F1000Research F1000Research 2046-1402 F1000 Research Limited London, UK 10.12688/f1000research.176668.1 Research Article Articles Evaluation of the Antibiofilm and Antimicrobial Effects of Selenium Nanoparticles on Multidrug-Resistant Salmonella Isolates

[version 1; peer review: 2 approved with reservations, 1 not approved]

 Noori Mahal Shaimaa Conceptualization Formal Analysis Funding Acquisition Resources Software Supervision 1 Jabbar Jabour Hamza Investigation Methodology Validation Visualization Writing – Original Draft Preparation https://orcid.org/0009-0004-4319-894X 2 Samir Mohsin Asmaa Formal Analysis Funding Acquisition Investigation Methodology Project Administration Writing – Original Draft Preparation Writing – Review & Editing 2 Mouaid Abbas Sura Conceptualization Funding Acquisition Investigation Resources Software Validation Writing – Original Draft Preparation Writing – Review & Editing 2 M.Taher Noor Conceptualization Project Administration Validation Visualization https://orcid.org/0000-0001-9602-619X a 1 Department of Microbiology College of Medicine, University of Fallujah, Al-Fallujah, Al Anbar Governorate, Iraq Department of Biology, Mustansiriyah University College of Science, Baghdad, Baghdad Governorate, Iraq noor.m.taher@uofallujah.edu.iq

No competing interests were disclosed.

 17 4 2026 2026 15 547 5 3 2026 Copyright: © 2026 Noori Mahal S et al. 2026 This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The author(s) is/are employees of the US Government and therefore domestic copyright protection in USA does not apply to this work. The work may be protected under the copyright laws of other jurisdictions when used in those jurisdictions. Background and Aim

Globally, Salmonella is a leading cause of bloodstream infections and foodborne diseases. Treatment and public health are seriously threatened by the rise of multidrug-resistant (MDR) strains and biofilm formation. As a result, novel approaches are required to manage illnesses linked to biofilms. With a focus on the expression of biofilm-related genes, this work attempts to assess the antibiofilm and antibacterial activity of selenium nanoparticles (SeNPs) against MDR Salmonella isolates.

 Methods

Thirty-two isolates were recovered from 167 blood samples collected from Baghdad, Iraq. All isolates were screened for biofilm formation using congo red and microtiter plate assays. Antimicrobial susceptibility was tested against a range of antibiotics. Selenium nanoparticles were biosynthesized and characterized (UV-Vis, DLS, TEM) and applied at sub-MIC concentrations. RT-qPCR was then done to quantify the expression levels of biofilm-associated genes csgD and ssrB.

Results

All isolates form biofilms, while 75% of them are classified as strong formers. High resistance was observed to beta-lactams; moderate resistance accompanied fluoroquinolones. RT-qPCR results indicated a dose-dependent downregulation of csgD and ssrB with the SeNP treatment with stronger suppressive effects at higher concentrations.

 Conclusions

SeNPs effectively inhibit biofilm formation and hold strong antimicrobial activity against MDR Salmonella, presenting an opportunity for application as adjunctive therapeutic agents in food safety and clinical medicine.

 Salmonella Multidrug-resistant Biofilm Selenium nanoparticles Antimicrobial activity csgD ssrB RT-qPCR Nanotherapy The author(s) declared that no grants were involved in supporting this work. Introduction

Salmonella is a rod-shaped, facultative anaerobic, non-spore-forming, Gram-negative bacterium that can cause disease among humans as well as animals. The bacteria are a member of the Enterobacteriaceae family. 1

The ongoing face-off between the multidrug resistance (MDR) of Salmonella on one hand and the drug development and use of antibiotics and other antipathogenic substances on the other hand remains an important global problem. 2 The infectivity of these bacteria and the threats that follow to many industries, including healthcare, water, food, and energy, wherein Salmonella could cause a terrible deal of harm, continue to be highlighted among critical world concerns. 3 The increasing drug resistance among Salmonella species is an emerging problem and the syndrome of MDR keeps getting worse. Given Salmonella’s massive toll on public health, ongoing alerts for its drug resistance pattern will be needed to understand resistive evolution, enable proper clinical treatment protocols, and curb its transmission and infection. 4

The past decade has witnessed a great increase in the prevalence of multidrug-resistant Salmonella species, with MDR Salmonella typhimurium imposing such significant therapeutic challenges because of rising morbidity and mortality rates sustained by its infection. Alarmingly, accession of mortality rates is by the MDR-ACSSuT resistance pattern that is 4.8 times higher than that for non-MDR-ACSSuT strains, with resistance including Ampicillin, Chloramphenicol, Streptomycin, Sulfamethoxazole, and Tetracycline. 5 Beyond cellular drug resistance mechanisms, S. typhimurium acquires adaptive resistance mechanisms, such as the capability to form biofilms. Observations of biofilm formation are postulated to be aiding in significantly increasing the drug resistance in the strains. 6 In addition, studies have increasingly shown that virulent multidrug-resistant bacterial pathogens are emerging from a variety of sources, thereby stressing the need for proper use of antibiotics. This is coupled with the pressing imperative for the design and implementation of rapid, reliable diagnostic tools for the detection of emerging virulent multidrug-resistant strains. 7–9

The increased pathogenicity of Salmonella is an aggravating factor increasing public health consequences. 10 Biofilm formation by Salmonella species on biotic or abiotic surfaces is a well-documented mode of bacterial existence. 11, 12 Biofilm formation is considered clinically relevant since about 80% of chronic bacterial infections are associated with this mode of growth. 13, 14 Biofilms can increase bacterial survival rates by promoting resistance against antimicrobial agents and decoying immune defenses, thereby allowing them to play an important role in chronic and device-related infections. 15–17

A biofilm is a membrane-like structure composed of bacteria encapsulated by extra-cellular macromolecules forming a hydrated matrix during bacterial growth. Research has established that almost all Salmonella strains can form biofilms, and most have been shown to be highly proficient in this. 18 The formation of biofilms greatly increases bacterial resistance to stress conditions, which include drying, extreme temperature, antimicrobial agents, and disinfectants, and hence facilitates the survival of Salmonella in diverse environments. 19 In-depth investigation of biofilm formation mechanisms could aid in developing preventive measures against Salmonella spread and infection. 20

Therefore, further studies are needed for a more effective Salmonella biofilm control. The present study will focus on drug resistance to Salmonella species and will test those in vitro for biofilm formation in relation to the gene expression of biofilm-producing strains, which will provide important data that can be utilized for the clinical treatment of Salmonella infections. The context explored in connection with the study involved the observation of SeNPs as a possible candidate to hinder biofilm-associated genes in Salmonella.

