<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.173833.2</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>In-house designed Multiplex Real-Time PCR Assay Developed for Epstein - Barr virus and Cytomegalovirus DNA detection in Pooled Blood Samples from Iraqi blood donors</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 2; peer review: 2 approved]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Majid</surname>
                        <given-names>Ghinwa S.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <uri content-type="orcid">https://orcid.org/0000-0003-0879-7512</uri>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Abdulamir</surname>
                        <given-names>Ahmed S.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Aufi</surname>
                        <given-names>Iman M.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Software</role>
                    <xref ref-type="aff" rid="a3">3</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Biology, Alnahrain University, College of sciences, Baghdad, 10001, Iraq</aff>
                <aff id="a2">
                    <label>2</label>College of Medicine, Al-Nahrain University, Baghdad, Iraq</aff>
                <aff id="a3">
                    <label>3</label>Central Public Health Laboratory, Baghdad, Iraq</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:ghinwa.sattar@nahrainuniv.edu.iq">ghinwa.sattar@nahrainuniv.edu.iq</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>25</day>
                <month>6</month>
                <year>2026</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2026</year>
            </pub-date>
            <volume>15</volume>
            <elocation-id>360</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>16</day>
                    <month>6</month>
                    <year>2026</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2026 Majid GS et al.</copyright-statement>
                <copyright-year>2026</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/15-360/pdf"/>
            <abstract>
                <sec>
                    <title>Background</title>
                    <p>The problem of transmissible human herpesvirus infections through blood donation has not been completely resolved by serological testing due to issues such as delayed in seroconversion or false-negative results. This study aimed to develop a cost-effective, In-house designed multiplex real-time PCR assay for the simultaneous detection of Epstein&#x2013;Barr virus (EBV) and cytomegalovirus (CMV) DNA in pooled blood donor samples.</p>
                </sec>
                <sec>
                    <title>Methods</title>
                    <p>A total of 1000 whole-blood samples were collected from apparently healthy Iraqi blood donors and pooled into mini pools 10(MP10) i.e. 100 MP10 tested by a commercial CMV and EBV multiplex- qPCR detection kit; then retested by In-house designed multiplex qPCR. Fifteen patients who were positive for CMV and fifteen for EBV were considered as positive groups and fifteen healthy individuals as negative groups used to estimate the validity and feasibility of the In-house designed kit.</p>
                </sec>
                <sec>
                    <title>Results</title>
                    <p>Blood donors who tested by the commercial kit were 42% MP10 positive for EBV and 4% positive for CMV while the In-house designed multiplex qPCR results were 40% and 6% for EBV and CMV, respectively. The specificity and sensitivity of the In-house designed kit for the detection of CMV were 97.92% (95% CI 92.6 to 99.7), 100% (95% CI 39.7 to 100), for EBV were 100% (95% CI 93.84 to100.00) and 95.24 % (95% CI 83.84 to 99.42), respectively.</p>
                </sec>
                <sec>
                    <title>Conclusion</title>
                    <p>The rate of EBV was high within Iraqi blood donors while the CMV was moderately low and the In-house designed multiplex qPCR was sensitive and specific for CMV and EBV DNA detection at a much lower cost than that of the commercial, about 10% of the commercial cost. Such a cost-effective and sensitive test is crucial in reducing blood transfusion-associated diseases.</p>
                </sec>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>CMV</kwd>
                <kwd>EBV</kwd>
                <kwd>multiplex PCR</kwd>
                <kwd>blood donors</kwd>
                <kwd>cost-effectiveness</kwd>
                <kwd>blood transfusion. viral detection</kwd>
                <kwd>In-house designed</kwd>
            </kwd-group>
            <funding-group>
                <funding-statement>The author(s) declared that no grants were involved in supporting this work.</funding-statement>
            </funding-group>
        </article-meta>
        <notes>
            <sec sec-type="version-changes">
                <label>Revised</label>
                <title>Amendments from Version 1</title>
                <p>This version has been revised in response to the reviewers&#x2019; comments and suggestions. 
                    <bold>The corrections were:</bold> 1-corrected spelling errors in affiliation, the word univercity to university 2- corrected spelling errors within introduction, the word analysing to analyzing. 3-Added reference related to commercially available assay (Sacace Biotechnologies/EBV/HHV6 Quant Real-TM Handbook) as a response to reviewers&#x2019; notifications. 4- corrected spelling errors in materials and methods within study population section, the word pateints to patients. 5-clarifications were added within materials and methods in samples, control and pooling of samples section. The paragraph was added at the beginning of section to clarify the validation process of pooling, it was: 
                    <bold>samples, control and pooling of samples:</bold> &#x201c;Sets of pooled whole blood samples prepared for validation consisting of 5,10 and 15 samples, they were containing one CMV-positive whole-blood sample and one EBV-positive whole-blood sample, while the rest of pooled samples were negative for both viruses. The results revealed that the 5-sample and 10-sample pools yielded promising outcomes, whereas the 15-sample pool did not&#x201d; as a response to reviewers&#x2019; recommendations. 6- clarifications were added within materials and methods in samples, control and pooling of samples section. 7-corrected the PCR topography within materials and methods in DNA amplification section from 40 min to 40 sec. 8- spelling errors were corrected within the discussion, the word utilized to utilized. 9- A new reference has been added as reference 24 and therefore all subsequent references have been renumbered accordingly (25&#x2013;31). 10- All references were checked and corrected as appropriate.</p>
            </sec>
        </notes>
    </front>
    <body>
        <sec id="sec5" sec-type="intro">
            <title>Introduction</title>
            <p>Therapy through blood transfusion is still considered one of the safest and most effective methods for managing cases with significant morbidity or mortality, and it is widely used in medicine, particularly for haematological and other systemic diseases (
                <xref ref-type="bibr" rid="ref3">Busch 
                    <italic toggle="yes">et al.</italic>, 2019</xref>). However, transfusion-transmissible infections remain among the most serious problems associated with blood transfusion (
                <xref ref-type="bibr" rid="ref20">Mengjiao 
                    <italic toggle="yes">et al</italic>., 2024</xref>). Epstein&#x2013;Barr virus (EBV) and cytomegalovirus (CMV) are human herpesviruses that establish lifelong latency. They can compromise the safety of blood transfusion, particularly in immunocompromised patients, and are among the most common infectious agents linked to post-transfusion complications, especially in solid organ transplant recipients with a high risk of opportunistic infections (
                <xref ref-type="bibr" rid="ref2">Bunchorntavakul &amp; Reddy, 2020</xref>; 
                <xref ref-type="bibr" rid="ref27">Wada 
                    <italic toggle="yes">et al</italic>., 2007</xref>). Other high-risk groups include seronegative recipients of bone marrow transplants, seronegative patients with haematological malignancies, pregnant women, and premature infants born to seronegative mothers (
                <xref ref-type="bibr" rid="ref6">de Melo Silva 
                    <italic toggle="yes">et al.</italic>, 2020</xref>).</p>
            <p>Therefore, qualitative or quantitative detection of these viruses could help prevent diseases or complications arising from the transfusion of blood containing reactivated or recently acquired EBV or CMV infections (
                <xref ref-type="bibr" rid="ref10">Gunson 
                    <italic toggle="yes">et al</italic>., 2009</xref>). The implementation of multiplex PCR assays enables rapid and precise detection of viral infections through nucleic acid amplification techniques (NAT). This approach offers a convenient, time-efficient, and cost-effective screening tool for both clinical and research laboratories (
                <xref ref-type="bibr" rid="ref16">Luzius 
                    <italic toggle="yes">et al</italic>., 2025</xref>; 
                <xref ref-type="bibr" rid="ref19">Markoulatos 
                    <italic toggle="yes">et al.</italic>, 2002</xref>). Furthermore, the use of pooled samples in multiplex PCR assays has proven highly efficient in reducing testing costs (
                <xref ref-type="bibr" rid="ref9">Grobe 
                    <italic toggle="yes">et al</italic>., 2021</xref>; 
                <xref ref-type="bibr" rid="ref25">Smatti 
                    <italic toggle="yes">et al.</italic>, 2017</xref>; 
                <xref ref-type="bibr" rid="ref29">Yamkasem 
                    <italic toggle="yes">et al.</italic>, 2025</xref>). Detection of EBV and CMV in whole blood has been shown to be more sensitive, as the DNA levels of them are generally higher in whole blood samples from the same patient (
                <xref ref-type="bibr" rid="ref8">Fukuda 
                    <italic toggle="yes">et al</italic>., 2024</xref>; 
                <xref ref-type="bibr" rid="ref22">Rzepka 
                    <italic toggle="yes">et al</italic>., 2022</xref>). Traditionally, EBV and CMV reactivation has been diagnosed using serological methods; however, serological tests are less accurate and may yield false-negative results due to their inability to detect viral antigens or antibodies in samples with low viral loads, particularly in newly infected or immunosuppressed individuals (
                <xref ref-type="bibr" rid="ref21">Nemr &amp; Nashwa, 2024</xref>; 
                <xref ref-type="bibr" rid="ref25">Smatti 

