<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.174480.1</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of selenium</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 1; peer review: 1 approved, 1 not approved]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Shahooth</surname>
                        <given-names>Mohammed Ali</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Abdulrahman Ghazi</surname>
                        <given-names>Maysam</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-8534-726X</uri>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Khamees  Abed</surname>
                        <given-names>Sabea</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0009-0005-6639-0384</uri>
                    <xref ref-type="corresp" rid="c2">b</xref>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Emad  Abood</surname>
                        <given-names>Ahmed</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Software</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>A. Saud</surname>
                        <given-names>Mustafa</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>University of Anbar, Ramadi, Al Anbar Governorate, Iraq</aff>
                <aff id="a2">
                    <label>2</label>University of Fallujah, Al-Fallujah, Al Anbar Governorate, Iraq</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:maisam.a.ghazee@uofallujah.edu.iq">maisam.a.ghazee@uofallujah.edu.iq</email>
                </corresp>
                <corresp id="c2">
                    <label>b</label>
                    <email xlink:href="mailto:sabeavet@uofallujah.edu.iq">sabeavet@uofallujah.edu.iq</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>24</day>
                <month>1</month>
                <year>2026</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2026</year>
            </pub-date>
            <volume>15</volume>
            <elocation-id>115</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>13</day>
                    <month>1</month>
                    <year>2026</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2026 Shahooth MA et al.</copyright-statement>
                <copyright-year>2026</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/15-115/pdf"/>
            <abstract>
                <sec>
                    <title>Background</title>
                    <p>Anabolic-androgenic steroids (AAS), such as methandienone, are synthetic testosterone derivatives that are widely used for the enhancement of physical performance and the growth of muscles. This study looked at the effect of methandienone on ovarian CYP19A1 gene expression and oxidative status in rabbits. The work also examined whether supplementation with selenium could reduce the adverse effects caused by methandienone.</p>
                </sec>
                <sec>
                    <title>Methods</title>
                    <p>Twenty healthy adult female rabbits were randomly assigned to four groups and maintained under uniform management for 30 days. The groups included a control, a methandienone-treated group (T1), a selenium group (T2), and a combined methandienone plus selenium group (T3). Serum oestrogens concentrations were measured using standard biochemical techniques. CYP19A1 mRNA expression in ovarian tissue and markers were quantified by established molecular and biochemical protocols.</p>
                </sec>
                <sec>
                    <title>Results</title>
                    <p>Rabbits receiving methandienone alone (T1) showed a significant decline (P&#x2264;0.05) in CYP19A1 mRNA expression and serum oestrogens when compared with the control and other treatment groups. Selenium supplementation (T2) produced marked increases in both parameters relative to G1 and G3, indicating a robust corrective effect. Oxidative stress analysis revealed elevated levels of malondialdehyde (MDA) and protein carbonyl content (PCC) in the T1 group, consistent with increased oxidative stress. Intermediate oxidative stress values were observed in the T3 group, exceeding those in the T1 group but remaining below those in the T2 group.</p>
                </sec>
                <sec>
                    <title>Conclusion</title>
                    <p>Methandienone appears to impair ovarian function by suppressing CYP19A1gene expression and promoting oxidative stress, leading to reduced steroidogenic activity. Selenium administration mitigates these disturbances by enhancing antioxidant defense and partially restoring gene expression and oestrogens levels. These findings highlight the potential of selenium as a supportive intervention against methandienone -induced oxidative and hormonal disruptions in rabbits.</p>
                </sec>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>Methandienone</kwd>
                <kwd>Selenium</kwd>
                <kwd>CYP19A1 gene</kwd>
            </kwd-group>
            <funding-group>
                <award-group id="fund-1">
                    <funding-source>This article is submitted through the university of Fallujah gateway | No specific funding was received for this work</funding-source>
                </award-group>
                <funding-statement>The author(s) declared that no grants were involved in supporting this work.</funding-statement>
            </funding-group>
        </article-meta>
    </front>
    <body>
        <sec id="sec5" sec-type="intro">
            <title>Introduction</title>
            <p>Anabolic-androgenic steroids (AAS), such as methandienone, are synthetic derivatives of testosterone which are widely used to enhance physical performance and muscle growth. Although anabolic steroids have potent anabolic properties and utilized to treat senile osteoporosis and various kinds of anemia, as well as the anabolic impact associated with masculinization (
                <xref ref-type="bibr" rid="ref5">Barbonetti et al., 2020</xref>), prolonged or excessive use is associated with a number of physiological and biochemical adverse reactions, including cardiovascular dysfunction, hepatotoxicity, endocrine imbalances and reproductive disorders (
                <xref ref-type="bibr" rid="ref3">Albano et al., 2021</xref>). The female reproductive system, especially the ovaries, is particularly sensitive to hormonal disturbances and oxidative damage as a result of exposure to exogenous steroids (
                <xref ref-type="bibr" rid="ref15">Matyja et al., 2023</xref>).</p>
            <p>Within the ovary, aromatase, which is encoded by CYP19A1, is the key enzyme in steroidogenesis, which catalyzes the conversion of androgens to oestrogens by removing C19 from testosterone. This aromatic process is essential for follicular development, ovulation and maintenance of normal ovarian circulation (
                <xref ref-type="bibr" rid="ref14">Magnani et al., 2017</xref>). Alterations in the expression of CYP19A1 gene or in its enzyme activity may alter the physiological balance of accumulation of androgens and reduce oestrogens synthesis, potentially leading to affects follicular development and oocyte maturation and infertility (
                <xref ref-type="bibr" rid="ref9">El Fouikar et al., 2024</xref>). Elevated androgen levels are also strongly associated with follicular cystic in animals (
                <xref ref-type="bibr" rid="ref11">Kalhori et al., 2018</xref>) and polycystic ovarian syndrome (PCOS), a hormonal disorder characterized by masculinity, anovulation, menstrual irregularities and multiple ovarian cysts, which often leads to infertility and widespread metabolic disorders (
                <xref ref-type="bibr" rid="ref16">Morales-Ledesma et al., 2017</xref>).</p>
            <p>Methandienone has been shown to induce oxidative stress by inducing over production of reactive oxygen species (ROS) and reducing the activity of antioxidant enzymes, mitochondrial dysfunctions (
                <xref ref-type="bibr" rid="ref1">Abed, 2020</xref>) and stimulating pro-inflammatory cytokines (TNF-&#x03b1;, IL-6) (
                <xref ref-type="bibr" rid="ref17">Petrovic et al., 2022</xref>). This oxidative imbalance is a key pathogenic pathway mediating cytotoxicity and multiple organ apoptotic effects of anabolic-androgenic steroids (
                <xref ref-type="bibr" rid="ref1">Abed, 2020</xref>). In ovarian tissue, increased levels of ROS impair mitochondrial integrity, increase lipid peroxidation and induce apoptosis of granulocytes, thereby reducing both follicular development and steroidogenic synthesis (
                <xref ref-type="bibr" rid="ref8">Dutta et al., 2024</xref>).</p>
            <p>Selenium (Se) is a basic micronutrient and a critical component of several selenoproteins such as glutathione peroxidase (GPx) and thioredoxin reductase (ThiR) and Selenoprotein P (SelP) which play a central role in maintaining the balance of redox and preserving mitochondrial integrity in the body. Experimental data suggest that selenium supplementation reduces oxidative damage by activating the Nrf2 pathway, regulates steroidogenic enzyme expression and improves mammalian reproduction (
