<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.2-238.v1</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                    <subj-group>
                        <subject>Medical Microbiology</subject>
                    </subj-group>
                    <subj-group>
                        <subject>Microbial Evolution &amp; Genomics</subject>
                    </subj-group>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>Functional characterization of 
                    <italic>Candida</italic>
                    <italic> albicans</italic> Hos2 histone deacetylase</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 1; peer review: 2 approved with reservations]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Karthikeyan</surname>
                        <given-names>G</given-names>
                    </name>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Paul-Satyaseela</surname>
                        <given-names>Maneesh</given-names>
                    </name>
                    <xref ref-type="aff" rid="a1">1</xref>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Dhatchana Moorthy</surname>
                        <given-names>Nachiappan</given-names>
                    </name>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Gopalaswamy</surname>
                        <given-names>Radha</given-names>
                    </name>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Narayanan</surname>
                        <given-names>Shridhar</given-names>
                    </name>
                    <xref ref-type="aff" rid="a1">1</xref>
                    <xref ref-type="aff" rid="a3">3</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Drug Discovery Research, Orchid Chemicals and Pharmaceuticals Limited, Chennai, 600 119, India</aff>
                <aff id="a2">
                    <label>2</label>Current address: Samrud Foundation for Health &amp; Research, Bangalore, 560106, India</aff>
                <aff id="a3">
                    <label>3</label>Current address: AstraZeneca India Pvt. Ltd, Bengaluru, 560024, India</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:karthik@orchidpharma.com">karthik@orchidpharma.com</email>
                </corresp>
                <fn fn-type="con">
                    <p>GK, MPS and SN conceived the study. GK, NDM and RG designed the experiments. GK, NDM and RG carried out the research. GK and NDM prepared the first draft of the manuscript. All authors were involved in the revision of the draft manuscript and have agreed to the final content.</p>
                </fn>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>11</day>
                <month>11</month>
                <year>2013</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2013</year>
            </pub-date>
            <volume>2</volume>
            <elocation-id>238</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>8</day>
                    <month>11</month>
                    <year>2013</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2013 Karthikeyan G et al.</copyright-statement>
                <copyright-year>2013</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/3.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/2-238/pdf"/>
            <abstract>
                <p>
					
                    <italic toggle="yes">Candida albicans</italic> is a mucosal commensal organism in normal individuals, but is a major pathogen causing systemic and mucosal infections in immunocompromised individuals. Azoles have been very effective anti-fungal agents and the mainstay in treating opportunistic mold and yeast infections. Azole resistant strains have emerged compromising the utility of this class of drugs. It has been shown that azole resistance can be reversed by the co-administration of a histone deacetylase (HDAC) inhibitor, suggesting that resistance is mediated by epigenetic mechanisms possibly involving Hos2, a fungal deacetylase.</p>
                <p>We report here the cloning and functional characterization of 
                    <italic toggle="yes">HOS2 (H</italic>igh 
                    <italic toggle="yes">O</italic>smolarity 
                    <italic toggle="yes">S</italic>ensitive), a gene coding for fungal histone deacetylase from 
                    <italic toggle="yes">C. albicans</italic>. Inhibition studies showed that Hos2 is susceptible to pan inhibitors such as trichostatin A (TSA) and suberoylanilide hydroxamic acid (SAHA), but is not inhibited by class I inhibitors such MS-275. Purified Hos2 protein consistently deacetylated tubulins, rather than histones from TSA-treated cells. This 
                    <italic toggle="yes">in vitro</italic> enzymatic assay, which is amenable to high throughput could be used for screening potent fungal Hos2 inhibitors that could be a potential anti-fungal adjuvant. Hos2 has been reported to be a putative NAD+ dependent histone deacetylase, a feature of sirtuins. We assayed for sirtuin activation with resveratrol and purified Hos2 protein and did not find any sirtuin activity.</p>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>C. albicans</kwd>
                <kwd>HOS2</kwd>
                <kwd>enzyme assay</kwd>
                <kwd>histone/ tubulin deacetylase activity.</kwd>
            </kwd-group>
            <funding-group>
                <funding-statement>This was an exploratory in-house project funded solely by Orchid Chemicals and Pharmaceuticals Limited.</funding-statement>
                <funding-statement>
                    <italic>The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.</italic>
                </funding-statement>
            </funding-group>
        </article-meta>
    </front>
    <body>
        <sec sec-type="intro">
            <title>Introduction</title>
            <p>
				
