<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.179581.1</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>Design and Molecular Validation of eNOS PCR Primers for Gene Expression Studies in Rat Corpus Cavernosum: A Tool for Erectile Dysfunction Research</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 1; peer review: awaiting peer review]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Hadibrata</surname>
                        <given-names>Exsa</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Setiawan</surname>
                        <given-names>Wawan Abdullah</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Putri</surname>
                        <given-names>Adinda Nurulita</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Software</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <xref ref-type="aff" rid="a3">3</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Sutyarso</surname>
                        <given-names>Sutyarso</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Busman</surname>
                        <given-names>Hendri</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Mustofa</surname>
                        <given-names>Syazili</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-7646-0869</uri>
                    <xref ref-type="aff" rid="a4">4</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Syamhudi</surname>
                        <given-names>Muhammad Farras Afif</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Software</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0009-0004-2265-917X</uri>
                    <xref ref-type="corresp" rid="c2">b</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Brodjonegoro</surname>
                        <given-names>Sakti Ronggowardhana</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <xref ref-type="aff" rid="a5">5</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Department of Urology, University of Lampung Faculty of Medicine, Bandar Lampung, Lampung, 35141, Indonesia</aff>
                <aff id="a2">
                    <label>2</label>Department of Biology, Lampung University Faculty of Mathematics and Natural Sciences, Bandar Lampung, Lampung, 35141, Indonesia</aff>
                <aff id="a3">
                    <label>3</label>Students of Magister Agronomy Program, Lampung University Faculty of Agriculture, Bandar Lampung, Lampung, 35141, Indonesia</aff>
                <aff id="a4">
                    <label>4</label>Department of Biochemistry and Biomolecular, University of Lampung Faculty of Medicine, Bandar Lampung, Lampung, 35141, Indonesia</aff>
                <aff id="a5">
                    <label>5</label>Department of Urology, Gadjah Mada University Faculty of Medicine, Yogyakarta, Special Region of Yogyakarta, 55281, Indonesia</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:exsa.hadibrata@gmail.com">exsa.hadibrata@gmail.com</email>
                </corresp>
                <corresp id="c2">
                    <label>b</label>
                    <email xlink:href="mailto:farrassyamhudi@yahoo.co.id">farrassyamhudi@yahoo.co.id</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>30</day>
                <month>4</month>
                <year>2026</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2026</year>
            </pub-date>
            <volume>15</volume>
            <elocation-id>643</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>9</day>
                    <month>4</month>
                    <year>2026</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2026 Hadibrata E et al.</copyright-statement>
                <copyright-year>2026</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/15-643/pdf"/>
            <abstract>
                <sec>
                    <title>Background</title>
                    <p>Endothelial nitric oxide synthase (eNOS) plays an important role in erectile physiology through nitric oxide production in penile vascular tissue. Reduced eNOS expression has been associated with diabetes-related erectile dysfunction, making reliable molecular detection of this gene important for experimental studies. This study aimed to design and validate PCR primers targeting the eNOS gene in Rattus norvegicus corpus cavernosum tissue for future gene expression applications.</p>
                </sec>
                <sec>
                    <title>Methods</title>
                    <p>Three primer pairs (N1, N2, and N3) were designed using NCBI Primer-BLAST based on the Rattus norvegicus eNOS reference sequence (NM_021838.2). Total RNA was extracted from corpus cavernosum tissue of Sprague-Dawley rats, followed by cDNA synthesis. Primer performance was evaluated using high-resolution melting (HRM) analysis across an annealing temperature range of 50&#x2013;61&#x00a0;&#x00b0;C. Amplicon specificity was assessed by conventional PCR, agarose gel electrophoresis, and Sanger sequencing, followed by sequence alignment using BLAST.</p>
                </sec>
                <sec>
                    <title>Results</title>
                    <p>All primer pairs generated detectable amplification products, with optimal annealing observed at 57&#x00a0;&#x00b0;C. Agarose gel electrophoresis demonstrated single bands corresponding to expected product sizes of 869&#x00a0;bp (N1), 944&#x00a0;bp (N2), and 874&#x00a0;bp (N3). Sequence alignment confirmed target specificity, with identity values of 99.35% for N1, 97.77% for N2, and 100.00% for N3 relative to the reference sequence. Among the three candidates, primer pair N3 showed the highest sequence specificity and the most consistent amplification profile.</p>
                </sec>
                <sec>
                    <title>Conclusions</title>
                    <p>The three primer pairs were successfully validated for conventional PCR amplification of the eNOS gene in Rattus norvegicus. Primer pair N3 demonstrated the highest specificity and may serve as a reference candidate for further molecular studies involving eNOS detection in experimental erectile dysfunction models. Additional optimization is required before application in quantitative PCR assays.</p>
                </sec>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>eNOS</kwd>
                <kwd>Primer Design</kwd>
                <kwd>Rattus norvegicus</kwd>
                <kwd>qPCR</kwd>
                <kwd>Erectile Dysfunction</kwd>
                <kwd>Diabetes Mellitus</kwd>
            </kwd-group>
            <funding-group>
                <funding-statement>The author(s) declared that no grants were involved in supporting this work.</funding-statement>
            </funding-group>
        </article-meta>
    </front>
    <body>
        <sec id="sec5" sec-type="intro">
            <title>Introduction</title>
            <p>Nitric oxide (NO) is a ubiquitous signaling molecule essential for the maintenance of diverse physiological and pathological processes in nearly all living organisms (
                <xref ref-type="bibr" rid="ref13">Locascio et al., 2023</xref>). Within the vascular system, NO is synthesized from L-arginine by the nitric oxide synthase (NOS) family, which comprises three distinct isoforms: neuronal (nNOS), endothelial (eNOS), and inducible (iNOS). NO acts as a critical regulator of systemic functions, ranging from arterial blood pressure maintenance to the complex mechanics of penile erection (
                <xref ref-type="bibr" rid="ref11">Forstermann &amp; Sessa, 2011</xref>). Furthermore, within the central nervous system, NO modulates energy homeostasis, memory, and sexual behavior by acting in the paraventricular nucleus and the medial preoptic area (
                <xref ref-type="bibr" rid="ref14">Melis &amp; Argiolas, 2021</xref>).</p>
            <p>In sexual physiology, NO induces the relaxation of smooth muscle tissue within the 
                <italic toggle="yes">corpus cavernosum</italic>, facilitating increased blood flow to the penis and triggering the erectile response (
                <xref ref-type="bibr" rid="ref8">Davies, 2015</xref>). Consequently, aberrations in NO synthesis can lead to erectile dysfunction (ED). Patients with cardiovascular risk factors&#x2014;such as hypertension and diabetes mellitus&#x2014;frequently exhibit endothelial dysfunction, characterized by the inability of the endothelium to produce sufficient bioactive NO (
