect the circulatory distribution of vitamin D, which leads to vitamin D deficiency. 5 In various populations of the world, the two extensively studied non-synonymous DBP single nucleotide polymorphisms (SNPs) rs7041 and rs4588 exhibit variable distributions. 4 These variations are located in exon 11, where 7041 encodes c.1296 T>G p.Asp416Glu, while rs4588 encodes c.1307 C>A p.Thr420Lys. 11 These two variations give rise to three polymorphic isoforms, which are known to differ by lineage and include Gc1F, Gc1S and Gc2. 12, 13 The wild type of these SNPs is Gc1Fgenotype variations in the in Gc1F, D416E, and T420K result in, the Gc1S and Gc2 genotypes, respectively. 14 Gc2 is found at locus rs4588 while Gc1F and Gc1S are found at locus rs7041. 10 Previous studies have shown that people who have the rs7041 G allele as a substitute for the T allele and the rs4588 A allele instead of the C allele have higher levels of DBP and a higher affinity for vitamin D, consequently resulting in lower free and bioavailable vitamin D levels. Consequently, the DBP role controlling total, free, and bioavailable vitamin D is crucial in immunity and influences progression of disease. 15

Studies have documented that vitamin D deficiency contributes to TB susceptibility, and individuals with deficiency are at a high risk of developing TB. 16 Therefore, vitamin D status is implicated in the response to M. tuberculosis, and is genotype-dependent, varying across geographical areas. 17

The wild-type Gc1F genotype is predominantly found in the African population, with a low frequency of Gc2 and Gc1S and is associated with low levels of vitamin D. This association is an effect of DBP concentration levels in different genetic variants. The Gc1F genotype has a low concentration of DBP with high affinity for vitamin D metabolites; consequently, low bioavailable vitamin D levels have been reported. 18 Therefore, we performed a cross-sectional study to determine the frequency distribution of DBP gene polymorphisms among ATB patients, LTBI patients, and individuals without TB infection in a Ugandan population.

 Methods Study design and study setting

This pilot study was based on a previous cross-sectional study of 148 participants between the ages of 12-65 years, whose free, bioavailable, and Total vitamin D levels were measured, and a high proportion of hypovitaminosis D was reported in our previous publications. 1 Of these, 102 samples were conveniently selected for genotying. The active TB patients were enrolled between July 2019 to August 2020 at Kiruddu Hospital. The LTBI individuals and healthy control samples were retrieved from the Kampala TB cohort. Details of this previous study have been reported elsewhere. 19 This study was nested from a larger study that was conducted in accordance with the Declaration of Helsinki, and approval was granted by the Makerere University School of Biomedical Sciences Higher Degrees Research Ethics Committee (SBS HDREC)/#SBS-637 on 25 th Jan 2019, Kiruddu Referral Hospital, and National Council of Science and Technology (HS2639) on the 31 st October 2019. All experimental protocols were approved by Makerere University SBS HDREC (#SBS-637) and the National Council of Science and Technology (HS2639), as guided by the Helsinki Declaration. Written informed consent was obtained from active TB patients at Kiruddu Hospital for study participation. Informed consent was obtained from the KTB household contacts, and the parents or guardians consented on behalf of the minors.

Following the inclusion and exclusion criteria, the active TB patients who were positive on GeneXpert without deranged glucose and renal function tests were selected and 4 mls of whole blood was taken. The KTB PBMC samples of LTBI and individuals with no TB, with volumes between 0.2-1.5 mls were selected for genotyping of DBP gene polymorphisms. This was based on the availability of whole blood for ATB patients and peripheral blood mononuclear cells (PBMCs) for LTBI patients/individuals and those with no TB infection. After obtaining ethical approval and informed consent, Gen-expert-positive TB patients from Kiruddu Referral Hospital were enrolled, and samples of household contacts of LTBI Individuals with (QFN+ TST+) results and individuals with no TB infection who were (QFNTST-) from the Kampala TB (KTB) project were included in the study. Samples from patients with LTBI and those without TB infection were purposively selected. PBMC samples with adequate cells were selected for genotyping, and samples with fewer cells were excluded. Based on this, 46 samples were excluded because of inadequate sample volume and the number of cells available for successful genotyping. Individuals with an HIV +serostatus were not excluded from the study.

 DBP gene genotyping

DNA extraction

The phenol-chloroform (PhCHCL 3) method was used to extract DNA from whole blood samples of active TB patients, PBMCs fromLTBIpatients, and those with no TB infection.

Briefly 100 μl of 10% SDS were Dispensed in eppendorf tubes. 150μl of whole blood were then added and mixed by pipeting up and down. This was followed by incubation at 65°C for 10 min using a heat block. 100 μl of 3N Soduim Acetate were added and 5 vortexed vigorously. This was followed by addition of 700 μl of PhCHCL 3. And 280 μl of PCR grade water. The tubes were inverted vigorously several times. they were then Centrifuged @ 13000 rpm for 30 min. 450 μl of the aqueous layer was Transferred to a new eppendorf tube. 1000 μl of absolute isopropanol (100%) was then added. DNA was precipitated at -80°C for 20min. this was followed by centrifuging at 14000 rpm for 30 minutes. The isopropanol was removed off leaving approx 50 μl. Add 700 μl of 70% isopropanol were added and Centrifuged @ 14000 rpm for 30 minutes. The 70% isopropanol was completely removed leaving the dry pellet. The DNA tubes were dried at 65°C. DNA was eluted in 100 μl of PCR H 2O @ 65°C. It was then stored at – 80 °C for future use.