                    <italic toggle="yes">et al.,
</italic> 2017</xref>). To the best of our knowledge, no previous studies have investigated circulating EBV and CMV DNA levels in the blood of Iraqi blood donors using whole blood samples. Therefore, this study aimed to estimate the prevalence of EBV and CMV DNA among apparently healthy Iraqi blood donors by analyzing pooled whole blood samples using a multiplex qPCR assay. Moreover, it sought to develop a cost-effective, In-house designed multiplex qPCR kit for detecting EBV and CMV DNA in blood donors and to compare the performance of this In-house kit with that of a commercially available assay targeting the same viruses (
                <xref ref-type="bibr" rid="ref31">Sacace Biotechnologies, 2016</xref>).
</p>
        </sec>
        <sec id="sec6">
            <title>Materials and methods</title>
            <sec id="sec7">
                <title>Study population</title>
                <p>A developmental cross-sectional study was designed for a total of one thousand healthy Iraqi blood donors who donated blood through the National Iraqi Blood Bank in Baghdad City from July 2018 to January 2019, and all of them were seronegative for HBV, HCV, and HIV according to the routine screening tests conducted for viral detection within the Iraqi Blood Bank. This study was implemented in accordance with the Declaration of Helsinki (
                    <ext-link ext-link-type="uri" xlink:href="https://www.wma.net/policies-post/wmadeclaration-of-helsinki">https://www.wma.net/policies-post/wmadeclaration-of-helsinki</ext-link>). Ethical approval was obtained from the Iraqi Ministry of Health/national center for training and human development No. 1009 in 24/6/2018 and from Institutional Review committee (IRB) in College of Medicine-university of AlNahrain No. 577 in 16/4/2018 to get this approval. All patients and blood donors provided written informed consent before participation. The consent process included a detailed explanation of the study objectives, the sample collection procedures, and the potential risks and benefits. Participants were informed that their data would remain confidential and anonymized. Written consent forms were signed by each participant and archived according to institutional requirements.
</p>
            </sec>
            <sec id="sec8">
                <title>Samples, controls and pooling of samples</title>
                <p>Sets of pooled whole blood samples prepared for validation consisting of 5, 10 and 15 samples, they were containing one CMV-positive whole-blood sample and one EBV-positive whole-blood sample, while the rest of pooled samples were negative for both viruses. The results revealed that the 5-sample and 10-sample pools yielded promising outcomes, whereas the 15-sample pool did not.</p>
                <p>About 150 &#x03bc;l was pipetted from each of ten whole blood samples (individual samples) and then mixed, i.e., pooled into one set of 10 samples with a total volume of 1.5 ml of pooled whole blood, thereby reducing the number of samples to 100 mini-pooled (MP10) whole blood samples from blood donors. A positive control was also included, consisting of fourteen patients confirmed to have CMV infection through serology (IgM+) and nucleic acid tests (NAT), or NAT tests only, and thirteen patients confirmed to have EBV infection through serology using viral capsid antigen (VCA IgM+) and NAT, or NAT tests only. Furthermore, a negative control group of fifteen whole blood samples from healthy individuals was included as negative controls for CMV and EBV, based on NAT test results only.</p>
                <p>Then all samples were stored frozen at &#x2212;80 &#x00b0;C, in accordance with the manufacturer&#x2019;s instructions, until processing.
</p>
            </sec>
            <sec id="sec9">
                <title>DNA extraction and amplification by commercial kit</title>
                <p>DNA extraction of the viruses was done from 200 &#x03bc;l MP10 whole blood of blood donors, positive and negative control groups by QIAamp
                    <sup>&#x00ae;</sup> DNA Mini and Blood Mini 250 (Lot no. 151043756 Qiagen/Germany). Then, eluted DNA samples were stored at &#x2212;20&#x00b0;C. CMV/EBV/HHV6 Quant Real-TM kit (Lot no. 27H181705 sacace/Italy) was used for the detection and differentiation of Cytomegalovirus (CMV) and Epstein Barr Virus (EBV) simultaneously by multiplex qualitative Real-time PCR using 10 &#x03bc;l of extracted DNA as manufacturer&#x2019;s instructions.
</p>
            </sec>
            <sec id="sec10">
                <title>Development of In-house designed multiplex qPCR</title>
                <p>Primers and Taqman probes were designed based on conserved regions of the genome for each virus, CMV DNA polymerase gene or UL54 (152pb) and EBV DNA polymerase gene (150pb), and B-actin gene used as an internal control. These were retrieved from Genbank from NCBI (
                    <ext-link ext-link-type="uri" xlink:href="http://www.ncbi.nlm.nih.gov">www.ncbi.nlm.nih.gov</ext-link>), then the primer and probes were designed for these genes in NCBI (
                    <ext-link ext-link-type="uri" xlink:href="http://www.ncbi.nlm.nih.blast">www.ncbi.nlm.nih.blast</ext-link>). Different fluorochromes were used for Taq-man probe labeling, the EBV probe was labeled with Rox fluorescent dye at the 5&#x2032; and quenched with Black-Hole-Quencher2 at the 
                    <bold>3&#x2032;</bold> (BHQ2); while CMV probe was labeled with FAM fluorescent dye and quenched with BHQ1 (
                    <xref ref-type="table" rid="T1">
Table 1</xref>). After that to check the specificity of designed primers and probes for target genes, they were queried against the GenBank nucleotide database using BLASTN. All primers and probes were manufactured by IDT company.
                    <table-wrap id="T1" orientation="portrait" position="float">
                        <label>
Table 1. </label>
                        <caption>
                            <title>In-house designed primers and Taq-man probes.</title>
                        </caption>
                        <table content-type="article-table" frame="hsides">
                            <thead>
                                <tr>
                                    <th align="left" colspan="1" rowspan="1" valign="top">VIRUS NAME</th>
                                    <th align="left" colspan="1" rowspan="1" valign="top"/>
                                </tr>
                            </thead>
                            <tbody>
                                <tr>
                                    <td align="left" colspan="1" rowspan="1" valign="top">CMV-F
</td>
                                    <td align="left" colspan="1" rowspan="1" valign="top">5-ACTGTAGCCGTGTTCTGTG-3</td>
                                </tr>
                                <tr>
                                    <td align="left" colspan="1" rowspan="1" valign="top">CMV-R
</td>
                                    <td align="left" colspan="1" rowspan="1" valign="top">5-CACCTACGATCAGACGGACG-3</td>
                                </tr>
                                <tr>
                                    <td align="left" colspan="1" rowspan="1" valign="top">CMV-Probe
</td>
                                    <td align="left" colspan="1" rowspan="1" valign="top">FAM"TGACGATAGCGCGGCGACAC"BHQ1</td>
                                </tr>
                                <tr>
                                    <td align="left" colspan="1" rowspan="1" valign="top">EBV-F
</td>
                                    <td align="left" colspan="1" rowspan="1" valign="top">5"GAAAAGCAGAGCTCCCCCA"3</td>
                                </tr>
                                <tr>
                                    <td align="left" colspan="1" rowspan="1" valign="top">EBV-R
</td>
                                    <td align="left" colspan="1" rowspan="1" valign="top">5-CGGCCCTTCCAAGAGTCATT-3</td>
                                </tr>
                                <tr>
                                    <td align="left" colspan="1" rowspan="1" valign="top">EBV-Probe
</td>
                                    <td align="left" colspan="1" rowspan="1" valign="top">Rox"GGGGACCCTGCCTTCACGGA"BHQ2</td>
                                </tr>
                                <tr>
                                    <td align="left" colspan="1" rowspan="1" valign="top">B-actin-F</td>
                                    <td align="left" colspan="1" rowspan="1" valign="top">CGTGCTCGATGGGGTACTTC</td>
                                </tr>
                                <tr>
                                    <td align="left" colspan="1" rowspan="1" valign="top">B-actin-R</td>
                                    <td align="left" colspan="1" rowspan="1" valign="top">GCTCAGGGCTTCTTGTCCTTT</td>
                                </tr>
                                <tr>
                                    <td align="left" colspan="1" rowspan="1" valign="top">B-actin-probe</td>
                                    <td align="left" colspan="1" rowspan="1" valign="top">HEX-TGGGCCTCGTCGCCCACATA-BHQ1</td>
                                </tr>
                            </tbody>
                        </table>
                        <table-wrap-foot>
                            <p>CMV, Cytomegalo viruse; EBV, Epstein Bar viruse.</p>
                        </table-wrap-foot>
                    </table-wrap>
</p>
            </sec>
            <sec id="sec11">
                <title>DNA amplification</title>
                <p>Gradient PCR was performed and 63&#x00b0;C was chosen as a suitable annealing temperature for multiplex PCR reaction. Then DNA from two positive whole blood samples for CMV and EBV was mixed, and the 20 &#x03bc;l qPCR reaction was prepared by adding 10 &#x03bc;l of GoTaq
                    <sup>&#x00ae;</sup> probe qPCR Master Mixes (Promega/USA), 0.5 &#x03bc;l of 10 &#x03bc;m primers mix, 0.5 &#x03bc;l of 10 &#x03bc;m probes mix, 0.3 &#x03bc;l of extracted human DNA, 0.7 &#x03bc;l of free nuclease DW and 8 &#x03bc;l of DNA template were added. The qPCR reactions were loaded in MicroAmpR fast Reaction tubes (8 tubes/strips) (Appliedbiosystem/USA) and placed in a Real-time fast 7500 thermocycler (Appliedbiosystem/USA). The thermoprofile of the multiplex PCR reaction was 1 cycle 2 mins at 95&#x00b0;C, 40 cycles for 10 secs at 95&#x00b0;C, 40 secs at 63&#x00b0;C, 15 sec at 72&#x00b0;C, and 1 cycle for 1 min at 72&#x00b0;C.</p>
            </sec>
            <sec id="sec12">
                <title>Primer efficiency and determination the detection limit</title>
                <p>Tenfold serial dilution was done through human negative whole blood and the viral concentration spanning (10
                    <sup>3</sup>, 10
                    <sup>2</sup>, 10) copies/10
                    <sup>5</sup> cells, and then tested in triplicate. The standard curves were plotted resulting from Ct value versus log of viral copy numbers.</p>
            </sec>
            <sec id="sec13">
                <title>Statistical analysis</title>
                <p>SPSS version 16.0.0, Microsoft Excel 2010, and GraphPad Prism version 7.04 were used for data processing. The Student&#x2019;s 
                    <italic toggle="yes">t</italic>-test and ANOVA were applied for parametric data, while the Mann&#x2013;Whitney test was used for non-parametric data to determine the significance of differences in means, taking into account whether the variables under analysis shared equal or different variances. In the current study, the coefficient of variation (CV) defined as the standard deviation divided by the mean and multiplied by 100 was used to obtain a percentage. For intra-assay CV, the average CV across all replicates of a single sample within one assay run was calculated, followed by calculating the overall average of these CVs. Conversely, for inter-assay CV, the mean of each sample across multiple runs was calculated, and the CVs derived from these means were then averaged.</p>
            </sec>
        </sec>
        <sec id="sec14" sec-type="results">
            <title>Results</title>
            <sec id="sec15">
                <title>1- Amplification of commercial NAT kit</title>
                <p>The results of the commercial NAT assay using multiplex Real-Time qPCR revealed that 4 out of 100 (4%) mini-pools of whole blood were CMV-positive, while 42 out of 100 (42%) mini-pools were EBV-positive among Iraqi blood donors (
                    <xref ref-type="fig" rid="f1">
Figure 1</xref>). NAT-positive pools were resolved by testing the individual donor samples using multiplex real-time PCR. The positive pools demonstrated that each EBV-positive MP10 contained, on average, three positive individual samples (i.e., out of 10 samples were positive for EBV), whereas each CMV-positive MP10 included one individual positive sample. In addition, two mini-pools tested positive for both EBV and CMV.</p>
                <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                    <label>
Figure 1. </label>
                    <caption>
                        <title>Bar chart showing the proportion of MP10-positive whole blood samples testing positive for EBV and CMV using the commercial multiplex qPCR kit.</title>
                        <p>The EBV-positive rate reached (42%), whereas CMV showed a lower positivity rate of (4%).</p>
                    </caption>
                    <graphic id="gr1" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/201804/a0c1dd15-700e-40b0-a911-ed2b37b4e0c6_figure1.gif"/>
                </fig>
            </sec>
            <sec id="sec16">
                <title>2- The In-house designed multiplex qPCR</title>
                <p>The positive and negative controls used for the estimation of the validity and feasibility of In-house designed multiplex qPCR are shown in 
                    <xref ref-type="fig" rid="f2">Figure 2</xref>
                    <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                        <label>
Figure 2. </label>
                        <caption>
                            <title>Amplification curves of multiplex qPCR showing simultaneous detection of CMV, EBV, and the internal control (IC).</title>
                            <p>The CMV target is represented by the green curve, the EBV target by the orange curve, and the IC by the yellow curve. Both viral targets, along with the internal control DNA, were successfully amplified within the same reaction mixture, confirming assay specificity and proper reaction performance.</p>
                        </caption>
                        <graphic id="gr2" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/201804/a0c1dd15-700e-40b0-a911-ed2b37b4e0c6_figure2.gif"/>
                    </fig>
.</p>
                <p>

