F1000Research F1000Research 2046-1402 F1000 Research Limited London, UK 10.12688/f1000research.173446.1 Research Article Articles Pathophysiological Effects of Titanium Dioxide Nanoparticles and the Protective Role of Piperine and a Piperine-TiO₂NP Combination in Rats.

[version 1; peer review: 1 not approved]

 Jasim Nawfal Ahmed Formal Analysis Investigation Methodology Supervision Writing – Review & Editing https://orcid.org/0009-0002-9076-0013 a 1 S. Mahdi Zahraa Conceptualization Data Curation Resources Validation 2 Khalid Ali Rafid Formal Analysis Investigation Project Administration Software 3 Department of Physiology and Medical Physics, College of Medicine, University of Fallujah, Al-Fallujah, Al Anbar Governorate, Iraq Department of Pathology and Poultry Disease, College of Veterinary Medicine, University of Kerbala College of Veterinary Medicine, Karbala, Karbala Governorate, Iraq Department of Pathology and Poultry Disease, College of Veterinary Medicine, University of Fallujah, Al-Fallujah, Al Anbar Governorate, Iraq dr.physiologist_med@uofallujah.edu.iq

No competing interests were disclosed.

 21 1 2026 2026 15 99 13 1 2026 Copyright: © 2026 Jasim Nawfal A et al. 2026 This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Background

This study aimed to evaluate the protective role of piperine and piperine-loaded titanium dioxide nanoparticles on oxidative and biochemical parameters, antioxidant levels, and cytogenetic parameters in the brain.

 Methods

forty rats were randomly divided into four equal groups for 35 days as follow: the control group was administered DW/IP; the G1 group received 40 mg/kg B.W. of piperine orally; The G2 group was given TiO2NPs (50 mg/kg B.W.)/i.p. received; and the G3 group received 75 mg/kg B.W. /I. P. of PIP-TiO2NPs.

 Results

A significant increase in serum TAO-C and a significant decrease in ROS were observed in G1 and G3 compared to G2 and the control groups. A significant reduction in serum neurotransmitter concentration was found in the G2 group compared to the G1, control, and G3 groups, while a significant increase was observed in the G1 group. Gene expression data for cyclooxygenase showed upregulation in the G2 group and was significantly higher than in the G3, G1, and control groups. Histopathological examination showed normal brain layers, hippocampus, and thalamus appearance in G1, G2, G3, and the control groups. The G2 group showed mild vascular congestion, hyperplasia, and mild disruption in the molecular cell layer of the cerebral cortex. The hippocampus of the G3 group showed moderate vacuolation with glial reduction.

 Conclusions

These findings indicate that piperine, combined with TiO 2NPs (PIP-TiO 2NPs), provides neuroprotection by reducing oxidative stress and inflammatory responses induced by TiO 2NPs in the rat brain.

 Antioxidants Brain Cerebral Cortex Cyclooxygenase Hippocampus Nanoparticles Neuroinflammation Neurotransmitters The author(s) declared that no grants were involved in supporting this work. Introduction

Exposure to titanium dioxide nanoparticles (TiO 2NPs) is associated with several systemic toxic effects. Titanium is extensively used in biomedical applications owing to its high biocompatibility. Titanium implants may release titanium dioxide (TiO 2) nanoparticles (NP), which can enter the bloodstream and reach different organs including the brain. 1, 2 Despite the precise processes and particle quantities that penetrate the blood-brain barrier being unclear, TiO 2NPs can enter the brain after ingestion. According to Ref. 3, exposure to titanium dioxide nanoparticles induces oxidative stress, neuroinflammation, brain chemistry alterations, and impairment of neuronal structure and functionality. Neural damage may result in behavioral disturbances and contribute to the development of neurodevelopmental and neurodegenerative diseases. Such neuronal injury and the neurodevelopment or neurodegenerative disorders that follow, along with any behavioral disorders that may be present, can be partially attributed to oxidative stress and inflammation. 4 Although Ref. 5 noted that inflammation levels in mineral miners exposed to titanium dioxide nanoparticles were significantly higher, the specific details surrounding the neurotoxicity of such exposure remain nebulous. The central nervous system responds to TiO 2NPs exposure by activating the neuroinflammatory pathway, as reported by Ref. 6. TiO 2NPs can induce genotoxicity through both direct and indirect mechanisms. Direct genotoxicity occurs when nanoparticles penetrate the nucleus, interact with the DNA, and inhibit replication. Indirect genotoxicity arises from ROS generation, suppression of antioxidant defenses, and releasing toxic ions from NPs. 7, 8 Following cellular uptake, TiO 2NPs accumulate in lysosomes, leading to lysosomal damage and cytosolic enzyme release, which combines with other cell components to produce inflammation, oxidative stress, DNA damage, and altered gene expression. 9, 10

Piperine is a bioactive alkaloid responsible for the pungency of black pepper (Piper nigrum) and long pepper (Piper longum). 11, 12 Chronic administration of piperine has demonstrated antioxidant properties and cognitive benefits. 13 Accumulating evidence supports the therapeutic potential of piperine and its metabolites in treating cancer, cardiovascular and hepatic diseases, and neurological diseases. In the case of piperine, to understand the tradeoffs in its use, particularly in the Central Nervous System, it is vital to evaluate the pharmacological profile alongside the associated toxicity. In a model of PD (Parkinson’s Disease), it was shown that the administration of piperine prevented the death of neuronal cells 14 and in a model of AD (Alzheimer’s Disease), enhanced cognition, 15 while also reducing depression, as seen in the works of 16 and associated with Huntington’s Disease. 17

According to the World Health Organization,450 million individuals worldwide suffer from mental or cognitive disorders. Like other plants of the Piperaceae family, the fruits of black pepper (Piper nigrum), long pepper (Piper longum), and some other piper plants contain an alkaloid piperine (1-piperoylpiperidine) that has a nitrogenous and pungent characteristic. Current studies in pharmacology suggest that piperine exerts anti-inflammatory and analgesic properties, 18 anticonvulsant, 19 and antiulcer 20 activities, as well as depression, 21 and cytoprotection and antioxidant effects. 22 This study aims to evaluate the harmful effects of titanium dioxide nanoparticles (TiO 2NPs) and assess the potential protective roles of piperine alone or in combination with TiO 2NPs (PIP-TiO 2NPs) to alleviate TiO 2NP-induced physiological neurological disorders.

 Methods Preparation of an aqueous solution of titanium dioxide

According to the instructions provided by Ref. 23, titanium tetrachloride (TiCl 4) and 99.9% ethanol are mixed at room temperature for 30 minutes while stirring at 600 rpm under a fume hood. The clear solution that resulted was used for manufacturing nanoparticles.

 Preparation of an aqueous solution of black pepper extract (piperine)

Two and a half grams of black pepper extract (piperine) was dissolved in 25 mL of deionized desalinated water according to Ref. 24, stirred at 300 rpm for 10 to 20 minutes with a magnetic hotplate stirrer at room temperature, and then filtered through Whatman ® filter paper. The resulting clear solution was used to produce nanoparticles.

 Biosynthesis of titanium dioxide (TiO <sub>2</sub>) nanoparticles using black pepper extract

Green titanium dioxide (TiO 2) nanoparticles were synthesized by adding 14 mL of titanium tetrachloride (ACROS Organics, France) TiCl 4 99.99% to 140 mL of absolute ethanol CH 3CH 2OH 99.99% (Ferak, Germany) with an ethanol ratio. The reaction was carried out at room temperature with stirring (600 rpm) and continued for 30 minutes under a hood due to the large amount of Cl 2 and HCl produced. The solution was allowed to rest and cool to room temperature, and then the solution’s pH was measured in the range 1–2. 23 Two and a half grams of piperine powder was dispersed in 25 ml of DD water at a ratio of 1:10 24 and filtered through Whatman ® filter paper. The resulting clear solution was used for the synthesis of nanoparticles. Then, the piperine solution was mixed with titanium in a ratio of 2:1 under stirring (700 rpm) for 3 hours at room temperature, where a clear yellow solution was formed. After that, the mixture was stirred for 30 minutes while 10–15 mL of ammonia (BDH, England) was added dropwise to maintain pH 6–7. 25 After centrifuging and rinsing three times with deionized water to get rid of contaminants, the mixture was dried for three hours at 100 °C and calcined for two hours at 500 °C. 26

Characterization of piperine-TiO <sub>2</sub> nanoparticles

UV-visible (ultraviolet-visible) spectroscopic

The stability and optical properties of nanoparticles were analyzed using UV-visible spectroscopy (Shimadzu, Japan). After diluting a small amount of the sample in distilled water, the UV-visible spectrum of the reducing agent was measured. To detect the bioreduction of piperine-TiO 2 nanoparticles, a UV-visible spectrophotometer was used to measure surface plasmon resonance (SPR) in the wavelength range 200–800 nm. Electromagnetic waves were analyzed spectroscopically in the wavelength range of 190–1100 nm. Surface plasmon resonance is represented as peaks in the UV-visible absorption spectra of nanoscale particles. 27

Diffraction of X-rays (XRD)

To characterize the formation, size and crystallinity of piperine-TiO 2 nanoparticles, an XRD pattern (Philips, Holland) was obtained after measuring the Bragg angle at 2θ. After centrifuging the nanoparticles for 30 minutes at 10,000 rpm, they were cleaned repeatedly using 20 milliliters of deionized water. A simultaneous theta-2 theta scan with a scan rate of 0.2000°/min was employed to acquire XRD patterns in the 10,000–90,000° range. The Debye–Scherrer equation was used to determine the crystallite size 28 : D = Kλ / β cosθ where D is the nanoparticle diameter, K is a constant (0.94), FWHM is full width at half maximum, and θ is the Bragg diffraction angle. XRD testing was performed using the Rietveld method 29 at Tehran University Central Lab.