The unique properties of metal NPs have led to their great interest as antimicrobial agents. Silver (Ag), Zinc oxide (ZnO), Titanium dioxide (TiO 2), Copper (Cu), Iron oxide (Fe 3O 4), Selenium (Se), and Gold (Au) metal NPs have been widely studied for their antimicrobial properties. 21 Previous studies have suggested that NPs can operate by mechanisms other than those used by conventional antibiotics, thus perhaps improving their activity against MDR bacteria. Antibacterial studies have shown that these NPs penetrate bacterial cells, bind to receptors on their surface, and exert their action by inflicting intracellular damage to finally kill the cells. NPs are also able to inhibit essential metabolic enzymes responsible for bacterial proliferation and respiration. Furthermore, some of these NPs can interfere with biofilm formation by disrupting the signaling pathways involved, preventing infections associated with biofilm. 22, 23 This review presents the potential of metal and metal oxide NPs as some of the most powerful therapeutics to treat biofilm, specifically focusing on their inhibition of the bacterial biofilm-associated genes.

 Materials and methods Collection and identification of bacterial isolates

Blood samples from a total of 167 patients were collected between January and June of 2024 at the Medical City Teaching Hospital in Baghdad, Iraq. For all participants, demographic and social information was collected, including age and sex. For initial identification of the isolates, conventional microbiological methods were employed, namely, colony morphology on selective agar, Gram staining, and biochemical testing. The strains were confirmed at the species level using the VITEK ® 2 Compact system (bioMérieux, France) for accurate identification, and molecular confirmation through PCR targeting the gapA gene, a specific marker for Salmonella species.

 Antimicrobial susceptibility testing

Antimicrobial susceptibility testing of Salmonella isolates was performed using the Laboratory Standards Institute (CLSI) standards. 24, 25 They were applied on the antibiotic discs from Liofilchem, Italy, at concentrations of 100 μg for Piperacillin (PR), 10 μg for Ampicillin (AM), 30 μg for Cefotaxime (CTX), 10 μg for Imipenem (IMP), 10 μg for Meropenem (MEM), 5 μg for Ciprofloxacin (CIP), 5 μg for Levofloxacin (LEV), 25 μg for Trimethoprim-Sulfamethoxazole (SXT), 30 μg for Chloramphenicol (C) and 30 μg for Tetracycline (TE). Those isolates that show resistance against more than three antibiotics are considered multidrug resistant (MDR). 26

Biofilm formation

Biofilm formation was assessed qualitatively using the Congo Red Agar (CRA) method. Colonies that were black, dry, and rough were considered positive for slime production, whereas red or smooth colonies indicated weak or no biofilm formation. 27 Congo Red Agar was prepared by supplementing brain heart infusion agar with 0.8 g/L Congo red dye (Sigma-Aldrich, USA, Cat. No. C6277).

For quantitative evaluation, biofilm formation was assessed using the microtiter plate assay. Each well of a sterile 96-well polystyrene microtiter plate (Corning, USA, Cat. No. 3599) was inoculated with 100 μL of bacterial culture in nutrient broth and incubated at 37 °C for 24–48 hours. After incubation, non-adherent cells were removed, and the remaining biofilm was stained with 1% (w/v) crystal violet (Sigma-Aldrich, USA, Cat. No. C0775). Biofilm biomass was quantified by measuring the absorbance at 570 nm using a microplate reader.

Biofilm formation was categorized into four distinct groups based on an arbitrary optical density (OD) cutoff defined as ODc 28 : 3 standard deviations above the mean OD of the negative control.

Non-producer: OD ≤ ODc

Weak producer: ODc < OD ≤ 2 × ODc

Moderate producer: 2 × ODc < OD ≤ 4 × ODc

Strong producer: OD > 4 × ODc

All the assays were maintained in triplicates for reproducibility, and the experiment was performed in biological replicates for validation of the results. Such a systematic approach was established to quantify and compare biofilm formations in different isolates.

 Impact of SeNPs on biofilm regulators expression

Biosynthesis and characterization of Selenium Nanoparticles (SeNPs)

SeNPs were biosynthesized using Escherichia coli ATCC 35218 according to the protocol described by Kora and Rastogi. 29 Sodium selenite (Na2SeO3; Sigma-Aldrich, USA, Cat. No. S5261) was used as the selenium precursor.

Morphological characterization was performed using a scanning electron microscope (SEM; MIRA3 LMU). SEM images were acquired at magnifications ranging from 5,000× to 100,000× under an accelerating voltage of 15 kV to evaluate particle shape, surface morphology, and size distribution within the nanoscale range. 30

Determination of Minimum Inhibitory Concentration (MIC)

The broth microdilution method, in conjunction with CLSI guidelines, was used to determine the MIC of SeNPs against the selected Salmonella isolates. MIC determination was performed using Mueller-Hinton broth (Oxoid, UK, Cat. No. CM0405) in sterile 96-well microtiter plates (Corning, USA, Cat. No. 3599). Standardized bacterial suspensions (0.5 McFarland standards) were inoculated into the plates containing serial dilutions of SeNPs. Appropriate controls included positive (bacteria without SeNPs) and negative (broth only). After incubation for 24 h at 37 °C, the MIC was defined as the lowest concentration that inhibited visible bacterial growth. 31 For gene expression studies, concentrations lower than the MIC (12.5%, 25%, 50%, and 100% of MIC) were selected.

RNA extraction and quantitative Real-Time PCR (RT-qPCR)

The selected sub-MIC concentrations of SeNPs in Mueller–Hinton broth were used to treat the three MDR and biofilm-producing Salmonella isolates. Total RNA was extracted using a commercial RNA extraction kit (Geneaid Biotech Ltd., Taiwan, Cat. No. RN050) as per the manufacturer’s instructions. RNA purity and concentration were measured using a NanoDrop spectrophotometer at 260/280 nm. Reverse transcription of 1 μg total RNA was performed using a cDNA synthesis kit (Bioneer, Korea, Cat. No. K-2041).