                <italic toggle="yes">Candida albicans</italic> is a commensal organism found in the mucosa and gastrointestinal tract of most healthy individuals but can cause severe systemic/superficial infections, especially in immunocompromised patients
                <sup>
                    <xref ref-type="bibr" rid="ref-1">1</xref>
                </sup>. This fungus is of clinical importance and is one of the leading causes of systemic infections in immunocompromised individuals. 
                <italic toggle="yes">C. albicans</italic> is the fourth most common cause of nosocomial bloodstream infections and is associated with high mortality rates
                <sup>
                    <xref ref-type="bibr" rid="ref-2">2</xref>
                </sup>. Azoles and echinocandins targeting the ergosterol and cell wall biosynthesis pathway respectively have been used as anti-fungal drugs though the emergence of drug-resistant strains has compromised the efficacy and utility of these drugs
                <sup>
                    <xref ref-type="bibr" rid="ref-3">3</xref>
                </sup>.</p>
            <p>Azole resistance in 
                <italic toggle="yes">Candida</italic> sp. is mediated by up regulation of genes encoding ERG11, a lanosterol demethylase
                <sup>
                    <xref ref-type="bibr" rid="ref-4">4</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-6">6</xref>
                </sup>, MDR1
                <sup>
                    <xref ref-type="bibr" rid="ref-5">5</xref>,
                    <xref ref-type="bibr" rid="ref-7">7</xref>
                </sup> and by CDR (Candida drug resistance) efflux pumps
                <sup>
                    <xref ref-type="bibr" rid="ref-5">5</xref>,
                    <xref ref-type="bibr" rid="ref-7">7</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-9">9</xref>
                </sup>. A combination of existing anti-fungals with new classes of drugs that act by different mechanisms will be viable alternatives to the current monotherapy regimen, which contributes to the emergence of drug resistance.</p>
            <p>Histone deacetylases (HDAC) play an important role in modulating chromatin conformation, by deacetylating crucial lysine residues in the histone octamers over which the chromatin DNA are wrapped
                <sup>
                    <xref ref-type="bibr" rid="ref-10">10</xref>
                </sup>. Human HDAC`s fall into four broad categories, Class I (HDAC1, 2, 3, and 8), Class II a (HDAC 4, 5, 7 and 9) Class II b (HDAC 6 and 10) Class III (sirtuins) and Class IV (HDAC11) based on sequence homology, substrate preference and co-factor requirements. The involvement of each of these isoforms in disease pathology has been elucidated to some extent in recent times. The approval of suberoylanilide hydroxamic acid (SAHA)
                <sup>
                    <xref ref-type="bibr" rid="ref-11">11</xref>
                </sup>, a well known inhibitor of HDACs by the US FDA for treating CTCL, (cutaneous T cell lymphoma)
                <sup>
                    <xref ref-type="bibr" rid="ref-12">12</xref>,
                    <xref ref-type="bibr" rid="ref-13">13</xref>
                </sup> has thrown open the doors for exploring the use of HDAC inhibitors in combination with existing drugs for several diseases, such as malaria and Kala-azar etc.,
                <sup>
                    <xref ref-type="bibr" rid="ref-14">14</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-16">16</xref>
                </sup>.</p>
            <p>Class specific inhibitors are now becoming a reality for human HDAC isoforms. For example the HDAC Class I specific inhibitor MS-275 is in advanced clinical trials (clinical trial Nos. NCT00020579, NCT00866333) for several forms of cancer, and the HDAC class II specific inhibitor ACY-1215 is at an advanced clinical phase (clinical trial Nos. 
                <ext-link ext-link-type="uri" xlink:href="http://clinicaltrials.gov/ct2/show/NCT01323751">NCT01323751</ext-link>, 
                <ext-link ext-link-type="uri" xlink:href="http://clinicaltrials.gov/show/NCT01583283">NCT01583283</ext-link>) for myeloma.</p>
            <p>HDAC inhibitors have been shown to synergize the actions of antifungal agents, due to their effect on preventing drug resistance 
                <italic toggle="yes">in vitro</italic>
                <sup>
                    <xref ref-type="bibr" rid="ref-17">17</xref>,
                    <xref ref-type="bibr" rid="ref-18">18</xref>
                </sup>. Therefore, an alternative approach to address fungal drug resistance could be to harness the potential of modulating fungal gene expression by inhibition of fungal HDACs
                <sup>
                    <xref ref-type="bibr" rid="ref-17">17</xref>,
                    <xref ref-type="bibr" rid="ref-19">19</xref>
                </sup>.</p>
            <p>Hos2, a class I HDAC enzyme plays an important role in gene activation in the yeast 
                <italic toggle="yes">Saccharomyces cerevisiae</italic> by binding to open reading frames (ORFs) of active genes
                <sup>
                    <xref ref-type="bibr" rid="ref-20">20</xref>
                </sup>. Hos2/Set3 histone deacetylase complex (Set3C) plays a key role in the conversion of white phase to virulent opaque phase in 
                <italic toggle="yes">C. albicans</italic>
                <sup>
                    <xref ref-type="bibr" rid="ref-21">21</xref>
                </sup>. Deletion of Hos2, the catalytic subunit of the Set3 complex produced a phenotype resembling inhibition of the Set3C by Trichostatin-A (TSA)
                <sup>
                    <xref ref-type="bibr" rid="ref-22">22</xref>
                </sup>. Serum-induced morphogenesis of some 
                <italic toggle="yes">C. albicans</italic> strains was shown to be inhibited by TSA
                <sup>
                    <xref ref-type="bibr" rid="ref-19">19</xref>
                </sup>. Thus inhibiting the morphogenetic ability of this opportunistic pathogen using HDAC inhibitors holds the promise of future antifungal agents. Recently a small molecule, MGCD 290 (Hos2 inhibitor) has entered clinical trials (clinical trial number 
                <ext-link ext-link-type="uri" xlink:href="http://clinicaltrials.gov/ct2/show/NCT01497223">NCT01497223</ext-link>)) for use in combination with azoles, such as fluconazole, for fungal infections
                <sup>
                    <xref ref-type="bibr" rid="ref-18">18</xref>
                </sup>.</p>
            <p>In light of the emerging utility of Hos2 inhibition as an anti-fungal strategy, we have cloned and characterized the 
                <italic toggle="yes">C. albicans HOS2</italic>. In this report, we present details on optimizing the codons and cloning for heterologous gene expression in Sf9 insect cells. Purified Hos2 was characterized by functional deacetylase activities on histone/tubulin preparations and inhibition studies with SAHA, TSA and MS-275. The Candida genome database reports Hos2 to be a putative NAD+ dependent histone deacetylase
                <sup>
                    <xref ref-type="bibr" rid="ref-23">23</xref>
                </sup>, reminiscent of sirtuins. The Candida genome encodes for 3 sirtuins (HST1, HST2 and HST3). It has been shown that inhibition of HST3 by either gene repression or nicotinamide treatment reduces to a considerable extent the clinical severity of candidiasis
                <sup>
                    <xref ref-type="bibr" rid="ref-24">24</xref>
                </sup>. In light of this reported observation, we checked for sirtuin like activity of purified Hos2 preparations using resveratrol, which activates sirtuins
                <sup>
                    <xref ref-type="bibr" rid="ref-25">25</xref>
                </sup>.</p>
        </sec>
        <sec sec-type="materials | methods">
            <title>Materials and methods</title>
            <sec>
                <title>Isolation of 
                    <italic toggle="yes">C. albicans</italic> genomic DNA</title>
                <p>
                    <italic toggle="yes">C. albicans</italic> ATCC 90028 was obtained from ATCC and grown in Sabouraud dextrose media. The protoplasts were prepared from an overnight culture of fully-grown mycelia using zymolyase (Cat. No. L5263, Sigma, St. Louis, MO, USA) as per the manufacturer&#x2019;s instructions. Protoplasts were lysed in a chaotrophic salt solution and genomic DNA was isolated according to manufacturer&#x2019;s instruction (Qiagen, Hilden, Germany). The final eluate was reprecipitated with ammonium acetate and isopropanol and DNA quantified by UV spectrophotometer (Spectramax Gemini XS, Molecular devices, CA. USA).</p>
            </sec>
            <sec>
                <title>Cloning and expression of HOS2 in an insect cell expression system</title>
                <p>Oligos were designed with codon changes made for 4
                    <sup>th</sup> and 271
                    <sup>st</sup> serine residues. Full length 
                    <italic toggle="yes">HOS2</italic> gene was amplified by using 4 different primers (
                    <xref ref-type="table" rid="T1">Table 1</xref>) using splicing by overlap extension (SOE PCR), so that codon usage could be maintained in any heterologous expression system. The full-length blunt end PCR product was cloned in to pJET1.2 cloning vector (CloneJET PCR Cloning Kit Thermo Scientific) and confirmed by restriction digestion using 
                    <italic toggle="yes">BamH1</italic> and 
                    <italic toggle="yes">Not1</italic>. DNA sequencing using T7 promoter (forward, 5&#x00b4;-TAATAC GACTCACTATAGGG-3&#x00b4;) and pJET1.2 (reverse, 5&#x00b4;-AAGAACATCGATTTTCCATGGCAG-&#x00b4;3) sequencing primer ascertained the sequence of the recombinant Hos2 gene.</p>
                <table-wrap id="T1" orientation="portrait" position="anchor">
                    <label>Table 1. </label>
                    <caption>
                        <title>Oligonucleotide primer pairs for the PCR amplification of Hos2 gene by SOE PCR.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="middle">Sl.
                                    <break/>No.</th>
                                <th align="left" colspan="1" rowspan="1" valign="middle">Primer
                                    <break/>Name</th>
                                <th align="left" colspan="1" rowspan="1">Primer sequence</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td colspan="1" rowspan="1">1</td>
                                <td colspan="1" rowspan="1">PR1</td>
                                <td colspan="1" rowspan="1">5&#x00b4; AAAAGGATCCATGACGATATCCATAAGTGAAACAGATACG 3&#x00b4;</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">2</td>
                                <td colspan="1" rowspan="1">PR2</td>
                                <td colspan="1" rowspan="1">5&#x00b4; ATTATTTAAATCCATTATGGAACCGTTAAT 3&#x00b4;</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">3</td>
                                <td colspan="1" rowspan="1">PR3</td>
                                <td colspan="1" rowspan="1">5&#x00b4; ATTAACGGTTCCATAATGGATTTAAATAAT 3&#x00b4;</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">4</td>
                                <td colspan="1" rowspan="1">PR4</td>
                                <td colspan="1" rowspan="1">5&#x00b4; CACCACTAGCGGCCGCTAAGTCATTAGTTCTCCTAGTTTGGTTTCA 3&#x00b4;</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <p>Recombinant baculoviruses were generated using the Bac-to-Bac
                    <sup>&#x00ae;</sup> baculovirus expression system according to the instructions of the manufacturer (Cat. No. 10359-016, Invitrogen, Carlsbad, USA). Sf9 insect cells (Cat. No. B825-01, Invitrogen, Carlsbad, USA) were cultured in complete TMN-FH medium (Cat. No. 554760, BD Bioscience, NJ, USA) served as host cells for virus generation and/or protein production. The 
                    <italic toggle="yes">HOS2</italic> gene was cloned in frame with N-terminal hexa-histidine tag into the transfer vector pFastBac-HT B (Cat. No. 10584-027, Invitrogen, Carlsbad, USA) and transformed in to 
                    <italic toggle="yes">Escherichia coli</italic> DH10Bac cells (Cat. No. 10361-012, Invitrogen, Carlsbad, USA). Sf9 cells were transfected using cellfectin reagent (Cat. No. 10362-100, Invitrogen, Carlsbad, USA) with the recombinant bacmid, and the resulting viruses were tested for their ability to produce recombinant Hos2 protein using western blot. Production cultures were performed T-150 cell culture flasks (Greiner bio-one GmbH, Germany) at a density of 16&#x00d7;10
                    <sup>6</sup> cells per flask. The cultures were inoculated with recombinant baculovirus stocks at multiplicities of infection of 10. At 4 days after infection, cells were harvested by centrifugation at 1200 g for 15 min at 4&#x00b0;C in a tabletop centrifuge (Model 5804R, Eppendorf AG, Hamburg, Germany). Cell pellets were stored at -80&#x00b0;C until protein purification.</p>
            </sec>
            <sec>
                <title>Purification of recombinant Hos2 protein</title>
                <p>The infected Sf9 cell pellets were resuspended in in-house ice-cold lysis buffer [10 mM Tris pH 7.5, 130 mM NaCl, 1% triton X-100, 10 mM NaF, 10 mM NaPi (sodium phosphate), and 10 mM NaPPi (sodium pyrophosphate)] with 1 X EDTA free protease inhibitor cocktail (Cat. No. 539134, Calbiochem, Merck-Millipore, San Diego, CA). Insoluble material was removed by centrifugation (Model 5804R, Eppendorf AG, Hamburg, Germany) at 16000 g, 4&#x00b0;C for 15 min. The cleared lysate was processed for nickel affinity chromatography. Briefly, the cell supernatant was loaded onto a 3-ml nickel-nitrilotriacetic acid-agarose resin (Ni-NTA agarose, Cat. No. 30210, Qiagen, Hilden, Germany) packed column pre-equilibrated with equilibration buffer (25 mM Tris-Cl pH 8.0, 300 mM NaCl). The column was washed with wash buffer (25 mM Tris-Cl pH 8.0, 300 mM NaCl, 20 mM imidazole). His-tagged Hos2 protein was eluted with buffer containing 300 mM imidazole (Sigma, St. Louis, MO, USA). The Hos2 protein preparation was dialyzed into buffer (25 mM Tris, pH 8.0, 138 mM NaCl, 10% glycerol) and kept in 100 &#x03bc;l aliquots at -70&#x00b0;C. The concentration of Hos2 protein in the final eluate was estimated by Bradford assay (Bio-Rad Laboratories, CA, USA).</p>
            </sec>
            <sec>
                <title>Hos2 deacetylase enzymatic assay</title>
                <p>HDAC inhibitors, namely SAHA, TSA or MS-275 were dissolved in DMSO as 10 mM stock and subsequently diluted in 1X assay buffer (50 mM Tris Cl, pH 8.0, 137 mM NaCl, 2.7 mM KCl, 2.5 mM MgCl
                    <sub>2</sub>, 1 mg/ml BSA). Enzymatic assay was carried out using the fluorogenic Class I HDAC substrate, Boc-Lys (Ac)-AMC (Cat. No. I1875, Bachem AG, Bubendorf, Switzerland). Briefly, 0.5 &#x03bc;g of purified recombinant protein in a volume of 10 &#x03bc;l of assay buffer was incubated with 50 &#x03bc;l of appropriate concentration of HDAC inhibitors and 20 &#x03bc;M of substrate at 37&#x00b0;C for 1 hr. Reactions were terminated by the addition of trichostatin A (TSA)/suberoylanilide hydroxamic acid (SAHA), trypsin (1 mg/mL) (Sigma, St. Louis, MO, USA) and left at 37&#x00b0;C for 15 min, before reading the plates in a fluorimeter (Spectramax Gemini XS, Molecular devices, CA. USA) at wavelengths 360 nm (ext) and 460 nm (emi).</p>
            </sec>
            <sec>
                <title>Production of polyclonal anti sera against Hos2 protein</title>
                <p>Female BALB/c mice were purchased from The Jackson Laboratory (Bar Harbor, ME) at 4 weeks of age and then housed at the animal facility, Orchid chemicals and Pharmaceuticals for 2 weeks in a specific-pathogen free facility with a 12 h light cycle (6 am&#x2013;6 pm) and a 12 h dark cycle (6 pm&#x2013;6 am). Groups of four mice were housed in sterilised polypropylene cages covered with stainless steel grid top, lined with autoclaved clean rice husk bedding. All animal experimentations were approved by the institutional animal ethics committee (Protocol No. 01/IAEC-05/PPK/2009). The native Hos2 protein (expressed in pET-32 bacterial vector system and purified using nickel affinity chromatography under denaturating conditions) was emulsified in complete Freund&#x2019;s adjuvant and injected subcutaneously into two female BALB/c mice (20 &#x03bc;g/mice). Booster doses of the deacetylase antigen (20 &#x03bc;g/mice) were given on the 14
                    <sup>th</sup> and 21
                    <sup>st</sup> day in Freund&#x2019;s incomplete adjuvant. Mice were bled 7 days after the second booster dose and polyclonal anti sera was separated after clotting the blood
                    <sup>
                        <xref ref-type="bibr" rid="ref-26">26</xref>
                    </sup>.</p>
            </sec>
            <sec>
                <title>Cell culture</title>
                <p>Jurkat, a human T lymphocyte cell line, and HeLa, a human cervical adenocarcinoma cell line was obtained from ATCC and were cultured in DMEM (Gibco, Life technologies) supplemented with 10% (v/v) fetal calf serum (FCS), 2 mM glutamine, 100 units/ml penicillin and 100 &#x00b5;g/ml streptomycin (Gibco, Life technologies).</p>
            </sec>
            <sec>
                <title>Isolation of nuclear histones from mammalian cells</title>
                <p>Acetylated histones were isolated from HeLa cells treated with the HDAC inhibitor SAHA as per published protocol
                    <sup>
                        <xref ref-type="bibr" rid="ref-27">27</xref>
                    </sup>. The histone pellet was then resuspended in ultra pure water, stored in 50 &#x03bc;l aliquots at -70&#x00b0;C and the protein concentration was determined using a BCA kit (Pierce).</p>
            </sec>
            <sec>
                <title>Isolation of histones from 
                    <italic toggle="yes">Candida sp</italic>.</title>
                <p>
                    <italic toggle="yes">C. albicans</italic> ATCC 90028 mycelia (~ 5 gm wet weight) were washed with water, centrifuged at 10,000 rpm for 10 minutes at 4&#x00b0;C and the mycelial pellet was resuspended in 50 ml of 0.1 mM Tris-HCl, pH 9.4, 10 mM DTT. The sample was incubated with shaking at 30&#x00b0;C for 15 min and pelleted. The pellet was washed with 50 ml of sorbitol/HEPES buffer (1.2 M sorbitol, 20 mM Hepes, pH 7.4) and left resuspended in the same buffer containing lyticase (1000 units) overnight at 30&#x00b0;C for spheroplasting
                    <sup>
                        <xref ref-type="bibr" rid="ref-28">28</xref>
                    </sup>. The sample was pelleted and proceeded to histone isolation using acid extraction as described previously
                    <sup>
                        <xref ref-type="bibr" rid="ref-29">29</xref>
                    </sup>. Acetone was added at 3:1 (vol/vol) to precipitate the histones, which were subsequently dissolved in 10 mM Tris, pH-8.0.</p>
            </sec>
            <sec>
                <title>Deacetylation of nuclear histones</title>
                <p>Acetylated histones isolated from SAHA treated HeLa cells were used for the deacetylation assay with recombinant Hos2 enzyme. In brief, purified acetylated histones (2 &#x03bc;g) were incubated with different amounts of recombinant Hos2 enzyme. Histone deacetylation with 300 ng of rhHDAC1 or rhHDAC6 (expressed in-house using Baculo-viral expression system) was used as a positive control. Deacetylation assays were carried out for 1 hr at 37&#x00b0;C in reaction buffer (50 mM Tris Cl, pH 8.0, 137 mM NaCl, 2.7 mM KCl, 2.5 mM MgCl
                    <sub>2</sub>, 1 mg/ml BSA). At the end of incubation, the reaction was stopped by the addition of 1X Lammeli sample buffer. The protein samples were resolved by SDS-PAGE and immunoblotted with anti-acetylated H3 Histone (Ac-K-9) antibody to study the deacetylation of H3-histone by rHos2.</p>
            </sec>
            <sec>
                <title>Deacetylation of acetylated tubulin</title>
                <p>Whole cell extracts from TSA (Sigma, St. Louis, MO, USA) treated Jurkat cells were used for the &#x03b1;-tubulin deacetylation assay with recombinant Hos2 enzyme. In brief, whole cell extract (10 &#x03bc;g) were incubated with 5 and 8 &#x03bc;g of recombinant Hos2 protein. Deacetylation assays were carried out for 3 hr at 37&#x00b0;C in reaction buffer (50 mM Tris-Cl, pH 8.0, 137 mM NaCl, 2.7 mM KCl, 2.5 mM MgCl
                    <sub>2</sub>). At the end of incubation, the reaction was stopped by the addition of 1X Lammeli sample buffer. The protein samples were resolved by SDS-PAGE and immunoblotted with either anti-acetylated &#x03b1;-tubulin or anti-&#x03b1;-tubulin antibodies.</p>
            </sec>
            <sec>
                <title>Western blotting</title>
                <p>Recombinant Hos2 protein or the acetylated/deacetylated nuclear histones from deacetylation assays were separated on 10&#x2013;15% SDS-polyacrylamide gels. The gels were stained with coomassie blue (Phast gel, Aersham) or electro-blotted onto nitrocellulose membrane (HyBond-C, Amersham), which was blocked with 5% nonfat dry milk (Cat No. 70166, Fluka, Sigma-Aldrich) in 0.1% Tween- 20 in TBS for 1 hr, followed by overnight incubation at 4&#x00b0;C with either the polyclonal mouse serum (dilution 1:4000 of the sera), rabbit polyclonal anti-acetylated H3-Histone (dilution 1:4000, Ac-K-9 of H3-Histone, Cat. No. 06-599; Millipore), mouse monoclonal anti-acetylated tubulin (dilution 1:15000, Cat. No. T7451, Sigma) or mouse monoclonal anti-tubulin antibody (dilution 1:150000, Cat. No. T6199, Sigma). After incubation with the appropriate horseradish peroxidase conjugated secondary antibodies (Bovine anti-mouse IgG HRP conjugate-dilution 1:7500, Santa Cruz, SC-2371, Goat anti-rabbit IgG-HRP Upstate (Millipore) 12&#x2013;348, dilution 1:4000), supersignal west pico substrate (Thermo Scientific Pierce) was used for detection.</p>
            </sec>
            <sec>
                <title>
					