                    <bold>Primers efficiency and limit of detection (LOD)</bold>
                </p>
                <p>The viral load of CMV- and EBV-positive whole blood samples (10
                    <sup>3</sup> copies/10
                    <sup>5</sup> cells) was used to determine the detection limit of the In-house-designed primers and probes for CMV and EBV. Tenfold serial dilutions were prepared in human CMV/EBV-negative whole blood, with concentrations of 10
                    <sup>3</sup>, 10
                    <sup>2</sup>, and 10
                    <sup>1</sup> copies per 10
                    <sup>5</sup> cells. Triplicates of each dilution were tested using the In-house-designed multiplex qPCR. The results revealed that the amplification efficiency for CMV and EBV PCR assays was 110% and 100%, respectively, as shown in 
                    <xref ref-type="fig" rid="f3">
Figures 3</xref> and 
                    <xref ref-type="fig" rid="f4">4</xref>. The limit of detection (LOD) is presented in 
                    <xref ref-type="table" rid="T2">
Tables 2</xref> and 
                    <xref ref-type="table" rid="T3">3</xref>.</p>
                <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                    <label>
Figure 3. </label>
                    <caption>
                        <title>Standard curve generated from serial dilutions of a single CMV-positive sample.</title>
                        <p>The curve shows the linear relationship between the log of the template concentration and the corresponding Ct values, with a regression equation of y = &#x2212;2.9x+41.7, and a coefficient of determination R
                            <sup>2</sup> = 0.9964. The calculated amplification efficiency for CMV was 110%.</p>
                    </caption>
                    <graphic id="gr3" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/201804/a0c1dd15-700e-40b0-a911-ed2b37b4e0c6_figure3.gif"/>
                </fig>
                <fig fig-type="figure" id="f4" orientation="portrait" position="float">
                    <label>
Figure 4. </label>
                    <caption>
                        <title>
Standard curve derived from serial dilutions of the positive EBV sample, illustrating the linear correlation between the logarithm of template concentration and the corresponding Ct values.</title>
                        <p>The regression equation was y =&#x2212;2.35x+41.267, with a coefficient of determination R
                            <sup>2</sup> = 0.9998, indicating excellent linearity of the assay. The amplification efficiency calculated from the slope was 100% consistent with optimal qPCR performance.</p>
                    </caption>
                    <graphic id="gr4" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/201804/a0c1dd15-700e-40b0-a911-ed2b37b4e0c6_figure4.gif"/>
                </fig>
                <table-wrap id="T2" orientation="portrait" position="float">
                    <label>
Table 2. </label>
                    <caption>
                        <title>Limit of detection (LOD) of EBV DNA by In-house designed multiplex qPCR.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">EBV LOD (one target)</th>
                                <th align="left" colspan="3" rowspan="1" valign="top">CT values</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">TRIPLICATE 1000 copies/10
                                    <sup>5</sup> CELLS</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">33.6</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">34</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">34.1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">TRIPLICATE 100 copies/10
                                    <sup>5</sup> CELLS</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">36.9</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">36</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">36.3</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">TRIPLICATE 10 copies/10
                                    <sup>5</sup> CELLS</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">38.5</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">38.9</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">38.3</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="4" rowspan="1" valign="top">EBV 
                                    <bold>LOD =10</bold> copies/10
                                    <sup>5</sup> CELLS, 
                                    <bold>CT value ranged (33-39)&#x00b1; 2</bold>
</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <table-wrap id="T3" orientation="portrait" position="float">
                    <label>
Table 3. </label>
                    <caption>
                        <title>Limit of detection (LOD) of CMV by In-house designed multiplex qPCR.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">CMV LOD (one target)</th>
                                <th align="left" colspan="3" rowspan="1" valign="top">CT values</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">TRIPLICATE 1000 copies/10
                                    <sup>5</sup> CELLS</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">32.5</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">32.8</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">33.2</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">TRIPLICATE 100 copies/10
                                    <sup>5</sup> CELLS</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">36.4</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">36.6</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">36.9</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">TRIPLICATE 10 copies/10
                                    <sup>5</sup> CELLS</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">38</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">38.7</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">38.6</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="4" rowspan="1" valign="top">CMV 
                                    <bold>LOD =10</bold> copies/10
                                    <sup>5</sup> CELLS, 
                                    <bold>CT value ranged (30-39)&#x00b1; 3</bold>
</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <p>

                    <bold>Analytical-sensitivity</bold>
                </p>
                <p>The ability of the In-house designed multiplex qPCR assay for detection of CMV and EBV DNA simultaneously in the same sample was evaluated through the mixing of two single positive samples for viruses (EBV and CMV) in four replicates, each replicate contain same viral load for both viruses (
                    <xref ref-type="table" rid="T4">
Table 4</xref>).</p>
                <table-wrap id="T4" orientation="portrait" position="float">
                    <label>
Table 4. </label>
                    <caption>
                        <title>Analytical sensitivity for simultaneous detection.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">CMV
                                    <xref ref-type="table-fn" rid="tfn1">*</xref> copies/10
                                    <sup>5</sup>cells</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">EBV
                                    <xref ref-type="table-fn" rid="tfn2">**</xref> copies/10
                                    <sup>5</sup>cells</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">+ CMV</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
+ EBV</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">10
                                    <sup>3</sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">10
                                    <sup>3</sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">4/4</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">4/4</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">10
                                    <sup>2</sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">10
                                    <sup>2</sup>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">4/4</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">4/4</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">10</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">10</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1/4</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2/4</td>
                            </tr>
                        </tbody>
                    </table>
                    <table-wrap-foot>
                        <fn-group content-type="footnotes">
                            <fn id="tfn1">
                                <label>