The RT-qPCR susceptibility test was conducted using a 20-μL reaction mixture containing SYBR Green Master Mix (Promega, USA, Cat. No. A6001), specific primers for biofilm-associated genes csgD and ssrB, and the housekeeping gene gapA as an internal control. The primer sequences and expected amplicon sizes are presented in Table 1.

Primer sequences used in this study for quantitative real-time PCR analysis.
Gene Nucleotide sequence ( 5 ′ → 3 ′ ) Amplicon sizes (bp) Reference
ssrB F: AATGCCTGTTGTGCATACGA 176 This study
R: TTAGCACCTGCGGCTAAAGT
csgD F: GCCTCATATTAACGGCGTGT 177
R: TCGCGATGAGTGAGTAATGC
gap A F:TACTGTTCACGCGACTACCG 173
R: GGAACGCCATACCAGTCAGT

Fw, forward; Rv, reverse; bp, base pair.

The efficiency of the primers developed for csgD, ssrB, and gapA was determined through the construction of a standard curve using cDNA serially diluted. The efficiency calculated via this method was related to the slope of the standard curve-generated efficiency value, ensuring it fell within the range of 90–110% for every pair of primer.

A melt curve analysis was conducted after amplification to confirm the specificity of the amplification products. A melt curve was generated by increasing gradually the temperature from 60 °C to 95 °C, and the melting temperature (Tm) was determined as the result of the dissociation of the PCR products.

Thermal cycling conditions consisted of the following: an initial denaturation step of 95 °C for 5 min, followed by 40 cycles which consisted of denaturation at 95 °C for 20 seconds, annealing at 60 °C for csgD and ssrB, and 56 °C for the reference gene gapA, for 20 seconds, and extension at 72 °C for 20 seconds.

All reactions were performed with three technical replicates, since that enhances reproducibility. The relative gene expression was then analyzed using the 2 − ΔΔCt method, 32 comparing SeNP-treated isolates with untreated controls. The Ct values were then calculated using Bio-Rad CFX Manager Software (version 3.1).

 Statistical analysis

Data were analyzed using SPSS version 26.0 (IBM, USA), and results were expressed as mean ± SD. One-way ANOVA was used to assess differences between groups, with post-hoc tests performed to identify specific differences. A p-value of less than 0.05 was considered statistically significant.

Ct values have been determined using Bio-Rad CFX Manager Software (version 3.1).

 Results Characterization of Selenium Nanoparticles (SeNPs)

SEM images of biosynthesized selenium nanoparticles at magnifications of 5,000×, 10,000× and 20,000× with an accelerating voltage of 20 kV show nanomaterials sparsely aggregated in certain areas, but even distribution across most of the surface. At higher magnifications (10,000× and 20,000×), aggregation is reduced, allowing for uniform distribution of particles, as shown in Figure 1. The overall particle size is within nanometer range, proving them appropriate for biological purposes.

Morphological characterization of biosynthesized SeNPs using SEM.

Scanning electron microscopy (SEM) image illustrating the surface morphology of biosynthesized selenium nanoparticles (SeNPs), acquired at an accelerating voltage of 20 kV and a magnification of 10,000×. The scale bar represents 5 μm.

 Demographic profile of bacterial isolates based on age and sex

The demographic distributions of 32 Salmonella isolates from blood samples collected from 167 patients are summarized in Table 2. Eighteen (56.3%) of these isolates are female and 14 (43.7%) are male.

Demographic characteristics of <italic toggle="yes">Salmonella</italic> isolates stratified by age and sex (n = 32).
Age group (years) Female n (%) Male n (%) Total n (%)
<19 12 (37.5%) 6 (18.8%) 18 (56.3%)
29–20 3 (9.4%) 4 (12.5%) 7 (21.9%)
39–30 0 (0%) 2 (6.3%) 2 (6.3%)
>40 3 (9.4%) 2 (6.3%) 5 (15.6%)
Total n (%) 18 (56.3%) 14 (43.7%) 32 (100%)

Isolate recovery was dominantly from subjects in the age range less than 20 years, with 12 females (37.5%) affected and 6 males (18.8%). Sure group isolates in the 20–29 years category made up 7 (21.9%) with 3 females (9.4%) and 4 males (12.5%).

 Antimicrobial resistance profile of <italic toggle="yes">Salmonella</italic> isolates

Antimicrobial susceptibility testing on 32 Salmonella isolates revealed high levels of resistance towards certain beta-lactam antibiotics. All isolates (32, 100%) gave a positive result towards resistance against Piperacillin (PR), Ampicillin (AM), and Cefotaxime (CTX).

Only 2 (6.3%) of these isolates showed resistance to Imipenem (IMP) and 5 (15.6%) to Meropenem (MEM), thus indicating low resistance to carbapenems. Resistance among the fluoroquinolones was moderate, with resistance confirmed among 23 isolates (71.9%) for ciprofloxacin (CIP) and 24 isolates (75%) for levofloxacin (LEV).

Resistance toward other antibiotics comes as follows: Trimethoprim-Sulfamethoxazole (SXT) with 1 isolate (3.1%), Chloramphenicol (C) having 2 isolates (6.3%), and Tetracycline (TE) with 4 isolates (12.5%), as summarized in Table 3.

Antimicrobial resistance pattern of <italic toggle="yes">Salmonella</italic> isolates (n = 32).
Antibiotic name Antibiotic code Number of resistant isolates (%)
Piperacillin PR 32(100%)
Ampicillin AM 32(100%)
Cefotaxime CTX 32(100%)
Imipenem IMP 2(6.3%)
Meropenem MEM 5(15.6%)
Ciprofloxacin CIP 23(71.9%)
Levofloxacin LEV 24(75%)
Trimethoprim-Sulfamethoxazole SXT 1(3.1%)
Chloramphenicol C 2(6.3%)
Tetracycline TE 4(12.5%)

n, number of isolates; %, percentage; PR, piperacillin; AM, ampicillin; CTX, cefotaxime; IMP, imipenem; MEM, meropenem; CIP, ciprofloxacin; LEV, levofloxacin; SXT, trimethoprim–sulfamethoxazole; C, chloramphenicol; TE, tetracycline.

