<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.166306.2</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>Peripheral Blood Expression of MMPs and DNA Methylation-Related Genes in Women with Recurrent Spontaneous Abortion: A Case-Control Study</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 2; peer review: 2 approved]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Imani</surname>
                        <given-names>Maryam</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0003-4311-8810</uri>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Zare</surname>
                        <given-names>Fateme</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Hadinedoushan</surname>
                        <given-names>Hossein</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Rahmani</surname>
                        <given-names>Fateme</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Fesahat</surname>
                        <given-names>Farzaneh</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-3743-4449</uri>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Reproductive Immunology Research Center, Shahid Sadoughi University of Medical Sciences, Yazd, Iran</aff>
                <aff id="a2">
                    <label>2</label>Department of Immunology, Faculty of Medicine, Shahid Sadoughi University of Medical Sciences, Yazd, Iran</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:farzaneh.fesahat@gmail.com">farzaneh.fesahat@gmail.com</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>6</day>
                <month>10</month>
                <year>2025</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2025</year>
            </pub-date>
            <volume>14</volume>
            <elocation-id>763</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>2</day>
                    <month>10</month>
                    <year>2025</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2025 Imani M et al.</copyright-statement>
                <copyright-year>2025</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/14-763/pdf"/>
            <abstract>
                <sec>
                    <title>Background</title>
                    <p>Recurrent spontaneous abortion (RSA) is one of the most common reproductive complications among women of childbearing age. Several factors&#x2014;including genetic, anatomical, endocrine, infectious, environmental, and immunological causes&#x2014;have been implicated in RSA. This study aimed to explore the potential association between RSA and the expression patterns of selected genes involved in critical biological processes related to pregnancy maintenance and miscarriage.</p>
                </sec>
                <sec>
                    <title>Methods</title>
                    <p>The relative expression levels of 
                        <italic toggle="yes">matrix metallopeptidase 2 (MMP2)</italic>, 
                        <italic toggle="yes">matrix metallopeptidase 9 (MMP9)</italic>, 
                        <italic toggle="yes">DNA methyltransferase 1 (DNMT1)</italic>, 
                        <italic toggle="yes">DNA methyltransferase 3 alpha (DNMT3A)</italic>, and 
                        <italic toggle="yes">methylenetetrahydrofolate reductase (MTHFR)</italic> were evaluated using peripheral blood samples from 30 women with a history of two or more spontaneous abortions (cases) and 30 age-matched non-pregnant women with no history of miscarriage and at least one successful pregnancy (controls).</p>
                </sec>
                <sec>
                    <title>Results</title>
                    <p>No significant differences in the mRNA expression levels of the target genes were observed between women with RSA and the control group.</p>
                </sec>
                <sec>
                    <title>Conclusions</title>
                    <p>Our findings suggest that peripheral blood gene expression profiles of 
                        <italic toggle="yes">MMP2, MMP9, DNMT1, DNMT3A</italic>, and 
                        <italic toggle="yes">MTHFR</italic> may not adequately reflect tissue-specific changes associated with RSA. Further investigations using relevant tissues, such as placental or decidual samples, are warranted to better understand the molecular mechanisms underlying RSA.</p>
                </sec>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>Recurrent spontaneous abortion; DNA methyltransferases; matrix metallopeptidases; gene expression; peripheral blood.</kwd>
            </kwd-group>
            <funding-group>
                <funding-statement>The author(s) declared that no grants were involved in supporting this work.</funding-statement>
            </funding-group>
        </article-meta>
        <notes>
            <sec sec-type="version-changes">
                <label>Revised</label>
                <title>Amendments from Version 1</title>
                <p>Based on the reviewers&#x2019; comments, a few references in the reference list have been updated, and the discussion section has been substantially revised and expanded. Additionally, the most recent published studies on DNA methylation and recurrent spontaneous abortion (RSA) have been incorporated into the introduction to enhance context and relevance.</p>
            </sec>
        </notes>
    </front>
    <body>
        <sec id="sec5" sec-type="intro">
            <title>Introduction</title>
            <p>Recurrent spontaneous abortion (RSA), defined as two or more pregnancy losses before 20 weeks of gestation, affects approximately 1&#x2013;3% of couples of reproductive age.
                <sup>
                    <xref ref-type="bibr" rid="ref1">1</xref>
                </sup> Despite advances in reproductive medicine, the etiology of RSA remains unexplained in nearly 50% of cases.
                <sup>
                    <xref ref-type="bibr" rid="ref2">2</xref>
                </sup> Among various contributing factors, genetic and epigenetic mechanisms have gained considerable attention due to their essential roles in pregnancy maintenance. Epigenetic markers regulate gene expression to preserve cellular and tissue homeostasis. Disruptions in epigenetic regulation are implicated in numerous conditions, including idiopathic RSA, where specific changes in epigenetic markers are crucial for embryo implantation, tissue remodeling, and the overall success of pregnancy.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>,
                    <xref ref-type="bibr" rid="ref4">4</xref>
                </sup> The field of epigenetics offers new insights into the pathogenesis of RSA. Epigenetic modifications&#x2014;such as DNA/RNA methylation and histone modification&#x2014;can influence gene expression without altering the DNA sequence and play key roles in cell differentiation, proliferation, and apoptosis.
                <sup>
                    <xref ref-type="bibr" rid="ref5">5</xref>
                </sup> Abnormal DNA methylation has been recognized as a potential cause of early pregnancy loss by affecting processes like embryonic development and maternal-fetal interaction.
                <sup>
                    <xref ref-type="bibr" rid="ref6">6</xref>
                </sup>
            </p>
            <p>Critical reproductive events, including embryonic development, trophoblast invasion, immune tolerance at the maternal-fetal interface, and spiral artery remodeling, are governed by a complex interplay between genetic and epigenetic mechanisms.
                <sup>
                    <xref ref-type="bibr" rid="ref7">7</xref>,
                    <xref ref-type="bibr" rid="ref8">8</xref>