Fourier transform infrared spectroscopy (FTIR)

The prepared piperine-TiO 2 nanoparticles in dry pellet form were subjected to FTIR spectroscopy (ABB/Spectro Lab, England). The number of scans was approximately 24, and the laser phase, F and D amplitudes were 35. Conventional KBr pellet technique was used for FTIR studies. The ratio between infrared light intensity and wave number was measured in the range 400–4000 cm −1. This analysis is important for elucidating functional groups in organic solutions involved in nanoparticle synthesis. The calculated spectra show optically dependent properties of nanoparticles, such as extinction cross section, scattering-to-absorption ratio, nanoparticle size and resonance wavelength. 30 The work was carried out in the laboratories of the Ministry of Science and Technology, the Institute for Materials Research and the Medical Materials and Equipment Research Centre.

Scanning Electron Microscopy (SEM)

Scanning electron microscopy (TESCAN MIRA3, Czech Republic) was used to detect the size and morphology of titanium dioxide nanoparticles. Dry piperine-TiO 2 nanoparticle thin films were prepared by dropping a small amount of the solution onto a cover glass grid and allowing it to dry at ambient temperature before observation. SEM was performed under the following parameters: Mag = 2305 ×, signal A = SE2, HV = 30.00 kV and WD = 12.6 mm. 31

Transmission Electron Microscopy (TEM)

A transmission electron microscope (Philips EM208S, Holland) was used to examine the size and shape of piperine-TiO 2 nanoparticles. The procedure of dropping dried materials onto TEM grids and letting them dry frequently results in nanoparticle accumulation. 32

EDX (energy-dispersive X-ray) spectroscopy

The elemental composition of the particles under SEM analysis was evaluated using EDX spectroscopy. 33 This work was completed at Tehran University Central Lab.

 Study design

Forty adult male rats weighing 185 ± 15 g were obtained from the College of veterinary medicine, University of Baghdad. The animals were housed in cages, each cage housed five rats and was cleaned daily, in the animal facility of the College of Medicine, University of Fallujah. They were maintained under standard laboratory conditions (temperature 22 ± 2°C, relative humidity 55 ± 10%, and a 12 h light/dark cycle) and had free access to tap water and a standard commercial pellet diet throughout the experiment. The rats were randomly divided into four equal groups (n = 10 per group) and treated for 35 days, as shown: Control group: Rats were injected intraperitoneally (i/p) with sterile distilled water, G1 group: Rats were administered piperine orally 40 mg/kg. B.w. 34 (Piperine was obtained as Black Pepper Extract from Charge Products/United Kingdom), G2 group: Rats were administered TiO2 NPs (i/p) of 50 mg/kg. B.w., 35, 36 G3 group: Rats received a combined 75 mg/kg treatment. B.w. i/p of Piperine- TiO2NPs, 37 TiO 2 nanoparticles and the combined piperine –TiO 2 formulation were prepared in the laboratory according to the referenced methods cited for each compound. Randomization was performed using simple random allocation, and all doses were calculated relative to body weight (mg/kg).

 Blood collection and analysis

Blood samples were collected via the Retro-orbital sinus technique, from anesthetized rats by intramuscular injection of 16 mg Xylazine + 60 mg ketamine i.m./kg B.W. 38 (Rambon/Germany), sample were placed in non-heparinized gel tubes and allowed to stand for 30 minutes before being centrifuged (for 15 minutes at 3000 rpm) and stored in firmly sealed tubes for further analysis at -20°C until analysis for the following parameters: Noradrenalin, glutamate, and gamma-aminobutyric acid (GABA) (Cloud-Clone Corp/USA). Serum total antioxidant capacity (TAO-C, U/mL) was measured calorimetrically using a Kit (YL Biotech/ China). Serum reactive oxygen species concentration was determined calorimetrically using an ELISA kit (SUNLONG/China) following the manufacturer’s instructions. Serum malondialdehyde (MDA) levels were determined colorimetrically. 39

Molecular study of Cyclooxygenase

Cyclooxygenase (COX) Gene expression in brain tissues was determined using quantitative real-time PCR (qRT-PCR). Relative transcript levels were calculated using the comparative Ct methodology (ΔΔCt), normalized to 12S-rRNA, and expressed relative to the control group. 40 The COX gene was amplified using the following primers ( Table 1), as previously described by reference. 41

Primer sequences used for COX and 12S-rRNA gene in brain rats tissues.
Name of Primer ‘5---------3’ Sequence Target gene
Rat-CO-F CCACCAAACCCATGCATACC Gene of interest (COX)
Rat-CO-R CAGTATCATGCTGCGGCTTC
Rat-12S-rRNA-F AGGTTTGGTCCTGGCCTT Internal reference gene (normalizer)
Rat-12S-rRNA-R GGCGGTGTGTGCGTACTTCATT

COX = cyclooxygenase, 12S-rRNA gene = housekeeping gene used as normalisation.

 Histopathological study

At the end of the experiment, euthanasia was performed using an overdose of anesthetic, which is an AVMA-approved method. After euthanasia, the rats remained under deep anesthesia and their brains were carefully removed from the skull for histological examination. The cerebral cortex and hippocampus were dissected, blotted, and fixed in 10% neutral buffered formalin for histological processing. Paraffin-embedded brain sections were stained with Hematoxylin-Eosin (H and E) stains according to Bancroft’s methods. 42

Statistical analysis

Data were analyzed using SPSS statistical software (version 31). 43 One-way ANOVA followed by the Least Significant Difference (LSD) test assessed differences among groups at a significance level of P < 0.05.

 Results

The mean serum total antioxidant capacity (TAO-C) concentration in all treated groups is shown in Figure 1. Significant (P < 0.05) increases in serum TAO-C were observed following treatment with piperine (G1) alone (A17.01±0.70a) or PIP-TiO 2NPs (G3) (B11.09±0.27c) compared to TiO 2NPs (G2) (B 8.77 ±0.15d) at the 5th weeks of experiment However, when compared with the control group (A17.01±0.70a), all treated groups exhibited a significant (P < 0.05) decrease in TAO-C levels.

Effect of Piperine, TiO2NPs, PIP-TiO2NPs treatment on serum total antioxidant capacity (TAO-C) concentration (U/mL).

Values are expressed as mean ± SE (n = 10). C: control; G1: piperine 40 mg/kg B.W.; G2: TiO 2NPs 50 mg/kg i.p.; G3: PIP –TiO 2NPs 75 mg/kg i.p. for 5 weeks.

Figure 2 shows all experimental groups’ serum reactive oxygen species (ROS)levels. The G2 treatment group (intraperitoneal titanium dioxide nanoparticles at a dose of 50 mg/kg/day) showed a significant (P < 0.05) decrease in serum ROS levels (A 530.66 ± 2.19 a) compared to other treatment groups. The result also showed that treatment with G1 (orally piperine 40 mg/kg B.W) (A 434.61 ± 6.42 c) or its incorporation with G3 (i.p PIP-TiO 2NPs 75 mg/kg. B.W), a significant (P < 0.05) reduction in this parameter (A 481.71 ± 10.03 b) as contrasted with the G2 treated group. In contrast, the results indicated that these groups (G1 and G3) had a significant (P < 0.05) decline as contrasted with the control group (A 396.45 ± 9.43 d), and a significant (P < 0.05) difference was also observed between G1 and G3.

Effect of Piperine, TiO <sub>2</sub>NPs, and PIP-TiO <sub>2</sub>NPs treatment on serum reactive oxygen species (ROS) concentration (pg/mL) in treated rats.

Values are expressed as mean ± SE (n = 10). C: control; G1: piperine 40 mg/kg B.W.; G2: TiO 2NPs 50 mg/kg i.p.; G3: PIP –TiO 2NPs 75 mg/kg i.p. for 5 weeks.