                <xref ref-type="bibr" rid="ref18">Rabah et al., 2023</xref>). Selenium is also essential in a number of biological processes, including electron transport, regulates immune cell proliferation, hydroxylation and oxidative metabolism of aromatic compounds in the metabolism of animals (
                <xref ref-type="bibr" rid="ref23">Stolwijk et al., 2020</xref>).</p>
            <p>The hypothesis of the study is that methandienone is expected to affect ovarian physiology via two related mechanisms: a reduction in oestrogen synthesis, and a reinforcement of oxidative stress due to the estrogen consider as an antioxidant activity, which causes cellular and molecular damage. It is thought that supplementation with selenium compensates for these disturbances by strengthening antioxidant protection and promoting normal steroidogenic function. Exploring these interactions in the rabbit model may provide valuable insights into the contribution of anabolic and androgenic steroids to ovarian dysfunction and may inform strategies for reducing their reproductive adverse effect.</p>
        </sec>
        <sec id="sec6">
            <title>Materials and methods</title>
            <p>In this study, we used twenty young adult female rabbits, aged between 8 and 14 weeks, weighing roughly 850 to 1,200 grams. These rabbits were kept in the Physiology Laboratory at the Veterinary Medicine College in Fallujah University, randomly divided them into four groups, with five rabbits in each. for the T1 group gave a dose of methandienone (Black dragon pharma, Thailand) orally, which was 0.35 mg/kg body weight Selenium yeast supplied by (21st Century
                <sup>&#x00ae;</sup> (USA)) and administered to T2 group at a dose of 3 &#x03bc;g/kg body weight (
                <xref ref-type="bibr" rid="ref2">Abed and Al-Azawi, 2020</xref>). Methandienone and selenium were administered orally (T3) to a combined group of rabbits (0.35 mg per kg bodyweight, 3 &#x03bc;g per kg bodyweight). All animals received oral administration every day for 30 days. After 30 days of the experiment, blood samples were taken from each rabbit by cardiac puncture for estrogen evaluation, and at the end of the study, Animal sacrifice was carried out in accordance with approved ethical standards. and ovary were isolated for gene expression evaluation. All animal experimental procedures, including anesthesia administration and blood sampling, were performed in accordance with American Veterinary Medical Association (AVMA) guidelines (
                <xref ref-type="bibr" rid="ref24">Underwood and Raymond, 2013</xref>). The estradiol test is a one-step immunoassay used to evaluate the value estradiol in serum of mammals using a universal assay protocol called chemiflex (
                <xref ref-type="bibr" rid="ref10">Fu et al., 2020</xref>).</p>
            <p>Malondialdehyde (MDA) assay was determined by colorimetric method (
                <xref ref-type="bibr" rid="ref25">Yal&#x00e7;in et al., 2010</xref>), using malondialdehyde colorimetric assay kit (Elabscience china) and assay, protein carbonyl content was determined by colorimetric method (
                <xref ref-type="bibr" rid="ref19">Reznick and Packer, 1994</xref>) using protein carbonyl colorimetric assay kit (Elabscience, china).</p>
            <p>The total RNA was extracted with a magnatronic nanosorbent kit as specified by the manufacturer (RealBest Extraction 100, Russia). The RNA integrity and purity were verified by nanodrop spectrophotometry. We used a reverse transcriptase (M-MLV) template from the Synthol (Russia) and appropriate primers to reverse transcript the RNA to cDNA for a real-time PCR (RT). 
                <xref ref-type="table" rid="T1">
Table 1</xref> shows the primer sequences purchased all from Bioneer (Korea). We examined the expression of these genes (the genes of interest) using GAPDH as a control gene. Start ExicyclerTM 96 real-time PCR-based thermal block device and load as follows: The PCR method was used for one hour of reverse transcriptase at 50&#x00b0;C, five minutes at 95&#x00b0;C, and 47 cycles at 96&#x00b0;C, 46 seconds at 62&#x00b0;C, all repeated 45 times. Delta-delta CT has previously been reported to be used to assess the relative amount of expression of a specific gene (
                <xref ref-type="bibr" rid="ref13">Livak and Schmittgen, 2001</xref>). Statistical analysis was performed with version 21.0 of SPSS software. Data were expressed as mean &#x00b1; standard error of the mean (SE) and compared to groups using (One-way) analysis of variance (ANOVA) with a P &#x2265; 0.05 (
                <xref ref-type="bibr" rid="ref12">Larsen et al., 1973</xref>). All experimental procedures have been carried out in accordance with institutional guidelines on the care and use of laboratory animals.</p>
            <table-wrap id="T1" orientation="portrait" position="float">
                <label>
Table 1. </label>
                <caption>
                    <title>The table shows the identifies of the primers and their sequence.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="left" colspan="1" rowspan="1" valign="top">Primer</th>
                            <th align="left" colspan="2" rowspan="1" valign="top">Sequence</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td align="left" colspan="1" rowspan="2" valign="top">
                                <bold>CYP19A1 (Aromatase enzyme)</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>F</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">GGAAGAATGCATCGACTTGAGTT</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>R</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">GGGCCCAAAACCAAATGGT</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="2" valign="top">
                                <bold>GAPDH (glyceraldehyde-3-phosphate dehydrogenase)</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>F</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">ATGCCCCCATGTTTGTGATG</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="top">
                                <bold>R</bold>
</td>
                            <td align="left" colspan="1" rowspan="1" valign="top">AGGATGCGTTGCTGACAATC</td>
                        </tr>
                    </tbody>
                </table>
                <table-wrap-foot>
                    <p>F: Forword, R: Reverse.</p>
                </table-wrap-foot>
            </table-wrap>
        </sec>
        <sec id="sec7" sec-type="results">
            <title>Results</title>
            <sec id="sec8">
                <title>1-The effect of methandienone, selenium and both on the aromatase gene expression and serum estrogen concentration</title>
                <p>There was a statistically significant difference (
                    <xref ref-type="table" rid="T2">Table 2</xref>) in the levels of mRNA CYP19A1 in ovarian tissues and serum oestrogen concentrations in rabbits treated with anabolic androgenic steroids (T1) (down regulation) compared to controls and non-treated animals (T2, T3). The selenium (T2) group showed a significant (P &lt; 0.05) increase in gene expression and oestrogen concentrations compared to T1 and T3.</p>
                <table-wrap id="T2" orientation="portrait" position="float">
                    <label>
Table 2. </label>
                    <caption>
                        <title>The effect of methandienone, selenium and both on CYP19A1 gene expression analysis (Aromatase gene) in ovary and serum estrogen concentration of different groups (T1, T2, and T3) in female rabbits.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">
Groups/Parameter</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
Control</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Methandienone (T1)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
Selenium (T2)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
Metha. + Se-organic (T3)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
LSD</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CYP19A1 gene (Fold change (2^-&#x2206;&#x2206;CT))</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1.20 &#x00b1; 0.03 D</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3.20 &#x00b1; 0.12 C</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6.11 &#x00b1; 0.14 A</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">4.54 &#x00b1; 0.85 B</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.33</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Estrogen (pg/ml)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">37.3 &#x00b1; 0.3 B</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">18.6 &#x00b1; 0.55 D</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">41.8 &#x00b1; 0.5 A</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">24.3 &#x00b1; 0.54 C</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.7</td>
                            </tr>
                        </tbody>
                    </table>
                    <table-wrap-foot>
                        <p>-Number of rabbits in each group (5), Data reflected as mean &#x00b1; Standard Error (SE). </p>
                        <p>-The different capital letters indicate significant (P &#x2264; 0.05) changes between variation between groups. </p>
                        <p>-control = no treatment. </p>