                </sup> Such dysregulations may contribute to unexplained recurrent pregnancy loss (URPL). Such dysregulations may contribute to unexplained recurrent pregnancy loss (URPL). Understanding these mechanisms could aid in the identification of novel biomarkers and therapeutic strategies for RSA. Recent studies have implicated abnormal DNA methylation in the pathogenesis of RSA, particularly in genes regulating immune tolerance, placental development, and cellular proliferation. Although the exact global prevalence remains uncertain, epigenetic dysregulation is increasingly recognized as a contributing factor in a substantial subset of spontaneous abortion cases.
                <sup>
                    <xref ref-type="bibr" rid="ref21">9</xref>,
                    <xref ref-type="bibr" rid="ref22">10</xref>
                </sup>
            </p>
            <p>DNA methylation&#x2014;the most widely studied epigenetic modification&#x2014;is vital for normal embryogenesis and placental function. DNA methyltransferases (DNMTs), including DNMT1 and DNMT3A, are key enzymes that establish and maintain methylation patterns during embryonic and germ cell development. Dysregulated DNA methylation, often due to altered DNMT activity, may impair embryo development and increase the risk of RSA.
                <sup>
                    <xref ref-type="bibr" rid="ref10">11</xref>,
                    <xref ref-type="bibr" rid="ref11">12</xref>
                </sup>
            </p>
            <p>Methylenetetrahydrofolate reductase (MTHFR) is another critical enzyme involved in the methylation cycle, catalyzing reactions that generate methyl groups required for DNA methylation. Polymorphisms in the 
                <italic toggle="yes">MTHFR</italic> gene have been associated with an increased risk of RSA in several studies.
                <sup>
                    <xref ref-type="bibr" rid="ref12">13</xref>
                </sup>
            </p>
            <p>Matrix metalloproteinases (MMPs) are important in reproductive biology, particularly in implantation and placentation.
                <sup>
                    <xref ref-type="bibr" rid="ref12">13</xref>
                </sup> These endopeptidases modulate the extracellular matrix (ECM), facilitating processes such as cell proliferation, migration, and angiogenesis. MMP2 and MMP9, in particular, contribute to ovulation and pregnancy by degrading ECM components to support tissue remodeling. Single nucleotide polymorphisms (SNPs) in the promoter regions of these genes have been reported to influence their expression and activity.
                <sup>
                    <xref ref-type="bibr" rid="ref13">14</xref>,
                    <xref ref-type="bibr" rid="ref14">15</xref>
                </sup>
            </p>
            <p>An imbalance in 
                <italic toggle="yes">MMPs</italic> expression, especially 
                <italic toggle="yes">MMP2</italic> and 
                <italic toggle="yes">MMP9</italic>, may lead to inadequate trophoblast invasion and defective placental formation, which can ultimately contribute to RSA.
                <sup>
                    <xref ref-type="bibr" rid="ref14">15</xref>
                </sup> The genes 
                <italic toggle="yes">DNMT1, DNMT3A, MTHFR, MMP2</italic>, and 
                <italic toggle="yes">MMP9</italic> are interconnected through pathways regulating methylation, folate metabolism, and ECM remodeling&#x2014;each essential for a successful pregnancy.</p>
            <p>Despite limited data on the specific contribution of genetic and epigenetic alterations in multiple miscarriages, available evidence supports their involvement in reproductive failure. Therefore, this study aims to assess the expression levels of 
                <italic toggle="yes">MTHFR, DNMT1, DNMT3A, MMP2</italic>, and 
                <italic toggle="yes">MMP9</italic> in the peripheral blood of women with a history of RSA compared to healthy controls. This research seeks to enhance our understanding of RSA pathophysiology and contribute to the development of novel diagnostic and therapeutic approaches.</p>
        </sec>
        <sec id="sec6">
            <title>Materials and methods</title>
            <p>This case-control study was conducted at the Yazd Institute of Reproductive Sciences and involved two distinct groups. The case group comprised 32 women with a history of two or more primary recurrent spontaneous abortions (RSA), with at least three months elapsed since their last miscarriage. The control group included 32 age-matched, non-pregnant women of reproductive age, with no history of miscarriage and at least one successful pregnancy. All participants underwent clinical examination by a gynecologist.</p>
            <p>Inclusion criteria for the case group were: absence of male-factor infertility, history of at least two RSAs, and exclusion of other known causes of pregnancy loss, such as genetic, hormonal, anatomical, or chromosomal abnormalities. Written informed consent was obtained from all participants prior to data collection. Peripheral blood samples (5 mL) were collected from each participant, and demographic and reproductive data, including age, number of abortions, and number of pregnancies, were recorded. The study protocol was approved by the Research Ethics Committees of school of public health, Shahid Sadoughi University of Medical Sciences, Yazd, Iran with ethical ID: IR.SSU.SPH.REC.1401.045. All of the participants signed an informed consent before entering the study.</p>
            <p>The ethical principles of the Declaration of Helsinki were applied with respect to the confidentiality and veracity of the data collected during the course of the study, which are faithfully presented. Personal identity data and patient privacy were protected. Authorship contributions and transparency in conflicts of interest were reported.
                <sup>
                    <xref ref-type="bibr" rid="ref15">16</xref>
                </sup>
            </p>
            <sec id="sec7">
                <title>RNA extraction and cDNA synthesis</title>
                <p>Total RNA was isolated from whole blood using a commercial RNA extraction kit (Yekta Tajhiz Azma, Iran), following the manufacturer&#x2019;s instructions. RNA concentration and purity were assessed by measuring absorbance at 260 nm and calculating the A260/A280 ratio using a UV spectrophotometer (PhotoBiometer, Eppendorf, Germany). Complementary DNA (cDNA) was synthesized from the extracted RNA using a cDNA synthesis kit (GeneAll, Korea). Synthesized cDNA was stored at &#x2212;20&#x00b0;C until use.</p>
            </sec>
            <sec id="sec8">
                <title>Quantitative real-time
 PCR</title>
                <p>Quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR) was performed to assess the relative mRNA expression of 
                    <italic toggle="yes">MMP2, MMP9, DNMT1, DNMT3A</italic>, and 
                    <italic toggle="yes">MTHFR.</italic> 
                    <italic toggle="yes">GAPDH</italic> was used as the internal reference gene. Primer sequences were selected based on published studies and validated using Primer-BLAST to ensure specificity. Primer sequences are listed in 
                    <xref ref-type="table" rid="T1">
Table 1</xref>.</p>
                <table-wrap id="T1" orientation="portrait" position="float">
                    <label>
Table 1. </label>
                    <caption>
                        <title>Primer sequences used for the real-time polymerase chain reaction.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Genes</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Primer sequence (5'-&gt;3')</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Accession No.</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
PCR Product (bp)</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="2" valign="top">
                                    <bold>