 Biofilm formation profile of bacterial isolates

The ability of the bacterial isolates to form biofilms was determined using the Congo Red and Microtiter Plate (MTP) assays. In the Congo Red assay, all 32 isolates were identified as biofilm producers, showing 100% positivity for biofilm generation. In the Microtiter Plate assay, 24 isolates (75%) were classified as strong biofilm formers, 7 isolates (22%) as moderate biofilm formers, and 1 isolate (3.1%) as a weak biofilm former, as summarized in Table 4, Figure 2.

Biofilm formation profile of <italic toggle="yes">Salmonella</italic> isolates (n = 32).
Assay Category Number of isolates Percentage (%)
Congo Red Producer 32 100
Microtiter Plate Strong 24 75
Moderate 7 22
Low 1 3.1

n, number of isolates; %, percentage.

 Biofilm formation profile of bacterial isolates assessed by Congo Red and Microtiter Plate assays.

Biofilm formation profile of the bacterial isolates as assessed by the Congo red agar method and the microtiter plate assay, showing the distribution of isolates classified as strong, moderate, or low biofilm producers.

 Dose-dependent downregulation of <italic toggle="yes">csgD</italic> and <italic toggle="yes">gapA</italic> gene expression revealed by RT-qPCR

Relative expression levels of the csgD and ssrB genes were determined by RT-qPCR, with gapA as the housekeeping gene for normalization. Fold change values (2^-ΔΔCt) were calculated relative to the control group and are shown as mean ± SD.

For csgD, the control group showed a stable expression (1.01 ± 0.18). Treatment at 12.5% concentration decreased expression (0.16 ± 0.01), whereas further decreases were recorded at increased concentrations: 0.09 ± 0.06 at 25%, 0.08 ± 0.04 at 50%, and 0.03 ± 0.02 at 100%, as shown in Figure 3.

Dose-dependent downregulation of csgD gene expression in Salmonella isolates treated with selenium nanoparticles (SeNPs).

Gene expression levels were quantified using the 2^−ΔΔCt method and normalized to the housekeeping gene gapA. Data are presented as mean ± SD.

For ssrB, the control group showed stable expression (1.02 ± 0.23). At 12.5% concentration, moderate reduction was detected (0.91 ± 0.29), followed by stronger decreases being recorded at 25% (0.75 ± 0.30), 50% (0.56 ± 0.23), and 100% (0.28 ± 0.16), as shown in Figure 4.The RT-qPCR results thus show that both csgD and ssrB gene expression was downregulated in a dose-dependent manner with respect to the treatment, with stronger reduction seen at higher concentrations.

Dose-dependent downregulation of ssrB gene expression in Salmonella isolates treated with selenium nanoparticles (SeNPs).

Relative gene expression was calculated using the 2^−ΔΔCt method and normalized to the housekeeping gene gapA. Data are presented as mean ± SD.

 Discussion

The above factors, among others, should contribute to the improved incidence of salmonellosis in persons less than 20 years old. These factors include lower doses needed to infect children, more symptomatic infection likely, more biological samples could be obtained for laboratory analysis, and heightened hospitalization rates to document better the cases of infection. 33 Gender-specific analysis demonstrated that infection rates were higher among females under 20 than among their male counterparts. This trend follows a previous study that reported that women are more exposed to contaminated food during preparation, especially raw meat and eggs. 33 Similar national indices were found internationally. For example, in Hong Kong (2003–2011), the ratio for females to males was 1.24:1; in the USA (2011), it was 1.09:1. Several studies conducted in London (2007–2011) and in Ireland (2012) reported negligible gender differences with ratios set at 1:1 and 0.90:1.11, respectively. 34–36 Moreover, Green (1992) had indicated that generally, females aged between 15 and 44 years recorded the incidence rates of enteric infections, including salmonellosis, higher than that for males. 37

Bacterial resistance has emerged as an issue acknowledged by the global community as a health hazard. Multi-drug resistant bacterial pathogens are rampant throughout the world. While the greatest numbers of pathogenic strains with serious resistance to drugs are those resistant to broad-spectrum cephalosporins and fluoroquinolones, Salmonella is one of them. 38 Clinical studies assess the strains resistant in general to common antibiotics such as ampicillin, nalidixic acid, and streptomycin, cefoperazone, and tetracycline. 39 The latest research has highlighted the serious health implications of multidrug-resistant Salmonella infection. For example, individuals infected with Salmonella resistant to one or more clinically important antibiotics are three times more susceptible to bloodstream invasion, and require hospitalization, compared with patients infected with the susceptible strains. 40 Excessive antibiotic uses have enabled the bacterial resistance-rising phenomenon as well as the resistance-gene arrays. 41

Bacterial biofilm (BBF) comprises a unique survival strategy that enables adaption of bacteria to environmental stress. Reportedly, most Salmonella strains can form biofilms that endow these bacteria with resistance from bactericidal actions such as host antibodies and often cause refractory infections. Biofilms are organized microcolonies differentiated by a complex communication system known as bacterial quorum sensing. Latest studies have portrayed quorum sensing as a major regulator in the control of biofilm formation, development, and functionality. 42

Salmonella virulence inside the host is mainly determined by its ability to form biofilms. 34 Biofilms provide an adaptive response to environmental stresses and antibiotics by altering bacterial gene expression for further resistance against both 43 ). Those feature characteristics by which Salmonella biofilms develop include causative factors composed mainly of curli fimbriae and cellulose in those aggregates. 44 Biofilm formation is mainly regulated by the curli subunit gene csgD, belonging to the LuxR family. 45 Post-transcriptional modulation is available through various environmental signals, including those from transcription factors like c-di-GMP and small RNAs (sRNA) that can act on csgD expression. 46