Figures 3, 4, and 5 illustrate the mean serum concentration of neurotransmitters (glutamate, noradrenaline and gamma-aminobutyric acid (GABA)) concentrations of the control and other groups, the result exhibits a significant (P < 0.05) decrease in serum neurotransmitter concentrations in rats treated with TiO2NPs (G2) compared with control and other treated animal groups (Piperine and pip-TiO 2NPs). On the contrary, rats treated with piperine (G1) exhibit the highest mean value, indicating a pronounced effect compared to those treated in the G2 and G3 groups after five weeks of the experiment. Also, the rats treated with PIP-Tio2NPs (G3) show an increase in the mean value compared to Tio2NPs alone (G2).

After five weeks, serum glutamate concentration (nmol/ml) in four experimental groups.

Values are expressed as mean ± SE (n = 10). C: control; G1: piperine 40 mg/kg B.W.; G2: TiO 2NPs 50 mg/kg i.p.; G3: PIP –TiO 2NPs 75 mg/kg i.p. for 5 weeks.

 After five weeks, serum noradrenaline concentration (pg/ml) in four experimental groups.

Values are expressed as mean ± SE (n = 10). C: control; G1: piperine 40 mg/kg B.W.; G2: TiO 2NPs 50 mg/kg i.p.; G3: PIP–TiO 2NPs 75 mg/kg i.p. for 5 weeks.

 After five weeks, serum GABA concentration (pg/ml) in four experimental groups.

Values are expressed as mean ± SE (n = 10). C: control; G1: piperine 40 mg/kg B.W.; G2: TiO 2NPs 50 mg/kg i.p.; G3: PIP –TiO 2NPs 75 mg/kg i.p. for 5 weeks.

Gene expression of the rats’ brain tissue of Cyclooxygenase (COX) in all experiment groups was clarified in Figure 6 (Using the internal reference gene (12S-rRNA) as a sample normalizer). Figure 7 (This indicates a successful RNA extraction and cDNA synthesis), while Figure 9 shows the fold change comparison between the groups expressing the COX gene in the brain. A significant upregulation of COX expression was observed in the TiO2NPs group (G2) compared with the control, and a significant increase in expression of Piperine-TiOeNPs (G3) and piperine (G1) groups. However, Piperine alone produced a moderate yet significant difference in COX relative to the G2 and Control groups regarding gene expression ( Figure 8).

Amplification curves of the tested samples representing the internal reference gene (12S-rRNA) as a normalizer to the assay. The amplification curve of the tested samples represents the COX gene. Fold change comparison between the groups expressing the COX gene in the brain.

Values are expressed as mean ± SE (n = 10). C: control; G1: piperine 40 mg/kg B.W.; G2: TiO 2NPs 50 mg/kg i.p.; G3: PIP –TiO 2NPs 75 mg/kg i.p. for 5 weeks.

 Control group shows histopathological section of (A): The cerebral cortex, normal appearance of meningeal pia mater (Arrow), molecular cells layer (1), external granular cells layer (2), external pyramidal cells layer (3) (H&E stain.100x), (B): Section of hippocampus shows crest of denta gyrus (C) with its supra pyramidal (S) & infra pyramidal blade (I), granular cells layer (G), molecular layer (M), polymorphic layer (P) of denta gyrus. The supra pyramidal blade with its layers (I), hilus of denta gyrus surrounding area of cornu ammonis (CA1, 2 & 3) of proper hippocampus (H&E stain.100x), and (C): Section of thalamus region with normal neurons of nuclei (H&E stain. 100x).

The result of the histopathological examination of the cerebral layers of the control and G1 groups ( Figures 9-A and 10-A) demonstrated the typical appearance of the ganglionic, multiform, pyramidal, granular layers as well as the molecular layer, and normal glial cells with axon tracts of subcortical white matter. The hippocampus revealed a normal, distinct C-shape that reveals its layered structure, including the encompassing the Dentate Gyrus (DG) and the Cornu Ammonis (CA) areas (CA1, CA2, CA3, CA4), these areas are consistent with densely packed pyramidal neurons in the stratum pyramidale ( Figures 9-B and 10-B). The thalamus also showed commonly appearing nuclei ( Figures 9-C and 10-C). The histopathological results in the G2 group figures showed the cerebral layers, mild vascular congestion with little hyperplasia of glial cells within the external pyramidal cells layer, and mild demyelination of the molecular cells layer ( Figure 11-A). The figures of hippocampus showed normal neurons of CA1, two areas, normal molecular layer, granular layer, and polymorphous layer (P) of dentate gyrus, and congestion of choroid plexuses ( Figure 11-B). The thalamus also showed normal-appearing nuclei ( Figure 11-C). The G3 group histopathological figures of the cerebral layers showed normal appearance of meningeal pia mater and other cortical cerebral cell layers ( Figure 12-A). The figures of the hippocampus showed normal neurons of CA1, 2, and 3, and the figures showed moderate vaculation with glial depletion of the molecular strata of the CA1 proper hippocampus ( Figure 12-B). The thalamus also showed normal-appearing nuclei ( Figure 12-C).

G1 group shows histopathological section of (A): the cerebral cortex normal appearance of meningeal pia mater (Arrow), molecular cells layer (1), external granular cells layer (2), external pyramidal cells layer (3) (H&E stain.100x), (B) Section of hippocampus (G1) shows crest of denta gyrus (C) with normal supra pyramidal & infra pyramidal blade, granular cells layer (G), molecular layer (M), polymorphic layer (P) of denta gyrus. normal area of cornu ammonis (CA1) of proper hippocampus (H&E stain.100x), and (C) Section of thalamus (G1) shows normal neurons of nuclei with normal glial cells (H&E stain.100x). G2 group shows histopathological section of: (A) cerebral cortex mild vascular congestion (Red arrow) with little hyperplasia of glial cells within external pyramidal cells layer (black arrow), little demyelination of molecular cells layer (m) (H&E stain.100x), (B) Section of hippocampus (G2) shows normal neurons of CA1 & 2 areas, normal molecular layer (m), granular layer (G) and polymorphous layer (P) of denta gyrus and congestion of choroid plexuses (red arrow) (H&E stain.100x), and (C) Section of thalamus (G2) shows normal neurons of nuclei with normal glial cells (H&E stain.100x). G3 group shows histopathological section of: (A) the cerebral cortex normal appearance of meningeal pia mater (Arrow), molecular cells layer (1) and external granular cells layer (2) (H&E stain.100x), (B) Section of hippocampus (G3) shows moderate vaculation of molecular strata of CA1 proper hippocampus with glial depletion (red arrow) (H&E stain.100x), and (C) Section of thalamus (G3) shows normal neurons of nuclei with normal glial cells (H&E stain.100x). Discussion

A significant decrease in TAO-C and an elevation in ROS levels in the TiO 2NPs (G2) treated group in the current study indicated TiO 2 toxicity and a case of oxidative stress documented by Refs. 44 and 45. The following can be used to explain how TiO 2NPs cause toxicity in organisms: LPO, the generation of ROS, and the electrostatic attachment of TiO 2 nanoparticles to the cell membrane. 46 Due to the surface area and other physical and chemical properties, TiO 2 has a high capacity to generate reactive oxygen species (ROS). 47, 48 In addition, the toxicity of the TiO 2NPPS may result from different doses, particle size, cultural medium, or test techniques. 49, 50 Due to their small size, large surface area, and hydrodynamic diameter, a small nanoparticle was more harmful than a large one. 51 TiO 2NPS is added to oxidative damage, protein oxidation, antioxidant function deficiency, and elevated brain oxidative stress. 52, 53 Apoptosis, 54 nuclear envelope shrinkage, 55 changes in the structure of macromolecules and microelements, such as copper (Cu), potassium (K), and zinc (Zn). 56

The outcomes in Figures 1 and 2 confirmed a high TAO-C level and low ROS levels in the organization handled with PIP, indicating its antioxidant impact. These findings were consistent with a few studies. 57– 59 Besides, the capability to lessen oxidative stress is more for piperine amino acid derivatives than PIP itself. 60 Numerous investigations have revealed that PIP can defend against high ranges of oxidative markers. 61– 63 who pronounced the co-administration of piperine with curcumin, showed reduced lipid peroxidation (LPO) and growing endogenous antioxidant enzyme levels. The capability of PIP to decrease in LPO of the mitochondrial membrane, similarly to an increase in antioxidant enzymes, PIP became utilized to deal with issues related to mitochondrial oxidative stress. 64 It needs to be stated that the antioxidant property of PIP will be attributed to its antiradical and loose radical scavenging capability. 65

