A disposable cotton swab was used to collect 100 specimens from pregnant and non-pregnant women who had bacterial vaginosis. In October 2023, the samples were collected at a private clinic. As soon as samples were taken from the patient for diagnosis, they were cultured, and the patient’s information was documented.

Every sample was grown on MacConkey agar, chocolate agar, and human blood agar. After that, it was incubated for 24 hours at 37 °C in an aerobic environment. To determine the type of bacteria, it was then subjected to a battery of tests. First, their size, shape, color, pigments, and hemolytic activity were evaluated. They were then subjected to gram staining and microscopic analysis. They next went through biochemical testing like Voges-Proskauer, indole, and methyl red. Lastly, VITEK2 was used to confirm each isolate’s diagnosis.

In accordance with CLSI 2023, the antibiotic susceptibility test was performed using the disc diffusion method ( Campbell, 2013). The effectiveness of antibiotics, which were produced by (Bioanalyse Company in Turkey) (Cefixime, Ciprofloxacin, Amikacin, Chloramphenicol, Levofloxacin, Gentamycin, Azithromycin, Tobramycin) against S taphylococcus. aureus, Streptococcus agalactiae.

Using the Resazurin Microtitre-plate Assay (REMA) with a few changes, the minimum inhibitory concentration (MIC) of the solutions Levofloxacin, Cefixime, Cranberry and mix (Levofloxacin + Cranberry) and (Cefixime + Cranberry) was found. Each well of the microtiter plate received 100 μl of Brain Heart Broth (BHI) under aseptic conditions. Next, the first row of the 96-well plates was filled with 100 μl of the test sample, which included (gentamicin, clove extract, and GCE). 100 μl of the test material was pipetted at descending concentrations (1/2,1/4,1/8,1/16,1/32,1/64, and 1/128) from one well to the next in order to perform serial dilutions. A 10 μl bacterial suspension containing 1.5 × 10 ⁸ CFU/ml was added to each well. For 18 to 24 hours, the plates were incubated at 35 ± 2 °C with loose wraps of Parafilm. Each well received 10 μl of resazurin solution (Alamar blue) after incubation. To see if the colour changed, the plate was incubated again for four hours. Resazurin’s hue was observed to determine the outcome visually; transitions from purple to pink, red, or colourless were considered positive ( Sarker et al., 2007).

The micro-titer plate method was used to determine bacteria’s ability to create biofilm. Microtiter wells with 180 μl of Tryptone soya broth were injected with a 20 μl bacterial suspension from an overnight culture (similar to McFarland standard No. 0.5). A control set of microtiter wells had 200 μl of sterile Tryptone soya broth. All microtiter plates were then incubated at 37 °C for the entire day. After that, the wells were washed three times with phosphate-buffered saline (pH 7.2) and dried at room temperature. Each well was treated with 200 μl of methanol for 15 minutes. Next, the plates were dried at room temperature. Each well received 200 μl of 0.1% crystal violet solution for 15 minutes. Following that, the crystal violet solution was withdrawn and washed three times with phosphate-buffered saline (pH 7.2) to remove any remaining dye. Wells were dried at room temperature for 15 minutes. A microplate reader (Biotek ELX 800, UK) measured absorbance at 600 nm after adding 200 μl of 33% glacial acetic acid to each well. The cutoff value was calculated as the control’s mean OD ₆₀₀ plus three standard deviations. Any isolate with an OD above the cut-off value was designated a biofilm producer ( Al-Shaabani et al., 2020).

The cranberry fruit was obtained from the local market. Air-dried at room temperature after being washed several times with distilled water (DW), then it was converted into powder form by using a sterile electric grinder. Then the active components of cranberry fruit were extracted by using an organic solvent (methanol). Where a quantity of 25 g of air-dried powder was extracted with 200 ml of methanol, by using the Soxhlet apparatus for 5 h at 60 °C. Thereafter, the methanol was evaporated by using the rotary evaporator at 40 °C. The final extract was kept at 4 °C before using ( Akroum et al., 2009).

Written informed consent was obtained from all participants prior to data collection. As shown in Form 1 and Form 2, which are examples and part of these approvals.