                <xref ref-type="bibr" rid="ref11">Forstermann &amp; Sessa, 2011</xref>). Specifically, eNOS expression is significantly downregulated in Type 2 diabetes (
                <xref ref-type="bibr" rid="ref3">Bahadoran et al., 2023</xref>), correlating with a high incidence of erectile disorders (
                <xref ref-type="bibr" rid="ref9">Defeudis et al., 2021</xref>).</p>
            <p>Given the rising global prevalence of diabetes, there is an urgent need for effective pharmacotherapies. Developing these products requires rigorous efficacy testing using model organisms such as the Sprague-Dawley strain of Rattus norvegicus (
                <xref ref-type="bibr" rid="ref4">Bryda, 2013</xref>). A critical component of these studies is the molecular analysis of gene expression using quantitative PCR (qPCR), which offers high sensitivity and efficiency (
                <xref ref-type="bibr" rid="ref5">Bustin, 2002</xref>). However, the reliability of qPCR depends on primer design (
                <xref ref-type="bibr" rid="ref7">Chen et al., 2023</xref>). Therefore, this study aims to design and validate PCR primers for the 
                <italic toggle="yes">eNOS</italic> gene to provide a standardized reference for evaluating novel treatments for erectile dysfunction in diabetic models.</p>
        </sec>
        <sec id="sec6">
            <title>Materials and methods</title>
            <sec id="sec7">
                <title>Ethical statement and biological models</title>
                <p>All experimental procedures were approved by the Health Research Ethics Committee, Faculty of Medicine, University of Lampung (No. 3468/UN26.18/PP.05.02.00/2024), and conducted in accordance with the 
                    <italic toggle="yes">Guide for the Care and Use of Laboratory Animals.</italic> Adult male 
                    <italic toggle="yes">Rattus norvegicus</italic> (Sprague-Dawley strain) were obtained from a certified breeder, Taufik Rat and Mice (No. 324/TRM/SK/VI/2024). This strain is widely used in cardiovascular and urological research because of its stable physiological characteristics (
                    <xref ref-type="bibr" rid="ref4">Bryda, 2013</xref>; 
                    <xref ref-type="bibr" rid="ref15">Nalbantoglu et al., 2024</xref>). Animals were acclimatized for seven days at the INALAB DNA facility (5&#x00b0;22&#x2032;8.33&#x2033; S, 105&#x00b0;14&#x2032;42.388&#x2033; E) under a 12-hour light/dark cycle before tissue collection. Rats were housed in wire-covered cages with hardwood shavings bedding (0.5&#x2013;1&#x00a0;cm thickness), which was replaced every three days to maintain hygiene and reduce microbial contamination. Six animals were housed per cage under controlled room temperature and humidity, with indirect natural daylight exposure. Standard pellet feed and water were provided, with both replaced daily. Prior to tissue harvesting, rats were anesthetized by intraperitoneal injection of ketamine (80&#x00a0;mg/kg body weight). Euthanasia was performed by cervical dislocation under deep anesthesia in accordance with the 
                    <xref ref-type="bibr" rid="ref2">American Veterinary Medical Association Guidelines for Animal Euthanasia (2020)</xref>. This procedure was performed while the animal was in an erect state or during courtship. Tissue collection was performed immediately after euthanasia to preserve nitric oxide synthase (NOS) mRNA levels in the corpus cavernosum (
                    <xref ref-type="bibr" rid="ref16">Park et al., 1999</xref>).</p>
            </sec>
            <sec id="sec8">
                <title>In silico primer design and characterization</title>
                <p>Specific oligonucleotide primers targeting the endothelial nitric oxide synthase (eNOS) transcript were designed using the NCBI Primer-BLAST suite. The Rattus norvegicus NOS reference sequence (RefSeq: 
                    <ext-link ext-link-type="uri" xlink:href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=search&amp;db=nucleotide&amp;doptcmdl=genbank&amp;term=NM_021838.2">NM_021838.2</ext-link>) was used as the alignment template. Primer design parameters were set to a GC content of 40&#x2013;60% and a melting temperature (Tm) of 55&#x2013;60&#x00a0;&#x00b0;C to ensure optimal hybridization efficiency (
                    <xref ref-type="bibr" rid="ref7">Chen et al., 2023</xref>). Three candidate primer pairs (N1, N2, and N3) were selected for experimental validation based on the absence of predicted secondary structures and 3&#x2032; self-complementarity. All primers were synthesized by Integrated DNA Technologies (Singapore).</p>
            </sec>
            <sec id="sec9">
                <title>Total RNA fractionation and quality control</title>
                <p>Total RNA was isolated from corpus cavernosum tissue using the easy-BLUE&#x2122; Total RNA Extraction Kit (Cat. No. 17061, iNtRON, Seongnam-si, South Korea). To preserve transcript integrity, tissue samples were cryo-pulverized in liquid nitrogen using a sterile mortar and pestle. The powdered tissue was then homogenized in 1&#x00a0;mL of easy-BLUE&#x2122; reagent. Phase separation was performed by adding 200&#x00a0;&#x03bc;L of chloroform (Cat. No. 1.02445.2500, Merck, Darmstadt, Germany), followed by centrifugation according to the manufacturer&#x2019;s instructions. RNA was precipitated using 400&#x00a0;&#x03bc;L of isopropanol (Cat. No. 1.00993.2500, Merck, Darmstadt, Germany), as described in established protocols (
                    <xref ref-type="bibr" rid="ref17">Stephenson, 2016</xref>). </p>
                <p>The RNA pellet was washed with 1&#x00a0;mL of 75% ethanol (Cat. No. 1.07017.2511, Merck, Darmstadt, Germany), gently mixed by inversion, and centrifuged at 10,000&#x00a0;rpm for 5&#x00a0;minutes. The supernatant was discarded, and the pellet was air-dried by inverting the microtube on clean tissue. RNA was then rehydrated in 30&#x00a0;&#x03bc;L of nuclease-free water (Cat. No. IBS-BW007A, iNtRON, Seongnam-si, South Korea) and dissolved by incubation at 55&#x00a0;&#x00b0;C for 45&#x00a0;minutes, with gentle tapping every 15&#x00a0;minutes.</p>
                <p>Quality Assessment: RNA concentration and purity (A260/A280 ratio) were quantified using a NanoPhotometer
                    <sup>&#x00ae;</sup> P300 (Implen, M&#x00fc;nchen, Germany). Only samples with a purity ratio of 1.8&#x2013;2.0 were progressed to downstream applications. To eliminate genomic DNA (gDNA) interference&#x2014;a common cause of false-positive results in qPCR&#x2014;samples were treated with 1&#x00a0;&#x03bc;L of RNase-Free DNase I (Cat. No. DNS050, Geneaid, Taipei, Taiwan) at 37&#x00a0;&#x00b0;C for 15&#x00a0;minutes (
                    <xref ref-type="bibr" rid="ref10">Die &amp; Roman, 2012</xref>).</p>
            </sec>
            <sec id="sec10">
                <title>Reverse transcription and cDNA synthesis</title>
                <p>First-strand cDNA was synthesized using the HiSenScript&#x2122; RH(&#x2212;) RT PreMix Kit (Cat. No. 25087, iNtRON, Seongnam-si, South Korea). The reaction was prepared by adding 2&#x00a0;&#x03bc;L of RNA extract, 18&#x00a0;&#x03bc;L of nuclease-free water (Cat. No. IBS-BW007A, iNtRON, Seongnam-si, South Korea), 0.25&#x00a0;&#x03bc;L of random hexamer primers, and 0.25&#x00a0;&#x03bc;L of oligo (dT) primers to the upper tube, followed by thorough mixing. This system employs a ribonuclease H-deficient reverse transcriptase, which minimizes RNA template degradation during long-range synthesis and enhances full-length cDNA yield (
                    <xref ref-type="bibr" rid="ref6">Bustin et al., 2009</xref>). The reaction mixture, containing both random hexamer and oligo (dT) primers, was incubated in a LineGene Mini S thermal cycler (Bioer, Hangzhou, China) at 42&#x00a0;&#x00b0;C for 15&#x00a0;minutes, followed by enzyme inactivation at 85&#x00a0;&#x00b0;C for 10&#x00a0;minutes.</p>
            </sec>
            <sec id="sec11">
                <title>Thermal optimization via High-Resolution Melting (HRM)</title>
                <p>To empirically determine the optimal annealing temperature (T