In the current study, SeNPs have a reducing effect on the Salmonella gene expression due to their anti-bacterial properties including Cathodestrupture of the cell wall; Referring DNA and protein interactions, Anti-biofilm development, Production of reactive oxygen species (ROS). 47 Nanotechnology gives a new boon to biofilms because engineering materials at the atomic and molecular levels provides high surface-to-volume ratios and reactivity. 48 Nanoscale metals can therefore change their physicochemical properties and new abilities that allow them to penetrate and inhibit biofilm formations. 49

Three stages characterize the interaction between nanoparticles and biofilms: transport near the biofilm, adherence to the biofilm surface, and migration within the biofilm. These processes differ by environmental conditions and composition of the extracellular polymeric matrix that hosts some nanoparticle property. 50 Some nanoparticles have intrinsic properties of anti-biofilm activity because they contain several antibacterial components, e.g. metal oxides or cationic surfactants. 42 Their large surface area combined with high reactivity and surface functionalization leads to an excellent-wave efficacy in biofilm destruction. Besides, nanoparticles also act as quorum-quenching)QQ) agents that interfere in bacterial cell-cell communication or inhibit quorum-sensing signaling that in turn forms complexes with signaling molecules and receptors. 51

This establishes selenium nanoparticles as a very promising antibiofilm and antimicrobial agent against multidrug-resistant Salmonella with probable use in clinical and food safety applications.

 Conclusion

Under dose-dependent conditions, selenium nanoparticles significantly reduced biofilm-related gene expression ( csgD and ssrB) and strongly inhibited the growth of multidrug-resistant Salmonella. Therefore, SeNPs may be contemplated as a potential adjunctive treatment for Salmonella infections.

 Ethical considerations

The Ethics Committee of the College of Science, Al-Mustansiriyah University approved this study on 2 January 2024 (Ref. No. BCSMU/1724/00073 M). The study involved the collection of clinical isolates and human blood samples. Written informed consent was obtained from all adult participants prior to sample collection. For participants under 18 years of age, written informed consent was obtained from their parents or legal guardians, in accordance with the Declaration of Helsinki and internationally accepted ethical standards for biomedical research. Consent for publication was obtained from all participants (or their legal guardians, where applicable), and all data were handled anonymously to ensure confidentiality.

 Data availability statement

The datasets generated and analyzed during the current study (including clinical data, antimicrobial susceptibility profiles, biofilm formation results, MIC values, and RT-qPCR data for Salmonella isolates treated with selenium nanoparticles) are available in the Zenodo repository. DOI: 10.5281/zenodo.18304092; https://doi.org/10.5281/zenodo.18304092. 52

Data is available under the terms of the Creative Commons Attribution 4.0 International.

 Acknowledgments

The authors express their gratitude to Mustansiriyah University, Baghdad, Iraq for providing the support and help necessary to complete this work.