Serum neurotransmitters concentrations analysis (Glutamate, Noradrenaline and GABA) in this study confirmed a significant differences in the values of these parameters in group of rats dealt with PIP (G1) by myself or as mixture with Tio2NPs (G3), these findings imply the function of piperine or their aggregate with TiO 2NPs (PIP-TiO 2NPs) in attenuated the damaging effects of TiO 2NPs on a few physiological mind features, these result agreed with Ref. 55 who suggested using 2.5 mg/kg/day of PIP for 4 weeks, enhanced rats’ persistent potentiation and memory test performance; chronic PIP treatment also produced more effective synaptic plasticity compared to the achieved with donepezil. 66 In the meanwhile, PIP therapy for 23 days also improved neurotransmission and locomotor activity by lowering oxidative-nitrosative stress in the hippocampus and cerebrospinal fluid and improving cholinergic function in a rat model of Alzheimer’s disease (AD). 14, 66 Ref. 14 who documented how piperine affected the redox state of CSF and hippocampus neurones, may undoubtedly be a factor in the medication’s ability to improve cognition. Additionally, by lowering acetylcholinesterase function, a plaque, and tangles, PIP solid lipid nano-formulation enhanced blood–brain barrier permeability and increased mobility in AD mice, 67 these finding agreed with results in this experiment of G3 treated rats with piperine or piperine-Tio2NPs combination (i.p PIP-TiO 2NPs 75 mg/Kg. B.W) and this may be result in enhance its potentiality in some brain dysfunctions treatment as mentioned in many studies as 68 indicates that PIP administration lowered lipid peroxidation and raised antioxidants in the striatum of 6-hydroxydopamine (6-OHDA)-lesioned rats 69 ; also found that PIP usage diminished neuronal damage in the substantia nigra in rotenone-injected PD mice and generated atuophagolysosome via Akt/mTOR pathway activation; a PIP-mediated increase in protein phosphatase 2A (PP2A) improved mitochondrial injury, mitochondrial membrane permeability transition pore dysfunction, and oxidative stress. 70, 71 According to Ref. 72, this alteration also increased the effectiveness of PIP derivatives in activating the Nrf2/Keap1 pathway, which provided neuroprotection in the Parkinson’s disease model and subsequently regulated brain activities. In Huntington’s disease rats, PIP therapy improved motor characteristics, striatal degeneration inside the basal ganglia, and ATP production. 73 PIP therapy improved serotonin stages and adjusted the glutamate, noradrenaline, monoamine oxidase, and gamma-aminobutyric acid (GABA-ergic) pathways. 74 Additionally, within the brain and serum of a pilocarpine-precipitated epileptic mouse model, PIP remedy decreased nitrite and multiplied GABA, glycine, and taurine. 75

The current experiment saw a significant reduction in serum neurotransmitter concentrations in mice administered TiO 2NPs (G2) compared to control and other treated groups treated groups. These results have been linked to neurodegenerative disorders, and exposure has been shown to interfere with presynaptic production and reduce the release of neurotransmitters. TiO 2NPs poisoning must mainly be seen as targeting the brain, according to the growing research part. 76, 77 According to several studies, 78, 79 the TiO 2NPs can form in the brain after risk. Similar to this, TiO 2 has been demonstrated to easily build up in the brain after oral exposure because of its capacity to penetrate the blood-brain barrier. Consequently, it may trigger oxidative stress, apoptosis, neuronal degeneration, and neuroinflammation; these findings agree with results that showed in this study, which indicate the significant decreases in serum concentrations of neurotransmitters (G2) as a result of this exposure. 80 Besides, 81 showed that while oral TiO2NPs have been proven to cause oxidative stress, neuroinflammation, and altered neurotransmitter metabolism, they also are known to promote apoptosis in hippocampus, cortical, and cerebellar neurones. It has been demonstrated that TiO2NPs affect the metabolism of neurotransmitters, particularly dopamine and glutamate/glutamine. 82 When mice were exposed to TiO2NPs, glutamine levels and glutamine synthetase activity decreased, but hippocampus glutamate release and phosphate-activated glutaminase activity significantly increased. Furthermore, it has been demonstrated that different types of TiO2NPs, in conjunction with oxidative stress and mitochondrial dysfunction, cause primary astrocytes to have reduced glutamate uptake. 83 When combined, these results suggest that rats given Tio2NPs (G2) throughout the experiment had reduced glutaminergic neurotransmission.

Likewise, it has been demonstrated that exposure to TiO 2NPs alters the metabolism of various neurotransmitters, including catecholamines in the brain. In particular, TiO 2 exposure raised the levels of monoamine neurotransmitter metabolites, which are a sign of increased neurotransmitter catabolism, while significantly lowering noradrenaline and serotonin levels in the hippocampus, cerebral cortex, cerebellum, and striatum as well as dopamine content in these regions. 84, 85 Despite this Ref. 86, showed that oral gavage of TiO 2 NPs resulted in a substantial change in the adrenergic, cholinergic, dopaminergic, and serotonergic neurotransmitter systems by lowering brain levels of noradrenaline, serotonin, and dopamine.

As demonstrated in this study, titanium promotes the generation of free radicals, which is expected to induce tissue inflammation. The purpose of this study is to investigate the physiological effects of titanium on the brain, particularly its impact on neural tissue activity and cellular function, by analyzing neurotransmitter concentrations in addition to the study assesses tissue-level damage in the brain as evidenced by COX-2 (cyclooxygenase) expression and its levels in brain tissue. Numerous intrinsic and external stimuli can cause the inflammatory response, which is catalysed by the primary enzyme cyclooxygenase-2 (COX-2). 87, 88 It acts as an important chemical bridge between the development of chronic inflammation and the reactive oxygen species (ROS) (ROS). 89 In the treated group (G2), mice showed a significant elevation of COX-2 gene expression in their brain tissue, which supports it. This result corresponds to previous research and shows that an increase in COX-2 expression promotes prostonoid production. 90, 91 According to Ref. 92 are powerful regulators for brain inflammation and vascular activity. Although neurons are constitutively COX-2, other brain cells, including astrocytes, microglia and vascular endothelial cells, usually have low basic levels of COX-2, but increase strongly under inflammatory conditions. 93 In addition, increased COX-2 expression is promoted in the brain by pathological conditions such as cerebral ischemia and hypoxia. 94

Piperine or its combination (PIP-TiO2NPS) treated mice in groups (G1 and G3), so a significant reduction in the level of COX-2. These findings correspond to these studies, which have shown that Piperine prevents large inflammatory enzymes such as 5 -lipoxinas and cycloxicinez -1, suggesting its potential role in modifying inflammation. 22, 95 In addition, Piperine has cytoprotective, antioxidant and neuroprotective activities, as shown in TAO-C and ROS results. 96 Despite these promising medical effects, data on Piperine painkillers, anti-inflammatory and antipyretic properties are limited. 97 Also Ref. 98, demonstrated that piperine may act as a potent COX-2 inhibitor, contributing to its anti-inflammatory effects. According to Ref. 99, piperine decreased the expression of the COX-2 gene and protein in tumor cells. The formation of prostaglandin E2 (PGE2) is catalyzed by the enzyme COX-2, which binds to its corresponding G protein-coupled membrane receptors. All cell tumors showed decreased gene expression in these receptors, suggesting that COX-2’s effect on these receptors is diminished. These findings showed why the COX-2 gene expression decreases in the animals treated with piperine or their combination (PIP-TiO2NPs), followed by enhanced physiological functions of brain cells, antioxidants and neuroprotective effects.

The findings of the histopathological study in the PIP-treated group (G1) showed normal architecture of brain tissues (cerebral cortex, Hippocampus, and Thalamus) and enhancement of cellular activity as compared with rats treated with PIP-TiO 2NPs or with TiO 2NPs; this is consistent with the above tests for neurotransmitters and antioxidant parameters, this finding align with 100 reported that the Piperine dramatically boosts quercetin’s antioxidant, anti-inflammatory, and neuroprotective benefits in rats given iron supplements and rotenone to cause Parkinson’s disease. 101 The presented histopathological results from the G2 group, treated with titanium dioxide-nanoparticles (TiO 2-NPs), reveal a nuanced picture of early-stage neurotoxicity characterized by selective damage and a clear glial response. The conclusions are fine because of their mild and specific nature, an exposure model with underwear or low-khurak suggests. There is increasing evidence that titanium-based products can be neurotoxic. For example, memory loss in the mouse model after intravascular delivery of titanium implantation or titanium nanoparticles (TiO 2NPs) was reported by Ref. 102. Blood-brain barrier (BBB) is compromised. This is a theory that is excluded to explain this effect. This is confirmed by research by Ref. 103, where it was found that TINAP improved paracellular permeability in the in vitro human BBB model. This discovery is compatible with the lower level of the significant BBB band in the hippocampus of mice treated with TiO 2NP. Many ways can cause tiotoxicity. In addition, new research by Ref. 104 indicates that other procedures are likely to include, such as the regulation of the intestinal brain axis through epigenetic modification and intestinal microbiota changes. Some studies, including Ref. 105 no average amount of tension in brain tissue, which indicates that the basic perception of brain translation is not widely accepted.