                        <p>-T1 = Rabbits administration of methandienone at dose 0.35 mg/kg daily for 30 days. </p>
                        <p>-T2 = Rabbits administration of selenium at dose 3 &#x03bc;g/kg daily for 30 days. </p>
                        <p>-T3 = Rabbits administration both of methandienone and selenium.</p>
                    </table-wrap-foot>
                </table-wrap>
            </sec>
            <sec id="sec9">
                <title>2-The effect of methandienone, selenium and both on malondialdehyde and protein carbonyl content in the ovarian tissue</title>
                <p>A significant (P &lt; 0.05) increases in oxidative markers (MDA and protein carbonyl content) were observed in the T1 group compared to all other groups (
                    <xref ref-type="table" rid="T3">Table 3</xref>). The protection group (T3) also had higher values than the control group (T2) and selenium group (T1), but lower values than T1.</p>
                <table-wrap id="T3" orientation="portrait" position="float">
                    <label>
Table 3. </label>
                    <caption>
                        <title>The effect of methandienone, selenium and both of malondialdehyde (MDA) and protein carbonyl content (PCC) levels in the ovarian tissue of different groups (T1, T2, and T3) in female rabbits.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">
Groups/Parameter</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
Control</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Methandienone (T1)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
Selenium (T2)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Metha. + Se-organic (T3)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
LSD</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">MDA (micro mole/L)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2.34 &#x00b1; 0.83 C</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">5.42 &#x00b1; 0.71 A</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2.21 &#x00b1; 0.54 C</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3.92 &#x00b1; 0.65 B</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.91</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">PCC (nmol/mgprot)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3.5 &#x00b1; 0.9 C</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">6.45 &#x00b1; 1.2 A</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">4.02 &#x00b1; 0.72 C</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">5.11 &#x00b1; 1.1 B</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1.09</td>
                            </tr>
                        </tbody>
                    </table>
                    <table-wrap-foot>
                        <p>Number of rabbits in each group (5), Data reflected as mean &#x00b1; Standard Error (SE). </p>
                        <p>The different capital letters indicate significant (P &#x2264; 0.05) variation between groups. </p>
                        <p>-control = no treatment. </p>
                        <p>-T1 = Rabbits administration of methandienone at dose 0.35 mg/kg daily for 30 days. </p>
                        <p>-T2 = Rabbits administration of selenium at dose 3 &#x03bc;g/kg daily for 30 days. </p>
                        <p>-T3 = Rabbits administration both of methandienone and selenium.</p>
                    </table-wrap-foot>
                </table-wrap>
            </sec>
        </sec>
        <sec id="sec10" sec-type="discussion">
            <title>Discussion</title>
            <p>This study showed that administration of methandienone resulted in a marked decrease in mRNA expression of CYP19A1 in ovarian tissues (
                <xref ref-type="table" rid="T2">Table 2</xref>) and a concurrent decrease in serum oestrogen concentrations in treated rabbits (T1 group) compared to control groups. These findings indicate that methandienone has a suppression effect on aromatase activity, resulting in a decrease in the conversion of androgens to oestrogens. The inhibition of aromatase expression observed in this study is consistent with previous studies suggesting that AAS exposure influences the hypothalamic-pituitary-gonadal (HPG) axis and ovarian steroidogenesis through the suppression of CYP19A1 transcription (
                <xref ref-type="bibr" rid="ref6">Barros-Oliveira et al., 2021</xref>; 
                <xref ref-type="bibr" rid="ref9">El Fouikar et al., 2024</xref>).</p>
            <p>Notably, supplementation with selenium (T2 group) significantly restored CYP19A1 expression and serum oestrogen concentrations compared with the methandienone-treated group. This enhancement highlights the modulatory role of selenium in maintaining the function of steroidogenic enzymes, influence on the Nrf2 pathway (
                <xref ref-type="bibr" rid="ref1">Abed, 2020</xref>) and its ability to counter the oxidative stress induced by AAS. Selenium is known to increase the activity of selenoproteins, including glutathione peroxidase and thioredoxin reductase, thereby reducing the accumulation of reactive oxygen species (ROS) and protecting the cellular macromolecules from oxidative damage (
                <xref ref-type="bibr" rid="ref26">Zhang et al., 2023</xref>). Thus, the observed upregulation of CYP19A1 following selenium supplementation may reflect the preservation of mitochondrial, endoplasmic reticulum function and transcription of antioxidant enzymes, both of which are essential for steroid hormone synthesis. These findings are consistent with 
                <xref ref-type="bibr" rid="ref18">Rabah et al., (2023)</xref>, who demonstrated that selenium supplementation enhances ovarian function and steroidogenesis under conditions of oxidative stress.</p>
            <p>The significant increase in oxidative markers, including malondialdehyde (MDA) and protein carbonyl (PC) levels in methandienone (T1) (
                <xref ref-type="table" rid="T3">Table 3</xref>) further highlights the role of oxidative stress in ovarian dysfunction. Increased lipid peroxidation and protein oxidation, associated with decreased antioxidant protection, and when oestrogen levels fall in this group, loss of oestrogenic antioxidant protection (
                <xref ref-type="bibr" rid="ref20">Ruiz-Romero et al., 2025</xref>), reflect a disruption in the balance between reactive species generation and the body&#x2019;s scavenging capacity. These oxidative insults may result in apoptosis of granulosa cells, mitochondrial dysfunction and reduced follicular viability (
                <xref ref-type="bibr" rid="ref7">Daraghmeh et al., 2025</xref>). In addition, testosterone and derivatives considered to be pro-oxidants causing adverse effects on primary biomolecules (
                <xref ref-type="bibr" rid="ref4">Andr&#x00e9;s Juan et al., 2021</xref>). Since testosterone normally increases the metabolic rate (
                <xref ref-type="bibr" rid="ref22">Stallone and Oloyo, 2023</xref>).</p>
            <p>Partial normalization of these oxidative markers in the group of selenium-protected (T3) supports the hypothesis that selenium provides cytoprotection by stabilizing the redox homeostasis and increasing the activity of antioxidant enzymes. Although the oxidative indices in the protection group were still higher than in the controls, their decrease compared to T1 indicates that oxidative damage caused by AAS is attenuated rather than reversed.</p>
        </sec>
        <sec id="sec11" sec-type="conclusion">
            <title>Conclussion</title>
            <p>These findings together highlight a dual pathogenic mechanism of methandienone toxicity: (1) direct endocrine disruption through aromatase inhibition and CYP19A1 downregulation; and (2) indirect oxidative damage by oxidative over production and oxidative depletion of antioxidant defences. The ability of selenium to inhibit both pathways reflects its integral role in maintaining cellular homeostasis, modulating redox signaling and stabilizing steroidogenic gene transcription.</p>
        </sec>
        <sec id="sec12">
            <title>Ethical considerations</title>
            <p>This study was conducted in full compliance with the ethical guidelines approved by the Scientific Committee on Research Ethics of the University of Fallujah Faculty of Veterinary Medicine (Approval No: 7; 13/10 2025) (
                <xref ref-type="bibr" rid="ref21">Shahooth et al., 2025</xref>).</p>
        </sec>
    </body>
    <back>
        <sec id="sec15" sec-type="data-availability">
            <title>Data availability</title>
            <p>Underlying data Zenodo: Data are available under the terms of the 
                <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/publicdomain/zero/1.0/legalcode">Creative Commons Zero &#x201c;No rights reserved&#x201d; data waiver (CC0 1.0 Public domain dedication)</ext-link>. The data raw of study of Methandienone and Selenium in rabbits. 
                <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.5281/zenodo.17897289">https://doi.org/10.5281/zenodo.17897289</ext-link> (
                <xref ref-type="bibr" rid="ref21">Shahooth et al., 2025</xref>).</p>
            <p>