                                        <italic toggle="yes">MMP2</italic>
</bold>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>F:</bold>GATACCCCTTTGACGGTAAGGA</td>
                                <td align="left" colspan="1" rowspan="2" valign="top">NM_001302510.2</td>
                                <td align="left" colspan="1" rowspan="2" valign="top">112 bp</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">

                                    <bold>R:</bold>CCTTCTCCCAAGGTCCATAGC</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="2" valign="top">
                                    <bold>

                                        <italic toggle="yes">MMP9</italic>
</bold>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>F:</bold>ACGCAGACATCGTCATCCAGT</td>
                                <td align="left" colspan="1" rowspan="2" valign="top">
                                    <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&amp;id=1519311730">NM_004994.3</ext-link>
</td>
                                <td align="left" colspan="1" rowspan="2" valign="top">146 bp</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">

                                    <bold>R:</bold>GGACCACAACTCGTCATCGTC</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="2" valign="top">
                                    <bold>

                                        <italic toggle="yes">MTHFR</italic>
</bold>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>F:</bold>TCCCGTCAGCTTCATGTTCT</td>
                                <td align="left" colspan="1" rowspan="2" valign="top">
                                    <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&amp;id=-2077699670">XM_005263463.5</ext-link>
</td>
                                <td align="left" colspan="1" rowspan="2" valign="top">72 bp</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">

                                    <bold>R:</bold>TCATACAGCTTTCCCCACCG</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="2" valign="top">
                                    <bold>

                                        <italic toggle="yes">DNMT1</italic>
</bold>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>F:</bold>TGGACGACCCTGACCTCAAAT</td>
                                <td align="left" colspan="1" rowspan="2" valign="top">NM_001379.4</td>
                                <td align="left" colspan="1" rowspan="2" valign="top">168 bp</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">

                                    <bold>R:</bold>GCTTACAGTACACACTGAAGCA</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="2" valign="top">
                                    <bold>

                                        <italic toggle="yes">DNMT3A</italic>
</bold>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>F:</bold>TATTGATGAGCGCACAAGAGAG</td>
                                <td align="left" colspan="1" rowspan="2" valign="top">NM_022552.5</td>
                                <td align="left" colspan="1" rowspan="2" valign="top">111 bp</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">

                                    <bold>R:</bold>GGGTGTTCCAGGGTAACATTGAG</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="2" valign="top">
                                    <bold>

                                        <italic toggle="yes">GAPDH</italic>
</bold>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>F:</bold>AAATCAAGTGGGGCGATGCTG</td>
                                <td align="left" colspan="1" rowspan="2" valign="top">NM_001256799.3</td>
                                <td align="left" colspan="1" rowspan="2" valign="top">118 bp</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">

                                    <bold>R:</bold>GCAGAGATGATGACCCTTTTG</td>
                            </tr>
                        </tbody>
                    </table>
                    <table-wrap-foot>
                        <p>PCR, Polymerase chain reaction; MMP2, Matrix metallopeptidase 2; MMP9, Matrix metallopeptidase 9; MTHFR, Methylenetetrahydrofolate reductase; DNMT1, DNA methyltransferase 1; DNMT3A, DNA methyltransferase 3 alpha; and GAPDH, Glyceraldehyde-3-phosphate dehydrogenase.</p>
                    </table-wrap-foot>
                </table-wrap>
                <p>The qRT-PCR reactions were performed using the RealQ Plus 2&#x00d7; Master Mix Green High ROX&#x2122; (Ampliqon, Denmark) on a StepOne&#x2122; Real-Time PCR System (Applied Biosystems, USA). Each 10 &#x03bc;L reaction mixture contained 1 &#x03bc;L cDNA, 0.5 &#x03bc;L of each forward and reverse primer, 5 &#x03bc;L master mix, and 3 &#x03bc;L nuclease-free water. The thermal cycling conditions included an initial denaturation at 95&#x00b0;C for 10 minutes, followed by 40 cycles of denaturation at 95&#x00b0;C for 15 seconds, annealing at 58&#x00b0;C&#x2013;64&#x00b0;C (depending on the primer) for 30 seconds, and extension at 72&#x00b0;C for 30 seconds. A melting curve analysis (60&#x00b0;C to 95&#x00b0;C) was performed to confirm the specificity of amplification. Relative gene expression was calculated using the 2
                    <sup>&#x2212;&#x0394;&#x0394;CT</sup> method.</p>
            </sec>
            <sec id="sec9">
                <title>Statistical analysis</title>
                <p>Statistical analysis was performed using SPSS version 16 and GraphPad Prism version 8. Data are presented as mean &#x00b1; standard error of the mean (SEM). The Kolmogorov-Smirnov test was used to assess data normality. As the data did not follow a normal distribution, the non-parametric Mann&#x2013;Whitney U test was applied to compare gene expression levels between groups. A p-value of &lt;0.05 was considered statistically significant.</p>
            </sec>
        </sec>
        <sec id="sec10" sec-type="results">
            <title>Results</title>
            <p>In this case-control study, 64 participants were enrolled and divided into two groups: cases and controls. There were no significant differences in maternal age between the two groups. The mean &#x00b1; SD maternal age was 29.1 &#x00b1; 1.52 years (range: 26&#x2013;32) in women with a history of recurrent spontaneous abortion (RSA) and 30.03 &#x00b1; 0.23 years in the control group. The mean &#x00b1; SD number of RSAs in the case group was 4 &#x00b1; 1.7. The mean gestational age at the time of the most recent abortion was 11.51 &#x00b1; 2.15 weeks. In the control group, the mean &#x00b1; SD number of successful pregnancies was 2.29 &#x00b1; 0.74). Although the mRNA expression levels of 
                <italic toggle="yes">MMP2, MMP9, DNMT1, DNMT3A</italic>, and 
                <italic toggle="yes">MTHFR</italic> were higher in women with a history of RSA compared to the control group, the differences were not statistically significant (
                <xref ref-type="table" rid="T2">
Table 2</xref>).</p>
            <table-wrap id="T2" orientation="portrait" position="float">
                <label>
Table 2. </label>
                <caption>
                    <title>Comparison of genes expression levels between the study groups.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="left" colspan="1" rowspan="1" valign="top">Variables</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Control</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Case</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">
P-Value
</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>

                                    <italic toggle="yes">DNMT1</italic>
</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.8 &#x00b1; 0.33</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.94 &#x00b1;0.45</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.55</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>

                                    <italic toggle="yes">DNMT3A</italic>
</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.43 &#x00b1; 0.21</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.91 &#x00b1; 0.39</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.87</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>