Histopathological consequences in a combined mouse combined by PIP-TiO 2NPS (G3 group) showed the protective effect of Piperine to reduce the toxic effects of TiO 2NPs on brain tissue, which was not the same by reducing tissue damage compared to TiO 2NPs alone, because it did not show that it did not show that it showed on the tissue of the tissues. Piperine-titanium dioxide nanoparticle (TiO 2NP) shows neuroprotective properties against induced brain damage, mainly by reducing oxidative stress. This discovery matches, 106 which showed that TiO 2NPS causes brain injury, triggers neuroinflammation, and leads to neuronal apoptosis, while Piperine can reverse these effects, improve cognitive function, and restore redox balance. 107 suggest that in different types of brain cells, there were noticeable variations in sensitivity to the harmful effects of TiO2NPS. Especially compared to the study, it was shown that both acute and long-lasting low dosage risk for TiO 2NP made neuronal cells more resistant than the human glial cell line. 108 In the animal model for AD, both control checks control both lipid peroxidation of piperine enzymes and non-enzymatic antioxidant levels as well as hippocampus pyramidal cells. 109 In addition, it was noted that Piperine increased the amount of brain-derived neurotrophic factor (BDNF) and the growth of the hippocampus precursor cells. This means that it puts tissue and neuron cells in one or a combination due to damage caused by TiO 2NPS. 97 The findings indicate that piperine, either alone or in combination with TiO 2NPs (PIP-TiO 2NPs), is protective and reduces the damaging effects of TiO 2NPs on some physiological brain functions and oxidative stress.

 Ethical considerations

This study was conducted in the Animal House of the College of Veterinary Medicine and was approved by the Ethical Committee of the College of Medicine, University of Fallujah (ethical approval number: 11, dated 5/01/2025) before commencing the research work. All animals were treated according to the standards of the Ethical Committee. All information was anonymized and used for research purposes only.

 Data availability

Each the scientific information generated and analyzed throughout the current study are included in the study’s article. The article includes a detailed description of every testing technique, methodology, dose, and laboratory environment. Replicating the study doesn’t require any more unreported data. As a consequence, the reader may easily access all pertinent information in the book. Researchers can reach the corresponding author at dr.physiologist_med@uofallujah.edu.iq and with any additional questions.

Reporting guidelines

The ARRIVE (Animal Research: Reporting of in vivo Experiments) principles were followed in the planning and documentation of this inquiry in order to guarantee reproducibility and transparency in animal research. For this publication, Pathophysiological Effects of Titanium Dioxide Nanoparticles and the Protective Role of Piperine and a Piperine-TiO 2NP Combination in Rats, the completed ARRIVE checklist has been posted to an online archive. ARRIVE 2.0 checklist for Pathophysiological Effects of Titanium Dioxide Nanoparticles and the Protective Role of Piperine and a Piperine-TiO 2NP Combination in Rats. [DOI 10.5281/zenodo.18220968]. Data are available under the terms of the Creative Commons Zero “No rights reserved” data waiver (CC0 1.0 Public domain dedication).

 Acknowledgements

The authors wish to express their deepest gratitude to the College of Veterinary Medicine and the College of Medicine, Fallujah University for their valuable support in providing the necessary animal housing facilities and scientific laboratories to conduct this study.