                    <sub>a</sub>), high-resolution melting (HRM) analysis was performed using RealMOD&#x2122; Green W2 2&#x00d7; qPCR mix (Cat. No. 25350, iNtRON, Seongnam-si, South Korea) in a LineGene Mini S thermal cycler (Bioer, Hangzhou, China). The PCR reaction mixture consisted of 5&#x00a0;&#x03bc;L of cDNA, 10&#x00a0;&#x03bc;L of RealMOD&#x2122; Green W2 2&#x00d7; qPCR mix, 5&#x00a0;&#x03bc;L of nuclease-free water (Cat. No. IBS-BW007A, iNtRON, Seongnam-si, South Korea), 0.25&#x00a0;&#x03bc;L of forward and reverse primers (10&#x00a0;&#x03bc;M each). This reaction composition was applied to each of the three primer pairs. HRM is a highly sensitive post-PCR technique that monitors the dissociation behavior of DNA duplexes, enabling the detection of nonspecific amplification products and primer dimers with greater precision than standard melting curve analysis (
                    <xref ref-type="bibr" rid="ref18">Tong &amp; Giffard, 2012</xref>). A temperature gradient ranging from 50 to 61&#x00a0;&#x00b0;C was applied, with a high-resolution ramp rate of 0.2&#x00a0;&#x00b0;C/s.</p>
            </sec>
            <sec id="sec12">
                <title>PCR amplification and amplicom verification</title>
                <p>Conventional PCR was performed using i-Taq 2&#x00d7; PCR Master Mix (Cat. No. 25027, iNtRON, Seongnam-si, South Korea) in a LineGene Mini S thermal cycler (Bioer, Hangzhou, China). Each reaction contained 5&#x00a0;&#x03bc;L of cDNA, 10&#x00a0;&#x03bc;L of i-Taq 2&#x00d7; PCR Master Mix, 5&#x00a0;&#x03bc;L of nuclease-free water (Cat. No. IBS-BW007A, iNtRON, Seongnam-si, South Korea), 0.25&#x00a0;&#x03bc;L of forward and reverse primers (10&#x00a0;&#x03bc;M each). This reaction composition was applied to each of the three primer pairs. The optimized thermal cycling conditions consisted of an initial denaturation at 95&#x00a0;&#x00b0;C for 5&#x00a0;minutes, followed by 35&#x00a0;cycles of denaturation at 95&#x00a0;&#x00b0;C for 1&#x00a0;minute, annealing at 57&#x00a0;&#x00b0;C for 15&#x00a0;seconds, and extension at 72&#x00a0;&#x00b0;C for 40&#x00a0;seconds.</p>
                <p>PCR amplification products were verified by agarose gel electrophoresis using a Mupid-exU electrophoresis system (Mupid, Tokyo, Japan) with a 1.2% agarose gel. The gel was prepared by dissolving 0.48&#x00a0;g of SeaKem
                    <sup>&#x00ae;</sup> LE Agarose (Cat. No. 50004, Lonza, Walkersville, USA) in 40&#x00a0;mL of 1&#x00d7; TAE buffer (Cat. No. IBS-BT002&#x2013;3, iNtRON, Seongnam-si, South Korea), followed by heating until the solution became fully dissolved and transparent. After cooling for approximately 30&#x2013;40&#x00a0;minutes, 2&#x00a0;&#x03bc;L of RedSafe&#x2122; nucleic acid staining solution (Cat. No. 21141, iNtRON, Seongnam-si, South Korea) was added under low-light conditions. The solution was then gently mixed, poured into a casting tray, and fitted with a comb to form wells. Once the gel had solidified, 7&#x00a0;&#x03bc;L of Sizer&#x2122;-100 DNA Marker (Cat. No. 24073, iNtRON, Seongnam-si, South Korea; 100&#x2013;1500&#x00a0;bp) was loaded into one well, followed by 5&#x00a0;&#x03bc;L of PCR products loaded into the remaining wells. Electrophoresis was conducted at 100&#x00a0;V for 25&#x00a0;minutes.</p>
            </sec>
            <sec id="sec13">
                <title>Genomic sequencing and bioinformatics analysis</title>
                <p>Verified PCR products were subjected to bidirectional Sanger Sequencing (PT. Inti Kemika Sejahtera, Jakarta, Indonesia). Sequence accuracy and genomic fidelity were assessed by aligning raw electropherograms to the reference genome using BioEdit and the NCBI BLAST database (
                    <xref ref-type="bibr" rid="ref1">Altschul et al., 1990</xref>).</p>
            </sec>
        </sec>
        <sec id="sec14" sec-type="results">
            <title>Results</title>
            <sec id="sec15">
                <title>In silico primer design and characterization</title>
                <p>Computational analysis using NCBI Primer-BLAST yielded three potential primer pairs (N1, N2, and N3) targeting the 
                    <italic toggle="yes">eNOS</italic> mRNA sequence of 
                    <italic toggle="yes">Rattus norvegicus</italic> (Accession: 
                    <ext-link ext-link-type="uri" xlink:href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=search&amp;db=nucleotide&amp;doptcmdl=genbank&amp;term=NM_021838.2">NM_021838.2</ext-link>). All candidates exhibited optimal thermodynamic parameters, with GC content ranging from 45.45% to 57.89% and a melting temperature (Tm) difference between the forward and reverse primers of less than 2&#x00a0;&#x00b0;C. Notably, the N3 pair demonstrated superior predicted specificity with a 3&#x2032; self-complementarity score of 0.00, suggesting a low probability of primer-dimer artifacts. The detailed physicochemical properties are summarized in 
                    <xref ref-type="table" rid="T1">
Table 1</xref>.</p>
                <table-wrap id="T1" orientation="portrait" position="float">
                    <label>
Table 1. </label>
                    <caption>
                        <title>Thermodynamic and physicochemical characteristics of candidate primer pairs (N1&#x2013;N3) designed 
                            <italic toggle="yes">in silico</italic> for amplification of the eNOS (endothelial nitric oxide synthase) gene from Rattus norvegicus mRNA (Accession: 
                            <ext-link ext-link-type="uri" xlink:href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=search&amp;db=nucleotide&amp;doptcmdl=genbank&amp;term=NM_021838.2">NM_021838.2</ext-link>), including primer sequence, length, melting temperature (Tm), predicted hairpin Tm, GC content, self 3&#x2032;-complementarity, and expected amplicon size.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">No</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Name</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Sequence (5&#x2032;&#x2794;3&#x2032;)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Length (nt)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Tm (&#x00b0;C)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Hairpin Tm</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">GC (%)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Self 3&#x2019; Complementarity</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Amplicon Size (bp)</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="2" valign="middle">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">N1F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GCAAGACCGATTACACGA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">18</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">54.79</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">35.1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">50.00</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.00</td>
                                <td align="left" colspan="1" rowspan="2" valign="middle">869</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">N1R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CCATCAAAGCATACGAAGAGG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">21</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">56.77</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">None</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">47.62</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.00</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="2" valign="top">2</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">N2F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GCTGCCACCTGATCCTAAC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">19</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">57.91</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">None</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">57.89</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.00</td>
                                <td align="left" colspan="1" rowspan="2" valign="middle">944</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">N2R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CCATCAAAGCATACGAAGAGG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">21</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">56.77</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">None</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">47.62</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.00</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="2" valign="top">3</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">N3F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GGCAAGACCGATTACACGA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">19</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">57.57</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">35.1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">52.63</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.00</td>