                                    <bold>*</bold>
</label>
                                <p>

                                    <bold>CMV</bold>=100% sensitivity at 10
                                    <sup>2</sup> copies/10
                                    <sup>5</sup> cells and at 10
                                    <sup>1</sup> copies/10
                                    <sup>5</sup> cells, the sensitivity is 25%</p>
                            </fn>
                            <fn id="tfn2">
                                <label>

                                    <bold>**</bold>
</label>
                                <p>

                                    <bold>EBV</bold>=100% sensitivity at 10
                                    <sup>2</sup> copies/10
                                    <sup>5</sup>cells and at 10
                                    <sup>1</sup> copies/10
                                    <sup>5</sup>, sensitivity is 50%.</p>
                            </fn>
                        </fn-group>
                    </table-wrap-foot>
                </table-wrap>
                <p>

                    <bold>Intra- and Inter-assay reproducibility</bold>
                </p>
                <p>The Intra-assay reproducibility of CMV and EBV In-house designed multiplex qPCR kit was determined by testing 4 replicates of 2 samples each containing 10
                    <sup>3</sup> copies/10
                    <sup>5</sup> cells, 10
                    <sup>2</sup> copies/10
                    <sup>5</sup> cells, and 10 copies/10
                    <sup>5</sup> cells. The CV% was found to be (1.9-0.7%) for EBV, the CT value ranged (34-39), and the CV% was (1.2-0.9%); for CMV, the CT value ranged (33.5-38), while the Inter-assay variability was determined by testing 4 replicates of 2 samples in 2 runs on two different machines each containing 10
                    <sup>3</sup> copies/10
                    <sup>5</sup> cells, 10
                    <sup>2</sup> copies/10
                    <sup>5</sup> cells, 10 copies/10
                    <sup>5</sup> cells, CV% was (1.2-1.3%) for EBV and (1.16-1.36%) for CMV.</p>
                <p>

                    <bold>The In-house designed multiplex qPCR assay cross-reactivity
</bold>
                </p>
                <p>
The specificity or cross &#x2013;reactivity determined first by NCBI Nucleotide BLAST software (
                    <ext-link ext-link-type="uri" xlink:href="http://blast.ncbi.nlm.nih.gov/">http://blast.ncbi.nlm.nih.gov/</ext-link>) demonstrated that the primers do not attach to any other sequences except for specific targets. Second, the human DNA was used to check the non-specific binding to human DNA; in addition, 15 negative samples for each virus were tested. The findings revealed 100% specificity.</p>
            </sec>
            <sec id="sec17">
                <title>3- In-house designed multiplex qPCR kit vs commercial kit</title>
                <p>The 100 mini-pooled whole blood samples from blood donors were retested using the In-house-designed multiplex qPCR. The results revealed that 40% of the mini-pool samples were positive for EBV, while 6% were positive for CMV. The specificity and sensitivity of the In-house-designed multiplex qPCR were calculated by comparison with the Sacace multiplex kit (commercial kit) results, which were considered the gold standard (dependable reference method) to determine the true positive, true negative, false positive, and false negative samples, as shown in 
                    <xref ref-type="fig" rid="f5">
Figure 5</xref>. Accordingly, the sensitivity and specificity of the In-house-designed kit for CMV detection in MP10 whole blood samples of blood donors were 100% (95% CI: 39.76&#x2013;100.00) and 97.92% (95% CI: 92.68&#x2013;99.75), respectively. In contrast, the sensitivity and specificity for EBV detection by the In-house-designed multiplex qPCR in MP10 whole blood samples were 95.24% (95% CI: 83.84&#x2013;99.42) and 100% (95% CI: 93.84&#x2013;100.00), respectively.</p>
                <fig fig-type="figure" id="f5" orientation="portrait" position="float">
                    <label>
Figure 5. </label>
                    <caption>
                        <title>Percentage of EBV and CMV positive MP10 whole blood samples from blood donors detected using the In-house multiplex PCR assay.</title>
                        <p>The In-house kit identified 40% EBV-positive and 6% CMV-positive samples. Comparison with the commercial kit revealed two false-negative EBV results and two false-positive CMV results, indicating minor discrepancies in detection performance.</p>
                    </caption>
                    <graphic id="gr5" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/201804/a0c1dd15-700e-40b0-a911-ed2b37b4e0c6_figure5.gif"/>
                </fig>
            </sec>
        </sec>
        <sec id="sec18" sec-type="discussion">
            <title>Discussion</title>
            <p>The use of seronegative blood donors as well as leukoreduced blood remains the safest approach to reduce the incidence of transfusion-transmitted CMV (TT-CMV) and EBV infections among at-risk individuals (
                <xref ref-type="bibr" rid="ref26">Trottier 
                    <italic toggle="yes">et al.</italic>, 2016</xref>; 
                <xref ref-type="bibr" rid="ref30">Ziemann &amp; Hennig, 2014</xref>). However, the risk of CMV infection during the window period may increase the likelihood of TT-CMV among high-risk recipients. Notably, approximately 80&#x2013;90% of blood donors are CMV-seropositive (
                <xref ref-type="bibr" rid="ref30">Ziemann &amp; Hennig, 2014</xref>), and EBV can still be detected in leukoreduced products (
                <xref ref-type="bibr" rid="ref26">Trottier 
                    <italic toggle="yes">et al.</italic>, 2016</xref>). Therefore, obtaining sufficient CMV-seronegative blood donors may be problematic (
                <xref ref-type="bibr" rid="ref1">Adane &amp; Getawa, 2021</xref>). In light of these findings, many researchers have focused on the detection of CMV DNA and EBV DNA in whole blood or plasma from blood donors using PCR to develop suitable infection-prevention strategies (
                <xref ref-type="bibr" rid="ref7">Eslami Kojidi 
                    <italic toggle="yes">et al.</italic>, 2024</xref>; 
                <xref ref-type="bibr" rid="ref12">Bevan 
                    <italic toggle="yes">et al.</italic>, 1991</xref>).</p>
            <p>The current study revealed 4% and 6% CMV-positive mini-pools by NAT using the commercial and In-house-designed multiplex PCR assays, respectively, while 42% and 40% of mini-pools were EBV-positive by the commercial and In-house assays, respectively. Within each positive EBV mini-pool, two to three individual samples per ten were EBV-positive, whereas one individual sample was CMV-positive. Yushan Xu 
                <italic toggle="yes">et al</italic>. reported 4.15% CMV DNA positivity in 820 whole-blood samples and 1.83% EBV DNA positivity samples using multiplex real-time PCR in 2024 (
                <xref ref-type="bibr" rid="ref28">Xu 
                    <italic toggle="yes">et al.</italic>, 2024</xref>). Compared with these findings, the present results indicate a relatively high prevalence of EBV DNA and a moderate level of CMV DNA among Iraqi blood donors, which may represent a real-life threat for high-risk blood transfusion recipients.</p>
            <p>These findings are consistent with observations by 
                <xref ref-type="bibr" rid="ref14">Lazzarotto 
                    <italic toggle="yes">et al</italic>. (2020)</xref>, who reported that CMV DNA load values in whole blood were consistently higher than in plasma during early infection until reaching the viral load peak, after which they decreased more rapidly in plasma (
                <xref ref-type="bibr" rid="ref14">Lazzarotto 
                    <italic toggle="yes">et al.</italic>, 2020</xref>). Similarly, 
                <xref ref-type="bibr" rid="ref11">Hudnall 
                    <italic toggle="yes">et al</italic>. (2008)</xref> quantified all eight human herpesviruses in blood leukocytes from 100 randomly selected donors in southeast Texas using real-time PCR; they reported EBV and CMV positivity rates of 72% and 1%, respectively (
                <xref ref-type="bibr" rid="ref11">Hudnall 
                    <italic toggle="yes">et al.</italic>, 2008</xref>). The difference may relate to CMV&#x2019;s median doubling time of 4.3 days, which is considerably longer than EBV&#x2019;s doubling time of 46&#x2013;56 hours (
                <xref ref-type="bibr" rid="ref4">Cromer 
                    <italic toggle="yes">et al.</italic>, 2013</xref>; 
                <xref ref-type="bibr" rid="ref15">Lodding 
                    <italic toggle="yes">et al.</italic>, 2015</xref>; 
                <xref ref-type="bibr" rid="ref24">Sica 
                    <italic toggle="yes">et al.</italic>, 2009</xref>).</p>
            <p>In this study, whole-blood samples were used rather than serum or plasma based on the premise that EBV and CMV establish latent infections in B lymphocytes and monocytes/macrophages, respectively. This assumption aligns with the findings of Kraft 
                <italic toggle="yes">et al</italic>. (
                <xref ref-type="bibr" rid="ref13">Kraft 
                    <italic toggle="yes">et al.</italic>, 2012</xref>), who demonstrated that CMV DNA detection and viral load values are higher in whole blood. Likewise, 
                <xref ref-type="bibr" rid="ref23">Rzepka 
                    <italic toggle="yes">et al</italic>. (2023)</xref> concluded that EBV DNA detection is more sensitive in whole-blood samples than in plasma (
                <xref ref-type="bibr" rid="ref23">Rzepka 
                    <italic toggle="yes">et al.</italic>, 2023</xref>).</p>
            <p>The multiplex qPCR assay employed in this study enabled the simultaneous detection of EBV and CMV DNA in blood donors, offering insight into the potential of this method to improve blood-screening efficiency in Iraqi blood banks by simplifying workflow, reducing turnaround time, and minimizing cost. This finding corresponds with that of 
                <xref ref-type="bibr" rid="ref5">Damian 
                    <italic toggle="yes">et al</italic>. (2024)</xref>, who demonstrated that multiplex qPCR is a cost-effective and robust technique for viral monitoring in kidney transplant recipients (
                <xref ref-type="bibr" rid="ref5">Damian 
                    <italic toggle="yes">et al.</italic>, 2024</xref>). Accordingly, the development of an In-house-designed multiplex qPCR kit and its comparison with a commercial assay revealed promising results, particularly when combined with the mini-pool testing strategy, which significantly reduces time and cost while maintaining high sensitivity and specificity.</p>
            <p>This concept has been successfully implemented previously by 
                <xref ref-type="bibr" rid="ref18">Markoulatos 
                    <italic toggle="yes">et al.</italic> (2001)</xref> and more recently by 
                <xref ref-type="bibr" rid="ref16">Luzius 
                    <italic toggle="yes">et al</italic>. (2025)</xref>, who utilized sensitive multiplex PCR assays capable of simultaneously detecting herpes simplex virus types 1 and 2, varicella-zoster virus, CMV, and EBV in cerebrospinal fluid (CSF) specimens with high accuracy (
                <xref ref-type="bibr" rid="ref16">Luzius 
                    <italic toggle="yes">et al.</italic>, 2025</xref>; 
                <xref ref-type="bibr" rid="ref18">Markoulatos 
                    <italic toggle="yes">et al.</italic>, 2001</xref>). The In-house-designed multiplex qPCR assay in the present study produced encouraging results when compared to the commercial reference assay in terms of specificity and sensitivity.</p>
            <p>Nevertheless, some limitations were encountered. Firstly, the number of positive (fifteen) and negative controls used for validation of the In-house assay was limited, as it was challenging to obtain newly infected patients for both viruses a stage when viral loads are typically at their peak. Hence, serological tests (IgM+) and nucleic acid testing were used to identify recent or reactivated infections, with the highest viral load observed being 1000 copies per 10
                <sup>5</sup> cells in the positive group. Secondly, cross-reactivity testing was conducted against human DNA using negative control samples and confirmed via the NCBI Nucleotide BLAST software (
                <ext-link ext-link-type="uri" xlink:href="http://blast.ncbi.nlm.nih.gov/">http://blast.ncbi.nlm.nih.gov/</ext-link>), while bacterial DNA cross-reactivity was assessed only in silico without experimental verification. Despite these limitations, both the In-house and commercial multiplex qPCR assays were applied for the first time in Iraq for blood donor screening of CMV and EBV DNA, representing a promising step toward improving blood safety for high-risk patient populations.</p>
        </sec>
        <sec id="sec19" sec-type="conclusion">
            <title>Conclusion</title>
            <p>Taken together, the rate of EBV in whole blood was high as compare with moderately low level of CMV in Iraqi blood donors. To eliminate this health problem the using of NAT is the best choice complementary to serological tests, but implementation of NAT is cost, need highly lab requirements with professional trained staff. The In-house designed multiplex qPCR kit when applied on 10 minipooled samples succeeded in amplifying 3 targets (CMV, EBV, and IC) at the same amplification reaction which correspondingly reduce the cost, time and was confirmed to be highly sensitive, specific with reproducible results compared to commercially dependable multiplex qPCR kit.</p>
        </sec>
    </body>
    <back>
        <sec id="sec22" sec-type="data-availability">
            <title>Data availability</title>
            <p>The data relating to the findings of this study are available at zenodo, In-house designed Multiplex Real-Time PCR Assay Developed for Epstein - Barr virus and Cytomegalovirus DNA detection in Pooled Blood Samples from Iraqi blood donors. DOI: (10.5281/zenodo.18342023); 
                <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.5281/zenodo.18342023">https://doi.org/10.5281/zenodo.18342023</ext-link> [
                <xref ref-type="bibr" rid="ref17">Majid 
                    <italic toggle="yes">et al.</italic>, 2026</xref>].</p>
            <p>Data are available under the terms of 
                <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Common Attributes 4.0 International License</ext-link> (CC-BY-4.0).</p>
        </sec>
        <ack>
            <title>Acknowledgments</title>
            <p>The authors would like to acknowledge the National center of blood bank in Baghdad/Medical city, and Central Public Health Laboratory in Baghdad/AL-Andalus square, for their cooperation in accomplishing this study.</p>
        </ack>
        <ref-list>
            <title>References</title>
            <ref id="ref1">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Adane</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Getawa</surname>
                            <given-names>S</given-names>
                        </name>
</person-group>:
                    <article-title>Cytomegalovirus seroprevalence among blood donors: a systematic review and meta-analysis.</article-title>
                    <source>

