<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.173746.1</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 1; peer review: 1 approved with reservations, 1 not approved]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Alfardan</surname>
                        <given-names>Rana</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Software</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-2859-9073</uri>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Community Health Techniques Department, Southern Technical University, Basrah, Basrah, 61004, Iraq</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:ranaaziz@stu.edu.iq">ranaaziz@stu.edu.iq</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>16</day>
                <month>1</month>
                <year>2026</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2026</year>
            </pub-date>
            <volume>15</volume>
            <elocation-id>68</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>7</day>
                    <month>1</month>
                    <year>2026</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2026 Alfardan R</copyright-statement>
                <copyright-year>2026</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/15-68/pdf"/>
            <abstract>
                <sec>
                    <title>Background</title>
                    <p>Pancreatic cancer has a poor prognosis and is highly aggressive and deadly. Most pancreatic cancer diagnoses are adenocarcinomas, which account for more than 90 % of all cases. Developing effective therapeutic strategies requires an understanding of the molecular mechanisms associated with pancreatic cancer progression. Small nucleolar RNA 64 (SNORA64) was presented as a predictive marker for pancreatic cancer stages in our previous study. SNORA64 showed a gradual loss of its expression throughout the carcinogenesis process, and it inhibited metastasis by interfering with epithelial to mesenchymal transition (EMT). In this study, we investigated the role of SNORA64 on an intrinsic apoptotic pathway in pancreatic cancers by using human pancreatic cell line derived from adenocarcinoma PK-8 with SNORA64 knockdown and the scramble to compare with.</p>
                </sec>
                <sec>
                    <title>Methods</title>
                    <p>QPCR techniques used to measure the gene expression level of apoptosis related genes and cell viability analyzer are implanted in this study as investigational methods.</p>
                </sec>
                <sec>
                    <title>Results</title>
                    <p>Pk-8 with low expression of SNORA64 shows significantly high expression of anti-apoptotic genes B-cell leukemia/lymphoma-2 (BCl2) and B-cell lymphoma-extra-large (BCL-Xl) in contrast to the scramble control cell line. Conversely, the pro-apoptotic genes BH3 interacting domain death agonist (BID), BCL2 Associated X (BAX), and BCL2 homologous antagonist/killer (BAK) show significantly low expression compared to the scramble control. However, there is no change in the expression of BAD and BIM in Pk-8 with SNORA64 knockdown compared to the scrambled control cell line. Furthermore, the Pk-8 with low expression of SNORA64 shows a significant high proliferation rate and viability percentage compared to the scramble control cell line.</p>
                </sec>
                <sec>
                    <title>Conclusion</title>
                    <p>The downregulation of SNORA64 affects apoptosis pathways by manipulating pro- and anti-apoptotic gene regulators. The SNORA64 interactions with apoptotic inhibitor molecules and downregulation of pro-apoptotic molecules significantly sustain cellular viability. Therefore; SNORA64 can be used to increase the cell sensitivity to death during treatment.</p>
                </sec>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>Apoptosis</kwd>
                <kwd>Pancreatic Cancer</kwd>
                <kwd>Cellular viability</kwd>
                <kwd>Regulator genes</kwd>
                <kwd>SNORA64</kwd>
            </kwd-group>
            <funding-group>
                <award-group id="fund-1">
                    <funding-source>This work was partially supported by Southern Technical University under scientific research awards</funding-source>
                    <award-id>No.9/7934</award-id>
                    <award-id>10Sep.2025.</award-id>
                </award-group>
                <funding-statement>This work was partially supported by Southern Technical University under scientific research awards, No. 9/7934, 10 Sep. 2025.</funding-statement>
                <funding-statement>
                    <italic>The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.</italic>
                </funding-statement>
            </funding-group>
        </article-meta>
    </front>
    <body>
        <sec id="sec5" sec-type="intro">
            <title>1. Introduction</title>
            <p>This Adenocarcinoma and neuroendocrine pancreatic cancer are two major types of pancreatic cancer. Most pancreatic cancer diagnoses are adenocarcinomas, which account for more than 90 % of all cases and originate in the pancreas&#x2019; duct lining.
                <sup>
                    <xref ref-type="bibr" rid="ref1">1</xref>
                </sup> There are limited treatment options for pancreatic cancer, because of its aggressive and lethal nature, it has a dismal prognosis. In order to develop effective therapeutic strategies for pancreatic cancer, it is essential to understand the molecular mechanisms involved in its progression.
                <sup>
                    <xref ref-type="bibr" rid="ref2">2</xref>
                </sup> Cancer cells, however, are often able to escape cell death and continue to proliferate in pancreatic cancer due to the deregulation of the apoptosis pathway.
                <sup>
                    <xref ref-type="bibr" rid="ref1">1</xref>
                </sup> The process of apoptosis, or programmed cell death, maintains tissue homeostasis and prevents cancer triggered by several stimuli. During early development and in pathophysiological conditions, programmed cell death plays a key role in maintaining morphogenetic homeostasis.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>
                </sup> The development and progression of cancer are associated with the deregulation of different apoptotic components.
                <sup>
                    <xref ref-type="bibr" rid="ref2">2</xref>
                </sup> Apoptosis requires the activation of distinct signaling pathways that are frequently deregulated by cancer, such as tumor suppressor P53.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>
                </sup> P53 is the most common genetic alteration found in clinical tumor samples, and there&#x2019;s a positive statistical association between its expression and apoptosis.
                <sup>
                    <xref ref-type="bibr" rid="ref4">4</xref>
                </sup> It may therefore be possible to track the progression of cancer by investigating the single or multiple apoptotic components involved in its expression during carcinogenesis.
                <sup>
                    <xref ref-type="bibr" rid="ref2">2</xref>
                </sup> DNA damage and oxidative stress are examples of internal, or so-called mitochondrial stimuli that can also affect apoptosis (as well as external stimuli).
                <sup>
                    <xref ref-type="bibr" rid="ref2">2</xref>,
                    <xref ref-type="bibr" rid="ref3">3</xref>
                </sup> In the intrinsic apoptotic pathway, members of the B-cell leukemia/lymphoma-2 (BCl2) family include groups of genes known as pro- or antiapoptotic proteins. Apoptosis activation is relatively dependent on the balance between the expression of these genes. There are anti-apoptotic regulators (BCl2, BCL-XL, BCLDW, and MCL-1), pro-apoptotic BH3-only regulators that act as apoptotic sensitizers (BAD, NOXA, HRK, BIK, BMF), pro-apoptotic BH3-only regulators that act as apoptotic activators (BID, BIM, and PUMA), and pore-forming regulators that act as effectors (BAX, BAK).
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>
                </sup> Specifically, the BCl2 family of proteins is responsible for regulating mitochondrial outer membrane permeabilization. Any change in mitochondrial outer membrane permeabilization leads to the irreversible release of intermembrane space proteins such as Cytochrome c (Cyt.c).
                <sup>
                    <xref ref-type="bibr" rid="ref5">5</xref>
                </sup> The latter is a water-soluble protein released from the mitochondrial membrane in the cytoplasm and initiates the executive apoptotic pathways, such as activates the execution pathway mediated by caspase enzymes. Several cancer types have been associated with Cyt.c as a prognostic indicator of apoptosis, based on the data available so far. Researchers discovered that NS398 medications were linked to the suppression of Cyclo-oxygenase-2 (COX-2) production in esophageal cancer cells via a cyt. c-dependent pathway.
                <sup>
                    <xref ref-type="bibr" rid="ref6">6</xref>
                </sup> In a similar study, teniposide increased Cyt. c expression in a dose-dependent manner, indicating that it affected anticancer drug resistance and induced programmed cell death in cancerous cells. Upon release from the mitochondrial membrane in the cytoplasm, Cyt. c activates procaspase-9 which has a proteolytic activity.
                <sup>
                    <xref ref-type="bibr" rid="ref7">7</xref>
                </sup> In the intrinsic apoptosis pathway, procaspase-9 is an initiator caspase that is present in a monomer form and consists of three domains.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>
                </sup> In the event of caspase-9 activation, it cleaves and activates executor caspase-3. It is known that caspase-3, a major component of the execution pathway, cleaves DNAase inhibitors and proteins of the cytoskeleton, causing the fragmentation of cells.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>,
                    <xref ref-type="bibr" rid="ref8">8</xref>
                </sup> It is believed that caspase-3 participates in proteolytic series by activating caspases -6, -7, and -9 to facilitate the disintegration of the apoptotic cells prior to their removal by phagocytosis.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>
                </sup> Generally, cell death results from the execution pathway, which is demonstrated by blebbing membranes, DNA disintegration condensed chromosomes, and cell shrinkage. Evidence suggests that deregulation of specific caspases enhances the tumorigenic potential of cells.
                <sup>
                    <xref ref-type="bibr" rid="ref9">9</xref>
                </sup>
            </p>
            <p>One of the most prominent examples of non-coding RNAs (ncRNAs) are small nucleolar RNAs (snoRNAs). snoRNA is a small RNA molecule that typically consists of 60 to 300 nucleotides and is found primarily in the nucleus of a cell.
                <sup>
                    <xref ref-type="bibr" rid="ref10">10</xref>
                </sup> In the late 1970s, snoRNA&#x2019;s primary role was uncovered in research to ensure that ribosomes, the cellular machinery that synthesizes proteins, are assembled and function correctly.
                <sup>
                    <xref ref-type="bibr" rid="ref11">11</xref>
                </sup> In recent years, researchers have covered a wide variety of regulatory processes, including transcription, post-transcriptional modification, and translation. However, it was found that snoRNA was significantly downregulated in meningiomas compared with normal brain tissue. This led to further investigation of the potential role of snoRNA in cancer.
                <sup>
                    <xref ref-type="bibr" rid="ref12">12</xref>
                </sup> Clinical samples and cell lines have also shown that snoRNAs are expressed in a variety of malignancies, indicating that they may be used as prognostic and diagnostic indicators for diseases including breast cancer and non-small cell lung cancer (NSCLC). Among the snoRNAs that are frequently overexpressed in breast cancer, prostate cancer, and lung cancer, SNORA42, SNORD15A, SNORD15B, SNORD22, SNORD17, and SNORD87 have been demonstrated to correlate with tumorigenicity, highlighting snoRNA&#x2019;s significance in regulating cancer biology.
                <sup>
                    <xref ref-type="bibr" rid="ref13">13</xref>
                </sup> As demonstrated by the strong correlation between a poor clinical outcome and increased SNORD52 expression in hepatocellular carcinoma (HCC). SNORD52 increases the stability of the CDK1 protein, which in turn promotes the development of HCC. Therefore; targeting the Upf1/SNORD52/CDK1 pathway may have therapeutic potential for the treatment of HCC.