                    <italic toggle="yes">In vitro</italic> Sirt1 activation assay</title>
                <p>HeLa nuclear extract (2 &#x03bc;g) or recombinant Hos2 enzyme (300 ng) was incubated with NAD+ (500 &#x03bc;M), Fluor de Lys
                    <sup>&#x00ae;</sup>&#x2212;Sirt1 (Enzo lifescience), varying concentrations of resveratrol (Cat. No. 0219605205, MP Biomedicals, Ohio, USA) (30, 100, 250 and 500 &#x03bc;M) in presence or absence of the pan-HDAC inhibitor trichostatin, at 37&#x00b0;C for 30 min. The reaction was carried out following manufacturer&#x2019;s protocol (Enzo lifescience).</p>
            </sec>
        </sec>
        <sec sec-type="results">
            <title>Results</title>
            <sec>
                <title>HOS2 gene PCR</title>
                <p>Codon usage in 
                    <italic toggle="yes">C. albicans</italic> is different from standard genetic code. The 4
                    <sup>th</sup> serine and the 271
                    <sup>st</sup> serine of 
                    <italic toggle="yes">HOS2</italic> are translated as leucine in both mammalian and in insect cell expression systems. Hence, these codons were mutated using oligonucleotide primers to express serine in the recombinant Hos2 protein. The PCR product was cloned in the pFastbac-HTB shuttle vector and subsequently into baculo viral DNA using the Bac-to-Bac expression system.</p>
            </sec>
            <sec>
                <title>Protein expression and purification</title>
                <p>The Hos2 enzyme was expressed in the baculoviral-insect cell expression system as a NH
                    <sub>2</sub>-terminal hexa histidine tagged fusion protein, which is detected on Western blot as a ~ 52 kDa protein using our own polyclonal anti-Hos2 anti-sera raised against Hos2 protein in mice. SDS-PAGE analysis of purified protein revealed a major band at ~ 52 kDa (
                    <xref ref-type="fig" rid="f1">Figure 1A</xref>).</p>
                <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                    <label>Figure 1. </label>
                    <caption>
                        <title>Expression of his-tagged Hos2 in insect cells and its characterization.</title>
                        <p>
			(
                            <bold>A</bold>) Sf9 cells were infected with 10 MOI of recombinant Hos2 baculovirus for 72 hours and the soluble fraction was collected. Two &#x03bc;g of protein was separated on a 10% SDS-PAGE. Lane 2 is coomassie stained SDS-PAGE and Lane 3 is Hos2 protein recognized by polyclonal anti sera from mice. Molecular weight markers are labeled at the left side (Lane 1) of the blot. 
(
                            <bold>B</bold>) Concentration dependent increase in deacetylase activity following incubation of baculo expressed Hos2 with Boc-lys (ac)-AMC fluorogenic peptide substrate in 1 hr assay at 37&#x00b0;C.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/2168/96dd95e2-e895-4ee1-86cf-0f738fdf2a07_figure1.gif"/>
                </fig>
                <p id="B1">
                    <media content-type="figshare" orientation="portrait" position="float" xlink:href="http://dx.doi.org/10.6084/m9.figshare.841666"/>
                </p>
            </sec>
            <sec>
                <title>
                    <italic toggle="yes">In vitro</italic>  deacetylation assay using synthetic peptide substrate</title>
                <p>Recombinant Hos2 enzyme was assayed for deacetylase activity using the synthetic deacetylase substrate, Boc-Lys (ac)-AMC. The total activity with Boc-Lys (ac) AMC showed the enzyme to be active in deacetylating the lysine residue and the activity increased with an increase in Hos2 concentration (
                    <xref ref-type="fig" rid="f1">Figure 1B</xref>).</p>
                <p>The inhibition of deacetylation activity of recombinant Hos2 was studied using classical HDAC inhibitors namely SAHA, TSA and MS-275. TSA was very potent in inhibiting Hos2 with an IC
                    <sub>50</sub> of 2.8 nM, SAHA inhibited Hos2 with an IC
                    <sub>50</sub> of 65 nM (
                    <xref ref-type="fig" rid="f2">Figure 2</xref>, 
                    <xref ref-type="table" rid="T2">Table 2</xref>). However, MS-275 showed &gt; 50% inhibition of Hos2 activity only at 10 &#x03bc;M (
                    <xref ref-type="table" rid="T3">Table 3</xref>).</p>
                <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                    <label>Figure 2. </label>
                    <caption>
                        <title>Dose-dependent inhibition of Hos2 deacetylase activity by SAHA (squares) and TSA (triangles).</title>
                        <p>Recombinant Hos2 enzyme was incubated with different concentrations of pan-HDAC inhibitors (SAHA or TSA) and the enzyme activity assay was performed.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/2168/96dd95e2-e895-4ee1-86cf-0f738fdf2a07_figure2.gif"/>
                </fig>
                <table-wrap id="T2" orientation="portrait" position="anchor">
                    <label>Table 2. </label>
                    <caption>
                        <title>IC50 values of standard HDAC inhibitors.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1">Sl. No.</th>
                                <th align="left" colspan="1" rowspan="1">Pan HDAC inhibitor</th>
                                <th align="left" colspan="1" rowspan="1">IC
                                    <sub>50</sub> &#x00b1; SE (nM)</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td colspan="1" rowspan="1">1</td>
                                <td colspan="1" rowspan="1">SAHA</td>
                                <td colspan="1" rowspan="1">65.4 &#x00b1; 2.4</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">2</td>
                                <td colspan="1" rowspan="1">TSA</td>
                                <td colspan="1" rowspan="1">2.8 &#x00b1; 0.9</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <table-wrap id="T3" orientation="portrait" position="anchor">
                    <label>Table 3. </label>
                    <caption>
                        <title>Hos2 enzyme inhibition values of Class I HDAC inhibitor.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="2" valign="middle">Sl. No.</th>
                                <th align="left" colspan="1" rowspan="2" valign="middle">Class I HDAC inhibitor</th>
                                <th align="center" colspan="2" rowspan="1" valign="middle">% inhibition &#x00b1; SE</th>
                            </tr>
                            <tr>
                                <th align="left" colspan="1" rowspan="1">10 &#x00b5;M</th>
                                <th align="left" colspan="1" rowspan="1">1 &#x00b5;M</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td colspan="1" rowspan="1">1</td>
                                <td colspan="1" rowspan="1">MS275</td>
                                <td colspan="1" rowspan="1">56.3 &#x00b1; 0.9</td>
                                <td colspan="1" rowspan="1">46.3 &#x00b1; 1.4</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
            </sec>
            <sec>
                <title>
                    <italic toggle="yes">In vitro</italic> deacetylation assay using natural substrates</title>
                <p>The ability of purified Hos2 protein to deacetylate acetylated histones was examined 
                    <italic toggle="yes">in vitro</italic> using acetylated nuclear histone preparation made from SAHA treated HeLa cells. The nuclear histones from HeLa cells were isolated using a modified protocol of Shechter 
                    <italic toggle="yes">et al.</italic>
                    <sup>
                        <xref ref-type="bibr" rid="ref-27">27</xref>
                    </sup> and established the deacetylation assay using rhHDAC1/rhHDAC6 as controls along with rHos2. In these assays it was found that 0.3 &#x03bc;g of rhHDAC1 was able to deacetylate the nuclear acetylated histones as detected by an anti-H3-K9 histone antibody. Recombinant hHDAC1 was more potent in deacetylating lysine residues in H3-histones than rhHDAC6. However, no significant deacetylation of H3-Histone was seen with 0.3 &#x03bc;g of Hos2 (
                    <xref ref-type="fig" rid="f3">Figure 3A</xref>). Similar results were obtained with acetylated histones from 
                    <italic toggle="yes">Candida</italic> in the 
                    <italic toggle="yes">in vitro</italic> histone deacetylation assay with purified Hos2 protein (up to 3 &#x03bc;g, 
                    <xref ref-type="fig" rid="f3">Figure 3B</xref>). In contrast, when recombinant Hos2 was incubated with mammalian acetylated &#x03b1;-tubulin, a significant reduction in acetylation of &#x03b1;-tubulin (K40) could be observed (
                    <xref ref-type="fig" rid="f4">Figure 4</xref>).</p>
                <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                    <label>Figure 3. </label>
                    <caption>
                        <title>Deacetylation assays of deacetylases with nuclear histones.</title>
                        <p>
							
