<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.2-5.v1</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                    <subj-group>
                        <subject>Agriculture &amp; Biotechnology</subject>
                    </subj-group>
                    <subj-group>
                        <subject>Control of Gene Expression</subject>
                    </subj-group>
                    <subj-group>
                        <subject>Developmental Evolution</subject>
                    </subj-group>
                    <subj-group>
                        <subject>Evolutionary/Comparative Genetics</subject>
                    </subj-group>
                    <subj-group>
                        <subject>Evolutionary Ecology</subject>
                    </subj-group>
                    <subj-group>
                        <subject>Genomics</subject>
                    </subj-group>
                    <subj-group>
                        <subject>Plant Genetics &amp; Gene Expression</subject>
                    </subj-group>
                    <subj-group>
                        <subject>Plant Genomes &amp; Evolution</subject>
                    </subj-group>
                    <subj-group>
                        <subject>Plant Growth &amp; Development</subject>
                    </subj-group>
                    <subj-group>
                        <subject>Structural Genomics</subject>
                    </subj-group>
                    <subj-group>
                        <subject>Structure: RNA</subject>
                    </subj-group>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>
                    <italic>De novo</italic> genetic variation revealed in somatic sectors of single Arabidopsis plants</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 1; peer review: 3 approved]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Hopkins</surname>
                        <given-names>Marianne T</given-names>
                    </name>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Khalid</surname>
                        <given-names>Aaron M</given-names>
                    </name>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Chang</surname>
                        <given-names>Pei-Chun</given-names>
                    </name>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Vanderhoek</surname>
                        <given-names>Karen C</given-names>
                    </name>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Lai</surname>
                        <given-names>Dulcie</given-names>
                    </name>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Doerr</surname>
                        <given-names>Meghan D</given-names>
                    </name>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Lolle</surname>
                        <given-names>Susan J</given-names>
                    </name>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Department of Biology, University of Waterloo, Waterloo, N2L 3G1, Canada</aff>
                <aff id="a2">
                    <label>2</label>Department of Pathology and Molecular Medicine, Queen's University, Kingston, K7L 3N6, Canada</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:slolle@uwaterloo.ca">slolle@uwaterloo.ca</email>
                </corresp>
                <fn fn-type="con">
                    <p>SJL conceived the study. MTH, AMK, PCC KCV, DL, MDD and SJL carried out the research. MTH, AMK, PCC and SJL contributed to the design of the experiments. SJL prepared the manuscript. All authors were involved in the revision of the manuscript and have agreed to the final content.</p>
                </fn>
                <fn fn-type="conflict">
                    <p>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>10</day>
                <month>1</month>
                <year>2013</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2013</year>
            </pub-date>
            <volume>2</volume>
            <elocation-id>5</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>20</day>
                    <month>12</month>
                    <year>2012</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2013 Hopkins MT et al.</copyright-statement>
                <copyright-year>2013</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/3.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/2-5/pdf"/>
            <related-article elocation-id="10.12688/f1000research.2-6.v1" id="related-article-version-866" journal-id="F1000Research" journal-id-type="pmc" related-article-type="companion" vol="2">
                <article-title>The novel 
                    <italic>Arabidopsis thaliana</italic> 
                    <italic>svt2</italic> suppressor of the ascorbic acid-deficient mutant 
                    <italic>vtc1-1</italic> exhibits phenotypic and genotypic instability</article-title>
                <pub-id pub-id-type="doi">10.12688/f1000research.2-6.v1</pub-id>
            </related-article>
            <abstract>
                <p>Concern over the tremendous loss of genetic diversity among many of our most important crops has prompted major efforts to preserve seed stocks derived from cultivated species and their wild relatives. 