                <sup>
                    <xref ref-type="bibr" rid="ref14">14</xref>
                </sup> Though their processes, particularly their functions in cellular signal transduction pathways, are not fully understood, the majority of recent reports focus on SNORAs screening and verifying their correlations with illnesses. Based on these findings, it is possible that SNORAs play an important role at the transcriptional and epigenetic levels, as well as in healthy and tumor tissues and body fluids.
                <sup>
                    <xref ref-type="bibr" rid="ref12">12</xref>,
                    <xref ref-type="bibr" rid="ref13">13</xref>
                </sup>
            </p>
            <p>Small nucleolar RNA, H/ACA box 64 (SNORA64) or U64 is one of the SNORAs that enables protein binding, as evidenced by Inferred Physical Interaction (IPI). In addition, SNORA64 is involved in processing primary RNA transcripts into one or more mature RNA molecules as Inferred from Electronic Annotation (IEA).
                <sup>
                    <xref ref-type="bibr" rid="ref15">15</xref>,
                    <xref ref-type="bibr" rid="ref16">16</xref>
                </sup> The interaction of this molecule with a number of proteins could be involved in modulating telomerase, according to some researchers.
                <sup>
                    <xref ref-type="bibr" rid="ref15">15</xref>
                </sup> Further, it may serve as a potential osteoarthritis biomarker.
                <sup>
                    <xref ref-type="bibr" rid="ref17">17</xref>
                </sup> According to our earlier research, there are variations in mRNA expression between the three distinct tumor grades, indicating a significant part for SNORA64 in the genesis and progression of pancreatic cancer. Furthermore, there is a link between the stimulation of the epithelial-to-mesenchymal transition and the reduction of SNORA64 expression.
                <sup>
                    <xref ref-type="bibr" rid="ref18">18</xref>
                </sup> Due to the lack of knowledge of SNORAs&#x2019; impact on apoptotic pathways, we are currently examining how SNORA64 affects the expression of both pro- and anti-apoptotic genes in pancreatic cancer cells.</p>
        </sec>
        <sec id="sec6">
            <title>2. Material and methods</title>
            <sec id="sec7">
                <title>2.1 Cell line and construct</title>
                <p>Pancreatic cancer cell line PK-8 obtained from Riken Cell Bank (RRID:CVCL_4718). PK-8 with SNORA64 knockdown and scramble cell line as a control are used in this study. The efficiency of the transfection was around 50%, as determined in our previous study.
                    <sup>
                        <xref ref-type="bibr" rid="ref18">18</xref>
                    </sup> A humidified incubator is used for cultivation of cell lines in RPMI-1640 containing 10% fetal bovine serum (FBS), 100 u/ml of penicillin, 100 g/ml of streptomycin, and 5% carbon dioxide.</p>
            </sec>
            <sec id="sec8">
                <title>2.2 Real-time reverse transcription polymerase chain reaction (RT-PCR)</title>
                <p>Using two sets of primers (left and right), each gene&#x2019;s RNA expression was measured using RT-PCR analysis with four replicates for each sample. Gel electrophoresis utilizing ethidium bromide was employed for the confirmation of qPCR results. Data for gene sequences were obtained from the National Center for Biotechnology Information (NIH), starting with Homo sapiens tumor suppressor P53. Homo sapiens BCL2 and BCL2-related protein, long isoform (BCL-Xl) have been used as anti-apoptotic gene markers. Homo sapiens BCL2 like 11(BIM), BCL2 antagonist of cell death (BAD), BH3 interacting domain death agonist (BID), BCL2 associated X protein (BAX), and BCL2 antagonist/killer (BAK) have been used as pro-apoptotic genes. Homo sapiens CASP-9, CASP-3, and CASP-7 genes are used as indicators of the initiation of the apoptotic cascade. &#x03b2;-ACTIN, a housekeeping protein, is the reference gene used to normalize the amounts of mRNA (
                    <xref ref-type="table" rid="T1">
Table 1</xref>). The Trizol technique (MRC, Cata#RT111) was used to extract total RNA, and the nanodrop spectrophotometer used to measure the RNA purity and concentration. cDNA was produced using ProtoScript
                    <sup>&#x00ae;</sup> M-MuLV TaqRT-PCR kit (NEB, cat#E6400S).
                    <sup>
                        <xref ref-type="bibr" rid="ref18">18</xref>
                    </sup> The mixture&#x2019;s templet cDNA&#x2019;s targeted genes were amplified using Biorad CFX96.
                    <sup>
                        <xref ref-type="bibr" rid="ref18">18</xref>,
                        <xref ref-type="bibr" rid="ref19">19</xref>
                    </sup>
                </p>
                <table-wrap id="T1" orientation="portrait" position="float">
                    <label>
Table 1. </label>
                    <caption>
                        <title>Left and right primer sequences used in (RT-PCR) analysis.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="2" valign="top">Gene symbol</th>
                                <th align="left" colspan="2" rowspan="1" valign="top">Primer sequences pairs</th>
                            </tr>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">5'-Left Primer Sequence-3'</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
5'-Right Primer Sequence-3'</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">P53</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">aggttggctctgactgtacc</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">gattctcttcctctgtgcgc</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">BCL2</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">ggaggattgtggccttcttt</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">gccgtacagttccacaaagg</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">BCL-Xl
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">catggcagcagtaaagcaag</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">tcccggaagagttcattcac</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">BAD</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">gaagactccagctctgcaga</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">catcccttcgtcgtcctcc</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">BID</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">ggcctaccctagagacatgg</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">tggctaagctcctcacgtag</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">BIM</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">tggcccttttgctaccagat</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">aggaggacttggggtttgtg</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">BAX</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">tctgacggcaacttcaactg</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">ttgaggagtctcacccaacc</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">BAK</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">ccaggacacagaggaggttt</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">ctctgagtcatagcgtcggt</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CASP -9</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">ctagtttgcccacacccagt</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">cctttcaccgaaacagcatt</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CASP-3</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">tggaattgatgcgtgatgtt</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">ggcaggcctgaataatgaaa</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CASP -7</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">ttccacggttccaggctatt</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">agttccttggtgagcatgga</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">&#x03b2;-ACTIN</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">agaaaatctggcaccacacc</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">agaggcgtacagggatagca</td>
                            </tr>
                        </tbody>
                    </table>
                    <table-wrap-foot>
                        <p>All primers are designed by the author.</p>
                    </table-wrap-foot>
                </table-wrap>
            </sec>
            <sec id="sec9">
                <title>2.3 Cell proliferation assay</title>
                <p>Six-well plates were seeded with 2X10
                    <sup>4</sup> SNORA64 knockdown cells of PK-8, along with scramble cell lines as a control, and incubated for six hours. Trypsin was used to collect the cells, and then medium-washed over them. The Vi-cell XR (cell viability analyzer) uses trypan blue dye to determine the quantity of viability and viable cells.</p>
            </sec>
            <sec id="sec10">
                <title>2.4 Analytical statistics</title>
                <p>After the data were examined, a two-tailed Student&#x2019;s t-test was used to identify any significant differences in gene expression. P-value &#x2264; 0.05.</p>
            </sec>
        </sec>
        <sec id="sec11" sec-type="results">
            <title>3. Results</title>
            <sec id="sec12">
                <title>3.1 Pk-8 SNORA64 knockdown shows a significant low expression of tumor suppressor P53</title>
                <p>In comparison to a scrambled control cell line, Pk-8 with SNORA64 knockdown significantly downregulated the expression of p53 (
                    <xref ref-type="fig" rid="f1">Figure 1</xref>).</p>
                <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                    <label>
Figure 1. </label>
                    <caption>
                        <title>Tumor suppressor P53 mRNA expression level in Pk-8 SNORA64 knockdown cell line.</title>
                        <p>Pk-8 with SNORA64 knockdown significantly downregulated the expression of p53 mRNA compared to the scramble control cell line. P-value was 0.01.</p>
                    </caption>
                    <graphic id="gr1" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/191586/efd15e25-b982-4d11-91f4-28cb15c95904_figure1.gif"/>
                </fig>
            </sec>
            <sec id="sec13">
                <title>3.2 Pk-8 SNORA64 knockdown shows significant differences in the expression of apoptotic regulator genes</title>
                <p>Pk-8 cell line with SNORA64 knockdown significantly upregulated the expression of anti-apoptotic regulator genes BCL2 and BCL-Xl in contrast with the scramble (
                    <xref ref-type="fig" rid="f2">Figure 2A</xref>).</p>
                <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                    <label>
Figure 2. </label>
                    <caption>
                        <title>Apoptotic regulators mRNA expression levels in the Pk-8 SNORA64 knockdown cell line.</title>
                        <p>A.Pk-8 with SNORA64 knockdown significantly upregulated the expression of anti-apoptotic regulator genes BCL2 and BCL-Xl in contrast with the scramble. P-value were 0.01, and 0.01respectively.</p>
                        <p>B. In comparison to the scramble control cell line, Pk-8 with SNORA64 knockdown markedly reduced the pro-apoptotic regulator genes BID, BAX, and BAK. BAD and BIM, however, do not differ from scramble cell line control in terms of expression. P-value were 0.001, 0.001, 0.001, 0.1 and 0.06 respectively.</p>
                    </caption>
                    <graphic id="gr2" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/191586/efd15e25-b982-4d11-91f4-28cb15c95904_figure2.gif"/>
                </fig>
                <p>In comparison to a scrambled control cell line, Pk-8 with SNORA64 knockdown significantly downregulated the pro-apoptotic genes BID, BAX, and BAK (
                    <xref ref-type="fig" rid="f2">Figure 2B</xref>). Despite this, there is no change in the expression of BAD and BIM in Pk-8 with SNORA64 knockdown compared to the scrambled control cell line (
                    <xref ref-type="fig" rid="f2">Figure 2B</xref>).</p>
            </sec>
            <sec id="sec14">
                <title>3.3 Pk-8 SNORA64 knockdown shows significantly low expression of apoptotic enzymes</title>
                <p>In comparison to a scrambled control cell line, Pk-8 with SNORA64 knockdown significantly downregulated the expression of apoptotic enzyme genes CASP-9, 3, and 7 (
                    <xref ref-type="fig" rid="f3">Figure 3</xref>).</p>
                <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                    <label>
Figure 3. </label>
                    <caption>
                        <title>Apoptotic enzyme mRNA expression levels in the Pk-8 SNORA64 knockdown cell line.</title>