 References Takaya A Yamamoto T Tokoyoda K : Humoral immunity vs. Salmonella. Front. Immunol. 2020;10:3155. 10.3389/fimmu.2019.03155 Rather MA Gupta K Mandal M : Microbial biofilm: formation, architecture, antibiotic resistance, and control strategies. Braz. J. Microbiol. 2021;52(4):1701–1718. 34558029 10.1007/s42770-021-00624-x PMC8578483 Galán-Relaño Á Valero Díaz A Huerta Lorenzo B : Salmonella and salmonellosis: an update on public health implications and control strategies. Animals. 2023;13(23):3666. 38067017 10.3390/ani13233666 PMC10705591 Xiang Y Zhu K Min K : Characterization of a Salmonella enterica serovar Typhimurium lineage with rough colony morphology and multidrug resistance. Nat. Commun. 2024;15(1):6123. 39033143 10.1038/s41467-024-50331-y PMC11271444 Mølbak K : Human health consequences of antimicrobial drug-resistant Salmonella and other foodborne pathogens. Clin. Infect. Dis. 2005;41(11):1613–1620. 16267734 10.1086/497599 Chen K Gao Y Li L : Increased drug resistance and biofilm formation ability in ST34-type Salmonella Typhimurium in China. Front. Microbiol. 2022;13:876500. 10.3389/fmicb.2022.876500 Chowdhury MSR Hossain H Rahman MN : Emergence of highly virulent multidrug- and extensively drug-resistant Escherichia coli and Klebsiella pneumoniae in buffalo subclinical mastitis. Sci. Rep. 2025;15:11704. 10.1038/s41598-025-95914-x Algammal AM Abo Hashem ME Alfifi KJ : Sequence analysis, antibiogram profile, virulence and antibiotic resistance genes of XDR and MDR Gallibacterium anatis. Infect Drug Resist. 2022;15:4321–4334. 10.2147/IDR.S377797 Paudel S Alispahic M Liebhart D : Assessing pathogenicity of Gallibacterium anatis in chickens. Avian Pathol. 2013;42(6):527–535. 10.1080/03079457.2013.843160 Chen HM Wang Y Su LH : Nontyphoid Salmonella infection: microbiology, clinical features, and antimicrobial therapy. Pediatr. Neonatol. 2013;54(3):147–152. 23597525 10.1016/j.pedneo.2013.01.010 Steenackers H Hermans K Vanderleyden J : Salmonella biofilms: occurrence, structure, regulation and eradication. Food Res. Int. 2012;45:502–531. 10.1016/j.foodres.2011.01.038 Stepanović S Cirković I Ranin L : Biofilm formation by Salmonella spp. and Listeria monocytogenes. Lett. Appl. Microbiol. 2004;38(5):428–432. 10.1111/j.1472-765X.2004.01513.x Hall-Stoodley L Stoodley P : Evolving concepts in biofilm infections. Cell. Microbiol. 2009;11(7):1034–1043. 19374653 10.1111/j.1462-5822.2009.01323.x EFSA, ECDC: The European Union One Health 2021 zoonoses report. EFSA J. 2022;20(12):e07666. 10.2903/j.efsa.2022.7666 Cangui-Panchi SP Ñacato-Toapanta AL Enríquez-Martínez LJ : Immune response on biofilms-host pathogen interactions. Curr Res Immunol. 2023;4:100057. 10.1016/j.crimmu.2023.100057 González JF Alberts H Lee J : Biofilm formation protects Salmonella from ciprofloxacin. Sci. Rep. 2018;8:222. 10.1038/s41598-017-18516-2 Mirghani R Saba T Khaliq H : Biofilms: formation, drug resistance and alternatives. AIMS Microbiol. 2022;8(3):239–277. 10.3934/microbiol.2022019 Manafi L Aliakbarlu J Dastmalchi Saei H : Antibiotic resistance and biofilm formation of Salmonella. J. Food Sci. 2020;85(8):2516–2522. 10.1111/1750-3841.15335 Zhang B Bai P Zhao X : Increased growth rate and amikacin resistance of Salmonella enteritidis after spaceflight. MicrobiologyOpen. 2019;8(9):e00833. 10.1002/mbo3.833 Lamas A Miranda JM Regal P : Review of non-enterica subspecies of Salmonella enterica. Microbiol. Res. 2018;206:60–73. 10.1016/j.micres.2017.09.010 Hemeg HA : Nanomaterials for alternative antibacterial therapy. Int. J. Nanomedicine. 2017;Volume 12:8211–8225. 29184409 10.2147/IJN.S132163 PMC5689025 Gupta D Singh A Khan AU : Nanoparticles as efflux pump and biofilm inhibitors. Nanoscale Res. Lett. 2017;12:454. 10.1186/s11671-017-2222-6 Dizaj SM Lotfipour F Barzegar-Jalali M : Antimicrobial activity of the metals and metal oxide nanoparticles. Mater. Sci. Eng. C. 2014;44:278–284. 10.1016/j.msec.2014.08.031 Magiorakos AP Srinivasan A Carey RB : MDR, XDR and PDR bacteria definitions. Clin. Microbiol. Infect. 2012;18(3):268–281. 10.1111/j.1469-0691.2011.03570.x CLSI: Performance standards for antimicrobial susceptibility testing. Wayne, PA: 33rd ed.2023. Mohsin AS Alsakini AH Ali MR : Molecular characterization of Dr/Afa genes in MDR E. coli. Biomedicine. 2022;42(3):523–529. 10.51248/.v42i3.1632 Cimdins A Simm R : Semiquantitative analysis of rdar morphology. Methods Mol. Biol. 2017;1657:225–241. 10.1007/978-1-4939-7240-1_18 Avila-Novoa MG Guerrero-Medina PJ Navarrete-Sahagún V : Biofilm formation by MDR Salmonella. Appl. Sci. 2021;11(8):3581. 10.3390/app11083581 Kora AJ Rastogi L : Bacteriogenic synthesis of selenium nanoparticles. IET Nanobiotechnol. 2017;11(2):179–184. 28477001 10.1049/iet-nbt.2016.0011 PMC8676288 Vahdati M Tohidi Moghadam T : Selenium nanoparticles-lysozyme nanohybrid. Sci. Rep. 2020;10:510. 10.1038/s41598-019-57333-7 Saleh A El-Masry TA Negm WA : Antibacterial potential of selenium nanoparticles against Salmonella. Eur. Rev. Med. Pharmacol. Sci. 2023;27(8):3631–3644. 37140314 10.26355/eurrev_202304_32149 Livak KJ Schmittgen TD : Analysis of relative gene expression using 2−ΔΔCT. Methods. 2001;25(4):402–408. Gantois I Ducatelle R Pasmans F : Mechanisms of egg contamination by Salmonella Enteritidis. FEMS Microbiol. Rev. 2009;33(4):718–738. 10.1111/j.1574-6976.2008.00161.x Punchihewage-Don AJ Hawkins J Adnan AM : Antimicrobial resistant Salmonella in poultry. Heliyon. 2022;8(11):e11571. 10.1016/j.heliyon.2022.e11571 Health Protection Agency: Epidemiology of Salmonella infections in London, 2007–2011. London:2013. Health Protection Surveillance Centre: Annual reports on salmonellosis in Ireland. Dublin:2013. Green MS : Male predominance in infectious diseases in children. Int. J. Epidemiol. 1992;21(2):381–386. 10.1093/ije/21.2.381 Bjarnsholt T Buhlin K Dufrêne YF : Biofilm formation: recent developments. J. Intern. Med. 2018;284(4):332–345. 10.1111/joim.12782 Zarnowski R Sanchez H Covelli AS : Candida albicans biofilm-induced vesicles. PLoS Biol. 2018;16(10):e2006872. 10.1371/journal.pbio.2006872 Ling ML Ching P Apisarnthanarak A : APSIC guide for prevention of CAUTIs. Antimicrob. Resist. Infect. Control. 2023;12:52. 10.1186/s13756-023-01254-8 Senpuku H Tuna EB Nagasawa R : Polypyrrole inhibition of Streptococcus mutans biofilm. PLoS One. 2019;14(11):e0225584. 10.1371/journal.pone.0225584 Wang Y Wang Y Sun L : Streptococcus suis biofilm mechanisms. Appl. Microbiol. Biotechnol. 2018;102(21):9121–9129. 10.1007/s00253-018-9356-z Römling U : Characterization of the rdar morphotype. Cell. Mol. Life Sci. 2005;62(11):1234–1246. 15818467 10.1007/s00018-005-4557-x PMC11139082 Collinson SK Clouthier SC Doran JL : Salmonella enteritidis agfBAC operon. J. Bacteriol. 1996;178(3):662–667. 10.1128/jb.178.3.662-667.1996 Zakikhany K Harrington CR Nimtz M : Unphosphorylated csgD controls biofilm formation. Mol. Microbiol. 2010;77(3):771–786. 10.1111/j.1365-2958.2010.07247.x Wang L Hu C Shao L : Antimicrobial activity of nanoparticles. Int. J. Nanomedicine. 2017;12:1227–1249. 10.2147/IJN.S121956 Mohanta YK Chakrabartty I Mishra AK : Nanotechnology in combating biofilm. Front. Microbiol. 2023;13:1028086. 10.3389/fmicb.2022.1028086 Azeem K Fatima S Ali A : Biochemistry of bacterial biofilm. Life (Basel). 2025;15(1):49. 10.3390/life15010049 Shkodenko L Kassirov I Koshel E : Metal oxide nanoparticles against bacterial biofilms. Microorganisms. 2020;8(10):1545. 10.3390/microorganisms8101545 Shrestha L Fan HM Tao HR : Strategies to combat biofilms. Pathogens. 2022;11(3):292. 10.3390/pathogens11030292 Lahiri D Nag M Sheikh HI : Microbiologically synthesized nanoparticles and biofilm signaling. Front. Microbiol. 2021;12:636588. 10.3389/fmicb.2021.636588 Mohsin AS : Underlying data for Salmonella isolates treated with selenium nanoparticles. Zenodo. 2026. 10.5281/zenodo.18304092 10.5256/f1000research.194754.r477091 Reviewer response for version 1 mirani zulfiqar Ali 1 Referee https://orcid.org/0000-0002-3416-6311 Microbiology Section, PCSIR Laboratories Complex, karachi, sindh, Pakistan

Competing interests: No competing interests were disclosed.