                                    <italic toggle="yes">MTHFR</italic>
</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">2.34 &#x00b1; 0.45</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">2.44 &#x00b1; 0.55</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.98</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>

                                    <italic toggle="yes">MMP2</italic>
</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.40 &#x00b1; 0.25</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.82 &#x00b1; 0.29</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.67</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>

                                    <italic toggle="yes">MMP9</italic>
</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.13 &#x00b1; 0.11</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">1.36 &#x00b1; 0.21</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">0.64</td>
                        </tr>
                    </tbody>
                </table>
                <table-wrap-foot>
                    <p>Data were presented as mean &#x00b1; SEM. 
                        <italic toggle="yes">P </italic>&lt; 0.05 was regarded as a significant value. </p>
                    <p>DNMT1: DNA Methyltransferase 1; DNMT3A: DNA methyltransferase 3 alpha; MTHFR: Methylenetetrahydrofolate reductase; MMP2: Matrix metalloproteinases 2; MMP9: Matrix metalloproteinases9.</p>
                </table-wrap-foot>
            </table-wrap>
        </sec>
        <sec id="sec11" sec-type="discussion">
            <title>Discussion</title>
            <p>Recurrent spontaneous abortion (RSA) is a multifactorial condition influenced by genetic, epigenetic, and environmental factors. This study investigated the expression of 
                <italic toggle="yes">DNMT1, DNMT3A, MTHFR, MMP2</italic>, and 
                <italic toggle="yes">MMP9</italic> in the peripheral blood of women with RSA compared to healthy controls. Despite the biological relevance of these genes, no statistically significant differences in their expression were observed between the two groups.</p>
            <p>Epigenetic mechanisms, especially DNA methylation, are fundamental for the maintenance of pregnancy, regulating key processes such as embryo implantation, placental development, and maternal-fetal immune tolerance. DNA methyltransferases like DNMT1 and DNMT3A ensure the proper expression of imprinted and immune-related genes, and their dysregulation can impair trophoblast function and immune balance, potentially leading to RSA. Although our data showed a non-significant increase in 
                <italic toggle="yes">DNMT1</italic> and 
                <italic toggle="yes">DNMT3A</italic> expression in the RSA group, this finding does not directly align with previous studies such as those by Li et al., who reported global hypomethylation and reduced 
                <italic toggle="yes">DNMT</italic> expression in chorionic villi and decidua of URPL patients, along with increased TET enzyme activity. The discrepancy may be attributed to differences in tissue type, as our study was conducted on peripheral blood samples, which may reflect systemic or compensatory responses rather than local epigenetic changes at the maternal-fetal interface.
                <sup>
                    <xref ref-type="bibr" rid="ref16">17</xref>
                </sup> Additionally, experimental studies have shown that DNMT1 inhibition during early pregnancy reduces DNA methylation and disrupts embryonic attachment,
                <sup>
                    <xref ref-type="bibr" rid="ref17">18</xref>
                </sup> emphasizing the importance of balanced methylation for successful implantation. While our findings do not directly reflect local methylation dynamics, they may indicate broader epigenetic alterations relevant to RSA.</p>
            <p>It is important to acknowledge that peripheral blood may not accurately reflect gene expression patterns in reproductive tissues such as the decidua or placenta. Our use of peripheral blood was driven by accessibility, but tissue-specific studies are more appropriate for evaluating genes involved in implantation and early placentation.</p>
            <p>MTHFR is another key regulator of DNA methylation via folate metabolism.
                <sup>
                    <xref ref-type="bibr" rid="ref23">19</xref>
                </sup> Previous studies have reported altered methylation of the 
                <italic toggle="yes">MTHFR</italic> promoter in RSA patients, often associated with reduced enzyme activity and folate imbalance.
                <sup>
                    <xref ref-type="bibr" rid="ref12">13</xref>,
                    <xref ref-type="bibr" rid="ref18">20</xref>
                </sup> In our study, however, 
                <italic toggle="yes">MTHFR</italic> expression in peripheral blood did not differ significantly between RSA patients and healthy controls. Since we did not assess promoter methylation directly, any inference regarding a disconnect between methylation and gene expression must be interpreted with caution. Moreover, the three-month interval between the last miscarriage and sample collection may have influenced the expression profile, potentially masking transient changes that occur during the acute phase of pregnancy loss. These findings underscore the importance of future studies incorporating both methylation and expression analyses in relevant reproductive tissues and across different time points.</p>
            <p>Matrix metalloproteinases (MMP2 and MMP9) are crucial for extracellular matrix remodeling during early placental development. Although our findings showed a non-significant increase in 
                <italic toggle="yes">MMP2</italic> and 
                <italic toggle="yes">MMP9</italic> expression in the RSA group, this result may reflect limitations in sample type rather than a true absence of biological difference. Goto et al. suggested that protein expression of these 
                <italic toggle="yes">MMPs</italic> in decidua and villi&#x2014;not gene polymorphisms&#x2014;may be more indicative of their role in RSA, influenced by inflammatory and microenvironmental signals.
                <sup>
                    <xref ref-type="bibr" rid="ref19">21</xref>
                </sup> These observations emphasize the importance of post-transcriptional and local regulatory factors.</p>
            <p>Several limitations may explain the lack of statistically significant findings. The peripheral blood samples may not capture local gene expression changes in the uterine environment. Additionally, RSA is a heterogeneous condition with diverse underlying causes. Our sample likely included patients with varying etiologies, which may have masked specific gene-related differences. Future studies should include larger, stratified cohorts and analyze both gene and protein expression in relevant reproductive tissues, as well as epigenetic modifications.</p>
        </sec>
        <sec id="sec12" sec-type="conclusions">
            <title>Conclusion</title>
            <p>This study found no significant differences in the peripheral blood expression of 
                <italic toggle="yes">DNMT1</italic>, 
                <italic toggle="yes">DNMT3A, MTHFR, MMP2</italic>, and 
                <italic toggle="yes">MMP9</italic> between women with RSA and healthy controls. These findings suggest that peripheral blood may not be an ideal surrogate for evaluating gene expression changes related to pregnancy maintenance. Although these genes have been implicated in key processes such as DNA methylation and extracellular matrix remodeling, their roles may be tissue-specific and influenced by factors beyond mRNA expression levels. Therefore, future studies should focus on analyzing gene and protein expression in placental and decidual tissues, exploring epigenetic modifications, and considering environmental and immunological contexts. A comprehensive, tissue-based, and multidisciplinary approach is essential to unravel the complex pathogenesis of RSA.</p>
        </sec>
        <sec id="sec13">
            <title>Ethics statement</title>
            <p>The study protocol was approved by the Research Ethics Committees of School of Public Health, Shahid Sadoughi University of Medical Sciences, Yazd, Iran with ethical ID: IR.SSU.SPH.REC.1401.045. All of the participants written (signed) an informed consent before entering the study. (
                <bold>See supplementary ethic certificate</bold>).</p>
            <p>The ethical principles of the Declaration of Helsinki were applied with respect to the confidentiality and veracity of the data collected during the course of the study, which are faithfully presented. Personal identity data and patient privacy were protected. Authorship contributions and transparency in conflicts of interest were reported.
                <sup>
                    <xref ref-type="bibr" rid="ref14">15</xref>
                </sup>
            </p>
        </sec>
    </body>
    <back>
        <sec id="sec16" sec-type="data-availability">
            <title>Data availability</title>
            <p>The underlying data for this study are available via Figshare:</p>
            <p>GraphPad Prism results for &#x201c;Peripheral Blood Expression of MMPs and DNA Methylation-Related Genes in Women with Recurrent Spontaneous Abortion: A Case-Control Study&#x201d;</p>
            <p>DOI: 
                <ext-link ext-link-type="uri" xlink:href="http://doi.org/10.6084/m9.figshare.29262128">doi.org/10.6084/m9.figshare.29262128</ext-link>
                <sup>
                    <xref ref-type="bibr" rid="ref20">22</xref>
                </sup>
            </p>
            <p>The project contains the following underlying data:
                <list list-type="bullet">
                    <list-item>
                        <label>&#x2022;</label>
                        <p>Processed Ct values used for statistical analysis in GraphPad Prism</p>
                    </list-item>
                    <list-item>
                        <label>&#x2022;</label>
                        <p>Group-wise comparisons of gene expression between case and control samples</p>
                    </list-item>
                </list>
            </p>
            <p>Data are available under the terms of the 
                <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution 4.0 International license</ext-link> (CC-BY 4.0).</p>
        </sec>
        <ack>
            <title>Acknowledgements</title>
            <p>While preparing this work, the authors employed DeepSeek to enhance the overall quality of the writing. Following the use of DeepSeek, the authors thoroughly reviewed and edited the content as needed, assuming full responsibility for the accuracy and integrity of the published material.</p>
        </ack>
        <ref-list>
            <title>References</title>
            <ref id="ref1">
                <label>1</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sultana</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Nallari</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ananthapur</surname>
                            <given-names>V</given-names>
                        </name>
</person-group>:
                    <article-title>Recurrent pregnancy loss (RPL): an overview.</article-title>
                    <source>

