All animal operations adhered to the ARRIVE criteria and the preclinical ARRIVE Essential 10 checklist ¹⁴ and received approval from the Animal Ethics Committee of Mustansiriyah University, Baghdad, Iraq (Approval No: [54]). Rats were anesthetized by intraperitoneal administration of ketamine (100 mg/kg, 10%, Alfasan, Holland) and xylazine (10 mg/kg, 20 mg/ml, Kepro, Holland). Euthanasia was conducted at the conclusion of the experiment by an overdose of ketamine/xylazine, ¹⁵ in accordance with the American Veterinary Medical Association (AVMA) Guidelines for the Euthanasia of Animals (2020). All measures were taken to reduce animal suffering.

Materials used in this study include Reserpine (Sigma/Germany, cas.no 50-55-5), and Montelukast powder from (Sigma/Germany, cas.no158966-92-8), solvent Dimethyl sulfoxide and acetic acid from (Mumbai–India), and corn oil from (Sigma Aldrich-Germany, Cat. No. C8267), distilled water from (pioneer, Iraq), xylazine vial (20 mg/ml) from (Kepro, Holland), Ketamine vial (10%) from (Alfasan, Holland, cat.no, V/NRP/97/0547) hematoxylin and eosin from (Sigma, Germany.

For this experimental animal study, thirty-five albino male rats weighting (150-200mg), rats were housed in spacious, cozy cages after being acquired from the animal house Iraqi Centre for Cancer and Medical Genetics Research (ICCMGR)/of Mustansiriyah University. They were permitted to acclimatize for 21 days in a regulated environment. there was a light schedule with 12 hours of light and 12 hours of darkness, the temperature was kept at 25 ± 1°C, and the humidity was kept between 40 and 50%. They have unlimited access to food and drink ad libitum.

Rats were then divided into five groups at randomly. Each group contain seven rats. I.

Group 1 (n = 7): Negative control group, rats received a mixture of distilled water, 5% glacial acetic acid, corn oil, and 5% Dimethyl sulfoxide (DMSO) was given orally for 14 days.

For preparing 0.2 mg/kg reserpine we first prepared a working solution of 1mg reserpine that dissolved in 5 ml of diluted glacial acetic acid, the glacial acetic acid in 5% concentration, the procedure done in a glass tube and mixed thoroughly by vortex until completely dissolved to get a final concentration of 0.2 mg/1ml of reserpine concentration from which about (0.2 ml to 0.175) was injected intraperitonially. ¹⁷

To obtain a 5% DMSO concentration, five milligrams of montelukast were added to a laboratory glass. A small amount of DMSO was then added, and the mixture was stirred until the montelukast was completely dissolved. Corn oil was then used as a diluent and a vehicle of administration, and 5 mg/ml of montelukast solution was administered orally. ¹⁸ The dosage was divided based on the weighting of the animals, and each group is represented in Table 1.

At the day 14, rats were permitted to fast for 12 hours, and under anesthesia with ketamine and xylazine injections intraperitoneal at 100 and 10 mg/kg, respectively, At the day 14 blood samples were extracted from the apex of the heart (left ventricle) using a 5 ml syringe, gauge 23, placed in gel tubes, and allowed to clot for 15 minutes at room temperature. Subsequently, they were subjected to centrifugation for 15 minutes at 3000 RPM. The obtained serum was aliquoted into Eppendorf tubes (1.5 ml). They were preserved at −20°C to quantify blood levels of cortisol.

Upon completion of the experiment (on day 14), following euthanasia, the skull was dissected, and the brains of seven rats from each group were extracted and rinsed with cold phosphate-buffered saline (PBS, pH 7.4) to eliminate residual blood and debris. Subsequently, the tissue was dried using filter paper, divided into two segments for histopathological examination and PCR analysis, and weighed using a sensitive balance. For histological examination, samples were kept in 10% neutral buffered formalin (Euroclone-Italy) to safeguard the tissue architecture against autolysis. For PCR analysis, 50-100 mg of brain tissue was combined with 1 ml of TRIzol (TransGen Biotech, cat. no. ER501-01) solution in an Eppendorf tube and then frozen for future use.

RNA was isolated from a tissue sample using the RNA extraction kit methodology. 50-100 mg of hippocampal brain tissue was promptly added to 1ml of TRIzol solution, then kept in the deepfreeze tell the day of examination.

To quantify the expression of BDNF PRM (F: TGGCTGACACTTTTGAGCAC, R: CAAAGGCACTTGACTGCTGA) and chrna7 PRM (F: TGCAGTGAATGGAAGTTTGC, R: GGACACAGCCTCCACAAAGT) genes via the real-time quantitative polymerase chain reaction (RT-PCR) technique. This procedure included the separation of brain tissue, total RNA extraction by TRIzol and subsequent Complementary DNA (cDNA) synthesis, along with genomic DNA removal, was performed using TransScript ^® One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China, cat. no. AT311-02). ¹⁹ A total of 20 μL of cDNA was amplified using real-time PCR, including 10 μL of Perfect Start Green qPCR Super Mix (TransGen Biotech, Beijing, China; cat. no. AQ601), ²⁰ 1 μL of primers derived from forward and reverse solutions, 4 μL of cDNA, and 4 μL of nuclease-free water. ²¹

The finished solution was subjected to heat reaction in the RT-PCR apparatus. Table 2 and Table 3 presents the thermal cycling methodology along with the appropriate melting point for each primer as specified by the manufacturer’s guidelines Table 2.

		Temperature	Time/Sec.	Cycle
Stage 1	Denaturation	94	55	1
Stage 2	Denaturation	94	10	42
	Annealing	58	15
	Extension*	72	20
Stage 3	Dissociation	55-95	1	1

Table 3.