 12 5 2026 Copyright: © 2026 mirani zA 2026 This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. recommendation reject

Response to Question 1: Is the work clearly and accurately presented and does it cite the current literature?

Answer: Partly

Point 1.1: Abstract claims UV-Vis, DLS, and TEM characterization – but only SEM data are presented.

Point 1.2: MIC values for the three isolates used in RT-qPCR are not reported.

Point 1.3:  gapA is incorrectly claimed to be a "specific marker for  Salmonella species."

Point 1.4: Congo Red Agar protocol omitted fermentable sugar (e.g., sucrose), risking false negatives.

Point 1.5: Criteria for selecting the three isolates for RT-qPCR are not explained.

Point 1.6: Gene  ssrB is misspelled as " srsB" in Figure 4 and elsewhere.

Point 1.7: Typographical error: "cathodestrupture" appears in the discussion.

Point 1.8: Reference 52 cites the authors' own data repository – should be in Data Availability Statement, not references.

Point 1.9: Literature citation is otherwise adequate and current.

Response to Question 2: Is the study design appropriate and is the work technically sound?

Answer: Partly

Point 2.1: No direct antibacterial data (CFU counts, growth curves, viability assays, or biofilm biomass reduction) are provided to support claims of "strong antimicrobial activity."

Point 2.2: Nanoparticle stability between synthesis (November 2023) and sample collection (January–June 2024) is not addressed.

Point 2.3: SeNP biosynthesis protocol lacks critical details (incubation time/temperature, precursor concentration, harvesting method, storage conditions, final concentration).

Point 2.4: Only three isolates were used for RT-qPCR – insufficient to represent 32 isolates.

Point 2.5: Negative control for biofilm OD cutoff calculation is not clearly defined.

Point 2.6: No biological replicates are specified for RT-qPCR (only technical replicates mentioned).

Response to Question 3: Are sufficient details of methods and analysis provided to allow replication by others?

Answer: Partly

Point 3.1: SeNP synthesis protocol lacks purification, drying, and storage details.

Point 3.2: Primer sequences are provided, but annealing temperature for  gapA (56°C) differs from  csgD/ssrB (60°C) – validation of multiplex or separate runs is not described.

Point 3.3: Microtiter plate biofilm assay details (incubation time, washing steps, staining duration) are incomplete.

Point 3.4: SEM accelerating voltage is reported as 15kV in Methods but 20kV in Results – inconsistent.

Point 3.5: RNA purity criteria (e.g., A260/A280 ratio) are not reported.

Response to Question 4: If applicable, is the statistical analysis and its interpretation appropriate?

Answer: Partly

Point 4.1: p-values are not reported for gene expression comparisons.

Point 4.2: The post-hoc test used after ANOVA is not named.

Point 4.3: It is unclear whether statistical analysis was performed on ΔCt values (appropriate) or fold-change values (inappropriate for parametric tests).

Point 4.4: Confidence intervals are not provided.

Point 4.5: Sample size per comparison group is not clearly stated.

Point 4.6: Figures 3 and 4 show trends but do not indicate statistical significance (e.g., with asterisks or letters).

Response to Question 5: Are all the source data underlying the results available to ensure full reproducibility?

Answer: Partly

Point 5.1: A Zenodo DOI is provided (10.5281/zenodo.18304092), but it is not verified whether this contains raw data (e.g., Ct values, OD readings, MIC values).

Point 5.2: Raw SEM images beyond the single representative figure are not provided.

Point 5.3: Individual isolate-level data (resistance profiles, biofilm ODs) are presented only in aggregate.

Point 5.4: RT-qPCR raw Ct values and melt curve data are not included in the repository (based on the manuscript description).

  Response to Question 6: Are the conclusions drawn adequately supported by the results?

Answer: Partly

Point 6.1: The conclusion that SeNPs "strongly inhibit the growth" of MDR  Salmonella is not supported by direct growth or viability data.

Point 6.2: Claims about clinical and food-safety applications are premature given the in vitro nature of the study.

Point 6.3: No toxicity, selectivity, or in vivo efficacy data are presented to support therapeutic claims.

Point 6.4: The dose-dependent downregulation of  csgD and  ssrB is well-supported by the RT-qPCR data.

Point 6.5: The conclusion should be revised to reflect a preliminary in vitro observation rather than a therapeutic recommendation.

Is the work clearly and accurately presented and does it cite the current literature?

No

If applicable, is the statistical analysis and its interpretation appropriate?

No

Are all the source data underlying the results available to ensure full reproducibility?

Partly

Is the study design appropriate and is the work technically sound?

Partly

Are the conclusions drawn adequately supported by the results?

Partly

Are sufficient details of methods and analysis provided to allow replication by others?

No

Reviewer Expertise:

Microbiology

I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.

 10.5256/f1000research.194754.r477093 Reviewer response for version 1 El-Tayeb Ali Mohamed Abdellatif 1 Referee King Saud University, Riyadh, Riyadh Province, Saudi Arabia

Competing interests: No competing interests were disclosed.

 7 5 2026 Copyright: © 2026 El-Tayeb Ali MA 2026 This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. recommendation approve-with-reservations

This study aimed to investigate the effect of selenium nanoparticles on biofilm formation on antibiotic-resistant Salmonella isolates. A total of 167 blood samples were collected from patients, and 32 Salmonella isolates were isolated and confirmed using biochemical tests and the VITEK® 2 Compact system. The authors investigated the properties of the selenium nanoparticles, tested the isolates' antibiotic susceptibility, and assessed biofilm formation using Congo red agar and microtiter plate assays. The results showed that most isolates formed biofilms and exhibited antibiotic resistance. The authors also investigated the downregulation of csgD and ssrB expression after SeNP treatment using RT-PCR.

