Inherent limitations are associated with the antibody characterization platform used in this study. Firstly, the YCharOS project focuses on renewable (recombinant and monoclonal) antibodies and does not test all commercially available MMP7 antibodies. YCharOS partners provide approximately 80% of all renewable antibodies, but some top-cited polyclonal antibodies may not be available through these partners. We encourage readers to consult vendor documentation to identify the specific antigen each antibody is raised against, where such information is available.

Secondly, the YCharOS effort employs a non-biased approach that is agnostic to the protein for which antibodies have been characterized. The aim is to provide objective data on antibody performance without preconceived notions about how antibodies should perform or the molecular weight that should be observed in western blot. As the authors are not experts in MMP7, only a brief overview of the protein’s function and its relevance in disease is provided. MMP7 experts are invited to analyse and interpret observed banding patterns in western blots. Thirdly, YCharOS experiments are not performed in replicates primarily due to the use of multiple antibodies targeting various epitopes. Once a specific antibody is identified, it validates the protein expression of the intended target in the selected cell line, confirms the lack of protein expression in the KO cell line and supports conclusions regarding the specificity of the other antibodies. All experiments are performed using master mixes, and meticulous attention is paid to sample preparation and experimental execution. In instances where antibodies yield no signal, a repeat experiment is conducted following titration. Additionally, our independent data is performed subsequently to the antibody manufacturers internal validation process, therefore making our characterization process a repeat.

Lastly, as comprehensive and standardized procedures are respected, any conclusions remain confined to the experimental conditions and cell line used for this study. The use of a single cell type for evaluating antibody performance poses as a limitation, as factors such as target protein abundance significantly impact results. Additionally, the use of cancer cell lines containing gene mutations poses a potential challenge, as these mutations may be within the epitope coding sequence or other regions of the gene responsible for the intended target. Such alterations can impact the binding affinity of antibodies. This represents an inherent limitation of any approach that employs cancer cell lines.

All MMP7 antibodies are listed in Table 2, together with their corresponding Research Resource Identifiers (RRID), to ensure antibodies are cited properly. ¹⁰ Secondary antibodies used in this study are provided in Table 3. To ensure consistency with manufacturer recommendations and account for proprietary formulations (where antibody concentrations are not disclosed), antibody usage is reported as dilution ratios rather than absolute concentrations.

All cell lines used in this study are listed in Table 1, alongside their corresponding RRIDs, to ensure proper citation. ¹¹ Cells were cultured in DMEM high-glucose (Capricorn Scientific #DMEM-HPSTA) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific #A5256801) and 1% antibiotic/antimycotic solution (Capricorn Scientific #AAS-B). All cell lines used in this study were routinely tested for mycoplasma contamination and were confirmed to be mycoplasma-free.

The A549 MMP7 KO clone was generated using low-passage cells. Prior to ribonucleoprotein transfection, 20,000 cells were plated in each well of a 48-well plate and incubated overnight to allow attachment. in vitro guide RNA was generated with the HighYield T7 sgRNA synthesis kit (Jena Bioscience #RNT-105), followed by incubation with DNase I-XT (New England Biolabs #M0570) and quick CIP (New England Biolabs #M0525) to remove DNA and 5’ phosphorylation respectively. RNA was purified using the Monarch spin RNA cleanup kit (New England Biolabs #T2040) and 125 ng of guide RNA (target sequence: TCAAAGGCTTTAAACATGTG) was combined with 625 ng of spCas9. Ribonucleoprotein transfection was then performed using the Lipofectamine CRISPRMAX Cas9 transfection reagent (Thermo Fisher Scientific #CMAX000008) according to the manufacturer’s protocol. The culture medium was replaced the following day, and single-cell isolation was performed on day three. Single cells were plated into 96-well plates and clonally expanded.