                    <italic toggle="yes">Arabidopsis thaliana</italic> propagates mainly by self-fertilizing, and therefore, like many crop plants, theoretically has a limited potential for producing genetically diverse offspring. Despite this, inbreeding has persisted in Arabidopsis for over a million years suggesting that some underlying adaptive mechanism buffers the deleterious consequences of this reproductive strategy. Using presence-absence molecular markers we demonstrate that single Arabidopsis plants can have multiple genotypes. Sequence analyses reveal single nucleotide changes, loss of sequences and, surprisingly, acquisition of unique genomic insertions. Estimates based on quantitative analyses suggest that these genetically discordant sectors are very small but can have a complex genetic makeup. In ruling out more trivial explanations for these data, our findings raise the possibility that intrinsic drivers of genetic variation are responsible for the targeted sequence changes we detect. Given the evolutionary advantage afforded to populations with greater genetic diversity, we hypothesize that organisms that primarily self-fertilize or propagate clonally counteract the genetic cost of such reproductive strategies by leveraging a cryptic reserve of extra-genomic information.</p>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>Arabidopsis</kwd>
                <kwd>genome instability</kwd>
                <kwd>genetic heterogeneity</kwd>
                <kwd>mosaicism</kwd>
                <kwd>inbreeding</kwd>
            </kwd-group>
            <funding-group>
                <funding-statement>SJL gratefully acknowledges funding from the Natural Sci-ences and Engineering Research Council of Canada (NSERC: RGPIN-341446) and the University of Waterloo (UW). MTH, PCC, and DL each were supported by NSERC Fel-lowships. AMK was supported by an Ontario Graduate Scholarship.</funding-statement>
            </funding-group>
        </article-meta>
    </front>
    <body>
        <sec sec-type="intro">
            <title>Introduction</title>
            <p>Plants live in ever changing environments and must adapt using strategies that fundamentally differ from those employed by animals. Developmental plasticity is at the core of those strategies allowing plants to modify their growth and the organs they produce in response to different environmental signals. This type of open-ended modular development enhances survival because damaged or diseased units can readily be discarded without compromising viability. Furthermore, because plants are constrained to sessile life styles, a modular growth habit affords greater versatility allowing phenotypic and genetic variation between modules to be used to the plant&#x2019;s advantage, aiding adaption to pathogen life cycles
                <sup>
                    <xref ref-type="bibr" rid="ref-1">1</xref>
                </sup> or to longer-term environmental perturbations such as climate change. As a consequence of this profound developmental versatility, even individuals composed of cell populations derived from different plant species are viable and can coordinate the growth and development of chimeric organs
                <sup>
                    <xref ref-type="bibr" rid="ref-2">2</xref>
                </sup>. In an elegant paper published in 1981, Whitham and Slobodchikoff
                <sup>
                    <xref ref-type="bibr" rid="ref-3">3</xref>
                </sup> proposed that mosaicism offers a unique adaptive advantage for plants by allowing introduction of genetic variants into the gene pool either through vegetative propagation or through sexual reproduction. They further propose that mutations arising somatically have a greater probability of being incorporated into the gene pool than mutations that arise in the gametes
                <sup>
                    <xref ref-type="bibr" rid="ref-3">3</xref>
                </sup> precisely because germ line cells are derived from somatic tissues that arise late in the developmental history of the plant
                <sup>
                    <xref ref-type="bibr" rid="ref-4">4</xref>,
                    <xref ref-type="bibr" rid="ref-5">5</xref>
                </sup>.</p>
            <p>The relatively frequent occurrence of mosaics among various plant species has been extensively utilized in the development of novel ornamentals and for the selection and maintenance of desirable traits in many cultivated crops. Any desirable cultivars that have arisen in this manner have been maintained through vegetative propagation and, to date, are responsible for a significant fraction of agriculturally important perennial plants. On the other hand, desirable traits in many important annual crops, such as rice, soybean, maize and wheat, have been introduced through classical genetic manipulations using directed breeding strategies. Once generated, annuals with good agronomic performance are usually maintained by inbreeding.</p>
            <p>In recent years, concern has grown over the presumed loss of genetic diversity resulting from the application of modern horticultural and breeding practices. Therefore, the benefit of excellent performance may come with a significant cost
                <sup>
                    <xref ref-type="bibr" rid="ref-6">6</xref>,
                    <xref ref-type="bibr" rid="ref-7">7</xref>
                </sup>. However, recent and surprising results suggest that even highly inbred species harbor unanticipated sources of intrinsic genetic variation. For example, highly inbred soybean cultivars have been shown to manifest significant phenotypic and genetic variation in the absence of sexual manipulation
                <sup>