In general, the topic is important and contributes to finding ways to solve the problem of multidrug-resistant Salmonella and biofilm-associated infections, which continue to pose a health and economic burden.

ABSTRACT

Selenium nanoparticles were biosynthesized and characterized (UV-Vis, DLS, TEM) and applied at sub-MIC concentrations.

Comment: 

The authors used only a SEM to study the properties of Selenium nanoparticles.

INTRODUCTION

Comments

1.   Salmonella typhimurium (The scientific name is incorrect). The correct name is Salmonella Typhimurium

2. The aim of the study should be placed at the end of the introduction.

MATERIALS AND METHODS

1. The authors used the gapA gene as a specific marker for Salmonella species

Comment

The gapA gene is not specific to Salmonella; it is also present in E. coli. It  acts as a conserved housekeeping gene in a phylogenetic marker. The most commonly used genes for Salmonella detection are  invA, hilA, and spvC. 

2. Congo Red Agar was prepared by supplementing brain heart infusion agar with 0.8 g/L Congo red dye (Sigma-Aldrich, USA, Cat. No. C6277).

Comment

Sucrose or a similar fermentable sugar should have been added. If sugar is not added, it might result in a false negative result.

RESULTS

Characterization of Selenium Nanoparticles

Comment

As shown in Figure 1, the SEM was performed on November 19, 2023, while the samples were collected between January and June 2024.

It is noted that there is a gap between the synthesis of the nanoparticles and the experiments conducted on them. Does this gap affect the structural stability and efficiency of these nanoparticles?

Is the work clearly and accurately presented and does it cite the current literature?

Partly

If applicable, is the statistical analysis and its interpretation appropriate?

I cannot comment. A qualified statistician is required.

Are all the source data underlying the results available to ensure full reproducibility?

Partly

Is the study design appropriate and is the work technically sound?

Partly

Are the conclusions drawn adequately supported by the results?

Partly

Are sufficient details of methods and analysis provided to allow replication by others?

Partly

Reviewer Expertise:

Medical bacteriology, Antibiotic resistance genes, Virulence genes

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

 10.5256/f1000research.194754.r479765 Reviewer response for version 1 Prakash N. Tejo 1 Referee https://orcid.org/0000-0003-3422-5550 Thapar Institute of Engineering and Technology, Patiala, India

Competing interests: No competing interests were disclosed.

 30 4 2026 Copyright: © 2026 Prakash NT 2026 This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. recommendation approve-with-reservations

This study investigates the antimicrobial and antibiofilm effects of biosynthesized selenium nanoparticles against multidrug-resistant Salmonella isolates recovered from blood samples. Thirty-two Salmonella isolates were obtained from 167 patient blood samples. The authors assessed antibiotic resistance, biofilm formation using Congo red agar and microtiter plate assays, synthesized and characterized selenium nanoparticles, determined MIC values, and evaluated the expression of biofilm-associated genes csgD and ssrB using RT-qPCR. The study reports high resistance to several beta-lactam antibiotics, strong biofilm formation in most isolates, and dose-dependent downregulation of csgD and ssrB after SeNP treatment.

Overall, the topic is relevant and potentially valuable, particularly because MDR Salmonella and biofilm-associated infections remain important clinical and food-safety concerns.

1. The presentation needs substantial improvement. Several sections contain grammatical errors, unclear phrasing, and overly broad statements. For example, the introduction sometimes reads like a general review rather than a focused rationale for the study. The novelty of the work is also not clearly established. Since antimicrobial and antibiofilm effects of selenium nanoparticles have already been studied, the authors should clearly explain what specific knowledge gap this study addresses.

2. There are important weaknesses in technical design. The study uses only 32 isolates, and only three MDR biofilm-producing isolates appear to have been selected for RT-qPCR. The criteria for choosing these three isolates are not clearly explained. Also, the manuscript claims antimicrobial activity, but the reported results mainly emphasize resistance patterns and gene-expression changes. More direct antibacterial data, such as MIC values for each isolate, growth curves, viability assays, or biofilm biomass reduction after SeNP treatment, should be shown.

Nanoparticle characterization is also incomplete. The abstract mentions UV-Vis, DLS, and TEM, but the methods/results mainly describe SEM. This inconsistency must be corrected.

3. Several essential details are missing or unclear. The SeNP biosynthesis protocol is insufficiently described. The manuscript states that SeNPs were biosynthesized using E. coli ATCC 35218 according to a previous protocol, but replication requires details such as incubation conditions, precursor concentration, purification method, drying/storage conditions, and final nanoparticle concentration. The biofilm assay also needs more detail regarding negative controls, OD cutoff calculation, biological replicates, and whether the same isolates were used across all assays.

4. The statistical reporting is incomplete. The manuscript does not clearly report p-values, confidence intervals, post-hoc test names, assumptions of ANOVA, or sample size per comparison. The figures show trends but do not clearly indicate statistical significance. For RT-qPCR, it is also unclear whether biological replicates were sufficient and whether ΔCt values, rather than fold-change values, were statistically analyzed.

5. Broader claims that SeNPs “strongly inhibit the growth” of MDR Salmonella and may be used as adjunctive therapeutic agents are not fully supported by the presented data. The study does not provide enough direct evidence for clinical application, toxicity, selectivity, in vivo efficacy, or food-safety applications. The conclusion should be narrowed to reflect an in vitro preliminary study.

The manuscript is therefore recommended for  major revision before it can be considered scientifically sound.

Is the work clearly and accurately presented and does it cite the current literature?

Partly

If applicable, is the statistical analysis and its interpretation appropriate?

Partly

Are all the source data underlying the results available to ensure full reproducibility?

Partly

Is the study design appropriate and is the work technically sound?

Partly

Are the conclusions drawn adequately supported by the results?

Partly

Are sufficient details of methods and analysis provided to allow replication by others?

Partly

Reviewer Expertise:

Selenium quantification, speciation and bioactivity

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.