Agarose gel electrophoresis method

Agarose gel electrophoresis of human genomic DNA was performed using 1% agarose gel prepared by weighing and dissolving 1.5 g of agarose in 150 ml of 1x TAE (1% solution). The agarose was boiled thoroughly in a microwave oven for 3 minutes to allow thorough heating and mixing, and allowed to cool to 50°C at room temperature. 7.5 μl of 5 mg/ml ethidium bromide was added and mixed well by gentle agitation. The Agarose solution-ethidium bromide mixture was poured into an assembled gel casting tray with a comb attached and allowed to set at room temperature for approximately one hour. Upon setting, the gel was placed in to the electrophoretic tank and the combs vertically removed. 1x TAE buffer was poured in to the electrophoretic tank to just cover the gel. 5 μl of loading dye was added to 5 ul of each of the PCR product on the Para film, mixed and then loaded on to the wells in the gel.

While loading, the molecular weight marker was always loaded on the first lane and then the extracted human genomic DNA. The samples were run at 120 volts (constant voltages, variable current) for 30 mins. After 1 hr, the electrophoresis was stopped and the gel was carefully transferred to a UV trans illuminator for visualization.

PCR of DBP amplicons

Primers were purchased from Eurofins Genomics, Inc. Germany. The primer sequences were forward 5″AAATAATGAGCAAATGAAAGAAGAC3′ and reverse 5′ CAATAACAGCAAAGAAATGAGTAGA3′ with expected amplicons of approximately 483 bp. Mastermix preparation was performed from the pre-amplification room as follows: 25 μL of 2X Taq Master Mix, 2.5 μl of the reverse primer (6 pM) and 2.5 μl of forward primer (0.6 pM), and 15 μL of PCR water, making a volume of 45 μL for each reaction. Forty-five microliters of the master mix and 5 μL of DNA were added to each of the PCR tubes. Five microliters of PCR water was added to the negative control tube and transferred into the SimpliAmp Thermocycler for 40 cycles under the following programmed conditions: enzyme activation step 5 min at 95°C, denaturation for 20 s at 95°C, annealing for 45 s at 56°C, extension for 10 sat 72°C, Final Extension for 5 min at 72°C, and finally an infinite hold at 4°C. The amplicons were run on a 2% agarose gel, as previously described, and a product size of 483 bp was obtained ( Figure 1a and b).

Sanger sequencing

Under ambient conditions, the PCR products were sent for Sanger sequencing using the forward primer at ACGT in the United States of America. The ABI Big Dye Termination Kit (Applied Biosystems, USA) and the ABI prism 310 Genetic analyser (Applied Biosystems) was used. The sequenced chromatograms were obtained and cleaned up to remove low yield peaks. A BLAST query sequence was performed to confirm the DBP gene against that of the NCBI library. The gene products were named Homo sapiens Gc vitamin D binding protein (Gc), with sequence sizes between 414 bp and 448 bp with a percent identity of 98-99%. The DBP gene reference sequence (AH004448.2, Homo sapiens vitamin D-binding protein gene) was retrieved from the National Center for Biotechnology Information (NCBI). The raw DBP gene sequences from our analysis were aligned to the reference genome. Variant filtering was performed in which low-read regions and errors were identified. Coverage, quality scores, and proximity were also checked. Sites that differed from the reference genome and sequences were identified and sorted according to their nucleotide and amino acid composition. The detection of the presence of SNPs was performed by searching for the possible change in the codon GAT to GAG at position 416, representing the rs7041 variant, and ACG to AAG at position 420 for the rs4588 variant.

a: Agarose gel electrophoresis of the 483 bp DBP gene PCR product representative of active TB patients. Lanes: L=100bp DNA ladder, NC= Negative control, 1- 10=samples from active TB patients. b: Agarose gel electrophoresis of the 483bp DBP gene PCR product representative of LTBI and those with no TB infection. Lanes: L=100bp DNA ladder, NC= Negative control, 1-10=samples from LTBI and those with no TB infection.

All the figures provided here are only found in a preprint and have not been published anywhere else. I therefore assume I do not need to request for copy right permissions.

 Statistical analysis

The data were summarized using STATA software (Stata Corp. STATA 16.0, College Station, Texas, USA). Frequency and percentage (n [%]) were used to determine the frequency distribution of the DBP gene variants. Fisher’s exact test was used to compare the frequency of DBP among the study groups because of the sample size. A potential deviation from Hardy–Weinberg equilibrium was performed using the dnaSP software. V5 ( http://www.ub.es/dnasp).

The p-value was considered significant at P < 0.05, with a 95% confidence interval.