                    <xref ref-type="bibr" rid="ref-8">8</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-10">10</xref>
                </sup>. Such high intrinsic genetic variation has also been demonstrated for a number of other crop plants
                <sup>
                    <xref ref-type="bibr" rid="ref-11">11</xref>
                </sup>.</p>
            <p>In the natural world, inbreeding occurs in many highly successful flowering plant species including wild relatives of 
                <italic toggle="yes">Arabidopsis thaliana</italic>
                <sup>
                    <xref ref-type="bibr" rid="ref-12">12</xref>
                </sup>. Therefore, in nature species that are highly inbred have persisted despite their predicted reduction in genetic diversity. Why would such inbreeding strategies be successful and what are the implications from an adaptive perspective? One possibility put forward by Barrett
                <sup>
                    <xref ref-type="bibr" rid="ref-13">13</xref>
                </sup> is that such populations are very successful in their particular niches and benefit from producing large numbers of genetically identical offspring. Nevertheless, selection should favor plant species that can co-evolve on time scales reflecting particular environmental challenges such as fluctuations and variations in pathogen populations. In keeping with this view, it has been shown that sequence variation in 20 diverse strains of Arabidopsis is highly non-random. In gene families mediating biotic interactions, such as those implicated in pathogen defense, variation far exceeds that seen in families involved in basic biological processes
                <sup>
                    <xref ref-type="bibr" rid="ref-14">14</xref>
                </sup>.</p>
            <p>The underlying mechanisms driving phenotypic variation in highly inbred lines, whether domesticated or wild, have often been inferred and have had limited experimental verification. Nevertheless, relatively simple molecular approaches have provided insight into some of the genomic events coinciding with visible changes in phenotype. In flax, for example, molecular assays have demonstrated that heritable phenotypic changes induced by environmental shifts are accompanied by reproducible changes in genomic DNA including changes in total DNA content, non-random changes in DNA sequences or sequence rearrangements
                <sup>
                    <xref ref-type="bibr" rid="ref-15">15</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-18">18</xref>
                </sup>. In soybean, reproducible non-random DNA sequence changes induced by 
                <italic toggle="yes">in vitro</italic> culturing of root explants have also been demonstrated using restriction fragment length polymorphic markers
                <sup>
                    <xref ref-type="bibr" rid="ref-19">19</xref>
                </sup>. Genomic changes manifesting similar hallmarks of biased sequence alterations have also been described for banana
                <sup>
                    <xref ref-type="bibr" rid="ref-20">20</xref>
                </sup> and in rice hybrids
                <sup>
                    <xref ref-type="bibr" rid="ref-21">21</xref>
                </sup>.</p>
            <p>In the work described by Roth 
                <italic toggle="yes">et al.</italic>
                <sup>
                    <xref ref-type="bibr" rid="ref-19">19</xref>
                </sup> soybean root explants were shown to repeatedly give rise to particular alleles that were absent in the donor plants but had previously been found and characterized in other varieties of cultivated soybean. To account for the appearance of these particular allelic variants the authors proposed that these organisms had evolved "internal generators of genetic variation" that mediated genome changes through some type of recombination process. In 2005, Lolle and colleagues
                <sup>
                    <xref ref-type="bibr" rid="ref-22">22</xref>
                </sup> described a genome-wide phenomenon in Arabidopsis 
                <italic toggle="yes">hothead</italic> (
                <italic toggle="yes">hth</italic>) mutants that was very reminiscent of that described by Roth 
                <italic toggle="yes">et al.</italic>
                <sup>
                    <xref ref-type="bibr" rid="ref-19">19</xref>
                </sup>. Based on the nature and genome-wide locations of the sequence changes detected, it was proposed that a template-directed process mediated these changes and that these cryptic but stable extra-genomic templates themselves had persisted since at least the grandparental generation. Not surprisingly, this proposal met with considerable skepticism and numerous alternative explanations for these data have since been published
                <sup>
                    <xref ref-type="bibr" rid="ref-23">23</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-28">28</xref>
                </sup>.</p>
            <p>In this study we have employed presence-absence molecular markers to test for non-Mendelian inheritance and found that Arabidopsis plants can inherit novel insertion sequences that were absent in their immediate parents. Furthermore, we show that discordant DNA-based marker profiles can be found between tissues isolated from different parts of an individual plant. These experiments demonstrate that individual plants spontaneously produce somatic sectors and are genetic mosaics. Since genetic variation can occur in the same plant in the absence of sexual reproduction, we propose that these novel insertion sequences must originate from cryptic reserves intrinsic to the host plant itself. The data presented support the original contention that a previously unknown template-directed mechanism exists