                            <bold>A</bold>. Histone H3 acetylation determined by Western blot of extracted acetylated histones (2 &#x00b5;g) Control (Lane 1), incubated with 300 ng of recombinant Hos2 protein (Lane 2), recombinant human HDAC1 (HD1 Lane 3) and recombinant human HDAC6 (HD6 Lane 4) for 1 hour at 37&#x00b0;C in HDAC assay buffer. 
                            <bold>B</bold>. Histone H3 acetylation determined by Western blot of extracted acetylated histones (2 &#x00b5;g) isolated from 
                            <italic toggle="yes">C. albicans</italic>, incubated with different concentrations of recombinant Hos2 protein for 1 hour at 37&#x00b0;C in HDAC assay buffer.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/2168/96dd95e2-e895-4ee1-86cf-0f738fdf2a07_figure3.gif"/>
                </fig>
                <fig fig-type="figure" id="f4" orientation="portrait" position="float">
                    <label>Figure 4. </label>
                    <caption>
                        <title>Deacetylation assays or rHos2 with H3-histones and &#x03b1; tubulin.</title>
                        <p>&#x03b1;-tubulin acetylation determined by Western blot of SAHA-treated whole cell extracts containing acetylated &#x03b1;-tubulin (10 &#x00b5;g) incubated with 0, 5 or 8 &#x00b5;g of recombinant Hos2 for 3 hrs at 37&#x00b0;C in HDAC assay buffer.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/2168/96dd95e2-e895-4ee1-86cf-0f738fdf2a07_figure4.gif"/>
                </fig>
                <p id="B2">
                    <media content-type="figshare" orientation="portrait" position="float" xlink:href="http://dx.doi.org/10.6084/m9.figshare.841655"/>
                </p>
            </sec>
            <sec>
                <title>
                    <italic toggle="yes">In vitro</italic>  Sirt1 deacetylation assay using fluor-de-lys substrate</title>
                <p>Since Hos2 is a putative NAD+ dependent deacetylase, a feature of sirtuin class of deacetylases, it was of interest to check if the Hos2 protein displayed any sirtuin like activity. The sirtuin-like activity in response to the sirtuin activator resveratrol was studied using fluor-de-lys, a synthetic Sirt1 substrate. HeLa nuclear extract was used as a positive control for sirtuin activity. In the presence of TSA where the HDAC activities are inhibited no appreciable NAD+ dependent deacetylase-like activity was seen, following incubation of Hos2 with different concentrations of resveratrol (
                    <xref ref-type="fig" rid="f5">Figure 5</xref>).</p>
                <fig fig-type="figure" id="f5" orientation="portrait" position="float">
                    <label>Figure 5. </label>
                    <caption>
                        <title>SIRTI activation following incubation of Resveratrol with rHos2.</title>
                        <p>Fold activation of the Sirt1 like activity following incubation of recombinant 
                            <italic toggle="yes">Hos2</italic> enzyme with different concentration of resveratrol in presence and absence of HDAC inhibitor trichostatin.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/2168/96dd95e2-e895-4ee1-86cf-0f738fdf2a07_figure5.gif"/>
                </fig>
                <p id="B3">
                    <media content-type="figshare" orientation="portrait" position="float" xlink:href="http://dx.doi.org/10.6084/m9.figshare.841658"/>
                </p>
            </sec>
        </sec>
        <sec sec-type="discussion">
            <title>Discussion</title>
            <p>Hos2 is a histone deacetylase and interacts with several proteins both in the cytoplasmic milieu as well in the nucleus
                <sup>
                    <xref ref-type="bibr" rid="ref-30">30</xref>
                </sup>. Hos2 along with Set3 (SET domain-containing protein 3) an associated protein, plays an important role in controlling gene expression by associating with transcriptionally active regions of the chromatin
                <sup>
                    <xref ref-type="bibr" rid="ref-31">31</xref>
                </sup>.</p>
            <p>HDAC inhibitors by virtue of their ability to prevent antifungal resistance 
                <italic toggle="yes">in vitro</italic> have been proposed as antifungal adjuvants. It has been surmised that inhibiting Hda1 for example might enhance the anti-fungal effect of HDAC inhibitors by limiting hyphal development, while inhibiting Hos2 might contribute to limiting yeast development
                <sup>
                    <xref ref-type="bibr" rid="ref-32">32</xref>
                </sup>. Hos2 has an essential function in morphogenesis especially during conditions of nitrogen starvation
                <sup>
                    <xref ref-type="bibr" rid="ref-33">33</xref>
                </sup>. The critical role of HDAC`s in 
                <italic toggle="yes">C. albicans</italic> pathogenesis and survival to antifungal treatment underscores the necessity to study HDAC function in this organism.</p>
            <p>The increasing clinical incidences of azole resistant fungal infections in critical care patients, makes a good reason to find additional drug targets to control such diseases. There is at least one small molecule (MGCD 290) that inhibits Hos2 histone deacetylase that has progressed to clinical trials. MGCD 290 in combination with azoles was shown to be active against azole resistant yeasts and moulds
                <sup>
                    <xref ref-type="bibr" rid="ref-18">18</xref>
                </sup>.</p>
            <p>In order to better understand the role played by the 
                <italic toggle="yes">Candida</italic> Hos2 enzyme we attempted to clone, express and characterize the protein in detail. This study describes the cloning, expression, purification and characterization of the Hos2 deacetylase enzyme from 
                <italic toggle="yes">C. albicans</italic>.</p>
            <p>We cloned and expressed the 
                <italic toggle="yes">HOS2</italic> gene in baculoviral expression system as a 6x his-tagged protein, which exhibits classical deacetylase activity with the synthetic Boc-Lys (ac)-AMC peptide substrate. In our study, the yield of the Hos2 protein was generally low and probably could be attributed to difference in codon usage between 
                <italic toggle="yes">Candida</italic> and Sf9 insect cells. This 
                <italic toggle="yes">in vitro</italic> enzymatic assay, amenable to high throughput, could be used for screening potent fungal Hos2 inhibitors that could be a potential anti-fungal adjuvant.</p>
            <p>Our studies with the recombinant Hos2 protein showed that it is susceptible to inhibition by standard HDAC inhibitors such as SAHA and TSA. We characterized the inhibition profile of purified proteins with SAHA and TSA and showed that TSA is a more potent inhibitor of Hos2 with an IC
                <sub>50</sub> of 2.8 &#x00b1; 0.9 nM compared to SAHA (IC
                <sub>50</sub> 65.4 &#x00b1; 2.4 nM). Our studies with the class I HDAC inhibitor MS-275 showed that this inhibitor did not inhibit Hos2 deacetylase as effectively as the pan HDAC inhibitors SAHA or TSA, suggesting that 
                <italic toggle="yes">Candida</italic> Hos2 is more similar to class II deacetylases.</p>
            <p>The recombinant Hos2 failed to deacetylate either mammalian or fungal nuclear histones, suggesting that the histones are not the preferred substrates for the Hos2 enzyme. Experiments with total lysates from Jurkat cells containing acetylated &#x03b1;-tubulin showed a dose dependent deacetylation albeit at higher concentration of Hos2 (&gt; 5 &#x03bc;g). Hos2 in essence resembles the class II mammalian HDACs, specifically HDAC6 in its preference for tubulin deacetylation. The physiological relevance of tubulin deacetylation by Hos2 warrants further study.</p>
            <p>The 
                <italic toggle="yes">Candida</italic> genome database
                <sup>
                    <xref ref-type="bibr" rid="ref-23">23</xref>
                </sup> predicts Hos2 protein to be a NAD+ dependent deacetylase. Sirtuins which are classified as Class III deacetylases are NAD+ dependent enzymes activated by polyphenols such as resveratrol. Sirtuins have been proposed to regulate cellular metabolism, ageing and other related processes, specifically cellular stress response to caloric restriction, mediating life span extension. The role of resveratrol as a sirtuin activator has been resolved recently and it is now known that in addition to activating Sirt1, it also activates Sirt5, while inhibiting Sirt3
                <sup>
                    <xref ref-type="bibr" rid="ref-25">25</xref>
                </sup>. Thus inhibiting any sirtuin like activity with small molecule inhibitors could be another way of enhancing the activity of currently used anti-fungals. We evaluated the possibility of Hos2 being a sirtuin like enzyme with a known Sirt1 activator resveratrol. We did not observe any significant activation of NAD+ dependent deacetylase activity with the fluor-de-lys substrate.</p>
            <p>In conclusion this study establishes a functional assay for purified Hos2 protein. This 
                <italic toggle="yes">in vitro</italic> enzymatic assay can be used to screen small molecule inhibitors of Hos2, which can synergise current anti-fungals in the clinic.</p>
        </sec>
    </body>
    <back>
        <ack>
            <title>Acknowledgements</title>
            <p>The authors thank Dr. B. Gopalan, Chief Scientific Officer (CSO) for the encouragement and support and the Management of Orchid Chemicals and Pharmaceuticals Limited (
                <ext-link ext-link-type="uri" xlink:href="http://www.orchidpharma.com">www.orchidpharma.com</ext-link>), Chennai, India, for encouraging publication of this research.</p>
        </ack>
        <ref-list>
            <ref id="ref-1">
                <label>1</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Odds</surname>
                            <given-names>FC</given-names>
                        </name>
					</person-group>:
                    <article-title>Candida and candidosis: a review and bibliography</article-title>: Bailliere Tindall;<year>1988</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.cabdirect.org/abstracts/19892057780.html;jsessionid=96191081368C0F6E2D7FAA7819FD15CA">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-2">
                <label>2</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Pfaller</surname>
                            <given-names>MA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Diekema</surname>
                            <given-names>DJ</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Jones</surname>
                            <given-names>RN</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>International surveillance of bloodstream infections due to Candida species: frequency of occurrence and 
                        <italic toggle="yes">In vitro</italic>  susceptibilities to fluconazole, ravuconazole, and voriconazole of isolates collected from 1997 through 1999 in the SENTRY antimicrobial surveillance program.</article-title>
                    <source>
						