                        <italic toggle="yes">J. Int. Med. Res.</italic>
</source>
                    <year>2021</year>;<volume>49</volume>(<issue>8</issue>):<fpage>1</fpage>&#x2013;<lpage>16</lpage>.
                    <pub-id pub-id-type="pmid">34382466</pub-id>
                    <pub-id pub-id-type="doi">10.1177/03000605211034656</pub-id>
                    <pub-id pub-id-type="pmcid">PMC8366145</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref12">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Bevan</surname>
                            <given-names>IS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Daw</surname>
                            <given-names>RA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Day</surname>
                            <given-names>PJR</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Polymerase chain reaction for detection of human cytomegalovirus infection.</article-title>
                    <source>

                        <italic toggle="yes">Br. J. Haematol.</italic>
</source>
                    <year>1991</year>;<volume>78</volume>:<fpage>94</fpage>&#x2013;<lpage>99</lpage>.
                    <pub-id pub-id-type="doi">10.1111/j.1365-2141.1991.tb04388.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref2">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Bunchorntavakul</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Reddy</surname>
                            <given-names>KR</given-names>
                        </name>
</person-group>:
                    <article-title>Epstein-Barr virus and cytomegalovirus infections of the liver.</article-title>
                    <source>

                        <italic toggle="yes">Gastroenterol. Clin.</italic>
</source>
                    <year>2020</year>;<volume>49</volume>(<issue>2</issue>):<fpage>331</fpage>&#x2013;<lpage>346</lpage>.
                    <pub-id pub-id-type="doi">10.1016/j.gtc.2020.01.008</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref3">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Busch</surname>
                            <given-names>MP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bloch</surname>
                            <given-names>EM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kleinman</surname>
                            <given-names>S</given-names>
                        </name>
</person-group>:
                    <article-title>Prevention of transfusion-transmitted infections.</article-title>
                    <source>

                        <italic toggle="yes">Blood.</italic>
</source>
                    <year>2019</year>;<volume>133</volume>(<issue>17</issue>):<fpage>1854</fpage>&#x2013;<lpage>1864</lpage>.
                    <pub-id pub-id-type="doi">10.1182/blood-2018-11-833996</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref4">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Cromer</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tey</surname>
                            <given-names>SK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Khanna</surname>
                            <given-names>R</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Estimating cytomegalovirus growth rates by using only a single point.</article-title>
                    <source>

                        <italic toggle="yes">J. Virol.</italic>
</source>
                    <year>2013</year>;<volume>87</volume>(<issue>6</issue>):<fpage>3376</fpage>&#x2013;<lpage>3381</lpage>.
                    <pub-id pub-id-type="pmid">23302875</pub-id>
                    <pub-id pub-id-type="doi">10.1128/JVI.02821-12</pub-id>
                    <pub-id pub-id-type="pmcid">PMC3592124</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref5">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Damian</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ursu</surname>
                            <given-names>RG</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Covic</surname>
                            <given-names>AC</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Accurate Multiplex qPCR Detection of Epstein&#x2013;Barr Virus/Cytomegalovirus/BK Virus in Kidney Transplant Patients: Pilot Study.</article-title>
                    <source>

                        <italic toggle="yes">Int. J. Mol. Sci.</italic>
</source>
                    <year>2024</year>;<volume>25</volume>(<issue>23</issue>):<fpage>12698</fpage>.
                    <pub-id pub-id-type="pmid">39684406</pub-id>
                    <pub-id pub-id-type="doi">10.3390/ijms252312698</pub-id>
                    <pub-id pub-id-type="pmcid">PMC11641394</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref6">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Melo Silva</surname>
                            <given-names>J</given-names>
                            <prefix>de</prefix>
                        </name>

                        <name name-style="western">
                            <surname>Pinheiro-Silva</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Dhyani</surname>
                            <given-names>A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Cytomegalovirus and Epstein-Barr infections: prevalence and impact on patients with hematological diseases.</article-title>
                    <source>