 Results Socio-demographic description of study participants

A total of 102 participants were included, 52 were newly diagnosed ATB patients, 23 had LTBI and 27 had no TB infection with a median age of 28 years (IQR 12–65). The majority (44.6%) were aged between 19 and 30 years, and most were female (61.2%). Half of the participants (50.1%) had ATB. A small proportion of these were HIV-positive, 9 (18.4%). Table 1 shows the social, demographic, and clinical characteristics of the study participants and more details of the study participants have been described elsewhere. 19

Socio-demographic and clinical characteristics of study participants.
Participant characteristic Frequency n( %) Median (IQR)
Age (years) 28 (12,65)
 18 and below 19(18.4)
 19-30 46(44.6)
 31-40 22(21.3)
 Above 40 15(14.5)
Sex
 Female 63(61.2)
 Male 40(38.8)
TB status
 No TB infection 27(26.4)
 Latent TB infection 23(22.5)
 Active TB 52(50.1)
BCG scar
 No 47(46.1)
 Yes 55( 53.9)
Alcohol consumption
 No 75(73.5)
 Yes 27 (26.5)
Smoking
 No 96(94.1)
 Yes 6(5.9)
HIV status
 Negative 83(81.4)
 Positive 19(18.6)

n% represents the number of participants, IQR is interquartile range.

 Frequency distribution of the DBP rs7041 and rs4588 SNPs among active TB patients, LTBI, and those with no TB infection

A Gc1S reference sequence with the GAG codon at position 416 was retrieved from the NCBI database (Homo sapiens vitamin D-binding protein gene) for use. According to our search in BioEdit, all our sequences had the wild-type GAT codon at this position compared to the reference sequence. At position 420, all of our samples had an ACG codon, except for two samples that showed a conversion to AAG. Ninety-seven percent of the study population had rs7041 GAT and ACG for the rs4588 codons, 2% had GAT rs7041 and AAG rs4588, and 1% had rs7041 GAG and rs4588 ACG (Gc1S). Figure 2a- c show the details of this analysis and highlighted transformations. Therefore, the frequency distribution of the DBP genotypes in the study population was Gc1F, 97%; Gc, 2.2%; and Gc1S, 1%. The frequency distribution of the DBP genotypes among patients with TB was 96.2% Gc1f, 0% Gc1S, and 3.8% Gc2. Among the LTBI cases, 95.7% were Gc1F, 4.3% were Gc1S, and 0% were Gc2. For those without TB infection, the frequencies were Gc1F 100%, Gc1s 0% and 0% for Gc2. There was no statistically significant difference in the predominant Gc1F genotype among ATB patients, LTBI individuals, and those without TB infection (P=0.3). Notably, the participants with the Gc2 genotype were ATB patients with HIV coinfection. Furthermore, we also found that individuals with the Gc1S genotype had LTBI. The genotype and allele distributions of the study participants are shown in Table 2 and Table 3, respectively. The Hardy-Weinberg equilibrium analysis was in equilibrium, D’=0, P=0.2.

a: A Sanger sequencing representative chromatogram of the GAT and ACG (Gc1F) genotype.

No conversion was observed in both SNPs rs7041and rs4588, The figure was generated using BioEdit 7.2 software http://www.mbio.ncsu.edu/BioEdit/bioedit.html by A.A. b: A Sanger sequencing representative chromatogram of the GAG and ACG (Gc1S) genotype. A conversion was observed in the rs7041 SNP GAT to GAG and no conversion noted in the rs4588 SNP. The figure was generated using. The figure was generated using BioEdit 7.2, http://www.mbio.ncsu.edu/BioEdit/bioedit.html by A.A. c: A Sanger sequencing representative chromatogram of the GAT and AAG (Gc2)genotype. No conversion was observed in the rs7041 SNP and conversion is noted in the rs4588 SNP from ACG to AAG. The figure was generated using BioEdit 7.2 http://www.mbio.ncsu.edu/BioEdit/bioedit.html by A.A.

 Genotype and allele distribution of the DBP gene among ATB patients, LTBI, and those without TB infection.
GENOTYPES ALLELES Active TB patients LTBI Those with no TB infection N Total/ P value
N= 52 N=23 N=27 N=102
GCIF GC1F rs7041(A)- rs4588(G) 50 (49%) 22 (21.6%) 27(26.4%) P=0.6
GCIS GC1S rs7041(C)- rs4588(G) 0 (0%) 1(1%) 0 (0%)
GC2 GC2 rs7041(A)- rs4588(T)) 2 (2%) 0(0%) 0 (0)%

The frequency distribution of genotypes is represented as a percentage, where n is the number of participants and percentage. The P value was significant at < 0.05.

 Frequency distribution of DBP genotypes according to TB status.
DBP genotypes TB patients n %=52 LTBI n %=23 Those with no TB infection n %=27 P value
Gc1F 50(96.2%) 22(95.7%) 27(100%) 0.29
Gc1S 0(0%) 1(4.3%) 0(0%)
Gc2 2 (3.8%) 0(0% 0(0%)

P value ≤ 0.05.

 Comparison of Vitamin D Binding Protein (DBP) genotype distribution between female and male participants

The distribution of DBP genotypes (Gc1F, Gc1S, and Gc2) was similar between females and males, with no statistically significant difference observed (p=1.00). The Gc1F genotype was predominant in both sexes, being present in 96.8% of females and 97.5% of males ( Table 4).