                        <italic toggle="yes">J Clin Microbiol.</italic>
					</source>
                    <year>2001</year>;<volume>39</volume>(<issue>9</issue>):<fpage>3254</fpage>&#x2013;<lpage>3259</lpage>.
                    <pub-id pub-id-type="pmid">11526159</pub-id>
                    <pub-id pub-id-type="doi">10.1128/JCM.39.9.3254-3259.2001</pub-id>
                    <pub-id pub-id-type="pmcid">88327</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-3">
                <label>3</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Fera</surname>
                            <given-names>MT</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>La Camera</surname>
                            <given-names>E</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>De Sarro</surname>
                            <given-names>A</given-names>
                        </name>
					</person-group>:
                    <article-title>New triazoles and echinocandins: mode of action, 
                        <italic toggle="yes">In vitro</italic>  activity and mechanisms of resistance.</article-title>
                    <source>
						
                        <italic toggle="yes">Expert Rev Anti Infect Ther.</italic>
					</source>
                    <year>2009</year>;<volume>7</volume>(<issue>8</issue>):<fpage>981</fpage>&#x2013;<lpage>998</lpage>.
                    <pub-id pub-id-type="pmid">19803707</pub-id>
                    <pub-id pub-id-type="doi">10.1586/eri.09.67</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-4">
                <label>4</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Sanglard</surname>
                            <given-names>D</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Ischer</surname>
                            <given-names>F</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Koymans</surname>
                            <given-names>L</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Amino acid substitutions in the cytochrome P-450 lanosterol 14alpha-demethylase (CYP51A1) from azole-resistant Candida albicans clinical isolates contribute to resistance to azole antifungal agents.</article-title>
                    <source>
						
                        <italic toggle="yes">Antimicrob Agents Chemother.</italic>
					</source>
                    <year>1998</year>;<volume>42</volume>(<issue>2</issue>):<fpage>241</fpage>&#x2013;<lpage>253</lpage>.
                    <pub-id pub-id-type="pmid">9527767</pub-id>
                    <pub-id pub-id-type="pmcid">105395</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-5">
                <label>5</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>White</surname>
                            <given-names>TC</given-names>
                        </name>
					</person-group>:
                    <article-title>The presence of an R467K amino acid substitution and loss of allelic variation correlate with an azole-resistant lanosterol 14alpha demethylase in Candida albicans.</article-title>
                    <source>
						
                        <italic toggle="yes">Antimicrob Agents Chemother.</italic>
					</source>
                    <year>1997</year>;<volume>41</volume>(<issue>7</issue>):<fpage>1488</fpage>&#x2013;<lpage>1494</lpage>.
                    <pub-id pub-id-type="pmid">9210671</pub-id>
                    <pub-id pub-id-type="pmcid">163945</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-6">
                <label>6</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Song</surname>
                            <given-names>JL</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Harry</surname>
                            <given-names>JB</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Eastman</surname>
                            <given-names>RT</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>The Candida albicans lanosterol 14-alpha-demethylase (ERG11) gene promoter is maximally induced after prolonged growth with antifungal drugs.</article-title>
                    <source>
						