                        <p>Pk-8 with SNORA64 knockdown significantly downregulated the expression of apoptotic enzyme regulator genes CASP-9, 3, and 7 compared to the scramble control cell line. P-value were 0.0001, 0.002, and 0.001 respectively.</p>
                    </caption>
                    <graphic id="gr3" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/191586/efd15e25-b982-4d11-91f4-28cb15c95904_figure3.gif"/>
                </fig>
            </sec>
            <sec id="sec15">
                <title>3.4 Pk-8 SNORA64 knockdown shows significant survival n in viable cells and viability</title>
                <p>In comparison to a scrambled control cell line, Pk-8 with SNORA64 knockdown significantly elevated the number of viable cells (
                    <xref ref-type="fig" rid="f4">Figure 4A</xref>) and viability (
                    <xref ref-type="fig" rid="f4">Figure 4B</xref>).</p>
                <fig fig-type="figure" id="f4" orientation="portrait" position="float">
                    <label>
Figure 4. </label>
                    <caption>
                        <title>Cellular viabilities in Pk-8 SNORA64 knockdown cell line.</title>
                        <p>A. In comparison with the scramble control cell line, Pk-8 with SNORA64 knockdown showed a significant increase in viable cells. P-value was 0.01.</p>
                        <p>B. Pk-8 with SNORA64 knockdown significantly increased the viability of the cells compared to the scramble control cell line. P-value was 0.01.</p>
                    </caption>
                    <graphic id="gr4" orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/191586/efd15e25-b982-4d11-91f4-28cb15c95904_figure4.gif"/>
                </fig>
            </sec>
        </sec>
        <sec id="sec16" sec-type="discussion">
            <title>4. Discussion</title>
            <p>Despite the limited treatment options and poor prognosis for pancreatic cancer, this disease is highly aggressive and deadly.
                <sup>
                    <xref ref-type="bibr" rid="ref1">1</xref>
                </sup> One of the characteristics of pancreatic cancer that encourages initiation, growth, and therapeutic resistance is apoptosis avoidance.
                <sup>
                    <xref ref-type="bibr" rid="ref2">2</xref>,
                    <xref ref-type="bibr" rid="ref3">3</xref>,
                    <xref ref-type="bibr" rid="ref19">19</xref>
                </sup> Apoptosis relies on specific signaling pathways that are often deregulated in cancer development and progression.
                <sup>
                    <xref ref-type="bibr" rid="ref2">2</xref>,
                    <xref ref-type="bibr" rid="ref3">3</xref>
                </sup> The apoptosis pathway is cooperatively coordinated by tumor suppressor p53 signaling pathways. Epidemiological research and molecular evidence have shown that P53 mutations are associated with an increased risk of developing cancer.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>,
                    <xref ref-type="bibr" rid="ref4">4</xref>,
                    <xref ref-type="bibr" rid="ref20">20</xref>
                </sup> Our results show low expression of P53 in the Pk-8 with SNORA64 low expression compared to the control. It is well known that genetic alteration in the tumor suppressor P53 is common during stages of pancreatic carcinogenesis.
                <sup>
                    <xref ref-type="bibr" rid="ref20">20</xref>
                </sup> By interacting with the multidomain members of the BCL2 family, p53 directly contributes to the intrinsic apoptotic pathway by inducing permeabilization of the mitochondrial outer membrane.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>
                </sup> Furthermore, an investigation was conducted to determine how the expression of the p53 and BCL2 proteins relates to the various kinds of human cancers.
                <sup>
                    <xref ref-type="bibr" rid="ref20">20</xref>
                </sup> In the malignant tumors, there was a noteworthy negative connection observed between the expression of p53 and BCL2.
                <sup>
                    <xref ref-type="bibr" rid="ref10">10</xref>,
                    <xref ref-type="bibr" rid="ref20">20</xref>
                </sup> According to our findings, Pk-8 has elevated BCL2 and BCL-XL expression, while SNORA64 expression is low. The BCL2 and BCL-XL dimers prevent death signals and promote cell survival.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>
                </sup> As pancreatic cancer progresses, BCL-XL expression rises. Treatments using anti-BCL-XL may be able to stop pancreatic tumors from progressing from their primary to more advanced stages.
                <sup>
                    <xref ref-type="bibr" rid="ref21">21</xref>
                </sup> Furthermore, BCL-XL overexpression raises the incidence rates of pancreatic cancer by preventing apoptosis and senescence brought on by oncogenes.
                <sup>
                    <xref ref-type="bibr" rid="ref22">22</xref>
                </sup>
            </p>
            <p>It is well known that the tumor suppressor gene p53 essential for maintaining genomic stability. It controls the production of the anti-apoptosis molecule BCL2 as well as the pro-apoptosis molecule BAX.
                <sup>
                    <xref ref-type="bibr" rid="ref4">4</xref>
                </sup> The pro-apoptotic gene BAX and the anti-apoptotic gene BCL2 have been found to be significant participants in the control of apoptosis in pancreatic cancer.
                <sup>
                    <xref ref-type="bibr" rid="ref22">22</xref>
                </sup> Conversely, this study shows a decline in the expression of the pro-apoptotic molecules BID, BAK, and BAX, while SNORA64 expression is low. BID is one of the molecules that activate BAK and BAX dimerization. BID protein is truncated in the presence of one of the intrinsic signaling apoptosis. Truncated BID can activate the effector proteins BAK and BAX. The BAK and BAX dimers bind to and sequester the anti-apoptotic BCL2 and BCL-XL.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>,
                    <xref ref-type="bibr" rid="ref5">5</xref>
                </sup> The subsequent signals have an impact on the potential of the mitochondrial membrane and result in the release of Cyt. c to the cytoplasm. Consequently, the release of Cyt. c and the activation of Casp-9 and 3 initiate the cascade of caspases.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>,
                    <xref ref-type="bibr" rid="ref6">6</xref>
                </sup> Casp-3 activation is thought to initiate the apoptotic execution route since it can activate Casp-6 and 7. The execution route is irreversible and constitutes the last phase of apoptosis induction.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>
                </sup> Many studies demonstrated the Casp-3 role in the progression, aggressiveness, and overall survival time of patients with gastric, ovarian, prostate, cervical, and colorectal cancer.
                <sup>
                    <xref ref-type="bibr" rid="ref23">23</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref25">25</xref>
                </sup> Furthermore, Casp-3 can suppress dissemination and invasion and promote the epithelial-to-mesenchymal transition phenotype. Casp-3 is therefore regarded as a significant prognostic marker and an indicator for cancer disease-free survival rates as well as overall 5-year survival rates.
                <sup>
                    <xref ref-type="bibr" rid="ref23">23</xref>,
                    <xref ref-type="bibr" rid="ref25">25</xref>
                </sup> When compared to the scrambled control cells, our data demonstrate a decrease in the key caspases&#x2019; mRNA expression in the intrinsic signaling apoptosis Casp-9, 3, and 7. Despite this, SNORA64 knockdown showed no effect on the expression of BAD and BIM in Pk-8 with low expression of SNORA64 when compared with the scrambled control cells.</p>
            <p>Pro-apoptotic and anti-apoptotic regulator equilibrium is essential for homeostasis, and any change toward survival through a variety of escape mechanisms will encourage tumor growth.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>
                </sup> One of the primary methods that tumor cells develop resistance to chemotherapy and radiation treatment is through apoptosis-regulatory mediators, particularly elevated concentrations of anti-apoptotic proteins.
                <sup>
                    <xref ref-type="bibr" rid="ref26">26</xref>
                </sup> Restoring apoptosis in the tumor cells resistant to chemotherapy and radiation therapy is crucial to the treatment.
                <sup>
                    <xref ref-type="bibr" rid="ref26">26</xref>,
                    <xref ref-type="bibr" rid="ref27">27</xref>
                </sup> Therefore, SNORA64 can be used as a therapeutic agent to increase cell sensitivity to death by chemotherapy. A future step should be taken to investigate the synergistic effect of SNORA64 and chemotherapy in cancer treatment.</p>
            <p>The imbalance of both pro- and anti-apoptotic genes may stimulate tumor growth and progression in pancreatic cancer by increasing cell proliferation, cell viability, and decreasing cell death.
                <sup>
                    <xref ref-type="bibr" rid="ref1">1</xref>,
                    <xref ref-type="bibr" rid="ref2">2</xref>
                </sup> Our results indicated a significant increase in viable cells and viability in Pk-8 with low expression of SNORA64. Culture productivity is increased when anti-apoptosis genes, such as BCL2, are overexpressed and suppress apoptosis.
                <sup>
                    <xref ref-type="bibr" rid="ref5">5</xref>
                </sup> We also recently reported that the expression of SNORA64 in pancreatic cancer tissues is significantly higher than that in normal pancreatic ductal tissues.
                <sup>
                    <xref ref-type="bibr" rid="ref18">18</xref>
                </sup> Several studies have demonstrated the critical role played by SNORAs in cancer development and their potential uses as biomarkers and/or therapeutic targets.
                <sup>
                    <xref ref-type="bibr" rid="ref12">12</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref18">18</xref>
                </sup> As a result, changes in SNORAs expression could significantly affect the pathogenic processes and pathways underlying the development of cancer. Our research shows that, among particular molecules, the SNORA64 molecule has the capacity to activate the apoptotic intrinsic pathway or enhance sensitivity to death. On the other hand, SNORA64 could be a key indicator for cell proliferation and survival.</p>
        </sec>
        <sec id="sec17" sec-type="conclusion">
            <title>5. Conclusion</title>
            <p>Based on our findings, SNORA64 may modulate both pro-apoptotic and anti-apoptotic genes that control apoptosis. SNORA64 promotes apoptosis by increasing the expression of pro-apoptotic molecules such as BID, BAX, and BAK. Meanwhile, SNORA64 expression impact the anti-apoptosis molecules BCL2 and BCL-XL by decreasing their expression. Consequently, low expression of SNORA64 increases the viability of pancreatic cancer cells by increasing viable cells number.</p>
        </sec>
        <sec id="sec18">
            <title>Ethics information</title>
            <p>This study was completed in accordance with Southern Technical University&#x2019;s ethical guidelines with approval number 5/1863. This study did not involve human participants.</p>
        </sec>
    </body>
    <back>
        <sec id="sec21" sec-type="data-availability">
            <title>Data availability</title>
            <p>I consent to make all of the information and resources used to support the findings or analyses in my research publicly available under an open license that allows 
                <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">
CC-BY.4.0</ext-link>
 reuse. The datasets with DOI 10.6084/m9.figshare.30742097 are freely available at 
                <ext-link ext-link-type="uri" xlink:href="https://figshare.com">https://figshare.com</ext-link>.
                <sup>
                    <xref ref-type="bibr" rid="ref28">28</xref>
                </sup>
            </p>
        </sec>
        <ref-list>
            <title>References</title>
            <ref id="ref1">
                <label>1</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sarantis</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Koustas</surname>
                            <given-names>E</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Papadimitropoulou</surname>
                            <given-names>A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Pancreatic ductal adenocarcinoma: Treatment hurdles, tumor microenvironment and immunotherapy.</article-title>
                    <source>