                                <td align="left" colspan="1" rowspan="2" valign="middle">874</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">N3R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAGTCCATCAAAGCATACGAAG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">22</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">57.47</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">None</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">45.45</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.00</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
            </sec>
            <sec id="sec16">
                <title>RNA quality and cDNA synthesis</title>
                <p>Total RNA extracted from the rat 
                    <italic toggle="yes">corpus cavernosum</italic> showed high integrity and concentration. Spectrophotometric analysis revealed RNA concentrations of 2590&#x00a0;ng/&#x03bc;L (Sample 1) and 2938&#x00a0;ng/&#x03bc;L (Sample 2). The purity ratios were 1.995 and 1.953, respectively, falling within the ideal range of 1.8&#x2013;2.0. These results confirmed that the extracts were free from significant protein and organic solvent contamination, providing a high-quality template for subsequent cDNA library construction.</p>
            </sec>
            <sec id="sec17">
                <title>Thermal optimization via High-Resolution Melting (HRM)</title>
                <p>HRM analysis (
                    <xref ref-type="fig" rid="f1">Figure 1</xref>) was conducted across a temperature gradient (50&#x2013;61&#x00a0;&#x00b0;C) to determine the optimal annealing temperature (Ta) empirically. The HRM profiles demonstrated successful amplification for all three primer pairs. The derivative melting curves showed stable amplicon formation with distinct peaks, indicating that the Ta range of 56.75&#x2013;58.7&#x00a0;&#x00b0;C is highly conducive to primer-template hybridization.</p>
                <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                    <label>
Figure 1. </label>
                    <caption>
                        <title>High-resolution melting (HRM) analysis of the three designed primer pairs was performed using the LineGene Mini S thermal cycler (Bioer, Hangzhou, China).</title>
                        <p>The derived HRM curves showed that fluorescence was most frequently detected between 56.75&#x00a0;&#x00b0;C and 58.7&#x00a0;&#x00b0;C, indicating that the optimal annealing temperature for primers N1, N2, and N3 is within this range. The presence of a single melting curve suggests that the primers specifically amplify the target sequence. Based on Ct values, although the differences were not significant, primer N3 showed slightly better amplification efficiency due to its lower Ct value.</p>
                    </caption>
                    <graphic id="gr1" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/198108/e6d38eda-a441-4c9a-afc1-aee78babc727_figure1.gif"/>
                </fig>
            </sec>
            <sec id="sec18">
                <title>Electrophoretic validation and amplicon specificity</title>
                <p>The specificity of the amplicons was verified through 1.2% agarose gel electrophoresis. At a Ta 57&#x00a0;&#x00b0;C, all primer pairs produced single, high-intensity bands at the predicted molecular weights: N1 (869&#x00a0;bp), N2 (944&#x00a0;bp), and N3 (874&#x00a0;bp) (
                    <xref ref-type="fig" rid="f2">Figure 2</xref>). The absence of nonspecific bands or primer dimers at this temperature confirmed high amplification stringency.</p>
                <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                    <label>
Figure 2. </label>
                    <caption>
                        <title>Electrophoresis results of amplification at 57&#x00a0;&#x00b0;C from left to right are N1, N2, N3, and marker size (MS).</title>
                        <p>Description: N1: PCR results with primer pair N1 (&#x00b1;850&#x00a0;bp). N2: PCR results with primer pair N2 (&#x00b1;950&#x00a0;bp). N3: PCR results with primer pair N3 (&#x00b1;850&#x00a0;bp). MS: Marker Size (100&#x2013;1000&#x00a0;bp).</p>
                    </caption>
                    <graphic id="gr2" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/198108/e6d38eda-a441-4c9a-afc1-aee78babc727_figure2.gif"/>
                </fig>
                <p>In contrast, amplification at 59&#x00a0;&#x00b0;C yielded suboptimal profiles, characterized by multiple non-specific bands and low-molecular-weight primer dimers (
                    <xref ref-type="fig" rid="f3">Figure 3</xref>). This indicates that exceeding the optimized Ta significantly compromises the fidelity of the 
                    <italic toggle="yes">eNOS</italic> amplification.</p>
                <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                    <label>
Figure 3. </label>
                    <caption>
                        <title>Electrophoresis results of amplification at 59&#x00a0;&#x00b0;C from left to right are N1, N2, N3, and marker size (MS).</title>
                        <p>Description: N1: PCR results with primer pair N1 (&#x00b1;400 &amp; 500&#x00a0;bp). N2: PCR results with primer pair N2 (&#x00b1;100 &amp; 200&#x00a0;bp). N3: PCR results with primer pair N3 (&#x00b1; 200 &amp; 300&#x00a0;bp). MS: Marker Size (100&#x2013;1000&#x00a0;bp).</p>
                    </caption>
                    <graphic id="gr3" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/198108/e6d38eda-a441-4c9a-afc1-aee78babc727_figure3.gif"/>
                </fig>
            </sec>
            <sec id="sec19">
                <title>Genomic fidelity via sanger sequencing</title>
                <p>Validation through Sanger sequencing confirmed the identity of the PCR products (
                    <xref ref-type="fig" rid="f4">Figure 4</xref>). BLAST analysis revealed high homology between the amplicons and the 
                    <italic toggle="yes">Rattus norvegicus</italic> eNOS RefSeq (
                    <ext-link ext-link-type="uri" xlink:href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=search&amp;db=nucleotide&amp;doptcmdl=genbank&amp;term=NM_021838.2">NM_021838.2</ext-link>). The N3 primer pair exhibited 100.00% identity, corresponding precisely to nucleotides 3104&#x2013;3258 of the reference sequence (
                    <xref ref-type="table" rid="T2">
Table 2</xref>). N1 and N2 showed 99.35% and 97.77% identity, respectively. Based on these findings, N3 was identified as the most reliable primer set for high-precision transcriptomic quantification.</p>
                <fig fig-type="figure" id="f4" orientation="portrait" position="float">
                    <label>
Figure 4. </label>
                    <caption>
                        <title>Results of eNOS gene sequencing of 
                            <italic toggle="yes">Rattus norvegicus.</italic>
</title>
                        <p>Sequencing results were used to verify primers N1, N2, and N3 through sequence alignment using BioEdit software with the reference sequence from NCBI (accession number 
                            <ext-link ext-link-type="uri" xlink:href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=search&amp;db=nucleotide&amp;doptcmdl=genbank&amp;term=NM_021838.2">NM_021838.2</ext-link>). Alignment of the four sequences showed that N1, N2, and N3 were conserved with the reference sequence at nucleotide positions 3104&#x2013;3258.</p>
                    </caption>
                    <graphic id="gr4" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/198108/e6d38eda-a441-4c9a-afc1-aee78babc727_figure4.gif"/>
                </fig>
                <table-wrap id="T2" orientation="portrait" position="float">
                    <label>
Table 2. </label>
                    <caption>
                        <title>BLAST identity analysis of eNOS amplicons.</title>
                        <p>Based on these findings, N3 was identified as the most reliable primer set for high-precision transcriptomic quantification.</p>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">No</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Primer pairs</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">