                        <italic toggle="yes">Biomed. Res. Int.</italic>
</source>
                    <year>2020</year>;<volume>3</volume>(<issue>4</issue>):<fpage>25</fpage>&#x2013;<lpage>32</lpage>.
                    <pub-id pub-id-type="pmid">33163531</pub-id>
                    <pub-id pub-id-type="doi">10.1155/2020/1627824</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7605947</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref7">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Eslami Kojidi</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Shatizadeh Malekshahi</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jabbari</surname>
                            <given-names>MR</given-names>
                        </name>
</person-group>:
                    <article-title>The simultaneous presence of active BK, Epstein Barr, and human cytomegalovirus infectio.</article-title>
                    <source>

                        <italic toggle="yes">BMC Infect. Dis.</italic>
</source>
                    <year>2024</year>;<volume>24</volume>(<issue>1</issue>):<fpage>937</fpage>&#x2013;<lpage>942</lpage>.
                    <pub-id pub-id-type="pmid">39251898</pub-id>
                    <pub-id pub-id-type="doi">10.1186/s12879-024-09821-z</pub-id>
                    <pub-id pub-id-type="pmcid">PMC11385498</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref8">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Fukuda</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Torii</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Iwata</surname>
                            <given-names>KI</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Comparison of Whole Blood and Plasma for Monitoring Cytomegalovirus and Epstein-Barr Virus.</article-title>
                    <source>

                        <italic toggle="yes">New Microbiol.</italic>
</source>
                    <year>2024</year>;<volume>47</volume>(<issue>1</issue>):<fpage>52</fpage>&#x2013;<lpage>59</lpage>.
                    <pub-id pub-id-type="pmid">38700884</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref9">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Grobe</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Cherif</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>X</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Sample pooling: burden or solution?</article-title>
                    <source>

                        <italic toggle="yes">Clin. Microbiol. Infect.</italic>
</source>
                    <year>2021</year>;<volume>27</volume>(<issue>9</issue>):<fpage>1212</fpage>&#x2013;<lpage>1220</lpage>.
                    <pub-id pub-id-type="pmid">33878507</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.cmi.2021.04.007</pub-id>
                    <pub-id pub-id-type="pmcid">PMC9477502</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref10">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Gunson</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Maclean</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Shepherd</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Simultaneous detection and quantitation of CMV, EBV, and adenovirus by real-time PCR.</article-title>
                    <source>

                        <italic toggle="yes">J. Clin. Microbiol.</italic>
</source>
                    <year>2009</year>;<volume>47</volume>(<issue>3</issue>):<fpage>765</fpage>&#x2013;<lpage>770</lpage>.
                    <pub-id pub-id-type="pmid">19144801</pub-id>
                    <pub-id pub-id-type="doi">10.1128/JCM.01721-08</pub-id>
                    <pub-id pub-id-type="pmcid">PMC2650938</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref11">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hudnall</surname>
                            <given-names>SD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Chen</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Allison</surname>
                            <given-names>P</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Herpesvirus prevalence and viral load in healthy blood donors.</article-title>
                    <source>

                        <italic toggle="yes">Transfusion.</italic>
</source>
                    <year>2008</year>;<volume>48</volume>(<issue>6</issue>):<fpage>1180</fpage>&#x2013;<lpage>1187</lpage>.
                    <pub-id pub-id-type="pmid">18422852</pub-id>
                    <pub-id pub-id-type="doi">10.1111/j.1537-2995.2008.01685</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref13">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kraft</surname>
                            <given-names>CS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Armstrong</surname>
                            <given-names>WS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Caliendo</surname>
                            <given-names>AM</given-names>
                        </name>
</person-group>:
                    <article-title>Interpreting quantitative cytomegalovirus DNA testing: understanding the laboratory perspective.</article-title>
                    <source>

                        <italic toggle="yes">Clin. Infect. Dis.</italic>
</source>
                    <year>2012</year>;<volume>54</volume>(<issue>12</issue>):<fpage>1793</fpage>&#x2013;<lpage>1797</lpage>.
                    <pub-id pub-id-type="pmid">22412060</pub-id>
                    <pub-id pub-id-type="doi">10.1093/cid/cis212</pub-id>
                    <pub-id pub-id-type="pmcid">PMC3357478</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref14">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Lazzarotto</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Chiereghin</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Piralla</surname>
                            <given-names>A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Kinetics of CMV and EBV DNA in whole blood and plasma of kidney transplant recipients: Implications on management strategies.</article-title>
                    <source>

                        <italic toggle="yes">PLoS One.</italic>
</source>
                    <year>2020</year>;<volume>15</volume>(<issue>8</issue>):<fpage>185</fpage>&#x2013;<lpage>195</lpage>.
                    <pub-id pub-id-type="pmid">32841308</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0238062</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7447038</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref15">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Lodding</surname>
                            <given-names>I</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sengel&#x00f8;v</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Cunha-Bang</surname>
                            <given-names>C</given-names>
                            <prefix>da</prefix>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Clinical application of variation in replication kinetics during CMV infections.</article-title>
                    <source>

                        <italic toggle="yes">EBioMedicine.</italic>
</source>
                    <year>2015</year>;<volume>2</volume>(<issue>7</issue>):<fpage>699</fpage>&#x2013;<lpage>705</lpage>.
                    <pub-id pub-id-type="pmid">26288842</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.ebiom.2015.05.003</pub-id>
                    <pub-id pub-id-type="pmcid">PMC4534685</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref16">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Luzius</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jeske</surname>
                            <given-names>SD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Baer</surname>
                            <given-names>J</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>A Multiplex PCR Assay for HSV, CMV, and VZV in CSF.</article-title>
                    <source>

                        <italic toggle="yes">Microorganisms.</italic>
</source>
                    <year>2025</year>;<volume>13</volume>(<issue>1</issue>):<fpage>111</fpage>&#x2013;<lpage>119</lpage>.
                    <pub-id pub-id-type="pmid">39858879</pub-id>
                    <pub-id pub-id-type="doi">10.3390/microorganisms13010111</pub-id>
                    <pub-id pub-id-type="pmcid">PMC11767304</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref17">
                <mixed-citation publication-type="data">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Majid</surname>
                            <given-names>G</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <data-title>In-house designed Multiplex Real-Time PCR Assay Developed for Epstein - Barr virus and Cytomegalovirus DNA detection in Pooled Blood Samples from Iraqi blood donors.</data-title>[Data set].
                    <source>

                        <italic toggle="yes">Zenodo.</italic>
</source>
                    <year>2026</year>.
                    <pub-id pub-id-type="doi">10.5281/zenodo.18342023</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref18">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Markoulatos</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Georgopoulou</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Siafakas</surname>
                            <given-names>N</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Laboratory diagnosis of common herpesvirus infections of the central nervous system by a multiplex PCR assay.</article-title>
                    <source>

                        <italic toggle="yes">J. Clin. Microbiol.</italic>
</source>
                    <year>2001</year>;<volume>39</volume>(<issue>12</issue>):<fpage>4426</fpage>&#x2013;<lpage>4432</lpage>.
                    <pub-id pub-id-type="pmid">11724856</pub-id>
                    <pub-id pub-id-type="doi">10.1128/JCM.39.12.4426-4432.200</pub-id>
                    <pub-id pub-id-type="pmcid">PMC88560</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref19">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Markoulatos</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Siafakas</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Moncany</surname>
                            <given-names>M</given-names>
                        </name>
</person-group>:
                    <article-title>Multiplex polymerase chain reaction: a practical approach.</article-title>
                    <source>

                        <italic toggle="yes">J. Clin. Lab. Anal.</italic>
</source>
                    <year>2002</year>;<volume>16</volume>(<issue>1</issue>):<fpage>47</fpage>&#x2013;<lpage>51</lpage>.
                    <pub-id pub-id-type="doi">10.1002/jcla.2058</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref20">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Mengjiao</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yushan</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yan</surname>
                            <given-names>L</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Prevalence of transfusion-transmitted infections.</article-title>
                    <source>

                        <italic toggle="yes">Infect. Dis. Now.</italic>
</source>
                    <year>2024</year>;<volume>54</volume>(<issue>2</issue>):<fpage>104</fpage>&#x2013;<lpage>110</lpage>.
                    <pub-id pub-id-type="pmid">38316362</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.idnow.2024.104861</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref21">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Nemr</surname>
                            <given-names>WA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Nashwa</surname>
                            <given-names>RK</given-names>
                        </name>
</person-group>:
                    <article-title>Development of a multiplex PCR for HBV, HCV, HIV-1 detection.</article-title>
                    <source>

                        <italic toggle="yes">World J. Virol.</italic>
</source>
                    <year>2024</year>;<volume>13</volume>(<issue>1</issue>):<fpage>88164</fpage>.
                    <pub-id pub-id-type="pmid">38616859</pub-id>
                    <pub-id pub-id-type="doi">10.5501/wjv.v13.i1.88164</pub-id>
                    <pub-id pub-id-type="pmcid">PMC11008401</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref22">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Rzepka</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Depka</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Gospodarek-Komkowska</surname>
                            <given-names>E</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Whole blood versus plasma.</article-title>
                    <source>