                        <italic toggle="yes">World J. Gastrointest. Oncol.</italic>
</source>
                    <year>2020 Feb 15</year>;<volume>12</volume>(<issue>2</issue>):<fpage>173</fpage>&#x2013;<lpage>181</lpage>.
                    <pub-id pub-id-type="pmid">32104548</pub-id>
                    <pub-id pub-id-type="doi">10.4251/wjgo.v12.i2.173</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7031151</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref2">
                <label>2</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kumar</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kumar</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sandeep</surname>
                            <given-names>K</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Therapeutic Approaches in Pancreatic Cancer: Recent Updates.</article-title>
                    <source>

                        <italic toggle="yes">Biomedicines.</italic>
</source>
                    <year>2023 Jun 1</year>;<volume>11</volume>(<issue>6</issue>):<fpage>1611</fpage>&#x2013;<lpage>1632</lpage>.
                    <pub-id pub-id-type="pmid">37371705</pub-id>
                    <pub-id pub-id-type="doi">10.3390/biomedicines11061611</pub-id>
                    <pub-id pub-id-type="pmcid">PMC10296116</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref3">
                <label>3</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kashyap</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Garg</surname>
                            <given-names>VK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Goel</surname>
                            <given-names>N</given-names>
                        </name>
</person-group>:
                    <article-title>Intrinsic and extrinsic pathways of apoptosis: Role in cancer development and prognosis.</article-title>
                    <source>