RNA extraction

The gene expression was tested at ½MIC for three treatments for each isolate (Levofloxacin, Cefixime, Cranberry and mix (Levofloxacin + Cranberry) and (Cefixime + Cranberry), as well as a control without treatment (only bacteria growing in the broth). After growing the bacteria at ½MIC of each treatment solution, the RNA was extracted using the Trizol technique ( Thermo Fisher Scientific, 2016).

Convert RNA to cDNA

The RNA is extracted and converted into cDNA using the Luna Universal qPCR&RT-qPCR kit’s instructions (10 μl of master mix, 1 μl of random primer, 1 μl of RT enzyme, 2 μl of nucleas-free water, and finally 6–8 μl of RNA) in a PCR machine (verity, Applied Biosystems). The PCR conditions were 25 °C for 5 minutes, 42 °C for 15 minutes, 85 °C for 15 seconds, and 4 °C hold ( Jaafar & Shareef, 2023).

Two different genes were selected to each bacteria according to the bacteria the rgg2 gene was amplified used the forward primer (5′- GCGCCTTAGAATGAATCGACAC-3′) and reverse primer (5′- GCAGATGAGCACCTATCCAAGT-3′) and tetM gene with forward primer (5′-GCTTCCGTTGGGAAGTGGAA‐3′) and reverse primer (5′- CCTTGTTCGCAACCATAGCG-3′) for bacteria S. agalactiae. and for bacteria S. aureus the fnpB gene was amplified used forward primer (5′- TGGTGCCACTGCTTTAACCT-3′) and revers primer (5′- ACCAGTACCACCTGCCAAAG-3′) and also norA gene amplified used forward primer (5′- CCAGGTAAATTAGCCGATTGC-3′) and reverse primer (5′- AAATCGCCTGCGTTCTAGAG‐3′). Thereafter, a two-step gene expression was initiated by putting the cDNA samples into the real-time PCR instrument and making the additions according to the kit manufacturer’s instructions. (Luna Universal qPCR/RT-qPCR) The RT-PCR was performed using 10 μl of master mix, 3 μl of nuclease-free water, 1 μl of forward and reverse gene primers, and 5 μl of cDNA material. The thermal cycling conditions were as follows: 95 °C for 60 seconds (initial denaturation 1 cycle); 95 °C for 15 seconds (denaturation 40–45 cycles); and 60 °C for 30 seconds (extension 40–45 cycles) (Al-Taee et al., 2018).

After samples were collected from 100 patients cultivated on three culture mediums diagnosed microscopically and used the ViteK-2 system and biochemical tests. The following Table 1 displays the results achieved.

The disk diffusion method was used to determine antibiotic susceptibility. The susceptibility of bacteria varied based on the antibiotic used and species. The result shows the. Figure 1: the Staphylococcus. aureus isolates were sensitive to most antibiotics and resistant to Amikacin 53.5%, Levofloxacin 53.5%, Gentamycin 57,1% and Cefixime 74.8%. In Figure 2, the Streptococcus agalactiae is also sensitive to most antibiotics, but resistant to Cefixime 64.2%, Levofloxacin 53%, Gentamycin 60%, Tobramycin 47% Amikacin 60%.

In Figure 3 the Streptococcus agalactiae (86.66%)(13/15) of isolates were biofilm producers out of 13 biofilm producing isolates 3 (23.07%), 9(69.23%), and 1(7.69%) were weak, moderate, strong, respectively. Figure 4 demonstrated that (89%) (25/28) of Staphylococcus. aureus isolates were considered biofilm producers out of 25 biofilm-producing isolates; 10(40%), 12(48%), and 3(12%) were weak, moderate, and strong, respectively.

After the MIC was detect the gene expression results for rgg2 gene and tetM gene for S. agalactiae bacteria and norA gene and fnpB gene for S. aureus bacteria show ½MIC of Cefixime, Levofloxacin increase gene expression but ½MIC of cranberry, mix the (Cranberry + Cefixime), (Cranberry+ Levofloxacin) reduce gene expression ( Table 2), ( Table 3) and ( Table 4), ( Table 5).