                <bold>Arrive checklist</bold> 
                <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.5281/zenodo.17897289">

                    <sans-serif>https://doi.org/10.5281/zenodo.17897289</sans-serif>
</ext-link> (
                <xref ref-type="bibr" rid="ref21">Shahooth et al., 2025</xref>).</p>
        </sec>
        <ack>
            <title>Acknowledgments</title>
            <p>The authors thank the study staff as well as the study participants.</p>
        </ack>
        <ref-list>
            <title>References</title>
            <ref id="ref1">
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Abed</surname>
                            <given-names>SK</given-names>
                        </name>
</person-group>:
                    <article-title>The protective effects of the organic selenium (high-selenium yeast) on the oxidative stress caused by methanedienone on the brain of male rabbits.</article-title>
                    <year>2020</year>.</mixed-citation>
            </ref>
            <ref id="ref2">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Abed</surname>
                            <given-names>SK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Al-Azawi</surname>
                            <given-names>TSS</given-names>
                        </name>
</person-group>:
                    <article-title>Selenium Enriched Yeast Modifies the Effects of Methandienone in Male Rabbits on the HPA Axis and Adrenal Gland Oxidative Stress.</article-title>
                    <source>

                        <italic toggle="yes">Al-Anbar Journal of Veterinary Sciences.</italic>
</source>
                    <year>2020</year>;<volume>13</volume>(<issue>2</issue>).</mixed-citation>
            </ref>
            <ref id="ref3">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Albano</surname>
                            <given-names>GD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Amico</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Cocimano</surname>
                            <given-names>G</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Adverse effects of anabolic-androgenic steroids: a literature review.</article-title>
                    <source>

                        <italic toggle="yes">Healthcare.</italic>
</source>
                    <year>2021</year>;<volume>9</volume>(<issue>1</issue>):<fpage>97</fpage>.</mixed-citation>
            </ref>
            <ref id="ref4">
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Andr&#x00e9;s Juan</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>P&#x00e9;rez de Lastra</surname>
                            <given-names>JM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Plou Gasca</surname>
                            <given-names>FJ</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The chemistry of Reactive oxygen Species (ROS) revisited: Outlining their role in biological macromolecules (DNA, lipids and proteins) and induced pathologies.</article-title>
                    <year>2021</year>.</mixed-citation>
            </ref>
            <ref id="ref5">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Barbonetti</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>D&#x2019;Andrea</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Francavilla</surname>
                            <given-names>S</given-names>
                        </name>
</person-group>:
                    <article-title>Testosterone replacement therapy.</article-title>
                    <source>

                        <italic toggle="yes">Andrology.</italic>
</source>
                    <year>2020</year>;<volume>8</volume>(<issue>6</issue>):<fpage>1551</fpage>&#x2013;<lpage>1566</lpage>.
                    <pub-id pub-id-type="pmid">32068334</pub-id>
                    <pub-id pub-id-type="doi">10.1111/andr.12774</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref6">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Barros-Oliveira</surname>
                            <given-names>M d C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Costa-Silva</surname>
                            <given-names>DR</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Dos Santos</surname>
                            <given-names>AR</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Influence of CYP19A1 gene expression levels in women with breast cancer: A systematic review of the literature.</article-title>
                    <source>