                        <italic toggle="yes">Adv. Protein Chem. Struct. Biol.</italic>
</source>
                    <year>2021</year>;<volume>125</volume>:<fpage>73</fpage>&#x2013;<lpage>120</lpage>.
                    <pub-id pub-id-type="pmid">33931145</pub-id>
                    <pub-id pub-id-type="doi">10.1016/bs.apcsb.2021.01.003</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref4">
                <label>4</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Guo</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wei</surname>
                            <given-names>H</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Targeting p53 pathways: mechanisms, structures, and advances in therapy.</article-title>
                    <source>

                        <italic toggle="yes">Signal Transduct. Target. Ther.</italic>
</source>
                    <year>2023 Mar 1</year>;<volume>8</volume>(<issue>1</issue>):<fpage>92</fpage>&#x2013;<lpage>126</lpage>.
                    <pub-id pub-id-type="pmid">36859359</pub-id>
                    <pub-id pub-id-type="doi">10.1038/s41392-023-01347-1</pub-id>
                    <pub-id pub-id-type="pmcid">PMC9977964</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref5">
                <label>5</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Qian</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wei</surname>
                            <given-names>Z</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yang</surname>
                            <given-names>W</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The role of BCL-2 family proteins in regulating apoptosis and cancer therapy.</article-title>
                    <source>

                        <italic toggle="yes">Front. Oncol.</italic>
</source>
                    <year>2022 Oct 12</year>;<volume>12</volume>:<fpage>985363</fpage>&#x2013;<lpage>985379</lpage>.
                    <pub-id pub-id-type="pmid">36313628</pub-id>
                    <pub-id pub-id-type="doi">10.3389/fonc.2022.985363</pub-id>
                    <pub-id pub-id-type="pmcid">PMC9597512</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref6">
                <label>6</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wu</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Xu</surname>
                            <given-names>XC</given-names>
                        </name>
</person-group>:
                    <article-title>Induction of apoptosis by cyclo-oxygenase-2 inhibitor NS398 through a cytochrome C-dependent pathway in esophageal cancer cells.</article-title>
                    <source>

                        <italic toggle="yes">Int. J. Cancer.</italic>
</source>
                    <year>2001 Jul 15</year>;<volume>93</volume>(<issue>2</issue>):<fpage>218</fpage>&#x2013;<lpage>223</lpage>.
                    <pub-id pub-id-type="pmid">11410869</pub-id>
                    <pub-id pub-id-type="doi">10.1002/ijc.1322</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref7">
                <label>7</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kadenbach</surname>
                            <given-names>B</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Arnold</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lee</surname>
                            <given-names>I</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The possible role of cytochrome c oxidase in stress-induced apoptosis and degenerative diseases.</article-title>
                    <source>

                        <italic toggle="yes">Biochim. Biophys. Acta.</italic>
</source>
                    <year>2004</year>;<volume>1655</volume>(<issue>1-3</issue>):<fpage>400</fpage>&#x2013;<lpage>408</lpage>.
                    <pub-id pub-id-type="pmid">15100056</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.bbabio.2003.06.005</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref8">
                <label>8</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Soni</surname>
                            <given-names>IV</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jeanne</surname>
                            <given-names>A</given-names>
                        </name>
</person-group>:
                    <article-title>Hardy Caspase-9 Activation of Procaspase-3 but Not Procaspase-6 Is Based on the Local Context of Cleavage Site Motifs and on Sequence.</article-title>
                    <source>

                        <italic toggle="yes">Biochemistry.</italic>
</source>
                    <year>2021</year>;<volume>60</volume>(<issue>37</issue>):<fpage>2824</fpage>&#x2013;<lpage>2835</lpage>.
                    <pub-id pub-id-type="pmid">34472839</pub-id>
                    <pub-id pub-id-type="doi">10.1021/acs.biochem.1c00459</pub-id>
                    <pub-id pub-id-type="pmcid">PMC8489496</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref9">
                <label>9</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Boice</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bouchier-Hayes</surname>
                            <given-names>L</given-names>
                        </name>
</person-group>:
                    <article-title>Targeting apoptotic caspases in cancer.</article-title>
                    <source>

                        <italic toggle="yes">Biochim. Biophys. Acta, Mol. Cell Res.</italic>
</source>
                    <year>2020 Jun</year>;<volume>1867</volume>(<issue>6</issue>):<fpage>118688</fpage>.
                    <pub-id pub-id-type="pmid">32087180</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.bbamcr.2020.118688</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7155770</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref10">
                <label>10</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Bratkovi&#x010d;</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bo&#x017e;i&#x010d;</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rogelj</surname>
                            <given-names>B</given-names>
                        </name>
</person-group>:
                    <article-title>Functional diversity of small nucleolar RNAs.</article-title>
                    <source>

                        <italic toggle="yes">Nucleic Acids Res.</italic>
</source>
                    <year>2020 Feb 28</year>;<volume>48</volume>(<issue>4</issue>):<fpage>1627</fpage>&#x2013;<lpage>1651</lpage>.
                    <pub-id pub-id-type="pmid">31828325</pub-id>
                    <pub-id pub-id-type="doi">10.1093/nar/gkz1140</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7038934</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref11">
                <label>11</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Samarsky</surname>
                            <given-names>DA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Fournier</surname>
                            <given-names>MJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Singer</surname>
                            <given-names>RH</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The snoRNA box C/D motif directs nucleolar targeting and also couples snoRNA synthesis and localization.</article-title>
                    <source>

                        <italic toggle="yes">EMBO J.</italic>
</source>
                    <year>1998 Jul 1</year>;<volume>17</volume>(<issue>13</issue>):<fpage>3747</fpage>&#x2013;<lpage>3757</lpage>.
                    <pub-id pub-id-type="pmid">9649444</pub-id>
                    <pub-id pub-id-type="doi">10.1093/emboj/17.13.3747</pub-id>
                    <pub-id pub-id-type="pmcid">PMC1170710</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref12">
                <label>12</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Zhang</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Xia</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The emerging role of snoRNAs in human disease.</article-title>
                    <source>

                        <italic toggle="yes">Genes Dis.</italic>
</source>
                    <year>2022 Dec 26</year>;<volume>10</volume>(<issue>5</issue>):<fpage>2064</fpage>&#x2013;<lpage>2081</lpage>.
                    <pub-id pub-id-type="pmid">37492704</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.gendis.2022.11.018</pub-id>
                    <pub-id pub-id-type="pmcid">PMC10363644</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref13">
                <label>13</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Gong</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Liu</surname>
                            <given-names>CJ</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>A Pan-cancer Analysis of the Expression and Clinical Relevance of Small Nucleolar RNAs in Human Cancer.</article-title>
                    <source>

                        <italic toggle="yes">Cell Rep.</italic>
</source>
                    <year>2017 Nov 14</year>;<volume>21</volume>(<issue>7</issue>):<fpage>1968</fpage>&#x2013;<lpage>1981</lpage>.
                    <pub-id pub-id-type="pmid">29141226</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.celrep.2017.10.070</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref14">
                <label>14</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wu</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Liu</surname>
                            <given-names>P</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The C/D box small nucleolar RNA SNORD52 regulated by Upf1 facilitates Hepatocarcinogenesis by stabilizing CDK1.</article-title>
                    <source>

                        <italic toggle="yes">Theranostics.</italic>
</source>
                    <year>2020 Jul 23</year>;<volume>10</volume>(<issue>20</issue>):<fpage>9348</fpage>&#x2013;<lpage>9363</lpage>.
                    <pub-id pub-id-type="pmid">32802196</pub-id>
                    <pub-id pub-id-type="doi">10.7150/thno.47677</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7415794</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref15">
                <label>15</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Fu</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Collins</surname>
                            <given-names>K</given-names>
                        </name>
</person-group>:
                    <article-title>Purification of human telomerase complexes identifies factors involved in telomerase biogenesis and telomere length regulation.</article-title>
                    <source>

                        <italic toggle="yes">Mol. Cell.</italic>
</source>
                    <year>2007 Dec 14</year>;<volume>28</volume>(<issue>5</issue>):<fpage>773</fpage>&#x2013;<lpage>785</lpage>.
                    <pub-id pub-id-type="pmid">18082603</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.molcel.2007.09.023</pub-id>
                    <pub-id pub-id-type="pmcid">PMC2917595</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref16">
                <label>16</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Dragon</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Pogaci&#x0107;</surname>
                            <given-names>V</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Filipowicz</surname>
                            <given-names>W</given-names>
                        </name>
</person-group>:
                    <article-title>In vitro assembly of human H/ACA small nucleolar RNPs reveals unique features of U17 and telomerase RNAs.</article-title>
                    <source>

                        <italic toggle="yes">Mol. Cell. Biol.</italic>
</source>
                    <year>2000 May</year>;<volume>20</volume>(<issue>9</issue>):<fpage>3037</fpage>&#x2013;<lpage>3048</lpage>.
                    <pub-id pub-id-type="pmid">10757788</pub-id>
                    <pub-id pub-id-type="doi">10.1128/mcb.20.9.3037-3048.2000</pub-id>
                    <pub-id pub-id-type="pmcid">PMC85579</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref17">
                <label>17</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Steinbusch</surname>
                            <given-names>MM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Fang</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Milner</surname>
                            <given-names>PI</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Serum snoRNAs as biomarkers for joint ageing and post traumatic osteoarthritis.</article-title>
                    <source>