Distribution of DBP genotypes by gender

DBP genotypes Female (n=62), n (%) Male (n=40), n (%) p-value
Gc1F 60 (96.8) 39 (97.5) 1.00
Gc1S 1 (1.6) 0 (0.0)
Gc2 1 (1.6) 1 (2.5)

Relatedness of the DBP reference gene sequence and study sequence data

A phylogenetic tree was constructed to determine the closeness of the sequences using the maximum likelihood method. The phylogenetic tree revealed a close relationship between the samples and the reference genes, as shown in Figure 3.

Showing a phylogenetic tree indicating the relationship between the reference gene and sequence data, The figure was generated using BioEdit 7.2 <ext-link ext-link-type="uri" xlink:href="http://www.mbio.ncsu.edu/BioEdit/bioedit.html">http://www.mbio.ncsu.edu/BioEdit/bioedit.html</ext-link> by A.A. Discussion

DBP is highly polymorphic, with approximately 120 variants; however, the widely studied variants are the rs7041 and rs4588 SNPs from these three variant genotypes, Gc1F, Gc1S, and Gc2. These genotypes are the predominant source of diversity observed across different geographic locations and ethnicities. Well-documented reports have focused on multiracial populations and lack adequate information regarding homogeneous populations. Extensive research in population genetics has found that the frequency of the Gc1F genotype is predominantly found in Africans and African-Americans and that Gc2 is the lowest. 20 Our study showed a frequency distribution of 97% of the Gc1F genotype, 2% of the Gc2 genotype, and 1% of the Gc1S genotype in the population. This is consistent with the genotype frequency distribution of African Black populations. This finding is comparable to that of two West African studies in Gambia, with a nearly homogeneous population like ours. They reported a frequency distribution of 86.0% and 83.3%, respectively, and another study from South Africa reported 80.0%. 13, 21, 22 However, these studies had a larger sample size than the current study. Similarly, findings from a study among Black Americans and whites showed a frequency distribution of 92.7% for the Gc1F genotype among Blacks (2.1%) and Gc2 (2%). In contrast, the same study found a high-frequency distribution of Gc1S among the white population. 20 In contrast, a study performed among the Eurasian population found the Gc1F genotype to be the lowest (13.7%) and the highest was Gc1S. 18 Correspondingly, astudy from Finland reported a low frequency of Gc1F (3.7%). 23 The above observations show that DBP polymorphisms are ethnically based; therefore, diverse effects on vitamin D metabolites are likely to be observed. This study did not find a statistically significantdifference in the frequency distribution of the Gc1F DBP genotype among the three study groups (P=0.3). This finding is similar to that of a study from Pakistan that reported a non-significant association of DBP with TB (P=0.3). 24 However, we noted that the Gc2 genotype was only found among active TB patients with HIV coinfection. This finding is comparable to that of the previously mentioned South African study that reported an association between the Gc2 genotype and TB status among Asians. 25 Furthermore, a recent study in China exploring vitamin D pathway gene polymorphisms found that the DBP Gc2 genotype was associated with progression to pulmonary TB. 32 Moreover, in our study, the Gc1S genotype was detected in the LTBI group. Therefore, these findings suggest that the minor alleles in our population have a genetic association. The Gc1F genotype is predominant in the black population; therefore, it is worth mentioning that our population was consistent with the Hardy-Weinberg equilibrium, and the frequency distribution observed is possibly a representation of our study population. Consequently, in addition to genetic predisposition, environmental, social, and economic factors may play a major role in TB susceptibility in the population.

Regarding the HIV sub-analysis, no statistical significance was found among the genotypes and TB status. Similarly, from our previous study no significant difference was observed in vitamin D levels among the HIV and none HIV. 26 , 27

Considering the analysis of sex and the DBP gene, no statistical difference was observed in the frequency distribution among male and female participants (P=0.07). This observation is similar to that of a study in India on TB patients. 28

With reference to genetic polymorphisms and vitamin D metabolites, the Gc1F genotype is predicted to have high affinity for total vitamin D compared to others. 29 In our study free and bioavailable vitamin D levels, the Gc1F and Gc1S were associated with higher free and bioavailable vitamin D levels compared to the Gc2 which had the lowest (Data not shown). This finding may be closely similar to a study that found higher levels in the same genotypes compared to Gc2, nonetheless, they measured total vitamin D not free and bioavailable levels. 30 On the contrary, a study from Finland with adjustments parameters reported the Gc2 genotype to have the highest free and bioavailable vitamin D levels and the Gc1F the lowest. 31 A study from Saudi Arabia among postmenopausal women reported similar findings of no association between the DBP gene polymorphism and free and bioavailable vitamin D levels. 27 Furthermore, another study from the same region reported that free and bioavailable vitamin D levels differed according to minor and major rs7041 and rs4588 alleles. 26

We acknowledge that the small sample size and homogeneous population of the current study could have contributed to the less significant effect size needed to detect minor alleles, as observed. Further research is warranted in a larger homogenous and heterogeneous population to increase the probability of detecting minor alleles in the population in order to adequately determine their functional significance and their role in TB pathogenesis. This is important for TB control and prevention. We did not eliminate HIV positive individuals during the selection of the study participants therefore do not know their impact as confounders although this did not reveal in the sub analysis. Therefore, future studies should consider larger sample sizes to increase the probability of detecting minor alleles in the population. The strength of this study is that it is the first to determine DBP gene polymorphisms in the Ugandan population of active TB patients, LTBI, and household contacts, providing an adequate representation of TB status.