                        <italic toggle="yes">Clinics.</italic>
</source>
                    <year>2021</year>;<volume>76</volume>:<fpage>e2846</fpage>.</mixed-citation>
            </ref>
            <ref id="ref7">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Daraghmeh</surname>
                            <given-names>DN</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Salameh</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zahdeh</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Exploring the Effects of Oxidative Stress on Female Reproductive Function: The Role of Antioxidant Supplementation.</article-title>
                    <source>

                        <italic toggle="yes">Curr. Drug Metab.</italic>
</source>
                    <year>2025</year>.</mixed-citation>
            </ref>
            <ref id="ref8">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Dutta</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sengupta</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Izuka</surname>
                            <given-names>E</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Oxidative and nitrosative stress and female reproduction: Roles of oxidants and antioxidants.</article-title>
                    <source>

                        <italic toggle="yes">Journal of Integrated Science and Technology.</italic>
</source>
                    <year>2024</year>;<volume>12</volume>(<issue>3</issue>):<fpage>754</fpage>.</mixed-citation>
            </ref>
            <ref id="ref9">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>El Fouikar</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Van Acker</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>H&#x00e9;li&#x00e8;s</surname>
                            <given-names>V</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Folliculogenesis and steroidogenesis alterations after chronic exposure to a human-relevant mixture of environmental toxicants spare the ovarian reserve in the rabbit model.</article-title>
                    <source>

                        <italic toggle="yes">J. Ovarian Res.</italic>
</source>
                    <year>2024</year>;<volume>17</volume>(<issue>1</issue>):<fpage>134</fpage>.
                    <pub-id pub-id-type="pmid">38943138</pub-id>
                    <pub-id pub-id-type="doi">10.1186/s13048-024-01457-6</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref10">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Fu</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Devare</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Liu</surname>
                            <given-names>J</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Evaluate performance of the Abbott chemiluminescent microparticle immunoassay assay for detection of syphilis infection in Chinese blood donors.</article-title>
                    <source>

                        <italic toggle="yes">J. Clin. Lab. Anal.</italic>
</source>
                    <year>2020</year>;<volume>34</volume>(<issue>1</issue>):<fpage>e23033</fpage>.
                    <pub-id pub-id-type="pmid">31617243</pub-id>
                    <pub-id pub-id-type="doi">10.1002/jcla.23033</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref11">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kalhori</surname>
                            <given-names>Z</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mehranjani</surname>
                            <given-names>MS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Azadbakht</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Ovary stereological features and serum biochemical factors following induction of polycystic ovary syndrome with testosterone enanthate in mice: An experimental study.</article-title>
                    <source>

                        <italic toggle="yes">International Journal of Reproductive BioMedicine.</italic>
</source>
                    <year>2018</year>;<volume>16</volume>(<issue>4</issue>):<fpage>267</fpage>&#x2013;<lpage>274</lpage>.
                    <pub-id pub-id-type="pmid">29942935</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref12">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Larsen</surname>
                            <given-names>IL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hartmann</surname>
                            <given-names>NA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wagner</surname>
                            <given-names>JJ</given-names>
                        </name>
</person-group>:
                    <article-title>Estimating precision for the method of standard additions.</article-title>
                    <source>

                        <italic toggle="yes">Anal. Chem.</italic>
</source>
                    <year>1973</year>;<volume>45</volume>(<issue>8</issue>):<fpage>1511</fpage>&#x2013;<lpage>1513</lpage>.</mixed-citation>
            </ref>
            <ref id="ref13">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Livak</surname>
                            <given-names>KJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Schmittgen</surname>
                            <given-names>TD</given-names>
                        </name>
</person-group>:
                    <article-title>Analysis of relative gene expression data using real-time quantitative PCR and the 2&#x2212; &#x0394;&#x0394;CT method.</article-title>
                    <source>

                        <italic toggle="yes">Methods.</italic>
</source>
                    <year>2001</year>;<volume>25</volume>(<issue>4</issue>):<fpage>402</fpage>&#x2013;<lpage>408</lpage>.
                    <pub-id pub-id-type="pmid">11846609</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref14">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Magnani</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Frige</surname>
                            <given-names>G</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Gadaleta</surname>
                            <given-names>RM</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Acquired CYP19A1 amplification is an early specific mechanism of aromatase inhibitor resistance in ER&#x03b1; metastatic breast cancer.</article-title>
                    <source>

                        <italic toggle="yes">Nat. Genet.</italic>
</source>
                    <year>2017</year>;<volume>49</volume>(<issue>3</issue>):<fpage>444</fpage>&#x2013;<lpage>450</lpage>.
                    <pub-id pub-id-type="pmid">28112739</pub-id>
                    <pub-id pub-id-type="doi">10.1038/ng.3773</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref15">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Matyja</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Abod</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ilnicka</surname>
                            <given-names>N</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Anabolic-androgenic steroids. Mechanism of action and clinical effects.</article-title>
                    <source>

                        <italic toggle="yes">Journal of Education, Health and Sport.</italic>
</source>
                    <year>2023</year>;<volume>15</volume>(<issue>1</issue>):<fpage>122</fpage>&#x2013;<lpage>133</lpage>.</mixed-citation>
            </ref>
            <ref id="ref16">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Morales-Ledesma</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>D&#x00ed;az Ramos</surname>
                            <given-names>JA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Trujillo Hern&#x00e1;ndez</surname>
                            <given-names>A</given-names>
                        </name>
</person-group>:
                    <article-title>Polycystic ovary syndrome induced by exposure to testosterone propionate and effects of sympathectomy on the persistence of the syndrome.</article-title>
                    <source>

                        <italic toggle="yes">Reprod. Biol. Endocrinol.</italic>
</source>
                    <year>2017</year>;<volume>15</volume>(<issue>1</issue>):<fpage>50</fpage>.
                    <pub-id pub-id-type="pmid">28693534</pub-id>
                    <pub-id pub-id-type="doi">10.1186/s12958-017-0267-0</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref17">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Petrovic</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Vukadin</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sikora</surname>
                            <given-names>R</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Anabolic androgenic steroid-induced liver injury: An update.</article-title>
                    <source>