                        <italic toggle="yes">Sci. Rep.</italic>
</source>
                    <year>2017 Mar 2</year>;<volume>7</volume>:<fpage>43558</fpage>.
                    <pub-id pub-id-type="pmid">28252005</pub-id>
                    <pub-id pub-id-type="doi">10.1038/srep43558</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5333149</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref18">
                <label>18</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Alfardan</surname>
                            <given-names>R</given-names>
                        </name>
</person-group>:
                    <article-title>Small Nuclear RNA 64 (snoRNA64): A novel Tumor Biomarker for Pancreatic Cancer.</article-title>
                    <source>

                        <italic toggle="yes">Baghdad Sci. J.</italic>
</source>
                    <year>2023</year>;<volume>20</volume>(<issue>5</issue>):<fpage>1873</fpage>&#x2013;<lpage>1881</lpage>.
                    <pub-id pub-id-type="doi">10.21123/bsj.2023.7135</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref19">
                <label>19</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Alfardan</surname>
                            <given-names>RK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Al-Ismaeel</surname>
                            <given-names>WN</given-names>
                        </name>
</person-group>:
                    <article-title>The role of Integrin Subunit Alpha 2 (ITGA2) in pancreatic cancer progression.</article-title>
                    <source>

                        <italic toggle="yes">Eksp. Klin. Gastroenterol.</italic>
</source>
                    <year>2023</year>; (<issue>10</issue>):<fpage>120</fpage>&#x2013;<lpage>124</lpage>.
                    <pub-id pub-id-type="doi">10.31146/1682-8658-ecg-218-10-120-124</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref20">
                <label>20</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Voutsadakis</surname>
                            <given-names>IA</given-names>
                        </name>
</person-group>:
                    <article-title>Mutations of p53 associated with pancreatic cancer and therapeutic implications.</article-title>
                    <source>

                        <italic toggle="yes">Ann. Hepatobiliary Pancreat. Surg.</italic>
</source>
                    <year>2021 Aug 31</year>;<volume>25</volume>(<issue>3</issue>):<fpage>315</fpage>&#x2013;<lpage>327</lpage>.
                    <pub-id pub-id-type="pmid">34402431</pub-id>
                    <pub-id pub-id-type="doi">10.14701/ahbps.2021.25.3.315</pub-id>
                    <pub-id pub-id-type="pmcid">PMC8382872</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref21">
                <label>21</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Zhou</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sheng</surname>
                            <given-names>W</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jia</surname>
                            <given-names>C</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Musashi2 promotes the progression of pancreatic cancer through a novel ISYNA1-p21/ZEB-1 pathway.</article-title>
                    <source>

                        <italic toggle="yes">J. Cell. Mol. Med.</italic>
</source>
                    <year>2020 Sep</year>;<volume>24</volume>(<issue>18</issue>):<fpage>10560</fpage>&#x2013;<lpage>10572</lpage>.
                    <pub-id pub-id-type="pmid">32779876</pub-id>
                    <pub-id pub-id-type="doi">10.1111/jcmm.15676</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7521282</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref22">
                <label>22</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Magouliotis</surname>
                            <given-names>DE</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Karamolegkou</surname>
                            <given-names>AP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zotos</surname>
                            <given-names>PA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Bioinformatic Analysis of the BCL-xL/BCL2L1 Interactome in Patients with Pancreatic Cancer.</article-title>
                    <source>

                        <italic toggle="yes">Medicina (Kaunas).</italic>
</source>
                    <year>2022 Nov 17</year>;<volume>58</volume>(<issue>11</issue>):<fpage>1663</fpage>.
                    <pub-id pub-id-type="pmid">36422202</pub-id>
                    <pub-id pub-id-type="doi">10.3390/medicina58111663</pub-id>
                    <pub-id pub-id-type="pmcid">PMC9698957</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref23">
                <label>23</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hu</surname>
                            <given-names>Q</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Peng</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Liu</surname>
                            <given-names>W</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Elevated cleaved caspase-3 is associated with shortened overall survival in several cancer types.</article-title>
                    <source>

                        <italic toggle="yes">Int. J. Clin. Exp. Pathol.</italic>
</source>
                    <year>2014 Jul 15</year>;<volume>7</volume>(<issue>8</issue>):<fpage>5057</fpage>&#x2013;<lpage>5070</lpage>.
                    <pub-id pub-id-type="pmid">25197379</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref24">
                <label>24</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Gardner</surname>
                            <given-names>AB</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Charo</surname>
                            <given-names>LM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mann</surname>
                            <given-names>AK</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Ovarian, uterine, and cervical cancer patients with distant metastases at diagnosis: most common locations and outcomes.</article-title>
                    <source>

                        <italic toggle="yes">Clin. Exp. Metastasis.</italic>
</source>
                    <year>2020 Feb</year>;<volume>37</volume>(<issue>1</issue>):<fpage>107</fpage>&#x2013;<lpage>113</lpage>.
                    <pub-id pub-id-type="pmid">31758289</pub-id>
                    <pub-id pub-id-type="doi">10.1007/s10585-019-10007-0</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref25">
                <label>25</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Acar</surname>
                            <given-names>V</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Couto Fernandez</surname>
                            <given-names>FL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Buscariolo</surname>
                            <given-names>FF</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Immunohistochemical Evaluation of PARP and Caspase-3 as Prognostic Markers in Prostate Carcinomas.</article-title>
                    <source>

                        <italic toggle="yes">Clin. Med. Res.</italic>
</source>
                    <year>2021 Dec</year>;<volume>19</volume>(<issue>4</issue>):<fpage>183</fpage>&#x2013;<lpage>191</lpage>.
                    <pub-id pub-id-type="pmid">34933951</pub-id>
                    <pub-id pub-id-type="doi">10.3121/cmr.2021.1607</pub-id>
                    <pub-id pub-id-type="pmcid">PMC8691432</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref26">
                <label>26</label>
                <mixed-citation publication-type="book">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Dogan</surname>
                            <given-names>E</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kara</surname>
                            <given-names>HG</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kosova</surname>
                            <given-names>B</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <chapter-title>Targeting Apoptosis to Overcome Chemotherapy Resistance. </chapter-title>
                    <person-group person-group-type="editor">

                        <name name-style="western">
                            <surname>Sergi</surname>
                            <given-names>CM</given-names>
                        </name>
</person-group>, editor.
                    <source>

                        <italic toggle="yes">Metastasis.</italic>
</source>
                    <publisher-loc>Brisbane (AU)</publisher-loc>:
                    <publisher-name>Exon Publications</publisher-name>;<year>2022 May 3</year>. Chapter 12.
                    <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/books/NBK580869/10.36255/exon-publications.metastasis.chemotherapy-resistance">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref27">
                <label>27</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kim</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kin</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Beck</surname>
                            <given-names>WT</given-names>
                        </name>
</person-group>:
                    <article-title>Impact of Complex Apoptotic Signaling Pathways on Cancer Cell Sensitivity to Therapy.</article-title>
                    <source>