                <sup>
                    <xref ref-type="bibr" rid="ref-22">22</xref>
                </sup> and raise the encouraging possibility that other inbreeding species, including crop plants, may also harbor a cryptic reserve of genetic variation.</p>
        </sec>
        <sec sec-type="methods">
            <title>Methods</title>
            <sec>
                <title>Plant material and growth conditions</title>
                <p>All genetic stocks of 
                    <italic toggle="yes">Arabidopsis thaliana</italic> used for these experiments have been described previously
                    <sup>
                        <xref ref-type="bibr" rid="ref-29">29</xref>
                    </sup>. Arabidopsis seeds derived from these stocks were sown onto moistened potting mix (1:1 mixture of LC1:LG3 Sungro Sunshine potting mixes, Sungro Horticulture, Seba Beach, AB) and vernalized at 4&#x00b0;C for 2&#x2013;5 days. Plants were maintained in growth chambers (Econoair AC60, Ecological Chambers Inc., Winnipeg, MB; GC8-VH/GCB-B, Environmental Growth Chambers, Chagrin Falls, Ohio; Conviron PGW36/E15, Controlled Environments Ltd., Winnipeg, MB) and illuminated with a mixture of incandescent and fluorescent lights (140&#x2013;170&#x03bc;mol m
                    <sup>-2</sup> sec
                    <sup>-1</sup> at pot level) with a 24-hour photoperiod. Growth chambers were maintained at 20 &#x00b1; 4&#x00b0;C at 40&#x2013;60% relative humidity. Plants were grown in flats or in 3- or 6-inch pots and watered as needed. Seeds used for seedling root-shoot comparison were surface sterilized using bleach and plated on agar medium containing half strength MS basal salts (Sigma, St. Louis, USA). Seedlings were harvested approximately 5 days post-germination. Hybrid lines were generated between Landsberg and Columbia accessions by manual pollination and all crosses were done reciprocally. F2 seed was obtained from self-fertilized F1 plants. Individual F2 plants were reared in plastic tubes (Johnston Industrial Plastics, Ontario, Canada) and F3 seed collected from each F2 plant individually. Tissue samples were collected from individual F2 and F3 plants, and genotypic profiles were determined using insertion-deletion polymorphic molecular markers (see 
                    <xref ref-type="fig" rid="f1">Figure 1</xref>).</p>
                <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                    <label>Figure 1. </label>
                    <caption>
                        <title>Haploid representation of the 5 Arabidopsis chromosomes indicating the relative locations of the 16 insertion-deletion polymorphic markers used in this study.</title>
                        <p>Nine of the markers are intergenic (*). Marker names reflect clone designations. The size of the insertion sequence is indicated in base pairs (bp). The relative location of 
                            <italic toggle="yes">HOTHEAD</italic> (
                            <italic toggle="yes">HTH</italic>) is shown at the bottom of chromosome 1.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/752/0151474e-d7c7-4ae0-9528-62a770282145_figure1.gif"/>
                </fig>
            </sec>
            <sec>
                <title>Out-crossing experiments</title>
                <p>Experimental set ups were replicated twice and the net out-crossing frequencies determined. Herbicide-resistant transgenic Arabidopsis pollen donors previously transformed with the pCB302 mini binary vector only
                    <sup>
                        <xref ref-type="bibr" rid="ref-30">30</xref>
                    </sup> and mutant test plants were grown in a 1:1 ratio and arranged in randomized positions (
                    <ext-link ext-link-type="uri" xlink:href="http://www.random.org">www.random.org</ext-link>). Out-crossing frequencies were also compared to plants under the same conditions but reared within plastic tubes. Progeny were sprayed with glufosinate (40 micrograms ml
                    <sup>-1</sup> active ingredient: WipeOut, Nu-Gro IP Inc., Ontario) to test for herbicide resistance and resistant plants tested for segregation of 
                    <italic toggle="yes">hth</italic> mutant progeny plants.</p>
            </sec>
            <sec>
                <title>DNA extraction and molecular genotyping</title>
                <p>For DNA extraction, rosette or cauline leaf tissue was collected and DNA extracted according to the method of Edwards 
                    <italic toggle="yes">et al.</italic>
                    <sup>
                        <xref ref-type="bibr" rid="ref-31">31</xref>
                    </sup>. Samples not processed immediately were stored at -20&#x00b0;C. Sixteen sets of DNA oligonucleotide primers were designed to amplify approximately 150&#x2013;300bp genomic regions by polymerase chain reactions (PCR), each containing one 45&#x2013;94bp marker which is present in the Columbia but absent in the Landsberg accession (
                    <xref ref-type="table" rid="T1">Table 1</xref>). PCR amplicon products were size separated by agarose gel electrophoresis.</p>
                <table-wrap id="T1" orientation="portrait" position="anchor">
                    <label>Table 1. </label>
                    <caption>
                        <title>List of primer pairs used for PCR-based molecular genotyping.</title>
                        <p>Expected amplicon product sizes for the Columbia and Landsberg accessions are shown in adjacent columns.</p>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1">Insertion-deletion marker</th>
                                <th align="left" colspan="1" rowspan="1">Primer pairs</th>
                                <th align="left" colspan="1" rowspan="1">Columbia product size