 Conclusion

The frequency distribution of the DBP and Gc1F genotypes was predominantly found in the study population, with no statistically significant difference among the ATB patients, LTBI patients, and those with no TB infection.

 Ethical approval and informed consent

This study was nested from a larger study that was conducted in accordance with the Declaration of Helsinki, and approval was granted by the Makerere University School of Biomedical Sciences Higher Degrees Research Ethics Committee (SBS HDREC)/#SBS-637 on 25 th Jan 2019, Kiruddu Referral Hospital, and National Council of Science and Technology (HS2639) on the 31 st October 2019. All experimental protocols were approved by Makerere University SBS HDREC (#SBS-637) and the National Council of Science and Technology (HS2639), as guided by the Helsinki Declaration. Written informed consent was obtained from active TB patients at Kiruddu Hospital for study participation. Informed consent was obtained from the KTB household contacts, and the parents or guardians consented on behalf of the minors.

 Authors’ contributions

Conceptualization: E.L.A., Data curation: E. L. A., Formal analysis: E. L. A., A. A., R.B. S. N., A. O., Funding Acquisition: E.L.A., D.P. K., Investigation: E.L.A., Project Administration: E.L.A., I.A.B., W.W., D.P.K., M.L.J., Methodology: E. L. A., A. A., R.B.S.N., A.O. K. B., Resources: E.L.A., I, A.B., A.A., R.B. S. N., Software: M. B., A.A. K. B. Supervision: W. W., D.P. K., I. A. B., M L. J., Validation: E.L.A., W. W., D.P. K., I. A. B., M L. J., Visualization: E.L.A., A.A.R.B. S. N., M.B., K.B., A.O., Writing – original draft: E. L. A., Writing – review & editing: All authors reviewed the manuscript.

 Data availability

The dataset that was generated and analyzed during the current study is available in GenBank with accession numbers BankIt2605152: *OP032652 - OP032748* https://www.ncbi.nlm.nih.gov/nuccore/OP032652.1/.

The project contains

Figshare: Ester supplimentary data.zip. https://doi.org/10.6084/m9.figshare.28234484.v3. 32

Data are available under the terms of the Creative Commons (CC0 1.0 Public domain dedication), 4 Copyright: © 2025 Ester Acen et al.

 Acknowledgements

My sincere appreciation goes to the staff at Kiruddu National Referral Hospital for data collection. The management and staff at the MBN and Molecular and immunology laboratories for theirassistance with laboratory analyses. The PI of the KTB Household Cohort Study Immunity held by Dr. Irene Andia Biraro provided samples for household contacts.