                        <italic toggle="yes">Cancers (Basel).</italic>
</source>
                    <year>2024 Feb 28</year>;<volume>16</volume>(<issue>5</issue>):<fpage>984</fpage>.
                    <pub-id pub-id-type="pmid">38473345</pub-id>
                    <pub-id pub-id-type="doi">10.3390/cancers16050984</pub-id>
                    <pub-id pub-id-type="pmcid">PMC10930821</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref28">
                <label>28</label>
                <mixed-citation publication-type="data">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Alafrdan</surname>
                            <given-names>R</given-names>
                        </name>
</person-group>:
                    <data-title>Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer.</data-title>Dataset.
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>
                    <year>2025 Nov 29</year>.
                    <pub-id pub-id-type="doi">10.6084/m9.figshare.30742097.v1</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report455858">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.191586.r455858</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Liang</surname>
                        <given-names>Tingbo</given-names>
                    </name>
                    <xref ref-type="aff" rid="r455858a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r455858a1">
                    <label>1</label>Zhejiang University School of Medicine, Hangzhou, Zhejiang, China</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>23</day>
                <month>2</month>
                <year>2026</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2026 Liang T</copyright-statement>
                <copyright-year>2026</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport455858" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.173746.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>reject</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>Alfardan examines SNORA64 knockdown in PK-8 pancreatic adenocarcinoma cells using qPCR of BCL-2 family genes and viability/proliferation assays to argue SNORA64 regulates intrinsic apoptosis. While the concept is interesting, the conclusions are based mainly on mRNA changes and non-specific viability readouts, without direct apoptosis validation and with insufficient methodological detail. Substantial additional experiments and clearer reporting are required. 
                <list list-type="order">
                    <list-item>
                        <p>Apoptosis is inferred from mRNA only; functional apoptosis assays are needed. Please include at least one direct apoptosis readout:&#x00a0; Annexin V/PI (or Annexin V/7-AAD) flow cytometry;Caspase-3/7 activity, cleaved caspase-3 and cleaved PARP by Western blot;Mitochondrial membrane potential (JC-1/TMRE) and cytochrome c release to connect to intrinsic pathway. Without these, it is difficult to conclude that apoptosis is truly altered rather than changes in transcription accompanying altered growth state.</p>
                    </list-item>
                    <list-item>
                        <p>Clarify causality and strengthen mechanistic claims. The conclusion states &#x201c;SNORA64 interactions with apoptotic inhibitor molecules,&#x201d; but no interaction data are described. If &#x201c;interaction&#x201d; is meant mechanistically, consider: RNA pulldown / RIP (e.g., with candidate RNA-binding proteins) or CLIP-based approaches;Assessment of snoRNA canonical function (rRNA modification targets) and whether those changes affect translation of apoptosis regulators.&#x00a0;</p>
                    </list-item>
                    <list-item>
                        <p>Use of a single cell line limits generalizability. Findings are based on PK-8 only. Pancreatic cancer is heterogeneous. Please validate in additional PDAC lines (e.g., PANC-1, MiaPaCa-2, BxPC-3, AsPC-1) and/or a non-malignant pancreatic ductal cell line as a baseline.</p>
                    </list-item>
                    <list-item>
                        <p>Knockdown validation and experimental design details are insufficient. Provide SNORA64 knockdown efficiency (qPCR Ct values, % reduction) and number of independent biological replicates.</p>
                    </list-item>
                    <list-item>
                        <p>Therapeutic sensitization claim requires treatment context. The final sentence implies SNORA64 can increase sensitivity &#x201c;during treatment,&#x201d; but no drug or stress condition is tested. Consider adding experiments with standard PDAC agents (e.g., gemcitabine, nab-paclitaxel, irinotecan/5-FU regimens) or apoptosis inducers, showing differential response between scramble and knockdown (or rescue with SNORA64 re-expression).</p>
                    </list-item>
                </list>
            </p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Partly</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Partly</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Partly</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Pancreatic cancer</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.</p>
        </body>
        <sub-article article-type="response" id="comment15680-455858">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Alfardan</surname>
                            <given-names>Rana</given-names>
                        </name>
                        <aff>Community health Department, Southren Technical University, Basrah, Basrah, Iraq</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>13</day>
                    <month>3</month>
                    <year>2026</year>
                </pub-date>
            </front-stub>
            <body>
                <p>Dear Dr. Tingbo Liang,</p>
                <p> </p>
                <p> Thank you very much for your time and for your insightful comments on my manuscript. I would like to address the points you have raised and provide clarification where necessary: 
                    <list list-type="order">
                        <list-item>
                            <p>Regarding the assessment of apoptosis, quantitative real-time PCR (qPCR) results provide supporting evidence of apoptosis through the evaluation of changes in gene expression. Nevertheless, I acknowledge that confirmation via protein cleavage assays or flow cytometry constitutes an essential step and will be pursued in future investigations.</p>
                        </list-item>
                        <list-item>
                            <p>The use of a single cell line is acknowledged as a limitation of the current study. This point has now been explicitly mentioned in the second version of the manuscript.</p>
                        </list-item>
                        <list-item>
                            <p>Transfection of the PK-8 cell line was carried out using siRNA oligonucleotides delivered via the psiRNA-h7SKG1 vector. The specific oligo sequences and the detailed protocol are provided in the cited reference. In accordance with the other reviewer&#x2019;s suggestion, the type of small RNA employed for knockdown has now been clearly specified in the second version.</p>
                        </list-item>
                        <list-item>
                            <p>With respect to the therapeutic sensitization effect, I would like to clarify that this interpretation remains speculative at this stage and is proposed as a direction for future studies.</p>
                        </list-item>
                    </list> Thank you again for your valuable feedback, which has helped strengthen the manuscript.</p>
                <p> Sincerely,</p>
                <p> Dr. Rana Alfardan</p>
            </body>
        </sub-article>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report451315">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.191586.r451315</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Oluremi</surname>
                        <given-names>Adeolu</given-names>
                    </name>
                    <xref ref-type="aff" rid="r451315a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r451315a1">
                    <label>1</label>University of Arkansas at Little Rock, Little Rock, Arkansas, USA</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>21</day>
                <month>1</month>
                <year>2026</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2026 Oluremi A</copyright-statement>
                <copyright-year>2026</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport451315" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.173746.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>
                <bold>Title &amp; Abstract</bold>
            </p>
            <p> </p>
            <p> 
                <bold>Title:</bold>&#x00a0;Consider making it more specific and impactful.</p>
            <p> 
                <bold>Suggestion:</bold>&#x00a0;
                <italic>"Downregulation of SNORA64 Promotes Pancreatic Cancer Cell Survival by Modulating the Apoptotic Regulator Gene Network"</italic>
            </p>
            <p> </p>
            <p> 
                <bold>Abstract</bold>
            </p>
            <p> 
                <bold>Methods:</bold>&#x00a0;The methods description is overly brief. Specify the key techniques used (e.g., RT-qPCR for gene expression, cell viability assay using trypan blue exclusion).</p>
            <p> 
                <bold>Results:</bold>&#x00a0;Include the key finding about&#x00a0;p53 downregulation, as it's a central result. Mention the lack of change in BAD/BIM for completeness.</p>
            <p> 
                <bold>Conclusion:</bold>&#x00a0;State the&#x00a0;potential therapeutic implication&#x00a0;more clearly (e.g., "SNORA64 may serve as a sensitizer to apoptosis-inducing therapies.").</p>
            <p> </p>
            <p> 
                <bold>Introduction</bold>
            </p>
            <p> </p>
            <p> 
                <bold>Flow:</bold>&#x00a0;The transition from general apoptosis mechanisms to snoRNAs to&#x00a0;SNORA64 specifically&#x00a0;is somewhat abrupt. The rationale for studying&#x00a0;
                <italic>SNORA64 in pancreatic cancer</italic>&#x00a0;needs a stronger link.</p>
            <p> </p>
            <p> 
                <bold>Suggestion:</bold>&#x00a0;After introducing snoRNAs in cancer, add 1-2 sentences summarizing your&#x00a0;previous study&#x00a0;(mentioned in the Abstract) that identified SNORA64 as a predictive marker in pancreatic cancer, which directly motivates the current functional investigation into apoptosis.</p>
            <p> </p>
            <p> 
                <bold>Materials &amp; Methods</bold>
            </p>
            <p> 
                <bold>Clarity and Detail:</bold>
            </p>
            <p> </p>
            <p> 
                <bold>2.1:</bold>&#x00a0;Specify how the SNORA64 knockdown was achieved (e.g., shRNA, siRNA) and the source/sequence of the scramble control.</p>
            <p> </p>
            <p> 
                <bold>2.2:</bold>&#x00a0;The description of gel electrophoresis to "confirm qPCR results" is unusual, as qPCR is typically quantitative and agarose gels are qualitative. Clarify if this was for product verification.</p>
            <p> </p>
            <p> 
                <bold>Table 1:</bold>&#x00a0;The table formatting is corrupted in the text. Ensure it is presented clearly with separate columns for Gene Symbol, Left Primer, and Right Primer.</p>
            <p> </p>
            <p> 
                <bold>2.4:</bold>&#x00a0;Mention the software used for statistical analysis.</p>
            <p> </p>
            <p> 
                <bold>Results</bold>
            </p>
            <p> </p>
            <p> 
                <bold>Logical Order:</bold>&#x00a0;The results for&#x00a0;p53 (3.1)&#x00a0;are critical and should be presented&#x00a0;before&#x00a0;the BCL2 family results (3.2), as p53 is a key upstream regulator of many of these genes. This improves the narrative flow.</p>