                        <italic toggle="yes">J. Womens Health Dev.</italic>
</source>
                    <year>2020</year>;<volume>3</volume>(<issue>3</issue>):<fpage>302</fpage>&#x2013;<lpage>315</lpage>.</mixed-citation>
            </ref>
            <ref id="ref2">
                <label>2</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Cao</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bai</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zhang</surname>
                            <given-names>J</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Understanding recurrent pregnancy loss: recent advances on its etiology, clinical diagnosis, and management.</article-title>
                    <source>

                        <italic toggle="yes">J. Medical Review.</italic>
</source>
                    <year>2023</year>;<volume>2</volume>(<issue>6</issue>):<fpage>570</fpage>&#x2013;<lpage>589</lpage>.</mixed-citation>
            </ref>
            <ref id="ref3">
                <label>3</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Rull</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Nagirnaja</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Laan</surname>
                            <given-names>M</given-names>
                        </name>
</person-group>:
                    <article-title>Genetics of recurrent miscarriage: challenges, current knowledge, future directions.</article-title>
                    <source>

                        <italic toggle="yes">J. Front. Genet.</italic>
</source>
                    <year>2012</year>;<volume>3</volume>:<fpage>34</fpage>.</mixed-citation>
            </ref>
            <ref id="ref4">
                <label>4</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Arias-Sosa</surname>
                            <given-names>LA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Acosta</surname>
                            <given-names>ID</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lucena-Quevedo</surname>
                            <given-names>E</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Genetic and epigenetic variations associated with idiopathic recurrent pregnancy loss.</article-title>
                    <source>

                        <italic toggle="yes">J. Assist. Reprod. Genet.</italic>
</source>
                    <year>2018</year>;<volume>35</volume>:<fpage>355</fpage>&#x2013;<lpage>366</lpage>.
                    <pub-id pub-id-type="pmid">29313278</pub-id>
                    <pub-id pub-id-type="doi">10.1007/s10815-017-1108-y</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5904072</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref5">
                <label>5</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Talebi</surname>
                            <given-names>AR</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Fesahat</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mangoli</surname>
                            <given-names>E</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Relationship between sperm protamine deficiency and apoptosis in couples with unexplained repeated spontaneous abortions.</article-title>
                    <source>

                        <italic toggle="yes">Int. J. Reprod. BioMed.</italic>
</source>
                    <year>2016</year>;<volume>14</volume>(<issue>3</issue>):<fpage>199</fpage>.</mixed-citation>
            </ref>
            <ref id="ref6">
                <label>6</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Zhou</surname>
                            <given-names>Q</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Xiong</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Qu</surname>
                            <given-names>B</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>DNA methylation and recurrent pregnancy loss: a mysterious compass?</article-title>
                    <source>

                        <italic toggle="yes">Front. Immunol.</italic>
</source>
                    <year>2021</year>;<volume>12</volume>:<fpage>738962</fpage>.
                    <pub-id pub-id-type="pmid">34745108</pub-id>
                    <pub-id pub-id-type="doi">10.3389/fimmu.2021.738962</pub-id>
                    <pub-id pub-id-type="pmcid">PMC8566749</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref7">
                <label>7</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Smith</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Witte</surname>
                            <given-names>E</given-names>
                        </name>

                        <name name-style="western">
                            <surname>McGee</surname>
                            <given-names>D</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Cortisol inhibits CSF 2 and CSF 3 via DNA methylation and inhibits invasion in first-trimester trophoblast cells.</article-title>
                    <source>