 References Acen EL Biraro IA Bbuye M : Hypovitaminosis D among newly diagnosed pulmonary TB patients and their household contacts in Uganda. Sci. Rep. 2022;12(1):5296. 35351933 10.1038/s41598-022-09375-7 PMC8964708 Kibirige D Mutebi E Ssekitoleko R : Vitamin D deficiency among adult patients with tuberculosis: a cross sectional study from a national referral hospital in Uganda. BMC Res. Notes. 2013;6(1):293. 23886009 10.1186/1756-0500-6-293 PMC3737052 Speeckaert M Huang G Delanghe JR : Biological and clinical aspects of the vitamin D binding protein (Gc-globulin) and its polymorphism. Clin. Chim. Acta. 2006;372(1-2):33–42. 16697362 10.1016/j.cca.2006.03.011 Santos Lecke SB Spritzer PM : Genetic variant in vitamin D-binding protein is associated with metabolic syndrome and lower 25-hydroxyvitamin D levels in polycystic ovary syndrome: A cross-sectional study. PLoS One. 2017;12(3):e0173695. 28278285 10.1371/journal.pone.0173695 PMC5344505 Alhomsi B Aboualchamat G Alkadi I : Assessment of vitamin D-binding protein (DBP) gene polymorphisms and their correlation with multiple sclerosis: a case-control study in a sample of the Syrian population. Egypt. J. Med. Hum. Genet. 2020;21(1):1–7. 10.1186/s43042-020-00076-2 Newton EBJ Kindy MS Gattoni-Celli S : Vitamin D binding protein polymorphisms significantly impact vitamin D status in children. Pediatr. Res. 2019;86(5):662–669. 30712059 10.1038/s41390-019-0322-y PMC6677641 Yousefzadeh Shapses S Wang X : Vitamin D binding protein impact on 25-hydroxyvitamin D levels under different physiologic and pathologic conditions. Int. J. Endocrinol. 2014;2014:1–6. 24868205 10.1155/2014/981581 PMC4020458 Rehan M Aslam A Umber J : Immunomodulatory role of vitamin D in infectious and non-infectious diseases. Hosts Viruses. 2019;6(5):115–129. Reis JP Michos ED Selvin E : Race, vitamin D–binding protein gene polymorphisms, 25-hydroxyvitamin D, and incident diabetes: the Atherosclerosis Risk in Communities (ARIC) Study. Am. J. Clin. Nutr. 2015;101(6):1232–1240. 25926504 10.3945/ajcn.115.107334 PMC4441813 Bikle Schwartz : Vitamin D binding protein, total and free vitamin D levels in different physiological and pathophysiological conditions. Front. Endocrinol. 2019;10:317. 10.3389/fendo.2019.00317 Kurylowicz A Ramos-Lopez E Bednarczuk T : Vitamin D-binding protein (DBP) gene polymorphism is associated with Graves’ disease and the vitamin D status in a Polish population study. Exp. Clin. Endocrinol. Diabetes. 2006;114(06):329–335. 10.1055/s-2006-924256 Nielson Kerry J Chun RF : Free 25-hydroxyvitamin D: impact of vitamin D binding protein assays on racial-genotypic associations. J. Clin. Endocrinol. Metabol. 2016;101(5):2226–2234. 27007693 10.1210/jc.2016-1104 PMC4870848 Braithwaite Jones KS Schoenmakers : Vitamin D binding protein genotype is associated with plasma 25OHD concentration in West African children. Bone. 2015;74:166–170. 25652210 10.1016/j.bone.2014.12.068 PMC4366041 Chun Peercy BE Eric SO : Vitamin D and DBP: The free hormone hypothesis revisited. J. Steroid Biochem. Mol. Biol. 2014;144:132–137. 24095930 10.1016/j.jsbmb.2013.09.012 PMC3976473 Karcioglu Batur L Hekim N : The role of DBP gene polymorphisms in the prevalence of new coronavirus disease 2019 infection and mortality rate. 2021;93(3):1409–1413. Talat N Perry S Parsonnet J : Vitamin D deficiency and tuberculosis progression. Emerg. Infect. Dis. 2010;16(5):853–855. 20409383 10.3201/eid1605.091693 PMC2954005 Meyer V Saccone DS Tugizimana F : Methylation of the Vitamin D Receptor (VDR) Gene, Together with Genetic Variation, Race, and Environment Influence the Signaling Efficacy of the Toll-Like Receptor 2/1-VDR Pathway. Front. Immunol. 2017;8. 28959253 10.3389/fimmu.2017.01048 PMC5603903 Nizamutdinov I Popov Y Ilinsky V : Allele frequency distribution of SNPs associated with levels of Vitamin D-binding protein and 25-hydroxyvitamin D. bioRxiv. 2019;564229. Acen EL Kateete DP Worodria W : Evaluation of circulating serum cathelicidin levels as a potential biomarker to discriminate between active and latent tuberculosis in Uganda. PLoS One. 2022;17(8):e0272788. 36018845 10.1371/journal.pone.0272788 PMC9416991 Powe CE Evans MK Wenger J : Vitamin D–binding protein and vitamin D status of black Americans and white Americans. N. Engl. J. Med. 2013;369(21):1991–2000. 24256378 10.1056/NEJMoa1306357 PMC4030388 Mogire RM Morovat A Muriuki JM : Prevalence and predictors of vitamin D deficiency in young African children. BMC Med. 2021;19:1–14. 10.1186/s12916-021-01985-8 Martineau Leandro A Cristina CS : Association between Gc genotype and susceptibility to TB is dependent on vitamin D status. Eur. Respir. J. 2010;35(5):1106–1112. 19797128 10.1183/09031936.00087009 PMC2864196 Saarnio E Pekkinen M Itkonen ST : Serum parathyroid hormone is related to genetic variation in vitamin D binding protein with respect to total, free, and bioavailable 25-hydroxyvitamin D in middle-aged Caucasians–a cross-sectional study. BMC Nutrition. 2016;2:1–9. 10.1186/s40795-016-0085-3 Junaid K Rehman A Jolliffe DA : Vitamin D deficiency associates with susceptibility to tuberculosis in Pakistan, but polymorphisms in VDR, DBP and CYP2R1 do not. BMC Pulm. Med. 2016;16(1):73. 27160686 10.1186/s12890-016-0240-2 PMC4862192 Martineau AR Leandro AC Anderson ST : Association between Gc genotype and susceptibility to TB is dependent on vitamin D status. Eur. Respir. J. 2010;35(5):1106–1112. 19797128 10.1183/09031936.00087009 PMC2864196 Al-Daghri NM Mohammed AK Bukhari I : Efficacy of vitamin D supplementation according to vitamin D-binding protein polymorphisms. Nutrition. 2019;63-64:148–154. 30959383 10.1016/j.nut.2019.02.003 Alharazy S Naseer MI Alissa E : Association of SNPs in GC and CYP2R1 with total and directly measured free 25-hydroxyvitamin D in multi-ethnic postmenopausal women in Saudi Arabia. Saudi J. Biol. Sci. 2021;28(8):4626–4632. 34354449 10.1016/j.sjbs.2021.04.071 PMC8324961 Harishankar M Sampath P Athikesavan V : Association of rs7041 and rs4588 polymorphisms of vitamin D binding protein gene in pulmonary tuberculosis. Meta Gene. 2020;26:100822. 10.1016/j.mgene.2020.100822 Braithwaite VS Jones KS Schoenmakers I : Vitamin D binding protein genotype is associated with plasma 25OHD concentration in West African children. Bone. 2015;74:166–170. 25652210 10.1016/j.bone.2014.12.068 PMC4366041 Mogire RM Morovat A Muriuki JM : Prevalence and predictors of vitamin D deficiency in young African children. BMC Med. 2021;19(1):115. 34011341 10.1186/s12916-021-01985-8 PMC8136043 Saarnio E Pekkinen M Itkonen ST : Serum parathyroid hormone is related to genetic variation in vitamin D binding protein with respect to total, free, and bioavailable 25-hydroxyvitamin D in middle-aged Caucasians – a cross-sectional study. BMC Nutr. 2016;2(1):46. 10.1186/s40795-016-0085-3 Acen EL Joloba ML Akintola A : Ester supplimentary data.zip.Dataset. figshare. 2025. 10.6084/m9.figshare.28234484.v3 10.5256/f1000research.182062.r434456 Reviewer response for version 2 Wolde Habtamu Milkias 1 Referee https://orcid.org/0000-0003-0859-4280 School of Medicine, Department of Precision Medicine, SungKyunKwan University, Suwon, Seoul, South Korea