            <p> </p>
            <p> 
                <bold>Figure References:</bold>&#x00a0;Ensure every figure (1, 2A/B, 3, 4A/B) is explicitly called out in the results text in sequential order.</p>
            <p> </p>
            <p> 
                <bold>Language:</bold>&#x00a0;Consistently use "knockdown" or "low expression." Avoid switching between them (e.g., "Pk-8 with SNORA64 knockdown" vs. "Pk-8 with low expression of SNORA64").</p>
            <p> </p>
            <p> 
                <bold>Discussion</bold>
            </p>
            <p> 
                <bold>Structure:</bold>&#x00a0;The discussion is comprehensive but can be better organized to mirror the results.</p>
            <p> 
                <bold>Paragraph 1:</bold>&#x00a0;Discuss&#x00a0;p53 downregulation&#x00a0;and its implications.</p>
            <p> 
                <bold>Paragraph 2:</bold>&#x00a0;Discuss the&#x00a0;BCL2 family (anti-apoptotic: BCL2, BCL-XL; pro-apoptotic: BID, BAX, BAK)&#x00a0;results.</p>
            <p> </p>
            <p> 
                <bold>Paragraph 3:</bold>&#x00a0;Discuss the&#x00a0;caspase&#x00a0;results and their connection to the BCL2 pathway.</p>
            <p> </p>
            <p> 
                <bold>Paragraph 4:</bold>&#x00a0;Synthesize how these molecular changes explain the&#x00a0;increased cell viability.</p>
            <p> </p>
            <p> 
                <bold>Paragraph 5:</bold>&#x00a0;Discuss the&#x00a0;lack of effect on BAD/BIM, which is an interesting negative result&#x2014;speculate briefly on why SNORA64 might not affect these specific BH3-only proteins.</p>
            <p> </p>
            <p> 
                <bold>Mechanistic Speculation:</bold>&#x00a0;The discussion excellently connects the dots. To strengthen it, propose a&#x00a0;testable hypothetical model&#x00a0;in a sentence (e.g., "We propose that SNORA64 may influence a transcriptional or post-transcriptional regulator that coordinately modulates p53 and a subset of BCL2 family genes, but not BAD/BIM.").</p>
            <p> </p>
            <p> 
                <bold>Limitations:</bold>&#x00a0;Add a brief&#x00a0;limitations&#x00a0;subsection before the conclusion. Acknowledge that this is an&#x00a0;
                <italic>in vitro</italic>&#x00a0;study using a single cell line (PK-8). Future work should validate findings in other pancreatic cancer cell lines and&#x00a0;
                <italic>in vivo</italic>&#x00a0;models.</p>
            <p> </p>
            <p> </p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Partly</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Cancer Biology, Infectious diseases, Nanotechnology, Biomedical Sciences</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
        <sub-article article-type="response" id="comment15669-451315">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Alfardan</surname>
                            <given-names>Rana</given-names>
                        </name>
                        <aff>Community health Department, Southren Technical University, Basrah, Basrah, Iraq</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>12</day>
                    <month>3</month>
                    <year>2026</year>
                </pub-date>
            </front-stub>
            <body>
                <p>
                    <bold>Subject: Revision of the research article (Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro)</bold>
                </p>
                <p> </p>
                <p> Dear Dr. Adeolu Oluremi,</p>
                <p> Thank you very much for your thoughtful and constructive suggestions. I have accepted all of them, and they have significantly enriched my manuscript. Please find below a point-by-point response to your comments: 
                    <list list-type="order">
                        <list-item>
                            <p>
                                <bold>Title:</bold>&#x00a0;Thank you for your valuable suggestion regarding the manuscript title. I agree that the proposed title, 
                                <bold>"Downregulation of SNORA64 Promotes Pancreatic Cancer Cell Survival by Modulating the Apoptotic Regulator Gene Network,"</bold> would indeed be powerful and appropriate for this work.</p>
                            <p> However, upon further consideration of this modification, I have encountered a significant practical constraint. The data of the manuscript has already been published online under its current title, making a title change procedurally difficult at this stage. Furthermore, the previous two editors involved with this manuscript explicitly endorsed the current title during the review process.</p>
                            <p> Given these circumstances, and with respect for the editorial consistency maintained throughout the review process, I believe the title should remain unchanged. I hope you understand this decision, and I appreciate your understanding regarding this limitation.</p>
                            <p> Sincerely,</p>
                        </list-item>
                        <list-item>
                            <p>
                                <bold>Abstract:</bold>&#x00a0;As suggested, the abstract has been revised to specify the key techniques used. It now also explicitly includes the key findings regarding p53 downregulation and the lack of change in BAD/BIM. Furthermore, the potential therapeutic implications have been stated more clearly.</p>
                        </list-item>
                        <list-item>
                            <p>
                                <bold>Conclusion:</bold>&#x00a0;The conclusion has been revised exactly as you suggested.</p>
                        </list-item>
                        <list-item>
                            <p>
                                <bold>Introduction:</bold>&#x00a0;Our previous study is already mentioned in the introduction. The text has been revised to directly introduce pancreatic cancer and explicitly motivate the current functional investigation into apoptosis, creating a smoother transition from the background to the study's objective.</p>
                        </list-item>
                        <list-item>
                            <p>
                                <bold>Materials and Methods:</bold> 
                                <list list-type="bullet">
                                    <list-item>
                                        <p>
                                            <bold>2.1:</bold>&#x00a0;The transfection of the PK-8 cell line is performed with siRNA oligos carried by psiRNA-h7SKG1. The oligo sequences and the protocol are detailed in the cited reference. However, as you suggested, the type of small RNA used for the knockdown has now been specified in the text.</p>
                                    </list-item>
                                    <list-item>
                                        <p>
                                            <bold>2.2:</bold>&#x00a0;The sentence regarding the use of agarose gels for qPCR product verification has been revised as you suggested for clarity.</p>
                                    </list-item>
                                    <list-item>
                                        <p>
                                            <bold>Table 1:</bold>&#x00a0;The table format has been changed as you recommended. It now consists of three columns: Gene Symbol, Left Primer, and Right Primer.</p>
                                    </list-item>
                                    <list-item>
                                        <p>
                                            <bold>2.4:</bold>&#x00a0;Excel has now been added to the "Materials" subsection as one of the software used for statistical analysis.</p>
                                    </list-item>
                                </list> </p>
                        </list-item>
                        <list-item>
                            <p>
                                <bold>Results:</bold> 
                                <list list-type="bullet">
                                    <list-item>
                                        <p>The results for p53 (3.1) are now presented before the BCL2 family results (3.2), following the logical flow you recommended.</p>
                                    </list-item>
                                    <list-item>
                                        <p>
                                            <bold>Figure References:</bold>&#x00a0;All figures (Figure 1, 2A/B, 3, 4A/B) are now explicitly called out in the results text in sequential order.</p>
                                    </list-item>
                                    <list-item>
                                        <p>
                                            <bold>Language:</bold>&#x00a0;For consistency, the phrasing "PK-8 with SNORA64 knockdown" is now used consistently throughout the manuscript.</p>
                                    </list-item>
                                </list> </p>
                        </list-item>
                        <list-item>
                            <p>
                                <bold>Discussion:</bold> 
                                <list list-type="bullet">
                                    <list-item>
                                        <p>
                                            <bold>Paragraph 1:</bold>&#x00a0;Two sentences have been added to discuss the observed downregulation of p53 and its potential implications.</p>
                                    </list-item>
                                    <list-item>
                                        <p>
                                            <bold>Paragraph 2:</bold>&#x00a0;This paragraph now focuses on discussing the BCL2 family, including both pro- and anti-apoptotic molecules.</p>
                                    </list-item>
                                    <list-item>
                                        <p>
                                            <bold>Paragraph 3:</bold>&#x00a0;Two sentences have been added to discuss the connection between the caspase cascade and the BCL2 pathway.</p>
                                    </list-item>
                                    <list-item>
                                        <p>
                                            <bold>Paragraph 4:</bold>&#x00a0;This paragraph has been rephrased, and three sentences have been added to elaborate on the increase in cell viability.</p>
                                    </list-item>
                                    <list-item>
                                        <p>
                                            <bold>Paragraph 5:</bold>&#x00a0;A new paragraph specifically discussing BIM and BAD has been added.</p>
                                    </list-item>
                                    <list-item>
                                        <p>
                                            <bold>Mechanistic Speculation:</bold>&#x00a0;Thank you for this excellent suggestion. This section has been incorporated into the revised manuscript (version 2).</p>
                                    </list-item>
                                </list> </p>
                        </list-item>
                        <list-item>
                            <p>
                                <bold>Limitations:</bold>&#x00a0;A new "Limitations" subsection has been added to the discussion, as you recommended, to address the constraints of the current study.</p>
                        </list-item>
                    </list> Thank you again for your time and expertise, which have greatly improved the quality of my work.</p>
                <p> </p>
                <p> Sincerely,</p>
                <p> Dr. Rana Alfardan</p>
            </body>
        </sub-article>
    </sub-article>
</article>