                        <italic toggle="yes">Am. J. Reprod. Immunol.</italic>
</source>
                    <year>2017</year>;<volume>78</volume>(<issue>5</issue>):<fpage>e12741</fpage>.
                    <pub-id pub-id-type="pmid">28846166</pub-id>
                    <pub-id pub-id-type="doi">10.1111/aji.12741</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5833927</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref8">
                <label>8</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Novakovic</surname>
                            <given-names>B</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rakyan</surname>
                            <given-names>V</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ng</surname>
                            <given-names>HK</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Specific tumour-associated methylation in normal human term placenta and first-trimester cytotrophoblasts.</article-title>
                    <source>

                        <italic toggle="yes">Mol. Hum. Reprod.</italic>
</source>
                    <year>2008</year>;<volume>14</volume>(<issue>9</issue>):<fpage>547</fpage>&#x2013;<lpage>554</lpage>.
                    <pub-id pub-id-type="pmid">18708652</pub-id>
                    <pub-id pub-id-type="doi">10.1093/molehr/gan046</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref21">
                <label>9</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Zhou</surname>
                            <given-names>Q</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Xiong</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Qu</surname>
                            <given-names>B</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>DNA methylation and recurrent pregnancy loss: a mysterious compass?</article-title>
                    <source>

                        <italic toggle="yes">Front. Immunol.</italic>
</source>
                    <year>2021</year>;<volume>12</volume>:<fpage>738962</fpage>.
                    <pub-id pub-id-type="pmid">34745108</pub-id>
                    <pub-id pub-id-type="doi">10.3389/fimmu.2021.738962</pub-id>
                    <pub-id pub-id-type="pmcid">PMC8566749</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref22">
                <label>10</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Qin</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Chen</surname>
                            <given-names>W</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hua</surname>
                            <given-names>L</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>DNA methylation abnormalities induced by advanced maternal age in villi prime a high-risk state for spontaneous abortion.</article-title>
                    <source>

                        <italic toggle="yes">Clin. Epigenetics.</italic>
</source>
                    <year>2023</year>;<volume>15</volume>(<issue>1</issue>):<fpage>44</fpage>.
                    <pub-id pub-id-type="doi">10.1186/s13148-023-01432-w</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref10">
                <label>11</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ahmed</surname>
                            <given-names>AA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Azova</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ramazanova</surname>
                            <given-names>F</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>DNMT1 And DNMT3a gene polymorphisms and early pregnancy loss.</article-title>
                    <source>

                        <italic toggle="yes">Russ. J. Genet.</italic>
</source>
                    <year>2020</year>;<volume>56</volume>:<fpage>379</fpage>&#x2013;<lpage>382</lpage>.
                    <pub-id pub-id-type="doi">10.1134/S1022795420030023</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref11">
                <label>12</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Koukoura</surname>
                            <given-names>O</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sifakis</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Spandidos</surname>
                            <given-names>DA</given-names>
                        </name>
</person-group>:
                    <article-title>DNA methylation in the human placenta and fetal growth.</article-title>
                    <source>

                        <italic toggle="yes">Mol. Med. Rep.</italic>
</source>
                    <year>2012</year>;<volume>5</volume>(<issue>4</issue>):<fpage>883</fpage>&#x2013;<lpage>889</lpage>.
                    <pub-id pub-id-type="pmid">22294146</pub-id>
                    <pub-id pub-id-type="doi">10.3892/mmr.2012.763</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref12">
                <label>13</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Shaker</surname>
                            <given-names>MM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Shalabi</surname>
                            <given-names>TA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Amr</surname>
                            <given-names>KS</given-names>
                        </name>
</person-group>:
                    <article-title>Correlation of methylation status in MTHFR promoter region with recurrent pregnancy loss.</article-title>
                    <source>

                        <italic toggle="yes">J. Genet. Eng. Biotechnol.</italic>
</source>
                    <year>2021</year>;<volume>19</volume>:<fpage>1</fpage>&#x2013;<lpage>9</lpage>.</mixed-citation>
            </ref>
            <ref id="ref13">
                <label>14</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Yan</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Fang</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Association of MMP2 and MMP9 gene polymorphisms with the recurrent spontaneous abortion: A meta-analysis.</article-title>
                    <source>

                        <italic toggle="yes">Gene.</italic>
</source>
                    <year>2021</year>;<volume>767</volume>:<fpage>145173</fpage>.
                    <pub-id pub-id-type="pmid">33007375</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.gene.2020.145173</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref14">
                <label>15</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ramu</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Venkatesan</surname>
                            <given-names>V</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Paul</surname>
                            <given-names>SFD</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Genetic variation in matrix metalloproteinase MMP2 and MMP9 as a risk factor for idiopathic recurrent spontaneous abortions in an Indian population.</article-title>
                    <source>

                        <italic toggle="yes">J. Assist. Reprod. Genet.</italic>
</source>
                    <year>2017</year>;<volume>34</volume>:<fpage>945</fpage>&#x2013;<lpage>949</lpage>.
                    <pub-id pub-id-type="pmid">28500450</pub-id>
                    <pub-id pub-id-type="doi">10.1007/s10815-017-0939-x</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5476549</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref15">
                <label>16</label>
                <mixed-citation publication-type="other">
                    <article-title>WMA - The World Medical Association-Declaraci&#x00f3;n de Helsinki de la AMM &#x2013; Principios &#x00e9;ticos para las investigaciones m&#x00e9;dicas en seres humanos.</article-title>
                    <year>[citado 30 de noviembre de 2023]</year>.</mixed-citation>
            </ref>
            <ref id="ref16">
                <label>17</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yu</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yang</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>DNA hypomethylation in villi of patients with unexplained recurrent spontaneous abortion and its mechanism.</article-title>
                    <source>

                        <italic toggle="yes">Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi.</italic>
</source>
                    <year>2019</year>;<volume>35</volume>(<issue>4</issue>):<fpage>351</fpage>&#x2013;<lpage>356</lpage>.
                    <pub-id pub-id-type="pmid">31167695</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref17">
                <label>18</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Yin</surname>
                            <given-names>L-J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zhang</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lv</surname>
                            <given-names>P-P</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Insufficient maintenance DNA methylation is associated with abnormal embryonic development.</article-title>
                    <source>

                        <italic toggle="yes">BMC Med.</italic>
</source>
                    <year>2012</year>;<volume>10</volume>:<fpage>1</fpage>&#x2013;<lpage>10</lpage>.</mixed-citation>
            </ref>
            <ref id="ref23">
                <label>19</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Alsaffar</surname>
                            <given-names>SF</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Baqer</surname>
                            <given-names>NN</given-names>
                        </name>
</person-group>:
                    <article-title>Association between Methylenetetrahydrofolate Reductase (MTHFR) and 5-Methyltetrahydrofolate-Homocysteine Methyltransferase Reductase (MTRR) Polymorphisms in Iraqi Patients with COVID-19.</article-title>
                    <source>