 References Ferraro SA Domingo MG Etcheverrito A : Neurotoxicity mediated by oxidative stress caused by titanium dioxide nanoparticles in human neuroblastoma (SH-SY5Y) cells. J. Trace Elem. Med. Biol. 2020;57:126413. 31606305 10.1016/j.jtemb.2019.126413 Fouad A Mohamed L Mohamed G : Dose-Related Effects of Titanium Dioxide Nanoparticles on the Cerebellar Cortex of Adult Male Albino Rats and the Possible Neuroprotection of β-carotene: A Biochemical and Histological Study. Egypt. J. Histol. 2024. 10.21608/ejh.2024.271677.2025 Zhang X Song Y Gong H : Neurotoxicity of Titanium Dioxide Nanoparticles: A Comprehensive Review. Int. J. Nanomedicine. 2023;18:7183–7204. 38076727 10.2147/IJN.S442801 PMC10710240 Ziental D Czarczynska-Goslinska B Mlynarczyk DT : Titanium Dioxide Nanoparticles: Prospects and Applications in Medicine. Nanomaterials (Basel, Switzerland). 2020;10(2):387. 32102185 10.3390/nano10020387 PMC7075317 Khedr MA El-Kazaz SE Rashed RR : Neuroprotective Effects of Alpha-Lipoic Acid Against Behavioral Toxicity, Oxidative and Inflammatory Damage Caused by Titanium Dioxide Nanoparticles. Biol. Trace Elem. Res. 2025. Advance online publication. 40457157 10.1007/s12011-025-04672-4 Mao Y Bajinka O Tang Z : Lung-brain axis: metabolomics and pathological changes in lungs and brain of respiratory syncytial virus-infected mice. J. Med. Virol. 2022;94(12):5885–5893. 35945613 10.1002/jmv.28061 Golbamaki N Rasulev B Cassano A : Correction: Genotoxicity of metal oxide nanomaterials: review of recent data and discussion of possible mechanisms. Nanoscale. 2015;7(14):6388. 25776996 10.1039/c5nr90036k Ling C An H Li L : Genotoxicity Evaluation of Titanium Dioxide Nanoparticles In Vitro: a Systematic Review of the Literature and Meta-analysis. Biol. Trace Elem. Res. 2021;199(5):2057–2076. 32770326 10.1007/s12011-020-02311-8 Kansara K Kumar A Karakoti AS : Combination of humic acid and clay reduce the ecotoxic effect of TiO2 NPs: A combined physico-chemical and genetic study using zebrafish embryo. Sci. Total Environ. 2020;698:134133. 31505348 10.1016/j.scitotenv.2019.134133 Luo Z Li Z Xie Z : Rethinking Nano-TiO2 Safety: Overview of Toxic Effects in Humans and Aquatic Animals. Small (Weinheim an der Bergstrasse, Germany). 2020;16(36):e2002019. 32761797 10.1002/smll.202002019 Gorgani L Mohammadi M Najafpour GD : Piperine-The Bioactive Compound of Black Pepper: From Isolation to Medicinal Formulations. Compr. Rev. Food Sci. Food Saf. 2017;16(1):124–140. 33371546 10.1111/1541-4337.12246 Sahranavard T Ghorani V Forouzanfar F : Piperine relieves neuropathic pain induced by paclitaxel in mice. Acta Neurobiol. Exp. 2025;84(4):332–340. 39812529 10.55782/ane-2024-2590 Khalili-Fomeshi M Azizi MG Esmaeili MR : Piperine restores streptozotocin-induced cognitive impairments: Insights into oxidative balance in cerebrospinal fluid and hippocampus. Behav. Brain Res. 2018;337:131–138. 28939403 10.1016/j.bbr.2017.09.031 Shen L Yang Y Lu L : Design and synthesis of piperine-based photoaffinity probes for revealing potential targets of piperine in neurological disease. Chem. Commun. (Camb.). 2025;61(4):669–672. 39628399 10.1039/d4cc04330h Guo F Qin X Mao J : Potential Protective Effects of Pungent Flavor Components in Neurodegenerative Diseases. Molecules (Basel, Switzerland). 2024;29(23):5700. 39683859 10.3390/molecules29235700 PMC11643850 Azam S Park JY Kim IS : Piperine and Its Metabolite’s Pharmacology in Neurodegenerative and Neurological Diseases. Biomedicine. 2022;10(1):154. 35052833 10.3390/biomedicines10010154 PMC8773267 Haq IU Imran M Nadeem M : Piperine: A review of its biological effects. Phytother. Res. 2021;35(2):680–700. 10.1002/ptr.6855 Rahimi-Dehkordi N Heidari-Soureshjani S Rostamian S : A Systematic Review of the Anti-seizure and Antiepileptic Effects and Mechanisms of Piperine. Cent. Nerv. Syst. Agents Med. Chem. 2025;25(2):143–156. 39082167 10.2174/0118715249297934240630111059 Ghasemi A Saadinezhad A Halalkhor S : Piperine improves learning deficit through modulation of Wnt/β-catenin signaling pathway: Involvement of the dorsal hippocampus serotonin-1A receptors. Eur. J. Pharmacol. 2025;1003:177922. 40639477 10.1016/j.ejphar.2025.177922 Hu Y Wang Y Gao H : Piperine Improves DSS-Induced Colitis in Mice via Inhibition of Inflammation and Modulation of Gut Microbiota. Phytother. Res. 2025;39(7):3197–3211. 40456559 10.1002/ptr.8491 Nasrnezhad R Halalkhor S Sadeghi F : Piperine Improves Experimental Autoimmune Encephalomyelitis (EAE) in Lewis Rats Through its Neuroprotective, Anti-inflammatory, and Antioxidant Effects. Mol. Neurobiol. 2021;58(11):5473–5493. 34338970 10.1007/s12035-021-02497-5 Hosseini H Bagherniya M Sahebkar A : The effect of curcumin-piperine supplementation on lipid profile, glycemic index, inflammation, and blood pressure in patients with type 2 diabetes mellitus and hypertriglyceridemia. Phytother. Res. 2024;38(11):5150–5161. 39165011 10.1002/ptr.8304 Jameel ZN Haider AJ Taha SY : Synthesis of TiO2 nanoparticles by using sol-gel method and its applications as antibacterial agents. Eng. Technol. J. 2014;32(3):418–426. Prabakaran M Nithya P Kalaiarasi V : Green synthesis of piperine loaded gold/triton X-100 nanoconjugates: In-vitro evaluation of biocompatibility and anti-oxidant activity. Nano Biomed. Eng. 2019;11(2):192–199. Goutam SP Saxena G Singh V : Green synthesis of TiO2 nanoparticles using leaf extract of Jatropha curcas L. for photocatalytic degradation of tannery wastewater. Chem. Eng. J. 2018;336:386–396. Rao KG Ashok CH Rao KV : Green synthesis of TiO2 nanoparticles using Aloe vera extract. Int. J. Adv. Res. Phys. Sci. 2015;2(1A):28–34. Banerjee P Satapathy M Mukhopahayay A : Leaf extract mediated green synthesis of silver nanoparticles from widely available Indian plants: synthesis, characterization, antimicrobial property and toxicity analysis. Bioresour. Bioprocess. 2014;1:1–10. Holzwarth U Gibson N : The Scherrer equation versus the Debye-Scherrer equation. Nat. Nanotechnol. 2011;6(9):534–534. 21873991 10.1038/nnano.2011.145 Rietveld HM : A profile refinement method for nuclear and magnetic structures. J. Appl. Crystallogr. 1969;2(2):65–71. Alagesan V Venugopal S : Green synthesis of selenium nanoparticle using leaves extract of withania somnifera and its biological applications and photocatalytic activities. BioNanoScience. 2019;9(1):105–116. Khoshnamvand M Huo C Liu J : Silver nanoparticles synthesized using Allium ampeloprasum L. leaf extract: characterization and performance in catalytic reduction of 4- nitrophenol and antioxidant activity. J. Mol. Struct. 2019;1175:90–96. Bell NC Minelli C Tompkins J : Emerging techniques for submicrometer particle sizing applied to Stober silica. Langmuir. 2012;28(29):10860–10872. 22724385 10.1021/la301351k Rusli NS Embong Z Nor Hashim NZ : Assessment of Trace Element (Mg, Al, K and Mo) in 14 Types of Raw Herbs and Spices using SEM-EDX Analysis. ASM Sci. J. 2022;17:1–9. Atal S Agrawal RP Vyas S : Evaluation of the effect of piperine per se on blood glucose level in alloxan-induced diabetic mice. Acta Pol. Pharm. 2012;69(5):965–969. 23061294 El-Daly AA : The histopathological, ultrastructural and immunohistochemical effects of intraperitoneal injection with titanium dioxide nanoparticles and titanium dioxide bulk on the liver of the albino Mice. J. Anim. Health Behav. Sci. 2017;1(1):1–10. Reference Source Jia X Wang S Zhou L : The Potential Liver, Brain, and Embryo Toxicity of Titanium Dioxide Nanoparticles on Mice. Nanoscale Res. Lett. 2017;12(1):478. 28774157 10.1186/s11671-017-2242-2 PMC5540742 Yassen AT Khudair KK Hassan MAM : Piperine Loaded Titanium Dioxide Nanoparticles: Development, Characterisation and Biomedical Application. Nano Biomed. Eng. 2022;14(2):192–200. 10.5101/nbe.v14i2.p192-200 Parasuraman S Raveendran R Kesavan R : Blood sample collection in small laboratory animals. J. Pharmacol. Pharmacother. 2010;1(2):87–93. 21350616 10.4103/0976-500X.72350 PMC3043327 Alam MN Bristi NJ Rafiquzzaman M : Review on in vivo and in vitro methods evaluation of antioxidant activity. Saudi Pharm. J. 2013;21(2):143–152. 24936134 10.1016/j.jsps.2012.05.002 PMC4052538 Schmittgen TD Livak KJ : Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008;3:1101–1108. 10.1038/nprot.2008.73 Huang H Li F Alvarez RA : Downregulation of ATP Synthase Subunit-6, Cytochrome c Oxidase-III, and NADH Dehydrogenase-3 by Bright Cyclic Light in the Rat Retina. Investig. Opthalmol. Vis. Sci. 2004;45:2489–2496. 15277468 10.1167/iovs.03-1081 Bancroft’s J : Theory and Practice Of Histological Technique. 8th ed. USA: Elsevier;2019. Reference Source SPSS: Statistical Packages of Social Sciences-SPSS/IBM Statistics 26 step by step. 16th ed. 2019. 10.4324/9780429056765 Chen Z Zheng P Han S : Tissue-specific oxidative stress and element distribution after oral exposure to titanium dioxide nanoparticles in rats. Nanoscale. 2020;12(38):20033–20046. 32996981 10.1039/d0nr05591c Shirdare M Jabbari F Salehzadeh M : Curcuma reduces kidney and liver damage induced by titanium dioxide nanoparticles in male Wistar rats. Avicenna J. Phytomed. 2022;12(5):537–547. 36249452 10.22038/AJP.2021.53346.2727 PMC9516405 Hou J Wang L Wang C : Toxicity and mechanisms of action of titanium dioxide nanoparticles in living organisms. J. Environ. Sci. (China). 2019;75:40–53. 30473306 10.1016/j.jes.2018.06.010 Nesci S Pagliarani A : Emerging Roles for the Mitochondrial ATP Synthase Supercomplexes. Trends Biochem. Sci. 2019;44(10):821–823. 31402189 10.1016/j.tibs.2019.07.002 Sharma J Kumari R Bhargava A : Mitochondrial-induced Epigenetic Modifications: From Biology to Clinical Translation. Curr. Pharm. Des. 2021;27(2):159–176. 32851956 10.2174/1381612826666200826165735 Kazimirova A El Yamani N Rubio L : Effects of Titanium Dioxide Nanoparticles on the Hprt Gene Mutations in V79 Hamster Cells. Nanomaterials (Basel, Switzerland). 2020;10(3):465. 32150818 10.3390/nano10030465 PMC7153606 Fresegna AM Ursini CL Ciervo A : Assessment of the Influence of Crystalline Form on Cyto-Genotoxic and Inflammatory Effects Induced by TiO2 Nanoparticles on Human Bronchial and Alveolar Cells. Nanomaterials (Basel, Switzerland). 2021;11(1):253. 33478013 10.3390/nano11010253 PMC7835860 DeLoid GM Cohen JM Pyrgiotakis G : Preparation, characterization, and in vitro dosimetry of dispersed, engineered nanomaterials. Nat. Protoc. 2017;12(2):355–371. 28102836 10.1038/nprot.2016.172 PMC5857388 Feng X Chen A Zhang Y : Central nervous system toxicity of metallic nanoparticles. Int. J. Nanomedicine. 2015;10:4321–4340. 26170667 10.2147/IJN.S78308 PMC4498719 Li C Tang M : The toxicological effects of nano titanium dioxide on target organs and mechanisms of toxicity. J. Appl. Toxicol. 2024;44(2):152–164. 37655586 10.1002/jat.4534 Márquez-Ramírez SG Delgado-Buenrostro NL Chirino YI : Titanium dioxide nanoparticles inhibit proliferation and induce morphological changes and apoptosis in glial cells. Toxicology. 2012;302:146–156. 23044362 10.1016/j.tox.2012.09.005 Hu R Zheng L Zhang T : Molecular mechanism of hippocampal apoptosis of mice following exposure to titanium dioxide nanoparticles. J. Hazard. Mater. 2011;191:32–40. 21570177 10.1016/j. jhazmat.2011.04.027 Federici G Shaw BJ Handy RD : Toxicity of titanium dioxide nanoparticles to rainbow trout (Oncorhynchus mykiss): gill injury, oxidative stress, and other physiological effects. Aquat. Toxicol. 2007;84:415–430. 17727975 10.1016/j.aquatox.2007.07.009 Tupe RS Bangar N Nisar A : Piperine exhibits preventive and curative effect on erythrocytes membrane modifications and oxidative stress against in vitro albumin glycation. J. Food Biochem. 