                        <italic toggle="yes">Antimicrob Agents Chemother.</italic>
					</source>
                    <year>2004</year>;<volume>48</volume>(<issue>4</issue>):<fpage>1136</fpage>&#x2013;<lpage>1144</lpage>.
                    <pub-id pub-id-type="pmid">15047513</pub-id>
                    <pub-id pub-id-type="doi">10.1128/AAC.48.4.1136-1144.2004</pub-id>
                    <pub-id pub-id-type="pmcid">375326</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-7">
                <label>7</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Sanglard</surname>
                            <given-names>D</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Kuchler</surname>
                            <given-names>K</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Ischer</surname>
                            <given-names>F</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Mechanisms of resistance to azole antifungal agents in Candida albicans isolates from AIDS patients involve specific multidrug transporters.</article-title>
                    <source>
						
                        <italic toggle="yes">Antimicrob Agents Chemother.</italic>
					</source>
                    <year>1995</year>;<volume>39</volume>(<issue>11</issue>):<fpage>2378</fpage>&#x2013;<lpage>2386</lpage>.
                    <pub-id pub-id-type="pmid">8585712</pub-id>
                    <pub-id pub-id-type="doi">10.1128/AAC.39.11.2378</pub-id>
                    <pub-id pub-id-type="pmcid">162951</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-8">
                <label>8</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Albertson</surname>
                            <given-names>GD</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Niimi</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Cannon</surname>
                            <given-names>RD</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Multiple efflux mechanisms are involved in Candida albicans fluconazole resistance.</article-title>
                    <source>
						
                        <italic toggle="yes">Antimicrob Agents Chemother.</italic>
					</source>
                    <year>1996</year>;<volume>40</volume>(<issue>12</issue>):<fpage>2835</fpage>&#x2013;<lpage>2841</lpage>.
                    <pub-id pub-id-type="pmid">9124851</pub-id>
                    <pub-id pub-id-type="pmcid">163632</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-9">
                <label>9</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Marr</surname>
                            <given-names>KA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Lyons</surname>
                            <given-names>CN</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Rustad</surname>
                            <given-names>TR</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Rapid, transient fluconazole resistance in Candida albicans is associated with increased mRNA levels of CDR.</article-title>
                    <source>
						
                        <italic toggle="yes">Antimicrob Agents Chemother.</italic>
					</source>
                    <year>1998</year>;<volume>42</volume>(<issue>10</issue>):<fpage>2584</fpage>&#x2013;<lpage>2589</lpage>.
                    <pub-id pub-id-type="pmid">9756759</pub-id>
                    <pub-id pub-id-type="pmcid">105901</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-10">
                <label>10</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Clayton</surname>
                            <given-names>AL</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Hazzalin</surname>
                            <given-names>CA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Mahadevan</surname>
                            <given-names>LC</given-names>
                        </name>
					</person-group>:
                    <article-title>Enhanced histone acetylation and transcription: a dynamic perspective.</article-title>
                    <source>
						
                        <italic toggle="yes">Mol Cell.</italic>
					</source>
                    <year>2006</year>;<volume>23</volume>(<issue>3</issue>):<fpage>289</fpage>&#x2013;<lpage>296</lpage>.
                    <pub-id pub-id-type="pmid">16885019</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.molcel.2006.06.017</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-11">
                <label>11</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Marks</surname>
                            <given-names>PA</given-names>
                        </name>
					</person-group>:
                    <article-title>Discovery and development of SAHA as an anticancer agent.</article-title>
                    <source>
						
                        <italic toggle="yes">Oncogene.</italic>
					</source>
                    <year>2007</year>;<volume>26</volume>(<issue>9</issue>):<fpage>1351</fpage>&#x2013;<lpage>1356</lpage>.
                    <pub-id pub-id-type="pmid">17322921</pub-id>
                    <pub-id pub-id-type="doi">10.1038/sj.onc.1210204</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-12">
                <label>12</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Campas-Moya</surname>
                            <given-names>C</given-names>
                        </name>
					</person-group>:
                    <article-title>Romidepsin for the treatment of cutaneous T-cell lymphoma.</article-title>
                    <source>
						
                        <italic toggle="yes">Drugs Today (Barc.).</italic>
					</source>
                    <year>2009</year>;<volume>45</volume>(<issue>11</issue>):<fpage>787</fpage>&#x2013;<lpage>795</lpage>.
                    <pub-id pub-id-type="pmid">20126671</pub-id>
                    <pub-id pub-id-type="doi">10.1358/dot.2009.45.11.1437052</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-13">
                <label>13</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Duvic</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Vu</surname>
                            <given-names>J</given-names>
                        </name>
					</person-group>:
                    <article-title>Update on the treatment of cutaneous T-cell lymphoma (CTCL): Focus on vorinostat.</article-title>
                    <source>
						
                        <italic toggle="yes">Biologics.</italic>
					</source>
                    <year>2007</year>;<volume>1</volume>(<issue>4</issue>):<fpage>377</fpage>&#x2013;<lpage>392</lpage>.
                    <pub-id pub-id-type="pmid">19707308</pub-id>
                    <pub-id pub-id-type="doi">10.2147/BTT.S</pub-id>
                    <pub-id pub-id-type="pmcid">2721288</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-14">
                <label>14</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Dokmanovic</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Clarke</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Marks</surname>
                            <given-names>PA</given-names>
                        </name>
					</person-group>:
                    <article-title>Histone deacetylase inhibitors: overview and perspectives.</article-title>
                    <source>
						
                        <italic toggle="yes">Mol Cancer Res.</italic>
					</source>
                    <year>2007</year>;<volume>5</volume>(<issue>10</issue>):<fpage>981</fpage>&#x2013;<lpage>989</lpage>.
                    <pub-id pub-id-type="pmid">17951399</pub-id>
                    <pub-id pub-id-type="doi">10.1158/1541-7786.MCR-07-0324</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-15">
                <label>15</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Mai</surname>
                            <given-names>A</given-names>
                        </name>
					</person-group>:
                    <article-title>The therapeutic uses of chromatin-modifying agents.</article-title>
                    <source>
						
                        <italic toggle="yes">Expert Opin Ther Targets.</italic>
					</source>
                    <year>2007</year>;<volume>11</volume>(<issue>6</issue>):<fpage>835</fpage>&#x2013;<lpage>851</lpage>.
                    <pub-id pub-id-type="pmid">17504020</pub-id>
                    <pub-id pub-id-type="doi">10.1517/14728222.11.6.835</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-16">
                <label>16</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Riester</surname>
                            <given-names>D</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Hildmann</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Schwienhorst</surname>
                            <given-names>A</given-names>
                        </name>
					</person-group>:
                    <article-title>Histone deacetylase inhibitors--turning epigenic mechanisms of gene regulation into tools of therapeutic intervention in malignant and other diseases.</article-title>
                    <source>
						
                        <italic toggle="yes">Appl Microbiol Biotechnol.</italic>
					</source>
                    <year>2007</year>;<volume>75</volume>(<issue>3</issue>):<fpage>499</fpage>&#x2013;<lpage>514</lpage>.
                    <pub-id pub-id-type="pmid">17377788</pub-id>
                    <pub-id pub-id-type="doi">10.1007/s00253-007-0912-1</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-17">
                <label>17</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Smith</surname>
                            <given-names>WL</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Edlind</surname>
                            <given-names>TD</given-names>
                        </name>
					</person-group>:
                    <article-title>Histone deacetylase inhibitors enhance Candida albicans sensitivity to azoles and related antifungals: correlation with reduction in CDR and ERG upregulation.</article-title>
                    <source>
						
                        <italic toggle="yes">Antimicrob Agents Chemother.</italic>
					</source>
                    <year>2002</year>;<volume>46</volume>(<issue>11</issue>):<fpage>3532</fpage>&#x2013;<lpage>3539</lpage>.
                    <pub-id pub-id-type="pmid">12384361</pub-id>
                    <pub-id pub-id-type="doi">10.1128/AAC.46.11.3532-3539.2002</pub-id>
                    <pub-id pub-id-type="pmcid">128736</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-18">
                <label>18</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Pfaller</surname>
                            <given-names>MA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Messer</surname>
                            <given-names>SA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Georgopapadakou</surname>
                            <given-names>N</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Activity of MGCD290, a Hos2 histone deacetylase inhibitor, in combination with azole antifungals against opportunistic fungal pathogens.</article-title>
                    <source>
						
                        <italic toggle="yes">J Clin Microbiol.</italic>
					</source>
                    <year>2009</year>;<volume>47</volume>(<issue>12</issue>):<fpage>3797</fpage>&#x2013;<lpage>3804</lpage>.
                    <pub-id pub-id-type="pmid">19794038</pub-id>
                    <pub-id pub-id-type="doi">10.1128/JCM.00618-09</pub-id>
                    <pub-id pub-id-type="pmcid">2786684</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-19">
                <label>19</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Simonetti</surname>
                            <given-names>G</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Passariello</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Rotili</surname>
                            <given-names>D</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Histone deacetylase inhibitors may reduce pathogenicity and virulence in Candida albicans.</article-title>
                    <source>
						