                                    <italic toggle="yes">Identity</italic> (%)</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">N1 (&#x00b1;400 &amp; 500&#x00a0;bp)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">99,35</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">2</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">N2 (&#x00b1;100 &amp; 200&#x00a0;bp)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">97,77</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">3</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">N3 (&#x00b1; 200 &amp; 300&#x00a0;bp)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">100,00</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
            </sec>
        </sec>
        <sec id="sec20" sec-type="discussion">
            <title>Discussion</title>
            <p>Quantification of endothelial nitric oxide synthase (eNOS) mRNA is a critical diagnostic parameter for assessing vascular health, particularly in diabetic models, where the NO-cGMP pathway is significantly impaired. This study successfully validated a high-fidelity primer set, identifying the N3 pair as the optimal molecular tool for 
                <italic toggle="yes">eNOS</italic> transcriptomic profiling.</p>
            <sec id="sec21">
                <title>Thermodynamic precision and primer specificity</title>
                <p>The thermodynamic properties of the primer-template duplex fundamentally dictate the success of any qPCR-based assay. In this study, the N3 primer set exhibited an optimal GC content (52.63%) and a melting temperature (Tm) that enabled high-stringency binding. A critical observation was the absence of self-complementarity (Self 3&#x2032; value: 0.00). Theoretically, this minimizes the risk of primer-dimer formation, which can otherwise sequester reaction components and inflate fluorescence signals, leading to false-positive quantification (
                    <xref ref-type="bibr" rid="ref7">Chen et al., 2023</xref>).</p>
                <p>By achieving a clean electrophoretic profile and a single-peak HRM dissociation curve, the N3 set ensures that the resulting Cq values reflect true biological variation rather than technical noise. This high level of specificity is essential because 
                    <italic toggle="yes">eNOS</italic> belongs to a family of related isoforms (nNOS and iNOS); thus, primers must be meticulously designed to avoid cross-amplification of non-target sequences (
                    <xref ref-type="bibr" rid="ref11">Forstermann &amp; Sessa, 2011</xref>).</p>
            </sec>
            <sec id="sec22">
                <title>Impact of thermal stringency on amplification fidelity</title>
                <p>Experimental optimization identified 57&#x00a0;&#x00b0;C as the optimal annealing temperature (Ta). While computational tools like Primer-BLAST provide theoretical Ta values, the actual biochemical environment&#x2014;including salt concentrations in the master mix and template complexity&#x2014;requires empirical validation (
                    <xref ref-type="bibr" rid="ref1">Altschul et al., 1990</xref>).</p>
                <p>The failure of amplification at 59&#x00a0;&#x00b0;C, characterized by non-specific &#x201c;ghost bands&#x201d; and dimers, illustrates the principle of &#x201c;kinetic mismatching.&#x201d; When the Ta approaches or exceeds the Tm of the primer-template duplex, the system&#x2019;s kinetic energy may exceed the hydrogen bond strength of the specific target, preventing stable hybridization. Under these conditions, free primers are more likely to interact with each other or bind to secondary, lower-affinity sites on the cDNA template (
                    <xref ref-type="bibr" rid="ref6">Bustin et al., 2009</xref>). The successful amplification at 57&#x00a0;&#x00b0;C represents a precise balance between the entropy of primers in solution and the enthalpy of binding to the target 
                    <italic toggle="yes">eNOS</italic> sequence.</p>
            </sec>
            <sec id="sec23">
                <title>Methodological significance in diabetes and erectile dysfunction research</title>
                <p>In diabetic models, hyperglycemia-induced oxidative stress leads to 
                    <italic toggle="yes">eNOS</italic> uncoupling, resulting in decreased mRNA stability and bioactive NO production (
                    <xref ref-type="bibr" rid="ref3">Bahadoran et al., 2023</xref>). Using a primer set with 100.00% identity (NM_021838.2) is essential to ensure that research on novel pharmacotherapies&#x2014;such as those involving piperine or natural antioxidants&#x2014;is based on accurate molecular data (
                    <xref ref-type="bibr" rid="ref15">Nalbantoglu et al., 2024</xref>).</p>
                <p>The application of High-Resolution Melting (HRM) analysis provides an added layer of reliability. Unlike conventional melting curve analysis, HRM is sensitive enough to detect single-nucleotide polymorphisms (SNPs) and subtle variations in amplicon composition. This ensures that the N3 primer set remains robust across different Sprague-Dawley colonies, where minor genetic drift may occur (
                    <xref ref-type="bibr" rid="ref18">Tong &amp; Giffard, 2012</xref>).</p>
            </sec>
            <sec id="sec24">
                <title>Limitations and future directions</title>
                <p>While mRNA quantification is a powerful tool for gene expression profiling, it is important to note that 
                    <italic toggle="yes">eNOS</italic> activity is also heavily regulated by post-translational modifications, such as phosphorylation at Ser1177. Therefore, while the N3 primer set offers a validated framework for transcriptomic analysis, future studies should complement these findings with Western Blotting for protein quantification and Griess assays for measuring total nitrate/nitrite levels to provide a holistic view of endothelial function (
                    <xref ref-type="bibr" rid="ref9">Defeudis et al., 2021</xref>).</p>
            </sec>
        </sec>
        <sec id="sec25" sec-type="conclusion">
            <title>Conclusion</title>
            <p>In conclusion, this study successfully designed, optimized, and validated three primer pairs for the eNOS gene in 
                <italic toggle="yes">Rattus norvegicus</italic> (Sprague-Dawley strain). Based on molecular analysis, an annealing temperature (Ta) of 57&#x00a0;&#x00b0;C was identified as optimal for specific amplification, with high thermal stability and no detectable primer-dimer formation.</p>
            <p>Among the candidates, the N3 primer pair (F: 5&#x2019;-GGCAAGACCGATTACACGA-3&#x2032;; R: 5&#x2019;-CAGTCCATCAAAGCATACGAAG-3&#x2032;) demonstrated the highest specificity, yielding a 100.00% identity match with the GenBank reference sequence (NM_021838.2). The N1 and N2 primers also showed high reliability with 99.35% and 97.77% identity, respectively.</p>
            <p>Given its perfect sequence alignment and clean electrophoretic profile, the N3 primer is highly recommended as a standardized molecular tool for RT-qPCR assays. This validated primer set provides a reliable foundation for future research investigating eNOS gene expression pathways and evaluating the efficacy of pharmacotherapies in treating diabetes-induced erectile dysfunction.</p>
        </sec>
    </body>
    <back>
        <sec id="sec28" sec-type="data-availability">
            <title>Data availability</title>
            <sec id="sec29">
                <title>Underlying data</title>
                <p>Zenodo: Underlying data for &#x2018;Design and Molecular Validation of eNOS PCR Primers for Gene Expression Studies in Rat Corpus Cavernosum&#x2019;, 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.5281/zenodo.19341556">https://doi.org/10.5281/zenodo.19341556</ext-link> (
                    <xref ref-type="bibr" rid="ref12">Hadibrata, 2026</xref>).</p>
                <p>The project contains the following underlying data:
                    <list list-type="bullet">
                        <list-item>
                            <label>&#x2022;</label>
                            <p>High-Resolution Melting (
                                <xref ref-type="fig" rid="f1">Figure 1</xref>).jpg (raw High-resolution melting (HRM) analysis)</p>
                        </list-item>
                        <list-item>
                            <label>&#x2022;</label>
                            <p>Amplification at 57&#x00a0;&#x00b0;C (
                                <xref ref-type="fig" rid="f2">
Figure 2</xref>).jpg (raw Electrophoresis results of amplification at 57&#x00a0;&#x00b0;C)</p>
                        </list-item>
                        <list-item>
                            <label>&#x2022;</label>
                            <p>Amplification at 59&#x00a0;&#x00b0;C (
                                <xref ref-type="fig" rid="f3">
Figure 3</xref>).jpg (raw Electrophoresis results of amplification at 59&#x00a0;&#x00b0;C)</p>
                        </list-item>
                        <list-item>
                            <label>&#x2022;</label>
                            <p>Results of eNOS gene sequencing (
                                <xref ref-type="fig" rid="f4">
Figure 4</xref>).jpg (raw Results of eNOS gene sequencing of 
                                <italic toggle="yes">Rattus norvegicus.</italic>)</p>
                        </list-item>
                    </list>
                </p>
                <p>Data are available under the terms of the 
                    <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution 4.0 International</ext-link>.</p>
            </sec>
            <sec id="sec30">
                <title>Extended data</title>
                <p>Zenodo: Extended data for &#x2018;Design and Molecular Validation of eNOS PCR Primers for Gene Expression Studies in Rat Corpus Cavernosum&#x2019;, 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.5281/zenodo.19341556">https://doi.org/10.5281/zenodo.19341556</ext-link> (
                    <xref ref-type="bibr" rid="ref12">Hadibrata, 2026</xref>).</p>
                <p>This project contains the following extended data:
                    <list list-type="bullet">
                        <list-item>
                            <label>&#x2022;</label>
                            <p>Thermodynamic and physicochemical characteristics of candidate primer pairs N1&#x2013;N3 designed in silico for amplification of the eNOS (
                                <xref ref-type="table" rid="T1">
Table 1</xref>).xlxs (Thermodynamic and physicochemical characteristics of candidate primer pairs N1&#x2013;N3 designed in silico for amplification of the eNOS)</p>
                        </list-item>
                        <list-item>
                            <label>&#x2022;</label>
                            <p>ARRIVE.pdf (ARRIVE 2.0 reporting checklist for animal research)</p>
                        </list-item>
                    </list>
                </p>
                <p>Data are available under the terms of the 
                    <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution 4.0 International</ext-link>.</p>
            </sec>
        </sec>
        <ref-list>
            <title>References</title>
            <ref id="ref1">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Altschul</surname>
                            <given-names>SF</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Gish</surname>
                            <given-names>W</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Miller</surname>
                            <given-names>W</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Basic local alignment search tool.</article-title>
                    <source>