2021;e13846. Advance online publication. 34219237 10.1111/jfbc.13846 Vurmaz A Atay E : Antioxidant effects of piperine on steroid-induced hepatotoxicity. Eur. Rev. Med. Pharmacol. Sci. 2021;25(17):5500–5506. 34533800 10.26355/eurrev_202109_26659 Verma N Bal S Gupta R : Antioxidative Effects of Piperine against Cadmium-Induced Oxidative Stress in Cultured Human Peripheral Blood Lymphocytes. J. Diet. Suppl. 2020;17(1):41–52. 30299203 10.1080/19390211.2018.1481485 Qin B Yang K Cao R : Synthesis, radical-scavenging activities, and protective effects against AAPH-induced oxidative damage in DNA and erythrocytes of piperine derivatives. J. Chem. 2020;2020:1–12. 10.1155/2020/9026286 Mohammadi M Najafi H Mohamadi Yarijani Z : Piperine pretreatment attenuates renal ischemia-reperfusion induced liver injury. Heliyon. 2019;5(8):e02180. 31463384 10.1016/j.heliyon.2019.e02180 PMC6706586 Adeyemo OA Ore A Ajisafe EO : The protective effect of piperine on oxidative stress and hepatic damage induced by diisononyl phthalate in rat. Egypt. J. Basic Appl. Sci. 2021;8(1):293–301. 10.1080/2314808X.2021.1983746 Makhov P Golovine K Canter D : Co-administration of piperine and docetaxel results in improved anti-tumor efficacy via inhibition of CYP3A4 activity. Prostate. 2012;72(6):661–667. 21796656 10.1002/pros.21469 PMC3208085 Dutta M Ghosh AK Mishra P : Protective effects of piperine against copper-ascorbate induced toxic injury to goat cardiac mitochondria in vitro. Food Funct. 2014;5(9):2252–2267. 25059674 10.1039/c4fo00355a Dhiman P Malik N Khatkar A : Natural based piperine derivatives as potent monoamine oxidase inhibitors: an in silico ADMET analysis and molecular docking studies. BMC Chem. 2020;14(1):12. 32099971 10.1186/s13065-020-0661-0 PMC7027018 Nazifi M Oryan S Esfahani DE : The functional effects of piperine and piperine plus donepezil on hippocampal synaptic plasticity impairment in rat model of Alzheimer’s disease. Life Sci. 2021;265:118802. 33242524 10.1016/j.lfs.2020.118802 Takada-Takatori Y Nakagawa S Kimata R : Donepezil modulates amyloid precursor protein endocytosis and reduction by up-regulation of SNX33 expression in primary cortical neurons. Sci. Rep. 2019;9(1):11922. 31417133 10.1038/s41598-019-47462-4 PMC6695423 Wang C Cai Z Wang W : Piperine attenuates cognitive impairment in an experimental mouse model of sporadic Alzheimer’s disease. J. Nutr. Biochem. 2019;70:147–155. 31207354 10.1016/j.jnutbio.2019.05.009 Alam MZ Bagabir HA Zaher MAF : Black Seed Oil-Based Curcumin Nanoformulations Ameliorated Cuprizone-Induced Demyelination in the Mouse Hippocampus. Mol. Neurobiol. 2025;62(1):604–625. 38890237 10.1007/s12035-024-04310-5 Shrivastava P Vaibhav K Tabassum R : Anti-apoptotic and anti-inflammatory effect of Piperine on 6-OHDA induced Parkinson’s rat model. J. Nutr. Biochem. 2013;24(4):680–687. 22819561 10.1016/j.jnutbio.2012.03.018 Liu J Chen M Wang X : Piperine induces autophagy by enhancing protein phosphotase 2A activity in a rotenone-induced Parkinson’s disease model. Oncotarget. 2016;7(38):60823–60843. 27572322 10.18632/oncotarget.11661 PMC5308619 Wang H Liu J Gao G : Protection effect of piperine and piperlonguminine from Piper longum L. alkaloids against rotenone-induced neuronal injury. Brain Res. 2016;1639:214–227. 26232071 10.1016/j.brainres.2015.07.029 Wang L Cai X Shi M : Identification and optimization of piperine analogues as neuroprotective agents for the treatment of Parkinson’s disease via the activation of Nrf2/keap1 pathway. Eur. J. Med. Chem. 2020;199:112385. 32402936 10.1016/j.ejmech.2020.112385 Salman M Tabassum H Parvez S : Piperine mitigates behavioral impairments and provides neuroprotection against 3-nitropropinoic acid-induced Huntington disease-like symptoms. Nutr. Neurosci. 2022;25(1):100–109. 32093571 10.1080/1028415X.2020.1721645 Li G Ruan L Chen R : Synergistic antidepressant-like effect of ferulic acid in combination with piperine: involvement of monoaminergic system. Metab. Brain Dis. 2015;30(6):1505–1514. 26220010 10.1007/s11011-015-9704-y PMC4795470 Cruz GM da Felipe CF Scorza FA : Piperine decreases pilocarpine-induced convulsions by GABAergic mechanisms. Pharmacol. Biochem. Behav. 2013;104:144–153. 23313550 10.1016/j.pbb.2013.01.002 Song B Liu J Feng X : A review on potential neurotoxicity of titanium dioxide nanoparticles. Nanoscale Res. Lett. 2015;10(1):1042. 26306536 10.1186/s11671-015-1042-9 PMC4549355 Czajka M Sawicki K Sikorska K : Toxicity of titanium dioxide nanoparticles in central nervous system. Toxicol. In Vitro. 2015;29(5):1042–1052. 10.1016/j.tiv.2015.04.004 Yamashita K Yoshioka Y Higashisaka K : Silica and titanium dioxide nanoparticles cause pregnancy complications in mice. Nat. Nanotechnol. 2011;6(5):321–328. 21460826 10.1038/nnano.2011.41 Irshad MA Nawaz R Rehman MZU : Synthesis, characterization and advanced sustainable applications of titanium dioxide nanoparticles: A review. Ecotoxicol. Environ. Saf. 2021;212:111978. 33561774 10.1016/j.ecoenv.2021.111978 Grissa I ElGhoul J Mrimi R : In deep evaluation of the neurotoxicity of orally administered TiO2 nanoparticles. Brain Res. Bull. 2020;155:119–128. 31715315 10.1016/j.brainresbull.2019.10.005 Halawa A Elshopakey G El-Adl M : Chitosan attenuated the neurotoxicity-induced titanium dioxide nanoparticles in brain of adult rats. Environ. Toxicol. 2022;37(3):612–626. 34874108 10.1002/tox.23429 Heidari Z Mohammadipour A Haeri P : The effect of titanium dioxide nanoparticles on mice midbrain substantia nigra. Iran. J. Basic Med. Sci. 2019;22(7):745–751. 32373295 10.22038/ijbms.2019.33611.8018 PMC7196354 Wilson CL Natarajan V Hayward SL : Mitochondrial dysfunction and loss of glutamate uptake in primary astrocytes exposed to titanium dioxide nanoparticles. Nanoscale. 2015;7(44):18477–18488. 26274697 10.1039/c5nr03646a PMC4636459 Zhang L Bai R Li B : Rutile TiO 2 particles exert size and surface coating dependent retention and lesions on the murine brain. Toxicol. Lett. 2011;207(1):73–81. 21855616 10.1016/j.toxlet.2011.08.001 Ze X Su M Zhao X : TiO2 nanoparticle-induced neurotoxicity may be involved in dysfunction of glutamate metabolism and its receptor expression in mice. Environ. Toxicol. 2016;31(6):655–662. 25411160 10.1002/tox.22077 Hu R Gong X Duan Y : Neurotoxicological effects and the impairment of spatial recognition memory in mice caused by exposure to TiO2 nanoparticles. Biomaterials. 2010;31(31):8043–8050. 20692697 10.1016/j.biomaterials.2010.07.011 Ricciotti E FitzGerald GA : Prostaglandins and inflammation. Arterioscler. Thromb. Vasc. Biol. 2011;31(5):986–1000. 21508345 10.1161/ATVBAHA.110.207449 PMC3081099 Kumar S Chowdhury S Razdan A : Downregulation of Candidate Gene Expression and Neuroprotection by Piperine in Streptozotocin-Induced Hyperglycemia and Memory Impairment in Rats. Front. Pharmacol. 2021;11:595471. 33737876 10.3389/fphar.2020.595471 PMC7962412 Kundu JK Surh YJ : Emerging avenues linking inflammation and cancer. Free Radic. Biol. Med. 2012;52(9):2013–2037. 10.1016/j.freeradbiomed.2012.02.035 Beyan H Buckley LR Bustin SA : Altered monocyte cyclo-oxygenase response in non-obese diabetic mice. Clin. Exp. Immunol. 2009;155(2):304–310. 19040607 10.1111/j.1365-2249.2008.03825.x PMC2675262 Cui J Jia J : Natural COX-2 Inhibitors as Promising Anti-inflammatory Agents: An Update. Curr. Med. Chem. 2021;28(18):3622–3646. 32942970 10.2174/0929867327999200917150939 Czigler A Toth L Szarka N : Prostaglandin E2, a postulated mediator of neurovascular coupling, at low concentrations dilates whereas at higher concentrations constricts human cerebral parenchymal arterioles. Prostaglandins Other Lipid Mediat. 2020;146:106389. 31689497 10.1016/j.prostaglandins.2019.106389 Shojo H Borlongan CV Mabuchi T : Genetic and Histological Alterations Reveal Key Role of Prostaglandin Synthase and Cyclooxygenase 1 and 2 in Traumatic Brain Injury-Induced Neuroinflammation in the Cerebral Cortex of Rats Exposed to Moderate Fluid Percussion Injury. Cell Transplant. 2017;26(7):1301–1313. 28933223 10.1177/0963689717715169 PMC5657737 Li L Sluter MN Yu Y : Prostaglandin E receptors as targets for ischemic stroke: Novel evidence and molecular mechanisms of efficacy. Pharmacol. Res. 2021;163:105238. 33053444 10.1016/j.phrs.2020.105238 PMC7854947 Bukhari IA Pivac N Alhumayyd MS : The analgesic and anticonvulsant effects of piperine in mice. J. Physiol. Pharmacol. 2013;64(6):789–794. 24388894 Reference Source Roshanbakhsh H Elahdadi Salmani M Dehghan S : Piperine ameliorated memory impairment and myelin damage in lysolecethin induced hippocampal demyelination. Life Sci. 2020;253:117671. 32335165 10.1016/j.lfs.2020.117671 Ariyanasab R Askari VR Askari R : The interactive effect of seven weeks aerobic exercise training and piperine against paraquat-induced lung damage in male Wistar rats: Investigating role of oxidative and inflammatory indices. Heliyon. 2024;10(12):e33241. 39022054 10.1016/j.heliyon.2024.e33241 PMC11252759 Gueroui M Benembarek K Kerrada A : Analysis of the Molecular Docking of Piperine with Cyclooxygenase-2, Followed by an In-Vivo Study of Its Anti-Inflammatory and Analgesic Properties. Int. Pharm. Acta. 2025;8(1):e2. 10.22037/ipa.v8i1.47213 Cardoso LP Sousa SO de Gusson-Zanetoni JP : Piperine Reduces Neoplastic Progression in Cervical Cancer Cells by Downregulating the Cyclooxygenase 2 Pathway. Pharmaceuticals. 2023;16(1):103. 36678600 10.3390/ph16010103 PMC9866887 Sharma R Sarkar A Jha R : Sol-gel –mediated synthesis of TiO2 nanocrystals: Structural, optical, and electrochemical properties. Int. J. Appl. Ceram. Technol. 2020;17(3):1400–1409. 10.1111/ijac.13439 Shelly S Liraz Zaltsman S Ben-Gal O : Potential neurotoxicity of titanium implants: Prospective, in-vivo and in-vitro study. Biomaterials. 2021;276:121039. 34352627 10.1016/j.biomaterials.2021.121039 Aschner M Skalny AV Gritsenko VA : Role of gut microbiota in the modulation of the health effects of advanced glycation end-products (Review). Int. J. Mol. Med. 2023;51(5):44. 37052251 10.3892/ijmm.2023.5247 PMC10198061 Pogribna M Koonce NA Mathew A : Effect of titanium dioxide nanoparticles on DNA methylation in multiple human cell lines. Nanotoxicology. 2020;14(4):534–553. 32031460 10.1080/17435390.2020.1723730 Shinohara RT Sweeney EM Goldsmith J : Statistical normalization techniques for magnetic resonance imaging. NeuroImage. Clin. 2014;6:9–19. 25379412 10.1016/j.nicl.2014.08.008 PMC4215426 Eid A Ghaleb SS Zaki A : Hesperidin Attenuates Titanium Dioxide Nanoparticle-Induced Neurotoxicity in Rats by Regulating Nrf-2/TNF-α Signaling Pathway, the Suppression of Oxidative Stress, and Inflammation. ACS Omega. 2023;8(40):37584–37591. 37841165 10.1021/acsomega.3c06198 PMC10568688 Coccini T Grandi S Lonati D : Comparative cellular toxicity of titanium dioxide nanoparticles on human astrocyte and neuronal cells after acute and prolonged exposure. Neurotoxicology. 2015;48:77–89. 25783503 10.1016/j.neuro.2015.03.006 Baranowska-Wójcik E Szwajgier D Oleszczuk P : Effects of Titanium Dioxide Nanoparticles Exposure on Human Health-a Review. Biol. Trace Elem. Res. 2020;193(1):118–129. 30982201 10.1007/s12011-019-01706-6 PMC6914717 Balakrishnan R Azam S Kim IS : Neuroprotective Effects of Black Pepper and Its Bioactive Compounds in Age-Related Neurological Disorders. Aging Dis. 2023;14(3):750–777. 37191428 10.14336/AD.2022.1022 PMC10187688 10.5256/f1000research.191266.r455085 Reviewer response for version 1 Alam Mohammad Zubair 1 Referee https://orcid.org/0000-0003-2843-169X King Abdulaziz University, Jeddah, Makkah Province, Saudi Arabia