                        <italic toggle="yes">FEMS Yeast Res.</italic>
					</source>
                    <year>2007</year>;<volume>7</volume>(<issue>8</issue>):<fpage>1371</fpage>&#x2013;<lpage>1380</lpage>.
                    <pub-id pub-id-type="pmid">17627775</pub-id>
                    <pub-id pub-id-type="doi">10.1111/j.1567-1364.2007.00276.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-20">
                <label>20</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>A</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Kurdistani</surname>
                            <given-names>SK</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Grunstein</surname>
                            <given-names>M</given-names>
                        </name>
					</person-group>:
                    <article-title>Requirement of Hos2 histone deacetylase for gene activity in yeast.</article-title>
                    <source>
						
                        <italic toggle="yes">Science.</italic>
					</source>
                    <year>2002</year>;<volume>298</volume>(<issue>5597</issue>):<fpage>1412</fpage>&#x2013;<lpage>1414</lpage>.
                    <pub-id pub-id-type="pmid">12434058</pub-id>
                    <pub-id pub-id-type="doi">10.1126/science.1077790</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-21">
                <label>21</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Hnisz</surname>
                            <given-names>D</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Schwarzmuller</surname>
                            <given-names>T</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Kuchler</surname>
                            <given-names>K</given-names>
                        </name>
					</person-group>:
                    <article-title>Transcriptional loops meet chromatin: a dual-layer network controls white-opaque switching in Candida albicans.</article-title>
                    <source>
						
                        <italic toggle="yes">Mol Microbiol.</italic>
					</source>
                    <year>2009</year>;<volume>74</volume>(<issue>1</issue>):<fpage>1</fpage>&#x2013;<lpage>15</lpage>.
                    <pub-id pub-id-type="pmid">19555456</pub-id>
                    <pub-id pub-id-type="doi">10.1111/j.1365-2958.2009.06772.x</pub-id>
                    <pub-id pub-id-type="pmcid">2764112</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-22">
                <label>22</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Hnisz</surname>
                            <given-names>D</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Majer</surname>
                            <given-names>O</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Frohner</surname>
                            <given-names>IE</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>The Set3/Hos2 histone deacetylase complex attenuates cAMP/PKA signaling to regulate morphogenesis and virulence of Candida albicans.</article-title>
                    <source>
						
                        <italic toggle="yes">PLoS Pathog.</italic>
					</source>
                    <year>2010</year>;<volume>6</volume>(<issue>5</issue>):<fpage>e1000889</fpage>.
                    <pub-id pub-id-type="pmid">20485517</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.ppat.1000889</pub-id>
                    <pub-id pub-id-type="pmcid">2869326</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-23">
                <label>23</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Arnaud MB</surname>
                            <given-names>ID</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Skrzypek</surname>
                            <given-names>MS</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Binkley</surname>
                            <given-names>J</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Candida Genome Database</article-title>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.candidagenome.org/cgi-bin/locus.pl?locus=orf19.5377">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-24">
                <label>24</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Wurtele</surname>
                            <given-names>H</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Tsao</surname>
                            <given-names>S</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Lepine</surname>
                            <given-names>G</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Modulation of histone H3 lysine 56 acetylation as an antifungal therapeutic strategy.</article-title>
                    <source>
						
                        <italic toggle="yes">Nat Med.</italic>
					</source>
                    <year>2010</year>;<volume>16</volume>(<issue>7</issue>):<fpage>774</fpage>&#x2013;<lpage>780</lpage>.
                    <pub-id pub-id-type="pmid">20601951</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nm.2175</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-25">
                <label>25</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Gertz</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Nguyen</surname>
                            <given-names>GT</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Fischer</surname>
                            <given-names>F</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>A molecular mechanism for direct sirtuin activation by resveratrol.</article-title>
                    <source>
						
                        <italic toggle="yes">PLoS One.</italic>
					</source>
                    <year>2012</year>;<volume>7</volume>(<issue>11</issue>):<fpage>e49761</fpage>.
                    <pub-id pub-id-type="pmid">23185430</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0049761</pub-id>
                    <pub-id pub-id-type="pmcid">3504108</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-26">
                <label>26</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Fuller</surname>
                            <given-names>SA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Takahashi</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Hurrell</surname>
                            <given-names>JG</given-names>
                        </name>
					</person-group>:
                    <article-title>Immunization of Mice.</article-title>
                    <source>
					 
                        <italic toggle="yes">Curr Protoc Mol Biol.</italic>
					</source>John Wiley &amp; Sons, Inc.;<year>2001</year>.
                    <pub-id pub-id-type="pmid">18265076</pub-id>
                    <pub-id pub-id-type="doi">10.1002/0471142727.mb1104s18</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-27">
                <label>27</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Shechter</surname>
                            <given-names>D</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Dormann</surname>
                            <given-names>HL</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Allis</surname>
                            <given-names>CD</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Extraction, purification and analysis of histones.</article-title>
                    <source>
						
                        <italic toggle="yes">Nat Protoc.</italic>
					</source>
                    <year>2007</year>;<volume>2</volume>(<issue>6</issue>):<fpage>1445</fpage>&#x2013;<lpage>1457</lpage>.
                    <pub-id pub-id-type="pmid">17545981</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nprot.2007.202</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-28">
                <label>28</label>
                <mixed-citation publication-type="book">
                    <article-title>Yeast Nuclei Isolation</article-title>.
                    <ext-link ext-link-type="uri" xlink:href="http://labs.fhcrc.org/hahn/Methods/biochem_meth/yeast_nuclei_isol.html">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-29">
                <label>29</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Knapp</surname>
                            <given-names>AR</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Ren</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Su</surname>
                            <given-names>X</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Quantitative profiling of histone post-translational modifications by stable isotope labeling.</article-title>
                    <source>
						
                        <italic toggle="yes">Methods.</italic>
					</source>
                    <year>2007</year>;<volume>41</volume>(<issue>3</issue>):<fpage>312</fpage>&#x2013;<lpage>319</lpage>.
                    <pub-id pub-id-type="pmid">17309842</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.ymeth.2006.08.017</pub-id>
                    <pub-id pub-id-type="pmcid">2572810</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-30">
                <label>30</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Wiren</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Silverstein</surname>
                            <given-names>RA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Sinha</surname>
                            <given-names>I</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Genomewide analysis of nucleosome density histone acetylation and HDAC function in fission yeast.</article-title>
                    <source>
						
                        <italic toggle="yes">EMBO J.</italic>
					</source>
                    <year>2005</year>;<volume>24</volume>(<issue>16</issue>):<fpage>2906</fpage>&#x2013;<lpage>2918</lpage>.
                    <pub-id pub-id-type="pmid">16079916</pub-id>
                    <pub-id pub-id-type="doi">10.1038/sj.emboj.7600758</pub-id>
                    <pub-id pub-id-type="pmcid">1187943</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-31">
                <label>31</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Hnisz</surname>
                            <given-names>D</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Bardet</surname>
                            <given-names>AF</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Nobile</surname>
                            <given-names>CJ</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>A histone deacetylase adjusts transcription kinetics at coding sequences during Candida albicans morphogenesis.</article-title>
                    <source>
						
                        <italic toggle="yes">PLoS Genet.</italic>
					</source>
                    <year>2012</year>;<volume>8</volume>(<issue>12</issue>):<fpage>e1003118</fpage>.
                    <pub-id pub-id-type="pmid">23236295</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pgen.1003118</pub-id>
                    <pub-id pub-id-type="pmcid">3516536</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-32">
                <label>32</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Zacchi</surname>
                            <given-names>LF</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Schulz</surname>
                            <given-names>WL</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Davis</surname>
                            <given-names>DA</given-names>
                        </name>
					</person-group>:
                    <article-title>HOS2 and HDA1 encode histone deacetylases with opposing roles in Candida albicans morphogenesis.</article-title>
                    <source>
						
                        <italic toggle="yes">PLoS One.</italic>
					</source>
                    <year>2010</year>;<volume>5</volume>(<issue>8</issue>):<fpage>e12171</fpage>.
                    <pub-id pub-id-type="pmid">20730094</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0012171</pub-id>
                    <pub-id pub-id-type="pmcid">2921335</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-33">
                <label>33</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Robyr</surname>
                            <given-names>D</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Suka</surname>
                            <given-names>Y</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Xenarios</surname>
                            <given-names>I</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Microarray deacetylation maps determine genome-wide functions for yeast histone deacetylases.</article-title>
                    <source>
						