                        <italic toggle="yes">J. Mol. Biol.</italic>
</source>
                    <year>1990</year>;<volume>215</volume>(<issue>3</issue>):<fpage>403</fpage>&#x2013;<lpage>410</lpage>.
                    <pub-id pub-id-type="doi">10.1016/s0022-2836(05)80360-2</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref2">
                <mixed-citation publication-type="book">
                    <collab>American Veterinary Medical Association</collab>:
                    <source>

                        <italic toggle="yes">AVMA guidelines for the euthanasia of animals: 2020 edition.</italic>
</source>
                    <publisher-name>American Veterinary Medical Association</publisher-name>;<year>2020</year>.
                    <ext-link ext-link-type="uri" xlink:href="https://www.avma.org/sites/default/files/2020-02/Guidelines-on-Euthanasia-2020.pdf">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref3">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Bahadoran</surname>
                            <given-names>Z</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mirmiran</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kashfi</surname>
                            <given-names>K</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Vascular nitric oxide resistance in type 2 diabetes.</article-title>
                    <source>

                        <italic toggle="yes">Cell Death Dis.</italic>
</source>
                    <year>2023</year>;<volume>14</volume>(<issue>7</issue>):<fpage>410</fpage>.
                    <pub-id pub-id-type="pmid">37433795</pub-id>
                    <pub-id pub-id-type="doi">10.1038/s41419-023-05935-5</pub-id>
                    <pub-id pub-id-type="pmcid">PMC10336063</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref4">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Bryda</surname>
                            <given-names>EC</given-names>
                        </name>
</person-group>:
                    <article-title>The mighty mouse: The impact of rodents on advances in biomedical research.</article-title>
                    <source>