Competing interests: No competing interests were disclosed.

 11 12 2025 Copyright: © 2025 Wolde HM 2025 This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. recommendation approve

Comment

This is an interesting study that investigates the distribution of Vitamin D binding protein gene polymorphism among patients with active TB, latent TB and individuals with no TB infection in Uganda. It’s known fact that Vitamin D plays an important role in the immune systems response to TB and DBP gene polymorphisms can affect Vitamin D levels in the body and potentially increasing individuals’ susceptibility to TB. And the authors found no significant difference in the level of polymorphisms among the study groups which is again an interesting null finding. However, there are certain issues that need to be clarified before the manuscript is ready to be indexed, which I describe below as questions or suggestions.

 

Introduction

On the first line of the introduction section, the phrase “between 200-350 per 100 cases…” seems to be incorrect. Did you mean per 100,000 cases or some other denominator?

On the 6th line the following phrase “…reported among adult TB patient” patient should be made plural by adding “s”.

There are similar editorial issues the authors should carefully look into

  

Methods

Regarding the sample size, the study has included only 102 participants and out of these 46 samples were excluded. Would this size be sufficient enough reach to the conclusion?

The samples were selected based on a convenience sampling method which is a non-random method? So, do you think this is going to affect generalizability of the study to the Ugandan population?

Fisher’s exact test is preferred for small samples sizes but power calculations should have been done. With small sample, the study might be underpowered to detect modest risk/effect of the polymorphism on TB disease.

Though the authors mostly conducted descriptive analyses of the data. But associations between variables/cause and effect are better assessed though stronger methods including regression models. Why did you restrict the analyses to descriptive stats only?

Measuring the level of Vitamin D in the participants would have aided the analysis acting as a direct measure (e.g., comparison of blood plasma level) in addition to the genetic analysis.

  

Results and discussion

It would be insightful to discuss about the effect of the polymorphism on the different groups of participants including whether it accelerates progression of latent TB into active TB or whether it predisposes healthy individuals to be susceptible to TB infection.

Minor Issues

Grammar and clarity, many sentences require editing for clarity.

Methods section is too long. It should be shortened unless critical.

Acronyms should be defined once and then used consistently (e.g., ATB, LTBI)

Some typographical issues like missing spaces, repeated words, uppercase errors.

Is the work clearly and accurately presented and does it cite the current literature?

Yes

If applicable, is the statistical analysis and its interpretation appropriate?

Partly

Are all the source data underlying the results available to ensure full reproducibility?

Yes

Is the study design appropriate and is the work technically sound?

Yes

Are the conclusions drawn adequately supported by the results?

Partly

Are sufficient details of methods and analysis provided to allow replication by others?

Yes

Reviewer Expertise:

My broader area of expertise is Tropical and Infectious Diseases but I specialize in diseases such as Tuberculosis and Measles.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

 10.5256/f1000research.182062.r386374 Reviewer response for version 2 Sari Dina Keumala 1 Referee https://orcid.org/0000-0002-1442-5304 Department of Nutrition, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia

Competing interests: No competing interests were disclosed.

 24 6 2025 Copyright: © 2025 Sari DK 2025 This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. recommendation approve

I think this paper already fulfill the criterias and corrections.

I have no further comments.

Is the work clearly and accurately presented and does it cite the current literature?

Yes

If applicable, is the statistical analysis and its interpretation appropriate?

Yes

Are all the source data underlying the results available to ensure full reproducibility?

Yes

Is the study design appropriate and is the work technically sound?

Yes

Are the conclusions drawn adequately supported by the results?

Yes

Are sufficient details of methods and analysis provided to allow replication by others?

Partly

Reviewer Expertise:

Vitamin D and polimorphism of Vitamin D receptors.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

 10.5256/f1000research.176796.r369604 Reviewer response for version 1 Bethunaickan Ramalingam 1 Referee https://orcid.org/0000-0003-4595-5233 ICMR-National Institute for Research in Tuberculosis, Chennai, India

Competing interests: No competing interests were disclosed.