                        <italic toggle="yes">Iran J. Med. Sci.</italic>
</source>
                    <year>2024</year>;<volume>49</volume>(<issue>7</issue>):<fpage>430</fpage>&#x2013;<lpage>440</lpage>.
                    <pub-id pub-id-type="pmid">39114635</pub-id>
                    <pub-id pub-id-type="doi">10.30476/IJMS.2023.99555.3162</pub-id>
                    <pub-id pub-id-type="pmcid">PMC11300940</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref18">
                <label>20</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Mishra</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Talwar</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kaur</surname>
                            <given-names>L</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Differential global and MTHFR gene specific methylation patterns in preeclampsia and recurrent miscarriages: A case-control study from North India.</article-title>
                    <source>

                        <italic toggle="yes">Gene.</italic>
</source>
                    <year>2019</year>;<volume>704</volume>:<fpage>68</fpage>&#x2013;<lpage>73</lpage>.
                    <pub-id pub-id-type="pmid">30986448</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.gene.2019.04.036</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref19">
                <label>21</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Goto</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ozaki</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mori</surname>
                            <given-names>R</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>MMP2 and MMP9 are associated with the pathogenesis of recurrent pregnancy loss through protein expression rather than genetic polymorphism.</article-title>
                    <source>

                        <italic toggle="yes">J. Reprod. Immunol.</italic>
</source>
                    <year>2024</year>;<volume>164</volume>:<fpage>104270</fpage>.
                    <pub-id pub-id-type="pmid">38878627</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.jri.2024.104270</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref20">
                <label>22</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Imani</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zare</surname>
                            <given-names>F</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Peripheral Blood Expression of MMPs and DNA Methylation-Related Genes in Women with Recurrent Spontaneous Abortion: A Case-Control Study.</article-title>
                    <pub-id pub-id-type="doi">10.6084/m9.figshare.29262128</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report420793">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.189089.r420793</article-id>
            <title-group>
                <article-title>Reviewer response for version 2</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Balasinor</surname>
                        <given-names>Nafisa Huseni</given-names>
                    </name>
                    <xref ref-type="aff" rid="r420793a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0001-9937-7518</uri>
                </contrib>
                <aff id="r420793a1">
                    <label>1</label>ICMR-National Institute for Research in Reproductive &amp; Child Health, Mumbai, Maharashtra, India</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>14</day>
                <month>10</month>
                <year>2025</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2025 Balasinor NH</copyright-statement>
                <copyright-year>2025</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport420793" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.166306.2"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>The authors have responded to the comments and revised the manuscript. The manuscript may be accepted for indexing</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Partly</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Yes</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>No source data required</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Partly</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Partly</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Reproductive endocrinology, epigenetic and paternal factors in pregnancy outcome, like recurrent spontaneous abortions and preeclampsia</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report403505">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.183273.r403505</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Balasinor</surname>
                        <given-names>Nafisa Huseni</given-names>
                    </name>
                    <xref ref-type="aff" rid="r403505a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0001-9937-7518</uri>
                </contrib>
                <aff id="r403505a1">
                    <label>1</label>ICMR-National Institute for Research in Reproductive &amp; Child Health, Mumbai, Maharashtra, India</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>3</day>
                <month>9</month>
                <year>2025</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2025 Balasinor NH</copyright-statement>
                <copyright-year>2025</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport403505" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.166306.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>The manuscript has investigated the expression of 5 genes in peripheral blood&#x00a0; of women experiencing Recurrent spontaneous abortions ((RSA) and compared with non pregnant proven fertile women without any history of RSA and they did not find any significant change in the expression of the genes studied</p>
            <p> The MS is well carried out and well written, however the following aspect which needs to be addressed</p>
            <p> </p>
            <p> 1. The authors have studied gene expression in pheripheral blood and that too 3 months after miscarriage, which is too long an interval to study gene expression. The authors have acknowledged that studying in peripheral blood is a limitation of their study and not an ideal tissue to study gene expression. However, the 3 months time interval after miscarriage may not be appropriate</p>
            <p> </p>
            <p> Other points to be addressed</p>
            <p> </p>
            <p> 1. Introduction: 2nd paragraph last sentence. The statistics is from one study and quite old after which many studies have been published on DNA methylation and RSA/RPL &#x00a0;so cannot be taken as globally. Need to cite recent study on DNA methylation in the context of RSA</p>
            <p> 2. GAPDH used as internal reference genes: Was it ensured that expression of this gene is not affected in RSA cases. Usually more than one reference gene is used</p>
            <p> 3. Discussion: 2nd Paragraph: "...showed a higher expression of DNMT1 and DNMT3A in the RSA group, the differences were not statistically significant.&#x00a0;This aligns with findings from Li et al., who reported global hypomethylation and reduced DNMT expression in chorionic villi and decidua of URPL patients, along with increased TET enzyme activity. Additionally, inhibition of DNMT1 in</p>
            <p> early pregnancy models has been shown to reduce DNA methylation and impair embryonic attachment, underscoring the critical role of balanced methylation".</p>
            <p> Comment: In the present study a non significant increase in DNMTs would lead to hypermethylation which does not align with the cited 2 studies</p>
            <p> 4. Discussion: MTHFR expression: The authors conclude that their finding highlight potential disconnect between MTHFR promoter methylation and expression. However, they should be cautious as they have not analyzed methylation and the time interval of 3 months in the present study maybe the reason for observing no change in expression.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Partly</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Yes</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>No source data required</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Partly</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Partly</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Reproductive endocrinology, epigenetic and paternal factors in pregnancy outcome, like recurrent spontaneous abortions and preeclampsia</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
        <sub-article article-type="response" id="comment14582-403505">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Fesahat</surname>
                            <given-names>Farzaneh</given-names>
                        </name>