                        <italic toggle="yes">Mo. Med.</italic>
</source>
                    <year>2013</year>;<volume>110</volume>(<issue>3</issue>):<fpage>207</fpage>&#x2013;<lpage>211</lpage>.</mixed-citation>
            </ref>
            <ref id="ref5">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Bustin</surname>
                            <given-names>SA</given-names>
                        </name>
</person-group>:
                    <article-title>Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems.</article-title>
                    <source>

                        <italic toggle="yes">J. Mol. Endocrinol.</italic>
</source>
                    <year>2002</year>;<volume>29</volume>(<issue>1</issue>):<fpage>23</fpage>&#x2013;<lpage>39</lpage>.
                    <pub-id pub-id-type="pmid">12200227</pub-id>
                    <pub-id pub-id-type="doi">10.1677/jme.0.0290023</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref6">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Bustin</surname>
                            <given-names>SA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Benes</surname>
                            <given-names>V</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Garson</surname>
                            <given-names>JA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The MIQE Guidelines: Minimum information for publication of Quantitative Real-Time PCR experiments.</article-title>
                    <source>

                        <italic toggle="yes">Clin. Chem.</italic>
</source>
                    <year>2009</year>;<volume>55</volume>(<issue>4</issue>):<fpage>611</fpage>&#x2013;<lpage>622</lpage>.
                    <pub-id pub-id-type="doi">10.1373/clinchem.2008.112797</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref7">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Chen</surname>
                            <given-names>Z</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Halford</surname>
                            <given-names>NG</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Liu</surname>
                            <given-names>C</given-names>
                        </name>
</person-group>:
                    <article-title>Real-Time Quantitative PCR: primer design, reference gene selection, calculations and statistics.</article-title>
                    <source>

                        <italic toggle="yes">Meta.</italic>
</source>
                    <year>2023</year>;<volume>13</volume>(<issue>7</issue>):<fpage>806</fpage>.
                    <pub-id pub-id-type="pmid">37512513</pub-id>
                    <pub-id pub-id-type="doi">10.3390/metabo13070806</pub-id>
                    <pub-id pub-id-type="pmcid">PMC10384377</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref8">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Davies</surname>
                            <given-names>KP</given-names>
                        </name>
</person-group>:
                    <article-title>Development and therapeutic applications of nitric oxide-releasing materials.</article-title>
                    <source>