                        <italic toggle="yes">World J. Gastroenterol.</italic>
</source>
                    <year>2022</year>;<volume>28</volume>(<issue>26</issue>):<fpage>3071</fpage>&#x2013;<lpage>3080</lpage>.
                    <pub-id pub-id-type="pmid">36051334</pub-id>
                    <pub-id pub-id-type="doi">10.3748/wjg.v28.i26.3071</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref18">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Rabah</surname>
                            <given-names>HM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mohamed</surname>
                            <given-names>DA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mariah</surname>
                            <given-names>RA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Novel insights into the synergistic effects of selenium nanoparticles and metformin treatment of letrozole-induced polycystic ovarian syndrome: targeting PI3K/Akt signalling pathway, redox status and mitochondrial dysfunction in ovarian tissue.</article-title>
                    <source>

                        <italic toggle="yes">Redox Rep.</italic>
</source>
                    <year>2023</year>;<volume>28</volume>(<issue>1</issue>):<fpage>2160569</fpage>.
                    <pub-id pub-id-type="pmid">36661246</pub-id>
                    <pub-id pub-id-type="doi">10.1080/13510002.2022.2160569</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref19">
                <mixed-citation publication-type="book">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Reznick</surname>
                            <given-names>AZ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Packer</surname>
                            <given-names>L</given-names>
                        </name>
</person-group>:
                    <chapter-title>[38] Oxidative damage to proteins: spectrophotometric method for carbonyl assay.</chapter-title>
                    <source>

                        <italic toggle="yes">Methods in enzymology.</italic>
</source>
                    <publisher-name>Elsevier</publisher-name>;<year>1994</year>; Vol.<volume>233</volume>; pp.<fpage>357</fpage>&#x2013;<lpage>363</lpage>.</mixed-citation>
            </ref>
            <ref id="ref20">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ruiz-Romero</surname>
                            <given-names>GA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bern&#x00e1;ldez-Sarabia</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Orozco-Valdivia</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Antioxidant, Bioenergetic, and Metabolic Effects of Novel Mitochondria-Targeted Estrogens.</article-title>
                    <source>

                        <italic toggle="yes">J. Mol. Endocrinol.</italic>
</source>
                    <year>2025</year>;<volume>1</volume>(<issue>aop</issue>).</mixed-citation>
            </ref>
            <ref id="ref21">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Shahooth</surname>
                            <given-names>MA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ghazi</surname>
                            <given-names>MA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Abed</surname>
                            <given-names>SK</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The data raw of study of Methandienone and Selenium in rabbits.</article-title>
                    <source>

                        <italic toggle="yes">Zenodo.</italic>
</source>
                    <year>2025</year>.
                    <pub-id pub-id-type="doi">10.5281/zenodo.17897289</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref22">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Stallone</surname>
                            <given-names>JN</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Oloyo</surname>
                            <given-names>AK</given-names>
                        </name>
</person-group>:
                    <article-title>Cardiovascular and metabolic actions of the androgens: Is testosterone a Janus-faced molecule?</article-title>
                    <source>

                        <italic toggle="yes">Biochem. Pharmacol.</italic>
</source>
                    <year>2023</year>;<volume>208</volume>:<fpage>115347</fpage>.</mixed-citation>
            </ref>
            <ref id="ref23">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Stolwijk</surname>
                            <given-names>JM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Garje</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sieren</surname>
                            <given-names>JC</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Understanding the redox biology of selenium in the search of targeted cancer therapies.</article-title>
                    <source>

                        <italic toggle="yes">Antioxidants.</italic>
</source>
                    <year>2020</year>;<volume>9</volume>(<issue>5</issue>):<fpage>420</fpage>.</mixed-citation>
            </ref>
            <ref id="ref24">
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Underwood</surname>
                            <given-names>W</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Raymond</surname>
                            <given-names>A</given-names>
                        </name>
</person-group>:
                    <article-title>American Veterinary Medical Association AVMA Guidelines for the Euthanasia of Animals: 2020 Edition.</article-title>
                    <year>2013</year>.</mixed-citation>
            </ref>
            <ref id="ref25">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Yal&#x00e7;in</surname>
                            <given-names>AS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kilin&#x00e7;</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>C&#x00f6;bek</surname>
                            <given-names>B</given-names>
                        </name>
</person-group>:
                    <article-title>Evaluation of a simple colorimetric analysis for urinary malondialdehyde determination.</article-title>
                    <source>

                        <italic toggle="yes">Pathology and Laboratory Medicine International.</italic>
</source>
                    <year>2010</year>;<fpage>23</fpage>&#x2013;<lpage>26</lpage>.</mixed-citation>
            </ref>
            <ref id="ref26">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Zhang</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wei</surname>
                            <given-names>Y</given-names>
                        </name>
</person-group>:
                    <article-title>Selenium and selenoproteins in health.</article-title>
                    <source>