                        <italic toggle="yes">Pathogens.</italic>
</source>
                    <year>2022</year>;<volume>11</volume>(<issue>11</issue>):<fpage>1384</fpage>&#x2013;<lpage>1390</lpage>.
                    <pub-id pub-id-type="pmid">36422636</pub-id>
                    <pub-id pub-id-type="doi">10.3390/diagnostics13030476</pub-id>
                    <pub-id pub-id-type="pmcid">PMC9697577</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref23">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Rzepka</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Depka</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Gospodarek-Komkowska</surname>
                            <given-names>E</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Diagnostic Value of Whole-Blood and Plasma.</article-title>
                    <source>

                        <italic toggle="yes">Diagnostics.</italic>
</source>
                    <year>2023</year>;<volume>13</volume>(<issue>3</issue>):<fpage>476</fpage>.
                    <pub-id pub-id-type="pmid">36766581</pub-id>
                    <pub-id pub-id-type="doi">10.3390/pathogens11111384</pub-id>
                    <pub-id pub-id-type="pmcid">PMC9914079</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref31">
                <mixed-citation publication-type="book">
                    <collab>Sacace Biotechnologies</collab>:
                    <source>

                        <italic toggle="yes">CMV/EBV/HHV6 Quant Real-TM Handbook: Multiplex Real Time PCR Kit for quantitative detection and differentiation of Cytomegalovirus (CMV), Epstein Barr Virus (EBV) and Human Herpes 6 Virus (HHV6).</italic>
</source>
                    <publisher-loc>Verona, Italy</publisher-loc>:
                    <publisher-name>Sacace Biotechnelogies</publisher-name>;<year>2016</year>.</mixed-citation>
            </ref>
            <ref id="ref24">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sica</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Metafuni</surname>
                            <given-names>E</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bellesi</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Epstein-barr virus related lymphoproliferations after stem cell transplantation.</article-title>
                    <source>

                        <italic toggle="yes">Mediterr. J. Hematol. Infect. Dis.</italic>
</source>
                    <year>2009</year>;<volume>1</volume>(<issue>2</issue>):<fpage>e2009019</fpage>.
                    <pub-id pub-id-type="pmid">21416005</pub-id>
                    <pub-id pub-id-type="doi">10.4084/mjhid.2009.019</pub-id>
                    <pub-id pub-id-type="pmcid">PMC3033172</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref25">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Smatti</surname>
                            <given-names>MK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yassine</surname>
                            <given-names>HM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>AbuOdeh</surname>
                            <given-names>R</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Prevalence and molecular profiling of EBV among healthy blood donors.</article-title>
                    <source>

                        <italic toggle="yes">PLoS One.</italic>
</source>
                    <year>2017</year>;<volume>12</volume>(<issue>12</issue>):<fpage>e0189033</fpage>.
                    <pub-id pub-id-type="pmid">29228016</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0189033</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5724864</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref26">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Trottier</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Delage</surname>
                            <given-names>G</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hu</surname>
                            <given-names>J</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Detection of Epstein&#x2013;Barr virus in leucoreduced blood products.</article-title>
                    <source>

                        <italic toggle="yes">Vox Sang.</italic>
</source>
                    <year>2016</year>;<volume>110</volume>(<issue>2</issue>):<fpage>199</fpage>&#x2013;<lpage>201</lpage>.
                    <pub-id pub-id-type="pmid">26383177</pub-id>
                    <pub-id pub-id-type="doi">10.1111/vox.12330</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref27">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Wada</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kubota</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ito</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Simultaneous quantification of EBV, CMV, HHV-6 DNA.</article-title>
                    <source>

                        <italic toggle="yes">J. Clin. Microbiol.</italic>
</source>
                    <year>2007</year>;<volume>45</volume>(<issue>5</issue>):<fpage>1426</fpage>&#x2013;<lpage>1432</lpage>.
                    <pub-id pub-id-type="pmid">17376882</pub-id>
                    <pub-id pub-id-type="doi">10.1128/JCM.01515-06</pub-id>
                    <pub-id pub-id-type="pmcid">PMC1865882</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref28">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Xu</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lv</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lin</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>A novel multiplex real-time PCR for CMV, EBV, HSV1/2.</article-title>
                    <source>

                        <italic toggle="yes">Diagn. Microbiol. Infect. Dis.</italic>
</source>
                    <year>2024</year>;<volume>109</volume>(<issue>1</issue>):<fpage>116234</fpage>.
                    <pub-id pub-id-type="pmid">38432126</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.diagmicrobio.2024.116234</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref29">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Yamkasem</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tattiyapong</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Gardner</surname>
                            <given-names>IA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Assessment of pooled serum samples.</article-title>
                    <source>

                        <italic toggle="yes">Viruses.</italic>
</source>
                    <year>2025</year>;<volume>17</volume>(<issue>7</issue>):<fpage>877</fpage>&#x2013;<lpage>882</lpage>.
                    <pub-id pub-id-type="pmid">40733495</pub-id>
                    <pub-id pub-id-type="doi">10.3390/v17070877</pub-id>
                    <pub-id pub-id-type="pmcid">PMC12300263</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref30">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ziemann</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hennig</surname>
                            <given-names>H</given-names>
                        </name>
</person-group>:
                    <article-title>Prevention of transfusion-transmitted cytomegalovirus infections.</article-title>
                    <source>