A549 WT and MMP7 KO cells were washed three times in Hanks’ balanced salt solution (HBSS) (Capricorn Scientific #HBSS-2A) and serum deprived for 48-hours in DMEM media without phenol red (Thermo Fisher Scientific #21063029) supplemented with 1% antibiotic/antimycotic solution. Culture medium was then collected and centrifuged for 500 × g, for 10 minutes at 4°C to eliminate cells and larger contaminants, then for 4500 × g, for 10 minutes at 4°C to eliminate smaller contaminants. Conditioned medium was then concentrated by centrifugation at 4000 × g for 30 minutes at 4°C using Amicon Ultra 15 mL centrifugal filters with a 3 kDa molecular weight cut off (Sigma Aldrich #UFC900396). Culture media was then supplemented with 1× protease inhibitor cocktail (Cell Signaling Technology #7012).

For lysate preparation, A549 WT and MMP7 KO cells were washed three times in phosphate buffered saline (PBS) (Thermo Fisher Scientific #70011044) and lysed in RIPA buffer containing 1× of protease inhibitor cocktail, sodium orthovanadate and phenylmethylsulfonyl fluoride (Santa Cruz Biotechnology #sc-24948). Lysates were sonicated (40% amplitude for 5 seconds) three times and incubated for 30 minutes on ice prior to centrifugation at 20,000 × g for 1 hour at 4°C.

Protein concentration was confirmed using the Pierce BCA protein assay (Thermo Fisher Scientific #23225) and 30 μg of protein was used for both protein lysates and concentrated cell culture medium. Samples were combined with Laemmli sample buffer (Bio-Rad #1610747) containing 2-mercaptoethanol (final concentration 355 mM) (Sigma Aldrich #M7522) before being heated at 65°C for 10 minutes. Samples were then loaded in precast 4-20% WedgeWell Tris-Glycine Plus midi gels (Thermo Fisher Scientific #WTG42020BOX) alongside Prime-Step prestained broad range protein ladder (BioLegend #773302). SDS-PAGE was then performed in SureLock Tandem Midi Gel tanks (Thermo Fisher Scientific #STM1001) and run at 200V for 1 hour with Tris/Glycine/SDS buffer (Bio-Rad #1610772). Proteins were then transferred to 0.2μm supported nitrocellulose membranes (Cytiva #10600015) using a Criterion blotter with plate electrodes (Bio-Rad #17004070) run at 85V for 45 minutes. Proteins on the blot were then visualised with Ponceau S staining (Thermo Fisher Scientific #161470250) which was scanned to show alongside individual western blots. Blots were blocked with 5% milk for 1 hour except for antibody 71031 which was blocked in 5% BSA in Tris-buffered saline containing 1% Tween 20 (TBST) (Thermo Fisher Scientific #J77500.K2). Primary antibodies were then incubated overnight at 4°C in 5% milk TBST with gentle shaking. Following three ten-minute washes with TBST, horseradish peroxidase (HRP) conjugated secondary antibodies were incubated at a dilution of 1/10000 (0.1 μg/mL) in TBST with 5% milk for 1 hour at room temperature followed by three ten-minute washes with TBST. Membranes were then incubated with either Pierce ECL (Thermo Fisher Scientific #32106) for 1 minute or Clarity Western ECL substrate (Bio-Rad #1705061) for 5 minutes prior to detection with the ImageQuant LAS 4000.

Antibody-bead conjugates were prepared by adding 2 μg of antibody to 1 mL of Pierce IP Lysis Buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40 and 5% glycerol) (Thermo Fisher Scientific #87788) in a microcentrifuge tube, together with 30 μL of protein A (for rabbit antibodies) or protein G (for mouse antibodies) (Thermo Fisher Scientific #10002D and #10004D respectively). Tubes were rocked for 1 hour at 4°C followed by two washes to remove unbound antibody. Culture media from A549 WT were collected as described in the western section above. 0.5 mL aliquots at 1 mg/mL of culture medium were incubated with an antibody-bead conjugate for 18 hours at 4°C. The unbound fractions were collected, and beads were subsequently washed three times with 1.0 mL of IP buffer and processed for SDS-PAGE and western blot on precast midi 4-20% Tris-Glycine polyacrylamide gels.