                        <aff>Shahid Sadoughi University of Medical Sciences, Yazd, Iran, Iran</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>There is no conflict of interest.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>14</day>
                    <month>9</month>
                    <year>2025</year>
                </pub-date>
            </front-stub>
            <body>
                <p>We sincerely appreciate the reviewer&#x2019;s insightful comment regarding the timing of sample collection. As acknowledged in the manuscript, one of the limitations of this study is the use of peripheral blood as the tissue source for gene expression analysis, which may not fully reflect molecular changes occurring in reproductive tissues such as the decidua or placenta. However, our primary objective was to investigate persistent or baseline alterations in the expression of genes related to DNA methylation and extracellular matrix remodeling that may predispose individuals to recurrent spontaneous abortion (RSA), rather than transient changes associated with the acute phase of miscarriage.</p>
                <p> The three-month interval between the last miscarriage and sample collection was intentionally chosen to minimize the confounding effects of acute inflammation, hormonal fluctuations, and psychological stress, which are known to influence gene expression. Previous studies have suggested that certain epigenetic modifications and gene expression profiles can remain altered for extended periods following reproductive events. Therefore, we aimed to capture potentially stable molecular signatures that may persist beyond the acute phase, while avoiding short-term physiological noise. We have clarified this rationale in the revised Discussion section.</p>
                <p> 1. We appreciate the reviewer&#x2019;s valuable observation regarding the need to reference more recent studies on DNA methylation in the context of recurrent spontaneous abortion (RSA).&#x00a0; we have revised the final sentence of the second paragraph in the Introduction to include recent findings.</p>
                <p> Specifically, we have added the following two references to support the current understanding of epigenetic dysregulation in RSA:</p>
                <p> -&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0; Qin M, Chen W, Hua L, Meng Y, Wang J, Li H, et al. DNA methylation abnormalities induced by advanced maternal age in villi prime a high-risk state for spontaneous abortion. 2023;15(1):44.</p>
                <p> -&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0; Zhou Q, Xiong Y, Qu B, Bao A, Zhang YJFii. DNA methylation and recurrent pregnancy loss: a mysterious compass? 2021;12:738962.</p>
                <p> </p>
                <p> 2.&#x00a0;We thank the reviewer for raising this important point regarding the selection of GAPDH as the internal reference gene. During the initial setup phase, we randomly selected a subset of samples and evaluated the gene expression levels of both 
                    <italic>GAPDH</italic> and 
                    <italic>ACTB </italic>as candidate reference genes. The results showed no variation in the expression levels of either 
                    <italic>GAPDH</italic> or 
                    <italic>ACTB </italic>between RSA and control samples. Due to limitations in available cDNA quantity and Based on this preliminary assessment and the widespread use of 
                    <italic>GAPDH</italic> in studies (
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1186/s12864-021-07801-0">https://doi.org/10.1186/s12864-021-07801-0</ext-link>), (
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.5281/zenodo.13904990">
                        <underline>https://doi.org/10.5281/zenodo.13904990</underline>
                    </ext-link>) with similar sampling, GAPDH was finally selected for final normalization in this study.</p>
                <p> </p>
                <p> 3.&#x00a0;We have clarified this point in the revised Discussion (paragraph 2) and appreciate the reviewer&#x2019;s insight in helping us refine the interpretation of our findings.</p>
                <p> </p>
                <p> 4.&#x00a0;We thank the reviewer for this important and thoughtful comment. We fully acknowledge that our study did not include direct analysis of MTHFR promoter methylation, and therefore any inference regarding a disconnect between methylation and gene expression must be interpreted with caution. Our statement in the Discussion was intended to highlight a hypothesis based on previous literature, including studies that have reported altered methylation of the MTHFR promoter region in RSA patients. However, we agree that without direct methylation data, such conclusions remain speculative.</p>
                <p> </p>
                <p> Additionally, the reviewer&#x2019;s point regarding the three-month interval between miscarriage and sample collection is well taken. It is possible that transient changes in MTHFR expression, which may occur during or shortly after miscarriage, were no longer detectable at the time of sampling. Our study aimed to capture more stable or baseline expression patterns, but we recognize that this timing may have limited our ability to observe dynamic regulatory changes.</p>
                <p> </p>
                <p> We have revised the Discussion section to clarify these limitations and to avoid overinterpretation of the observed expression data. We appreciate the reviewer&#x2019;s insight in helping us refine the interpretation of our findings.</p>
            </body>
        </sub-article>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report403503">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.183273.r403503</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Baqer</surname>
                        <given-names>Noor Nihad</given-names>
                    </name>
                    <xref ref-type="aff" rid="r403503a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0001-8285-2693</uri>
                </contrib>
                <aff id="r403503a1">
                    <label>1</label>Research and Technology Center of Environment, Baghdad, Iraq</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>2</day>
                <month>9</month>
                <year>2025</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2025 Baqer NN</copyright-statement>
                <copyright-year>2025</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport403503" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.166306.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>Dears This research represent scientific article and its elegance in writing but there is some notes ,the author can added other referances in introduction speciality of the region near from iran such as iraq due to similar in race these referances such as :&#x00a0;</p>
            <p> 1-HLA-G rs1063320 Polymorphism with the incidence of Recurrent Spontaneous Abortion (RSA) in Iraqi Women</p>
            <p> 2-Association between Methylenetetrahydrofolate Reductase (MTHFR) and 5-Methyltetrahydrofolate-Homocysteine Methyltransferase Reductase (MTRR) Polymorphisms in Iraqi Patients with COVID-19</p>
            <p> 3-The association between serum level and genetic variation of IL-3 (rs40401) in recurrent abortion women infected with toxoplasmosis in Iraq</p>
            <p> 4- Association between genetic polymorphism of IL-27 (rs153109) and toxoplasmosis in Iraqi women with recurrent abortion</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Yes</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>immunogenetics</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
        <sub-article article-type="response" id="comment14581-403503">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Fesahat</surname>
                            <given-names>Farzaneh</given-names>
                        </name>
                        <aff>Shahid Sadoughi University of Medical Sciences, Yazd, Iran, Iran</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>There is no conflict of interest.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>14</day>
                    <month>9</month>
                    <year>2025</year>
                </pub-date>
            </front-stub>
            <body>
                <p>We sincerely thank the reviewer for their thoughtful and constructive feedback. We fully agree with the importance of incorporating regional studies, particularly from neighboring countries such as Iraq, given the shared genetic and ethnic backgrounds that may influence gene polymorphism patterns. In line with this valuable suggestion, we have cited the recommended article&#x2014;"Association between Methylenetetrahydrofolate Reductase (MTHFR) and 5-Methyltetrahydrofolate-Homocysteine Methyltransferase Reductase (MTRR) Polymorphisms in Iraqi Patients with COVID-19"&#x2014;in the revised manuscript.</p>
            </body>
        </sub-article>
    </sub-article>
</article>