                        <italic toggle="yes">Transfus. Med. Hemother.</italic>
</source>
                    <year>2014</year>;<volume>41</volume>(<issue>1</issue>):<fpage>40</fpage>&#x2013;<lpage>44</lpage>.
                    <pub-id pub-id-type="pmid">24659946</pub-id>
                    <pub-id pub-id-type="doi">10.1159/000357102</pub-id>
                    <pub-id pub-id-type="pmcid">PMC3949610</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report496644">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.201804.r496644</article-id>
            <title-group>
                <article-title>Reviewer response for version 2</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Hanoush</surname>
                        <given-names>Noor. Hameed</given-names>
                    </name>
                    <xref ref-type="aff" rid="r496644a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r496644a1">
                    <label>1</label>University of Anbar, Ramadi, Iraq</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>7</day>
                <month>7</month>
                <year>2026</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2026 Hanoush NH</copyright-statement>
                <copyright-year>2026</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport496644" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.173833.2"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>I have no other comments. The authors have satisfactorily addressed all of my previous comments.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>I cannot comment. A qualified statistician is required.</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Partly</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>My area expertise immunogenetics and haematological disease</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report496645">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.201804.r496645</article-id>
            <title-group>
                <article-title>Reviewer response for version 2</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>zhang</surname>
                        <given-names>xiao</given-names>
                    </name>
                    <xref ref-type="aff" rid="r496645a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r496645a1">
                    <label>1</label>Chongqing Medical University, Chongqing, China</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>29</day>
                <month>6</month>
                <year>2026</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2026 zhang x</copyright-statement>
                <copyright-year>2026</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport496645" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.173833.2"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>No more comments for the authors</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Yes</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Partly</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Partly</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Partly</p>
            <p>Reviewer Expertise:</p>
            <p>please see my comments</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report481703">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.191684.r481703</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Hanoush</surname>
                        <given-names>Noor. Hameed</given-names>
                    </name>
                    <xref ref-type="aff" rid="r481703a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r481703a1">
                    <label>1</label>University of Anbar, Ramadi, Iraq</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>19</day>
                <month>5</month>
                <year>2026</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2026 Hanoush NH</copyright-statement>
                <copyright-year>2026</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport481703" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.173833.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>The study support the reliability and diagnostic performance of the in-house designed multiplex qPCR assay for simultaneous detection of Cytomegalovirus (CMV) and Epstein&#x2013;Barr virus (EBV) DNA.&#x00a0;</p>
            <p> The analytical sensitivity of the assay was evaluated using mixed positive samples containing both viral targets in multiple replicates, confirming the assay&#x2019;s capability to detect CMV and EBV simultaneously within the same specimen</p>
            <p> The in-house multiplex qPCR assay was compared with a commercially available reference kit manufactured by Sacace Biotechnologies, which was considered the gold standard method. Additionally, the development of an in-house assay may provide economic advantages and improve accessibility in resource-limited laboratory settings.</p>
            <p> Despite these strengths, several limitations should be considered:</p>
            <p> The sample size was relatively limited, as only 100 mini-pooled blood donor samples were included, which may restrict the generalizability of the findings.&#x00a0;</p>
            <p> &#x00a0;The study did not extensively evaluate cross-reactivity with other clinically relevant herpesviruses, such as Herpes Simplex Virus which could further strengthen the specificity assessment. The use of pooled samples may also have reduced the viral concentration in low-titer specimens, potentially affecting assay sensitivity.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>I cannot comment. A qualified statistician is required.</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Partly</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>My area expertise immunogenetics and haematological disease</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
        <sub-article article-type="response" id="comment16313-481703">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Majid</surname>
                            <given-names>Ghinwa</given-names>
                        </name>
                        <aff>biology, Al-Nahrain univercity/college of sciences, Baghdad, lecturer, Iraq</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>28</day>
                    <month>5</month>
                    <year>2026</year>
                </pub-date>
            </front-stub>
            <body>
                <p>
                    <bold>We would like to greatly thanks Editor and Reviewers for their valuable comments and suggestions regarding our manuscript. We highly appreciate the time and effort invested in reviewing our work. The comments were carefully considered. Detailed responses to each comment are provided below.</bold>
                </p>
                <p> </p>
                <p> 
                    <bold>Response 1:</bold>
                </p>
                <p> Thank you for your valuable observation. The study initially included 
                    <bold>1000 whole blood donor samples</bold>, which were subsequently combined into 
                    <bold>100 mini-pools</bold> (10 samples per pool). In addition, the study included control groups consisting of 
                    <bold>15 CMV-positive samples, 15 CMV-negative samples, 15 EBV-positive samples, and 15 EBV-negative samples</bold>.</p>
                <p> Furthermore, the seroprevalence of both 
                    <bold>EBV</bold> and 
                    <bold>CMV</bold> is relatively high in Iraq, which increases the likelihood of detecting these viruses even when using a sample size of fewer than 100 pooled samples. Therefore, we believe that the sample size used in this study was adequate to achieve the study objectives and provide meaningful preliminary findings.</p>
                <p> 
                    <bold>Response2:</bold>
                </p>
                <p> Thank you for this important observation regarding cross-reactivity. The possibility of cross-reactivity was already mentioned in the limitations section of the discussion. In the present study, cross-reactivity with bacterial pathogens was assessed in silico, while cross-reactivity with human DNA was evaluated both experimentally and in silico to avoid false-negative results and ensure assay specificity.</p>
                <p> Regarding cross-reactivity with other pathogens, including viruses and bacteria, even if limited cross-reactivity occurs, this may still be considered beneficial in the context of blood transfusion safety. Detection of potentially contaminated blood units, regardless of the exact pathogen, could help prevent transfusion of infected blood to high-risk or immunocompromised patients. Therefore, such findings may contribute positively to precautionary blood donor screening and transfusion safety measures.</p>
                <p> 
                    <bold>Response 3:</bold>
                </p>
                <p> Thank you for this important comment regarding the possible dilution effect associated with pooled samples. The potential reduction in viral concentration after pooling was carefully evaluated during the preliminary phase of the study by testing pools containing 5, 10, and 15 whole blood samples. Based on the obtained findings, pooling of 10 samples per pool was selected as the most appropriate strategy, as it provided acceptable assay sensitivity and performance while achieving the main objective of the study, which was to reduce the overall cost of molecular screening.</p>
                <p> Moreover, sample pooling is widely used strategy especially in surveillance of large numbers of samples like in blood transfusion samples, particularly where the number of samples exceeded thousands, therefore the pooling system a good choice to reduce the time , cost &#x00a0;&#x00a0;and blood transfusion safety.</p>
            </body>
        </sub-article>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report469726">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.191684.r469726</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>zhang</surname>
                        <given-names>xiao</given-names>
                    </name>
                    <xref ref-type="aff" rid="r469726a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r469726a1">
                    <label>1</label>Chongqing Medical University, Chongqing, China</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>7</day>
                <month>4</month>
                <year>2026</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2026 zhang x</copyright-statement>
                <copyright-year>2026</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport469726" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.173833.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>This study established an in-house multiplex real-time PCR assay for EBV and CMV detection in Iraqi blood donors, which is of important clinical significance for ensuring blood transfusion safety. However, critical issues in methodological validation, sample quality control, and reference formatting require revision to improve the scientific rigor of the manuscript.</p>
            <p> 
                <bold>Major Comments:</bold>
            </p>
            <p> 1.The in-house developed kit was validated using only 15 positive and 15 negative samples. Such an insufficient validation sample size makes it difficult to comprehensively evaluate the stability, repeatability and clinical generalizability of the detection method, and may easily lead to biased results in the assessment of sensitivity and specificity.</p>
            <p> 2. The blood donor samples used in this study were collected from 2018 to 2019 with an excessively long storage period. The authors did not specify the DNA storage conditions or nucleic acid degradation quality control data, so the interference of aged samples on viral nucleic acid detection results cannot be excluded, which affects the authenticity and reliability of the research findings.</p>
            <p> 3. Insufficient sample size for validation. Only 15 positive and 15 negative controls were used to evaluate the performance of the in-house assay, resulting in wide confidence intervals and limited statistical power.</p>
            <p> 4. Potential dilution effect from the pooling strategy. The 10:1 pooling strategy (MP10) may lead to false negatives due to dilution of low-copy-number samples. The authors should address this issue experimentally or thoroughly discuss this risk in the manuscript.</p>
            <p> 5. Lack of independent validation of the commercial kit used as the gold standard. The study used the commercial Sacace kit as the reference method, but the manuscript does not provide its performance characteristics (sensitivity, specificity, limit of detection).</p>
            <p> 
                <bold>Minor Comments:</bold>
            </p>
            <p> 1. The reference list has inconsistent formatting in the presentation of volume, issue and page numbers, punctuation usage, and supplementary link annotations. These items are not standardized and should be revised uniformly in accordance with the journal&#x2019;s citation requirements.</p>
            <p> 2. Typographical error in PCR cycling conditions. In the "DNA amplification" section, the authors wrote "40 mins at 63&#x2103;," which is likely a mistake. The annealing/extension step in real-time PCR typically lasts seconds, not minutes. Please correct to "40 seconds" or confirm the actual protocol.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Yes</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Partly</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Partly</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Partly</p>
            <p>Reviewer Expertise:</p>
            <p>please see my comments</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
        <sub-article article-type="response" id="comment16206-469726">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Majid</surname>
                            <given-names>Ghinwa</given-names>
                        </name>
                        <aff>biology, Al-Nahrain univercity/college of sciences, Baghdad, lecturer, Iraq</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>15</day>
                    <month>5</month>
                    <year>2026</year>
                </pub-date>
            </front-stub>
            <body>
                <p>
                    <bold>We would like to express our sincere gratitude to the Editor and Reviewers for their valuable comments and constructive suggestions regarding our manuscript. We highly appreciate the time and effort invested in reviewing our work. The comments were carefully considered, and the manuscript has been revised accordingly to improve its scientific quality and clarity. Detailed responses to each comment are provided below.</bold>
                </p>
                <p> 
                    <bold>Major Comments:</bold>
                </p>
                <p> 
                    <bold>Response to Comment 1</bold>
                </p>
                <p> This limitation has been acknowledged and clearly stated in the discussion section of the revised manuscript. Although the initial validation included 15 positive and 15 negative individual samples, the in-house designed kit was additionally evaluated using 100 pooled clinical samples.</p>
                <p> These pooled samples were first tested using the commercially approved Sacace kit as a reference method and were subsequently retested using the in-house developed kit. The comparative analysis demonstrated consistent detection performance between both methods, supporting the preliminary reliability of the developed assay.</p>
                <p> 
                    <bold>Response to Comment 2</bold>
                </p>
                <p> All samples were stored frozen at &#x2212;80 &#x00b0;C in accordance with the manufacturer&#x2019;s instructions until processing and molecular analysis were performed.</p>
                <p> We appreciate the reviewer&#x2019;s observation, and this information has now been clearly added to the sample collection section in the newly revised manuscript.</p>
                <p> 
                    <bold>Response to Comment 3:</bold>
                </p>
                <p> We acknowledge that the number of positive and negative samples used for the initial validation of the in-house assay was relatively limited, which may affect the statistical power and confidence intervals of the obtained results. However, the primary objective of this study was to perform a preliminary evaluation of the assay performance under controlled laboratory conditions. In addition to the 15 positive and 15 negative control samples, the in-house assay was further evaluated using 100 pooled clinical samples that were initially tested with the approved Sacace reference kit and subsequently retested using the developed assay. The obtained results demonstrated comparable detection performance between both kits
                    <bold>.</bold>
                </p>
                <p> </p>
                <p> 
                    <bold>Response to Comment </bold>
                    <bold>4</bold>:</p>
                <p> We thank the reviewer for this important comment and for highlighting the need to clarify the pooling validation process in the manuscript.</p>
                <p> In addition, pooling validation was conducted using 10 whole blood samples per pool after preliminary evaluation of pools containing 5 and 15 samples. Based on the obtained results, pooling of 10 samples was selected as the most appropriate strategy, as it provided acceptable assay performance while supporting the main objective of the study, which was to reduce the overall cost of molecular screening.</p>
                <p> This clarification regarding the pooling validation strategy has now been added to the revised manuscript.</p>
                <p> 
                    <bold>Response to Minor Comments</bold>
                </p>
                <p> 
                    <bold>1- </bold>We have carefully revised the reference list to ensure consistency and standardization in formatting, including uniform presentation of volume, issue, page numbers, punctuation, and supplementary link annotations, in accordance with the journal&#x2019;s citation style requirements
                    <bold>. </bold>
                </p>
                <p> 
                    <bold>2- </bold>We appreciate the reviewer&#x2019;s observation regarding the PCR cycling conditions. The typographical error in the &#x201c;DNA amplification&#x201d; section has been corrected, and the annealing/extension step has been revised from &#x201c;40 mins at 63&#x2103;&#x201d; to &#x201c;40 seconds at 63&#x2103;&#x201d; to accurately reflect the actual protocol used.</p>
                <p> These corrections have been implemented in the revised manuscript</p>
            </body>
        </sub-article>
    </sub-article>
</article>