 13 3 2025 Copyright: © 2025 Bethunaickan R 2025 This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. recommendation approve-with-reservations

The authors studied Vitamin D binding protein gene polymorphisms in Ugandan tuberculosis patients and household contacts and reported no significant differences in DBP genetic polymorphisms among the study groups. This study needs to address the following points for better clarity.

Major comments:

1. This study was conducted in small sample size. The 102 samples were selected from previous cross-sectional study among which approximately 50% of the samples were excluded and stated that due to inadequate sample volume. For genotyping maximum 2ml blood is adequate for DNA extraction to carry out the experiment, hence those excluded can be done with lesser blood volume using cost effective methods like PCR-RFLP. Moreover, in this study individuals with an HIV+ serostatus were not excluded, then how authors would eliminate those confounders from the study results?

2. This study lack to study different genetic models and better fit model for their study population. Haplotype analysis needs to be done.

3. VDBP gene variants shown to be associated with serum vitamin D levels. Hence, for better understanding vitamin D and VDBP levels needs to be correlated with gene variants to known its association with the disease.

4. The authors stated that minor alleles appear to be associated with an increased risk of active and latent TB. However, no such significant association was noted in analysis and the frequencies in TB were 0% Gc1S, and 3.8% Gc2. Among the LTBI cases, 4.3% were Gc1S, and 0% were Gc2. For those without TB infection, the frequencies were Gc1s 0% and 0% for Gc2.

This needs to be confirmed with larger sample size.

Minor comments:

1. Include Gender based association Table.

2. Gene name mention in italics

3. In methods section, give sub-titles for DNA isolation, Gel electrophoresis, and Sanger methods.

4. Conclusion, minor allele association needs to be removed.

5. Grammar and typological errors needs to be checked throughout the manuscript.

Is the work clearly and accurately presented and does it cite the current literature?

Yes

If applicable, is the statistical analysis and its interpretation appropriate?

Yes

Are all the source data underlying the results available to ensure full reproducibility?

Yes

Is the study design appropriate and is the work technically sound?

Yes

Are the conclusions drawn adequately supported by the results?

Yes

Are sufficient details of methods and analysis provided to allow replication by others?

Yes

Reviewer Expertise:

Immunology- Immunogenetics- Nutrition- SLE and Tuberculosis

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

 10.5256/f1000research.176796.r369603 Reviewer response for version 1 Sari Dina Keumala 1 Referee https://orcid.org/0000-0002-1442-5304 Department of Nutrition, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia

Competing interests: No competing interests were disclosed.

 11 3 2025 Copyright: © 2025 Sari DK 2025 This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. recommendation approve-with-reservations

Title: please add specific with the reference SNPs that stated in this study to clear which gene that involved in this research.

Abstract:

In the introduction: please state about Gc1F genotype and its Reference SNPs.

In the methods: please clear when and where this research conducted.

In conclusions: no need to state about recommended larger studies, because this study should be collect the data by counting the right sample size.

Keywords: please choose other keywords that are not in the title to increased the search engine to the reader.

Main text:

Introduction: state about prevalence of Tuberculosis and vitamin D deficiency in Uganda, is it still main infectious problem? show the important or urgent of this study. So, it became the based of the research conducted.

Add more references that support the lower vitamin D level in this population. Is there any information about sun exposure or vitamin D intake in this area?

Methods:

Please add about the inclusion and exclusion criteria for each groups, the information about inclusion and exclusion based on previous study only explain about household contact subject based on  BMC Infectious Diseases  2015 15, Article number: 438  Biraro et al. study and  PLoS One. 2022 Acen et al [2022 (Ref-1)]: https://doi.org/10.1371/journal.pone.0272788. Not clear enough.

Is there any  data about vitamin D level serum in this research? Why this research did not assess vitamin D serum level whether 25(OH)D serum level or 1.25(OH)D serum level as the most active metabolite.

Statistical analysis:

Why choosing Fisher's exact test than Chi-Square test, is there any adjustment for this decisions?

Results: 

Please revise the P symbol into lettercase and itallic

Is there any difference between ATB-LTBI patient and group with no TB infection? 

Discussion:

Please add more discussion about related of this SNPs related to the Vitamin D level. 

Please stated also about sun exposure in Uganda and also is there any possibility all the subject avoid the sun exposure.

There are a statement about HIV, is this related to the lower vitamin D level? 

Is there any co founding factor in this research? how to control it?

Is there superiority of these two genotypes? is it okay if we only check for one genotype?

state about TB control and prevention.

Conclusions:

Please move the last statement of conclusions to discussion and add more information.

Is the work clearly and accurately presented and does it cite the current literature?

Yes

If applicable, is the statistical analysis and its interpretation appropriate?

Yes

Are all the source data underlying the results available to ensure full reproducibility?

Yes

Is the study design appropriate and is the work technically sound?

Yes

Are the conclusions drawn adequately supported by the results?

Yes

Are sufficient details of methods and analysis provided to allow replication by others?

Partly

Reviewer Expertise:

Vitamin D and polimorphism of Vitamin D receptors.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

References : Evaluation of circulating serum cathelicidin levels as a potential biomarker to discriminate between active and latent tuberculosis in Uganda. PLoS One .2022;17(8) : 10.1371/journal.pone.0272788 e0272788 36018845 10.1371/journal.pone.0272788