                        <italic toggle="yes">Biomolecules.</italic>
</source>
                    <year>2023</year>;<volume>13</volume>(<issue>5</issue>):<fpage>799</fpage>.</mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report453351">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.192385.r453351</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Pelton</surname>
                        <given-names>Luke M</given-names>
                    </name>
                    <xref ref-type="aff" rid="r453351a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-4954-854X</uri>
                </contrib>
                <aff id="r453351a1">
                    <label>1</label>Springfield College, Springfield, Massachusetts, USA</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>16</day>
                <month>2</month>
                <year>2026</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2026 Pelton LM</copyright-statement>
                <copyright-year>2026</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport453351" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.174480.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>reject</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>
                <bold>I had the privilege of being asked to provide an open review of the recently published &#x201c;Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of selenium.&#x201d; While I am greatly intrigued by the premise and purpose, I believe there are several crucial points that must be addressed before it is truly ready to add its findings to this area of research.&#x00a0;</bold>
            </p>
            <p> </p>
            <p> 
                <bold>In the Introduction, there is a noticeable jump from the background information of the Intro to the hypothesis. WHY is this investigation being conducted? Is there some crucial gap that exists in this previous area of research? Has anything similar been conducted previously? It seems as though your research group has actually conducted similar investigations in the brain (Abed et al. 2020). Why not present that as a recent relevant finding, and use that to pose the following: Although previous research has been conducted in brain tissues (Abed et al. 2020), there have been no such investigations in the subspinal reproductive centers. Therefore, the purpose of this study is to&#x2026;&#x201d;</bold>
            </p>
            <p> </p>
            <p> 
                <bold>In the Methods: there are several elements which gravely threaten the internal validity of this investigation. Firstly, it should be indicated whether all rabbits were the same breed/genetic strain. I am assuming this is the case, but requires clarification as any preexisting between-group differences at baseline must be accounted for. To that point: I am not seeing any indication that baseline data was gathered before the supplementation protocol. If this data was not gathered, it is a fatal threat to internal validity, as there is no accounting for whether the between-groups differences were actually a result of the protocol, or due to the aforementioned preexisting group differences.&#x00a0;</bold>
            </p>
            <p> </p>
            <p> 
                <bold>Finally, the use of Black Dragon Pharma: based on the name and a Google search, this seems like a UG lab (i.e. a black market trader of non-regulated AAS and PEDs) and not a reputable pharmaceutical provider. Was there any 3rd party testing conducted on this to even determine if the dosing of the compound was accurate? This is also a potentially fatal threat to the internal validity of this investigation, as it severely limits whether we can claim that the changes in groups are due to the protocol.&#x00a0;</bold>
            </p>
            <p> </p>
            <p> 
                <bold>Additionally, for the benefit of the authors, I have provided minor feedback which pertains mostly to writing style, organization, etc., and should be relatively simple for the authors to address.</bold>
            </p>
            <p> </p>
            <p> 
                <bold>Intro:&#x00a0;</bold> 
                <list list-type="order">
                    <list-item>
                        <p>
                            <bold>I would like to see a supporting citation for sentence 1</bold>
                        </p>
                    </list-item>
                    <list-item>
                        <p>
                            <bold>After introducing the acronymic abbreviation AAS&lt; use that for all instances going forward (i.e. sentence 2)</bold>
                        </p>
                    </list-item>
                    <list-item>
                        <p>
                            <bold>&#x201c;Senile osteoporosis&#x201d;: is this meant to be &#x201c;geriatric&#x201d;? Senile implies psychological/cognitive status</bold>
                        </p>
                    </list-item>
                    <list-item>
                        <p>
                            <bold>Sentence 3: this structure needs revision; the second phrase could better read &#x201c;...as well as their masculinizing effects&#x2026;&#x201d; &#x201c;Anabolic properties&#x201d; and &#x201c;anabolic impacts" are redundant and repetitive.&#x00a0;</bold>
                        </p>
                    </list-item>
                    <list-item>
                        <p>
                            <bold>Should be written &#x201c;...number of adverse psychological and biochemical reactions&#x2026;&#x201d;</bold>
                        </p>
                    </list-item>
                    <list-item>
                        <p>
                            <bold>Second paragraph: clarify what C19 is or the read (and then use C19 throughout)</bold>
                        </p>
                    </list-item>
                    <list-item>
                        <p>
                            <bold>&#x201c;Elevated androgen levels are also strongly associated with follicular cystic&#x2026;&#x201d; What is meant by &#x201c;follicular cystic&#x201d;? Should this be &#x201c;follicular cysts&#x201d;?</bold>
                        </p>
                    </list-item>
                    <list-item>
                        <p>
                            <bold>Third paragraph: should start by saying &#x201c;The AAS methandienone&#x2026;&#x201d;</bold>
                        </p>
                    </list-item>
                    <list-item>
                        <p>
                            <bold>Fourth paragraph: to facilitate a better transition to this point from the previous topic, I would revise this opening point sentence: &#x201c;A compound which plays a central role in maintaining the balance of redox and preserving mitochondrial integrity in the body is selenium (Se), a basic micronutrient&#x2026;&#x201d;</bold>
                        </p>
                    </list-item>
                </list> </p>
            <p> 
                <bold>Results:</bold> 
                <list list-type="order">
                    <list-item>
                        <p>
                            <bold>LSD: If this is Fisher&#x2019;s LSD as used as a post hoc analysis following the ANOVA, I would urge caution in its use and extrapolation. Fisher&#x2019;s LSD is often likely to return a false positive via hyperinflation of alpha in its multiple comparisons. I would suggest using Tukey&#x2019;s post hoc, as it is a more conservative measure (particularly given the lack of robust supporting research provided in the introduction as to provide rationale for the expected direction of change/difference; this, compounded with the previously mentioned concerns regarding the AAS dosing, present an additional threat to internal validity). I ran the analysis on my own with the raw data set you kindly provided, and found that your findings would be maintained with the use of Tukey&#x2019;s post hoc.&#x00a0;</bold>
                        </p>
                    </list-item>
                    <list-item>
                        <p>
                            <bold>When stating statistically significant findings: there must be some indication of the exact p value. Saying &#x201c;p &lt; 0.05&#x201d; is not enough, firstly as the threshold is &#x201c;p &#x2264; 0.05,&#x201d; and secondly as it is not indicated on the table anywhere. To that point, the use of capital letters to indicate significant differences is unwieldy and confusing. Please consider using this entire point of feedback to present the group differences in a way that both clarifies your presentation of the data and makes it more easily understood by the reader.&#x00a0;</bold>
                        </p>
                    </list-item>
                </list> </p>
            <p> 
                <bold>Discussion</bold> 
                <list list-type="order">
                    <list-item>
                        <p>
                            <bold>Throughout the discussion: be careful when using words like &#x201c;indicates,&#x201d; as they carry with them a weight of finality. Simply including the phrase &#x201c;may indicate&#x201d; presents your findings in a more conservative manner appropriate for conveying the findings of a single investigation.&#x00a0;&#x00a0;</bold>
                        </p>
                    </list-item>
                    <list-item>
                        <p>
                            <bold>Paragraph 2: this is the first introduction of the Nrf2 pathway. I recommend clarifying what that is for the reader, and how it relates to the current investigation.&#x00a0;</bold>
                        </p>
                    </list-item>
                    <list-item>
                        <p>