		Temperature	Time/Sec.	Cycle
Stage 1	Denaturation	94	55	1
Stage 2	Denaturation	94	11	45
	Annealing	56	20
	Extension*	72	20
Stage 3	Dissociation	55-95	1	1

.

CALCULATION: The cycle threshold (CT) of the target genes was standardized against that of the internal control gene. The disparity in cycle threshold (Ct) values between the β-actin (internal control gene) and the target genes, BDNF and CHRNA7, was determined using the following equation 28: ΔCT ( test ) = CT ( target , test ) − CT ( ref , test )

The calibrator was selected from the control samples, and the DCT of the calibrator was computed using the following equation: ΔCT ( calibrator ) = CT ( target , calibrator ) – CT ( ref , calibrator )

The DCT of the test samples was normalized to the DCT of the calibrator:DD CT was calculated according to the following equation ΔΔCT = ( ΔCT test ) – ΔCT ( calibrator )

Finally, the expression ratio was calculated according to the formula: ²² 2 − ΔΔCT = normalized expression ratio .

Elevated plus maze test (EPM): The maze has four arms, two non-consecutive open arms measuring 30 cm in length and 5 cm in width, and two closed arms that form a central zone measuring 5 cm by 5 cm. The EPM was positioned 60 cm above the floor in the center of the room. The mouse was positioned in one of the open arms, orientated away from the center, and allowed to roam freely for five minutes. All sessions were documented with a camera positioned above the EPM, and the duration spent in the arms and center of the maze was quantified. Open arms and central regions are classified as anxiety zones. ²³

Force swimming test: The animal finds itself in a cylindrical water container from which it cannot escape. Most animals will try to flee by means of vigorous swimming. The animal is said to have given up when it stops swimming and floats on the water’s surface. An animal that quits up quite fast is said to be exhibiting traits related to human despair. Animals are maintained in water for five minutes for each during which we determine their movement and stop times. ²⁴

This section provides a detailed characterization of the behavioral profiles observed in each experimental group. The parameters assessed, indicative of general activity, despair-like behavior (in a forced swim test context), and anxiety-related responses (an elevated plus maze), are sourced from thorough examination of Swimming Time, Immobility Time, Open Arms Time, and Closed Arms Time allows for a comprehensive understanding of the behavioral state of each group details are presented in Table 8.

Forced Swimming Test: Montelukast treatment showed dose-dependent effects, with the highest dose (20 mg/kg) producing the most pronounced reduction in swimming time (187.00 ± 8.51 s) details are presented in Figure 2, Table 5 and Table 6.

Montelukast treatment showed a dose-dependent increase in closed time, with the 20 mg/kg dose group spending 197.14 ± 14.88 s in open arms details are presented in Table 7, Figure 3 and Figure 4.

Cortisol levels were measured using a commercially available enzyme-linked immunosorbent assay (ELISA) kit (Cloud-Clone Corp., cat. no. CEA462Ge). Cortisol levels were markedly elevated in both reserpine (62.91 ± 9.27 ng/ml) and high-dose montelukast groups (91.12 ± 3.12 ng/ml) compared to control (11.57 ± 0.26 ng/ml) details are presented in Table 9 and Figure 5.

The control group exhibited a normal morphology of neurons and glial cells across the molecular layer, external granular layer, external pyramidal layer, inner granular layer, inner pyramidal layer, ganglionic layer, and multiform layer ( Figure 6). In contrast, the Reserpine-treated group displayed numerous vacuoles of varying sizes (indicative of demyelination), accompanied by degeneration and necrosis of glial cells, while the neurons maintained a normal appearance of pyramidal neuron types. The montelukast-treated groups at dosages of 5 mg/kg and 10mg/kg demonstrated normal meningeal diameter and normal morphology of neurons and glial cells throughout all cerebral cortical layers. However, the group treated with 20 mg/kg exhibited mild congestion of the meningeal blood vessels, along with congestion and perivascular edema of cerebral cortical blood vessels, while the glial cells and neurons across all cortical layers retained a normal appearance. details are presented in Figures 6– 10.

Analyses were performed in SPSS v26 and GraphPad Prism v9 (Excel 2021 for data verification/graphics). Data are reported as mean ± SD in tables and mean ± SEM in figures. Two-tailed tests were used with α = 0.05; exact p values are given where possible, and figures use p < 0.05, p < 0.01, p < 0.001. Assumptions were examined by Shapiro–Wilk tests and Q–Q plots (normality) and Levene’s test (homogeneity).

Group differences in behavioral outcomes (Forced Swimming Test; Elevated Plus Maze) and biochemical measures (dopamine, serotonin, norepinephrine, BDNF, cortisol) were tested by one-way ANOVA with Tukey HSD (or Tukey–Kramer) for pairwise comparisons. When comparisons were planned only versus the negative control, Dunnett’s test was applied. If variances were unequal, Welch’s ANOVA with Games–Howell post-hoc tests was used; for non-normal data, Kruskal–Wallis with Dunn’s tests (Bonferroni-adjusted) replaced parametric methods.

Gene expression was analyzed on ΔCq values (normalized to β-actin) using one-way ANOVA or the above non-parametric/heteroscedastic alternatives as required. For presentation, fold changes relative to control were computed by the 2^–ΔΔCq method; inference relied on ΔCq, with 95% confidence intervals provided.

Dose–response across montelukast groups (5, 10, 20 mg/kg) was evaluated using linear orthogonal polynomial contrasts within ANOVA, reporting slope, 95% CI, and η ²p; Associations between behavioral and biochemical variables were assessed with Pearson correlations.

Determinants of behavioral outcomes were examined using multiple linear regression with immobility time and Elevated Plus Maze indices as dependent variables and neurotransmitters, BDNF, cortisol, and treatment group/dose as predictors. All analyses were complete-case.