                        <italic toggle="yes">Future Sci. OA.</italic>
</source>
                    <year>2015</year>;<volume>1</volume>(<issue>1</issue>):<fpage>FSO53</fpage>.
                    <pub-id pub-id-type="doi">10.4155/fso.15.53</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref9">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Defeudis</surname>
                            <given-names>G</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mazzilli</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tenuta</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Erectile dysfunction and diabetes: A melting pot of circumstances and treatments.</article-title>
                    <source>

                        <italic toggle="yes">Diabetes Metab. Res. Rev.</italic>
</source>
                    <year>2021</year>;<volume>38</volume>(<issue>2</issue>):<fpage>e3494</fpage>.
                    <pub-id pub-id-type="doi">10.1002/dmrr.3494</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref10">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Die</surname>
                            <given-names>JV</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Roman</surname>
                            <given-names>B</given-names>
                        </name>
</person-group>:
                    <article-title>RNA quality assessment: a view from plant qPCR studies.</article-title>
                    <source>

                        <italic toggle="yes">J. Exp. Bot.</italic>
</source>
                    <year>2012</year>;<volume>63</volume>(<issue>17</issue>):<fpage>6069</fpage>&#x2013;<lpage>6077</lpage>.
                    <pub-id pub-id-type="doi">10.1093/jxb/ers276</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref11">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Forstermann</surname>
                            <given-names>U</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sessa</surname>
                            <given-names>WC</given-names>
                        </name>
</person-group>:
                    <article-title>Nitric oxide synthases: regulation and function.</article-title>
                    <source>

                        <italic toggle="yes">Eur. Heart J.</italic>
</source>
                    <year>2011</year>;<volume>33</volume>(<issue>7</issue>):<fpage>829</fpage>&#x2013;<lpage>837</lpage>.
                    <pub-id pub-id-type="pmid">21890489</pub-id>
                    <pub-id pub-id-type="doi">10.1093/eurheartj/ehr304</pub-id>
                    <pub-id pub-id-type="pmcid">PMC3345541</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref12">
                <mixed-citation publication-type="data">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hadibrata</surname>
                            <given-names>E</given-names>
                        </name>
</person-group>:
                    <data-title>Design and Molecular Validation of eNOS PCR Primers for Gene Expression Studies in Rat Corpus Cavernosum: A Tool for Erectile Dysfunction Research.</data-title>[Data set].
                    <source>

                        <italic toggle="yes">Zenodo.</italic>
</source>
                    <year>2026</year>.
                    <pub-id pub-id-type="doi">10.5281/zenodo.19341556</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref13">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Locascio</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Annona</surname>
                            <given-names>G</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Caccavale</surname>
                            <given-names>F</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Nitric oxide function and nitric oxide synthase evolution in aquatic chordates.</article-title>
                    <source>

                        <italic toggle="yes">Int. J. Mol. Sci.</italic>
</source>
                    <year>2023</year>;<volume>24</volume>(<issue>13</issue>):<fpage>11182</fpage>.
                    <pub-id pub-id-type="pmid">37446358</pub-id>
                    <pub-id pub-id-type="doi">10.3390/ijms241311182</pub-id>
                    <pub-id pub-id-type="pmcid">PMC10342570</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref14">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Melis</surname>
                            <given-names>MR</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Argiolas</surname>
                            <given-names>A</given-names>
                        </name>
</person-group>:
                    <article-title>Erectile Function and Sexual Behavior: A review of the role of nitric oxide in the central nervous system.</article-title>
                    <source>

                        <italic toggle="yes">Biomolecules.</italic>
</source>
                    <year>2021</year>;<volume>11</volume>(<issue>12</issue>):<fpage>1866</fpage>.
                    <pub-id pub-id-type="pmid">34944510</pub-id>
                    <pub-id pub-id-type="doi">10.3390/biom11121866</pub-id>
                    <pub-id pub-id-type="pmcid">PMC8699072</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref15">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Nalbantoglu</surname>
                            <given-names>IC</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sevgi</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kerimoglu</surname>
                            <given-names>G</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Ursodeoxycholic acid ameliorates erectile dysfunction and corporal fibrosis in diabetic rats by inhibiting the TGF-&#x03b2;1/Smad2 pathway.</article-title>
                    <source>

                        <italic toggle="yes">Int. J. Impot. Res.</italic>
</source>
                    <year>2024</year>;<volume>36</volume>(<issue>8</issue>):<fpage>886</fpage>&#x2013;<lpage>895</lpage>.
                    <pub-id pub-id-type="doi">10.1038/s41443-024-00868-9</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref16">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Park</surname>
                        </name>

                        <name name-style="western">
                            <surname>Kim</surname>
                        </name>

                        <name name-style="western">
                            <surname>Kim</surname>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Effects of androgens on the expression of nitric oxide synthase mRNAs in rat corpus cavernosum.</article-title>
                    <source>

                        <italic toggle="yes">Br. J. Urol.</italic>
</source>
                    <year>1999</year>;<volume>83</volume>(<issue>3</issue>):<fpage>327</fpage>&#x2013;<lpage>333</lpage>.
                    <pub-id pub-id-type="doi">10.1046/j.1464-410x.1999.00913.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref17">
                <mixed-citation publication-type="book">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Stephenson</surname>
                            <given-names>FH</given-names>
                        </name>
</person-group>:
                    <source>

                        <italic toggle="yes">Calculations for molecular biology and biotechnology.</italic>
</source>
                    <publisher-name>Academic Press</publisher-name>;
                    <edition> 3rd ed.</edition>
                    <year>2016</year>.</mixed-citation>
            </ref>
            <ref id="ref18">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Tong</surname>
                            <given-names>SY</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Giffard</surname>
                            <given-names>PM</given-names>
                        </name>
</person-group>:
                    <article-title>Microbiological applications of high-resolution melting analysis.</article-title>
                    <source>

                        <italic toggle="yes">J. Clin. Microbiol.</italic>
</source>
                    <year>2012</year>;<volume>50</volume>(<issue>11</issue>):<fpage>3418</fpage>&#x2013;<lpage>3421</lpage>.
                    <pub-id pub-id-type="pmid">22875887</pub-id>
                    <pub-id pub-id-type="doi">10.1128/JCM.01709-12</pub-id>
                    <pub-id pub-id-type="pmcid">PMC3486245</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
</article>