Competing interests: No competing interests were disclosed.

 11 2 2026 Copyright: © 2026 Alam MZ 2026 This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. recommendation reject

This manuscript investigates the neurotoxic effects of titanium dioxide nanoparticles (TiO₂NPs) and evaluates the neuroprotective potential of piperine alone and in combination with TiO₂NPs in a rat model.

The study integrates nanoparticle synthesis and characterization, biochemical oxidative stress markers, neurotransmitter analysis, gene expression (COX), and histopathology, which together provide a broad experimental framework.

The topic is relevant to nanotoxicology and neuroprotection research, and the dataset is substantial. However, despite these strengths, the manuscript has major issues related to experimental logic, data interpretation, statistical clarity, and language quality that currently limit its suitability for acceptance.

Major Issues:

The combined treatment group (PIP–TiO₂NPs) is conceptually confusing.

If TiO₂NPs are toxic, administering piperine conjugated with the same nanoparticles requires stronger justification. It is unclear whether this formulation reduces toxicity, alters biodistribution, or introduces additional nanoparticle exposure.

There is no group receiving TiO₂NPs + free piperine (co-administration without conjugation), which would be essential to distinguish formulation effects from pharmacological effects.

The TiO₂NPs group (G2) shows lower ROS levels than some treated groups, which contradicts both the introduction and discussion claiming oxidative stress induction.

The relationship between TAO-C, ROS, and MDA is not coherently interpreted, and some conclusions appear overstated given the actual trends in the figures.

Neurotransmitters are measured in serum, not brain tissue.

This is a critical limitation because serum neurotransmitter levels do not directly reflect synaptic or central nervous system neurotransmission.

Strong claims regarding “neuroprotection,” “synaptic function,” and “brain activity” are therefore not fully supported by the presented data.

Only COX gene expression is measured.

There is no distinction between COX-1 and COX-2 at the protein level, nor confirmation by Western blot or immunohistochemistry.

The manuscript frequently interprets COX changes as neuroinflammation, but no cytokines (e.g., TNF-α, IL-1β, IL-6) or microglial markers are assessed.

Histological changes are described as mild to moderate, yet the discussion sometimes implies robust neurodegeneration.

The presence of vacuolation and glial depletion in the G3 group contradicts the claim that the combined formulation is clearly protective.

Quantitative scoring or blinded histological assessment is not reported.

Use of LSD post-hoc testing without justification raises concerns about inflated type-I error.

Figures use letter-based significance labeling, but comparisons are not always clearly explained in the legends.

Effect sizes and confidence intervals are not reported.

The manuscript contains extensive grammatical errors, awkward phrasing, repetition, and unclear sentences, especially in the Discussion.

Several paragraphs are overly long, unfocused, and difficult to follow.

The Discussion frequently restates results instead of critically interpreting them.

Minor Issues

Abstract contains inconsistencies such as “significant decrease in ROS” in G2 conflicts with the hypothesis.

Units and symbols are sometimes inconsistent like spacing, capitalization.

Some references are cited repeatedly without adding new interpretive value.

Figure numbering and cross-referencing could be clearer.

In introduction the third paragraph should have been placed at first position.

Some citations refer to ….. as reported by Reference 6 or so on…. This is not the way of writing scientific papers. Please follow the standard way of citing references.  

For Editor: Major Revision

The manuscript addresses an important topic and contains valuable experimental data, but substantial revisions are necessary before it can be considered reliable and interpretable for indexing.

Is the work clearly and accurately presented and does it cite the current literature?

Partly

If applicable, is the statistical analysis and its interpretation appropriate?

Partly

Are all the source data underlying the results available to ensure full reproducibility?

Yes

Is the study design appropriate and is the work technically sound?

Yes

Are the conclusions drawn adequately supported by the results?

Yes

Are sufficient details of methods and analysis provided to allow replication by others?

Yes

Reviewer Expertise:

Neuroscience, Multiple Sclerosis

I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.