                        <italic toggle="yes">Cell.</italic>
					</source>
                    <year>2002</year>;<volume>109</volume>(<issue>4</issue>):<fpage>437</fpage>&#x2013;<lpage>446</lpage>.
                    <pub-id pub-id-type="pmid">12086601</pub-id>
                    <pub-id pub-id-type="doi">10.1016/S0092-8674(02)00746-8</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report4017">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.2168.r4017</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Soll</surname>
                        <given-names>David</given-names>
                    </name>
                    <xref ref-type="aff" rid="r4017a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r4017a1">
                    <label>1</label>Department of Biology, University of Iowa, Iowa City, IA, USA</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>16</day>
                <month>4</month>
                <year>2014</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2014 Soll D</copyright-statement>
                <copyright-year>2014</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport4017" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.2-238.v1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>This manuscript describes an 
                <italic>in vitro</italic> assay strategy for testing the effects of antifungal compounds on the activity of Hos2 deacetylase large scale screens.The goal is to find compounds that could be used as facilitators in combinatorial drug treatments for azole resistant 
                <italic>Candida albicans</italic> infections. Although 
                <italic>in vitro</italic> assays are sometimes useful for developing 
                <italic>in vivo</italic> strategies, they are not ideal for screening and identifying optimal drugs.</p>
            <p>As shown in this study by the authors, the recombinant Hos2 they generated exhibits paradoxically tubulin-specific deacetylase activity and not Hos2 specific activity. This finding seems to undermine their intent, because anti-tubulin deacetylase activity or anti-human HDAC6 activity demonstrated 
                <italic>in vitro</italic> could be an artifact of the recombinant protein. In addition, anti-tubulin and anti-HDAC6 activity might result in adverse side effects on human host functions and thus affect the specificity of the primary drug.</p>
            <p>It is surprising that the recombinant Hos2 did not show any activity in acetylating either the human or 
                <italic>Candida</italic> histone H3 
                <italic>in vitro</italic>, despite the fact that several earlier studies in 
                <italic>C. albicans </italic>has demonstrated that Hos2 is involved in morphogenetic programs by affecting chromatin function. In addition, an isolated study has demonstrated the efficacy of a Hos2-specfic inhibitor on azole-resistant strains of
                <italic> C. albicans </italic>
                <ext-link ext-link-type="uri" xlink:href="http://jcm.asm.org/content/47/12/3797.long">(Pfaller
                    <italic> et al.</italic>, 2009)</ext-link>, which is quoted by the authors. The authors do state in the introduction that Hos2 is not a typical deacetylase and has been described by the 
                <italic>Candida</italic> Genome Database as a member of NAD-dependent sirtuins. The authors&#x2019; data show that their recombinant version lacks this activity, but does exhibit inhibition by classical inhibitors of histone deacetylases.</p>
            <p>In addition to this major problem there are a few other aspects of the paper that need to be addressed:
                <list list-type="bullet">
                    <list-item>
                        <p>Firstly, Figure 1 and Figure 5 do not have error bars to indicate reproducibility of the data. Also, a statistical analysis of data sets would be useful to indicate the significance of the results.</p>
                    </list-item>
                    <list-item>
                        <p>Secondly, the units in Figure 2 and Table 2 need to be consistent with the units described in the text.</p>
                    </list-item>
                    <list-item>
                        <p>Thirdly, since Figure 4 shows the effect of recombinant Hos2 on only tubulin, the title needs to be changed to indicate that the assay was not done with purified histones.</p>
                    </list-item>
                    <list-item>
                        <p>Finally, it is not clear what 
                            <italic>&#x201c;fold activity&#x201d;</italic> (in Figure 1B) and 
                            <italic>&#x201c;fold activation&#x201d; </italic>(Figure 5) refer to.&#x00a0;</p>
                    </list-item>
                </list>
            </p>
            <p>Reviewer Expertise:</p>
            <p>NA</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
        <sub-article article-type="response" id="comment819-4017">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Ganesan</surname>
                            <given-names>Karthikeyan</given-names>
                        </name>
                        <aff>Orchid Research Laboratories Ltd, India</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>13</day>
                    <month>5</month>
                    <year>2014</year>
                </pub-date>
            </front-stub>
            <body>
                <p>As a pharmaceutical organization, involved in drug discovery, our initial compound libraries are screened for
                    <italic> in vitro</italic> activity/inhibition assays. These 
                    <italic>in vitro</italic> assays act as important filters removing in-active compounds to progress only the most potent ones to 
                    <italic>in vivo</italic> screening.</p>
                <p>Deacetylase assays using recombinant Hos2 enzyme and synthetic substrate Boc (Lys) AMC showed that the enzyme is active in standard fluorogenic assays.&#x00a0; Absence of deacetylase activity with histone preparations&#x00a0;(Human/
                    <italic>Candida</italic>) in the 
                    <italic>in vitro</italic> histone deacetylation assays was a surprise but the fact that Class I HDAC inhibitor like MS-275 did not inhibit rHos2 in standard fluorogenic assays, led us to explore alternate substrate, namely tubulins.</p>
                <p>We do agree with the reviewer that anti-tubulin deacetylase activity could be an artifact of recombinant protein, but we strongly feel that it is a remote possibility.</p>
                <p>Any small molecule that shows anti-tubulin or anti-HDAC6 activity would be picked up in the 
                    <italic>in vitro</italic> screen and would be prevented from moving further up the discovery path. (Which can be re-purposed for different therapeutic )</p>
                <p>We are indeed aware of the previous studies showing the effect of Set3/Hos2 complex and the opposing roles of Hda1 and Hos2 in 
                    <italic>Candida </italic>morphogenesis as well as the role of Hos2 in S. cerevisiae. In these studies Histone H4 acetylation levels vary dramatically, especially H4-K16, however the Histone H3 levels more or less remain constant, (supplementary materials from 
                    <ext-link ext-link-type="uri" xlink:href="http://www.ncbi.nlm.nih.gov/pubmed/12434058">Wang 
                        <italic>et al.</italic>, 2002</ext-link>) and that`s probably the reason why we don`t see any dramatic deacetylation when probed with Histone H3-K9. The study by 
                    <ext-link ext-link-type="uri" xlink:href="http://jcm.asm.org/content/47/12/3797.long">Pfaller 
                        <italic>et al.</italic>
                    </ext-link> did have 
                    <italic>in vivo</italic> data, but did not have any 
                    <italic>in vitro</italic> data.</p>
                <p>Error bars and statistical analysis have been incorporated for Figs. 1 and 5. Units for Fig. 2 and Table 2 corrected.</p>
                <p>Label has been changed for Fig. 4</p>
                <p>Fold activity and Fold activation is with respect to Blank and has been reflected in the figures.</p>
            </body>
        </sub-article>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report4016">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.2168.r4016</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>MacCallum</surname>
                        <given-names>Donna</given-names>
                    </name>
                    <xref ref-type="aff" rid="r4016a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0003-4833-0378</uri>
                </contrib>
                <aff id="r4016a1">
                    <label>1</label>Aberdeen Fungal Group, University of Aberdeen, Aberdeen, UK</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>19</day>
                <month>3</month>
                <year>2014</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2014 MacCallum D</copyright-statement>
                <copyright-year>2014</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport4016" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.2-238.v1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>This is an interesting study designed to examine the biological activities of&#x00a0;
                <italic>Candida albicans&#x00a0;</italic>Hos2 enzyme, a putative histone deacetylase. The authors express a recombinant version of the protein, which has a His tag added to the N-terminus, and use this to explore potential substrates for the enzyme.</p>
            <p>There are a number of major issues with the data as presented, which need to be addressed:
                <list list-type="bullet">
                    <list-item>
                        <p>It is difficult to make any conclusions from the quantitative data presented in the figures as there are no error bars and the number of replicates is not stated. In addition, it is unclear what the data in Figures 1B and 5 has been expressed relative to (i.e. fold change relative to...?)&#x00a0; Statistical analyses should also be carried out to determine whether any differences are statistically significant ones.</p>
                    </list-item>
                    <list-item>
                        <p>The authors should also revisit the data presented in Figure 2 and Table 2. The data does not correlate, as the authors suggest that the IC
                            <sub>50</sub> values are in micromolar amounts, yet the data in the figure would suggest millimolar levels - units should be checked.</p>
                    </list-item>
                </list>
                <list list-type="bullet">
                    <list-item>
                        <p>The title for Figure 4 should be modified, since this figure contains only data for beta-tubulin.&#x00a0;</p>
                    </list-item>
                </list>
                <list list-type="bullet">
                    <list-item>
                        <p>In the main text the authors need to be much clearer regarding the rationale for looking at tubulin as a substrate.&#x00a0;The authors may also wish to consider the possibility that the substrate specificity and/or activity may have been affected by the N-terminal tag and how this could be investigated.&#x00a0;</p>
                    </list-item>
                </list>
                <list list-type="bullet">
                    <list-item>
                        <p>The discussion section should be revisited to remove the reiteration of the introduction and results. Instead, use this part of the paper to discuss the findings in relation to other published work.&#x00a0;</p>
                    </list-item>
                </list>
                <bold>Minor points:</bold>
                <list list-type="bullet">
                    <list-item>
                        <p>
                            <italic>Candida albicans&#x00a0;</italic>is capable of causing superficial (oral and vaginal thrush)&#x00a0;infections in immune normal hosts (abstract and introduction).</p>
                    </list-item>
                </list>
                <list list-type="bullet">
                    <list-item>
                        <p>Gene names, e.g.&#x00a0;
                            <italic>CDR1&#x00a0;</italic>and&#x00a0;
                            <italic>ERG11</italic>, should be in italics.</p>
                    </list-item>
                </list>
                <list list-type="bullet">
                    <list-item>
                        <p>For the enzymatic assay it would be good to state the volume of the assay so that final concentrations can be worked out.</p>
                    </list-item>
                </list>
                <list list-type="bullet">
                    <list-item>
                        <p>Figure and table legends should include the number of replicates carried out to generate the data.</p>
                    </list-item>
                </list>
            </p>
            <p>Reviewer Expertise:</p>
            <p>NA</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
        <sub-article article-type="response" id="comment821-4016">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Ganesan</surname>
                            <given-names>Karthikeyan</given-names>
                        </name>
                        <aff>Orchid Research Laboratories Ltd, India</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No competing interest</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>13</day>
                    <month>5</month>
                    <year>2014</year>
                </pub-date>
            </front-stub>
            <body>
                <p>Error bars have been incorporated and where possible, statistical analysis done and reported.</p>
                <p>Error in reporting IC
                    <sub>50</sub> value in Table 2 and Fig. 2 is corrected.</p>
                <p>Title for Fig. 4 changed to reflect tubulin deacetylation.</p>
                <p>The rationale for choosing tubulin as a substrate has been explained. We agree with the reviewer that N-terminal tag could perhaps play a role, although we consider that as a remote possibility.</p>
                <p>Minor points suggested by reviewer has also been addressed.</p>
            </body>
        </sub-article>
    </sub-article>
</article>