                            <bold>Paragraph 3: the final sentence of this paragraph is an incomplete thought.&#x00a0;</bold>
                        </p>
                    </list-item>
                </list>
            </p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Partly</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>No</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Partly</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Partly</p>
            <p>Reviewer Expertise:</p>
            <p>Exercise physiology, reproductive endocrinology, anabolic-androgenic steroids</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.</p>
        </body>
        <sub-article article-type="response" id="comment15541-453351">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Abed</surname>
                            <given-names>Sabea</given-names>
                        </name>
                        <aff>veterinary medicine, University of Fallujah, Al-Fallujah, Al Anbar Governorate, Iraq</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>The authors declare that they have no competing interests.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>25</day>
                    <month>2</month>
                    <year>2026</year>
                </pub-date>
            </front-stub>
            <body>
                <p>Dear&#x00a0; Reviewers,</p>
                <p> </p>
                <p> We sincerely thank the reviewers for their valuable time, effort, and insightful comments on our manuscript titled: 
                    <italic>&#x201c;Effects of Methandienone on the ovaries of rabbits in relation to the aromatase gene (CYP19A1) and oxidative markers and the possible protective role of selenium.&#x201d;</italic>
                </p>
                <p> </p>
                <p> In response, we have carefully revised the manuscript and addressed all points raised:</p>
                <p> </p>
                <p> 
                    <bold>Paragraph 1</bold>: In response, we revised the Introduction to incorporate our previous findings in brain tissues (Abed et al., 2020) and clarified that no similar investigations have been conducted in the subspinal reproductive centers. This revision clearly defines the research gap and the objective of the present study.</p>
                <p> </p>
                <p> 
                    <bold>Paragraph 2:</bold> All rabbits used in this study were of the same breed and genetic background and were obtained from the Cancer Research Center, Baghdad. The animals were age- and weight-matched prior to the start of the experiment. In addition, rabbits were randomly assigned to the experimental groups to minimize potential preexisting differences between groups. The study was designed as a randomized controlled post-test experimental model; therefore, baseline measurements were not collected prior to the supplementation protocol. The inclusion of a control group together with random allocation ensures group comparability at the beginning of the experiment and allows the observed differences to be attributed to the intervention. These methodological clarifications have now been added to the Methods section</p>
                <p> </p>
                <p> 
                    <bold>Paragraph 3:</bold>The methandienone used in this study was obtained from a commercial supplement provider (Gym Center Supplements) as part of the doctoral research project. To ensure accuracy and consistency, the compound was analyzed for purity in the Department of Analytics at the Veterinary Directorate. All experimental groups received the same verified preparation under controlled conditions.</p>
                <p> </p>
                <p> 
                    <bold>Introduction</bold> 
                    <list list-type="order">
                        <list-item>
                            <p>Added a supporting citation for the first sentence.</p>
                        </list-item>
                        <list-item>
                            <p>Introduced the acronym &#x201c;AAS&#x201d; and used it consistently throughout the text.</p>
                        </list-item>
                        <list-item>
                            <p>Replaced &#x201c;senile osteoporosis&#x201d; with &#x201c;geriatric osteoporosis&#x201d; for accuracy.</p>
                        </list-item>
                        <list-item>
                            <p>Revised sentence 3 to read &#x201c;&#x2026;as well as their masculinizing effects&#x2026;&#x201d; and removed redundant references to &#x201c;anabolic properties.&#x201d;</p>
                        </list-item>
                        <list-item>
                            <p>Corrected phrasing to &#x201c;&#x2026;number of adverse psychological and biochemical reactions&#x2026;&#x201d;</p>
                        </list-item>
                        <list-item>
                            <p>Clarified the meaning of C19 and used it consistently throughout the paragraph.</p>
                        </list-item>
                        <list-item>
                            <p>Replaced &#x201c;follicular cystic&#x201d; with &#x201c;follicular cysts&#x201d; for precision.</p>
                        </list-item>
                        <list-item>
                            <p>Revised the third paragraph to begin with &#x201c;The AAS methandienone&#x2026;&#x201d;</p>
                        </list-item>
                        <list-item>
                            <p>Improved the opening sentence of the fourth paragraph to enhance transition, now reading: &#x201c;A compound which plays a central role in maintaining the balance of redox and preserving mitochondrial integrity in the body is selenium (Se), a basic micronutrient&#x2026;&#x201d;</p>
                        </list-item>
                    </list> </p>
                <p> 
                    <bold>Results:</bold>
                </p>
                <p> </p>
                <p> 1- Following the reviewer&#x2019;s suggestion, we have replaced Fisher&#x2019;s LSD post hoc analysis with Tukey&#x2019;s post hoc test to provide a more conservative assessment of group differences and reduce the risk of false positives. Re-analysis confirmed that the original findings are maintained with Tukey&#x2019;s test. This change has been updated in both the Results section and corresponding tables.</p>
                <p> </p>
                <p> 2- We have revised the presentation of statistically significant findings to include exact p-values for all comparisons (p &#x2264; 0.05), replacing the use of capital letters in the tables. Group differences are now presented in a clearer and more reader-friendly format, enhancing transparency and interpretability.</p>
                <p> </p>
                <p> 
                    <bold>Discussion</bold>
                </p>
                <p> </p>
                <p> 1- We have revised the language throughout the Discussion to use more conservative phrasing, replacing terms such as &#x201c;indicates&#x201d; with &#x201c;may indicate&#x201d; to appropriately reflect the findings of a single investigation.</p>
                <p> </p>
                <p> 2- The Nrf2 pathway is now clearly introduced and explained in paragraph 2, including its relevance to oxidative stress and the current study&#x2019;s objectives.</p>
                <p> </p>
                <p> 3- The final sentence of paragraph 3 has been corrected to complete the thought and improve clarity.</p>
                <p> </p>
                <p> 
                    <bold>Finally</bold>, we sincerely thank the reviewer for their time, effort, and valuable feedback on our manuscript. Your thorough evaluation and constructive suggestions have significantly enhanced the clarity, rigor, and overall quality of our work. We have learned a great deal from your comments, which have not only improved this study but also enriched our expertise in best practices for scientific writing and research presentation.</p>
                <p> Thank you for your consideration.&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0; &#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;Sincerely</p>
                <p> Sabea Khamees Abed</p>
            </body>
        </sub-article>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report453353">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.192385.r453353</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Al-Ghareebawi</surname>
                        <given-names>Aamir Maqtoof Abed</given-names>
                    </name>
                    <xref ref-type="aff" rid="r453353a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-1637-8089</uri>
                </contrib>
                <aff id="r453353a1">
                    <label>1</label>University of Al-Shatrah, Thi-Qar, Iraq</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>2</day>
                <month>2</month>
                <year>2026</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2026 Al-Ghareebawi AMA</copyright-statement>
                <copyright-year>2026</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport453353" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.174480.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>Thank you for the opportunity to review this submission. A paper submitted to the Journal is reviewed to determine whether the paper is suitable for indexing. In the review process, the originality, technical quality, and impact of the research work are critically evaluated. According to above, the article is suitable to indexing.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Yes</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Animal Physiology</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
</article>