                                    <break/>in base pairs</th>
                                <th align="left" colspan="1" rowspan="1">Landsberg product
                                    <break/>size in base pairs</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td colspan="1" rowspan="1">F12K11</td>
                                <td colspan="1" rowspan="1">ccatatcttggagttggcaga
                                    <break/>tgtcttcaggaacacaacca</td>
                                <td colspan="1" rowspan="1">166</td>
                                <td colspan="1" rowspan="1">121</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">F5J5</td>
                                <td colspan="1" rowspan="1">tgaagatttcgtggaagcaa
                                    <break/>ctcatggatgcctaataccg</td>
                                <td colspan="1" rowspan="1">275</td>
                                <td colspan="1" rowspan="1">200</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">F6D8</td>
                                <td colspan="1" rowspan="1">ctccgtcttccagagtttga
                                    <break/>ttcgggtgattagtacggaaa</td>
                                <td colspan="1" rowspan="1">211</td>
                                <td colspan="1" rowspan="1">107</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">F15H11</td>
                                <td colspan="1" rowspan="1">atttgcggctgaaagacaag
                                    <break/>tgagtgtgtcatgagtgtttgttt</td>
                                <td colspan="1" rowspan="1">229</td>
                                <td colspan="1" rowspan="1">153</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">F23M2</td>
                                <td colspan="1" rowspan="1">taaagttgttggccgaggag
                                    <break/>tcggagatacccgagctaaa</td>
                                <td colspan="1" rowspan="1">231</td>
                                <td colspan="1" rowspan="1">163</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">T14G11</td>
                                <td colspan="1" rowspan="1">cctatgtgtcaagagagatttcca
                                    <break/>tttgttccatttataagcgtttctc</td>
                                <td colspan="1" rowspan="1">286</td>
                                <td colspan="1" rowspan="1">213</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">T6A23</td>
                                <td colspan="1" rowspan="1">aacaccaagtcaactgtttttgtt
                                    <break/>tcaaaataaacacccccaact</td>
                                <td colspan="1" rowspan="1">241</td>
                                <td colspan="1" rowspan="1">180</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">T11I18</td>
                                <td colspan="1" rowspan="1">ccccaattcgaaatgtaagg
                                    <break/>cgctccttgacagttttcct</td>
                                <td colspan="1" rowspan="1">203</td>
                                <td colspan="1" rowspan="1">129</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">MSA6</td>
                                <td colspan="1" rowspan="1">ctggggtgttctcacaggat
                                    <break/>cgttggaggtggtcttaggt</td>
                                <td colspan="1" rowspan="1">199</td>
                                <td colspan="1" rowspan="1">145</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">T6H20</td>
                                <td colspan="1" rowspan="1">tgcattggtttctctgcttg
                                    <break/>gggaaacctccatactcgaa</td>
                                <td colspan="1" rowspan="1">231</td>
                                <td colspan="1" rowspan="1">154</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">F4C21</td>
                                <td colspan="1" rowspan="1">tggttagggttctggtcagg
                                    <break/>agtggctcatcgttcgagat</td>
                                <td colspan="1" rowspan="1">195</td>
                                <td colspan="1" rowspan="1">113</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">F16J13</td>
                                <td colspan="1" rowspan="1">gaagcatgttttgtgtatcttgc
                                    <break/>ccgcatctccacatttcatt</td>
                                <td colspan="1" rowspan="1">224</td>
                                <td colspan="1" rowspan="1">144</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">F8D20</td>
                                <td colspan="1" rowspan="1">caccagacggtgatgaagag
                                    <break/>cattcgcgcatttattgttg</td>
                                <td colspan="1" rowspan="1">202</td>
                                <td colspan="1" rowspan="1">117</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">F2P16</td>
                                <td colspan="1" rowspan="1">aaaatggtttaccacatggaca
                                    <break/>tcccaaatcaattcaaggaaa</td>
                                <td colspan="1" rowspan="1">223</td>
                                <td colspan="1" rowspan="1">175</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">MNJ8</td>
                                <td colspan="1" rowspan="1">catggatcaaagatgatctcca
                                    <break/>ttcgcttttcgtgtttctga</td>
                                <td colspan="1" rowspan="1">184</td>
                                <td colspan="1" rowspan="1">133</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">MGI19</td>
                                <td colspan="1" rowspan="1">tgcacatgacttcaacagaaaa
                                    <break/>atgtgggtgggtgttgattt</td>
                                <td colspan="1" rowspan="1">203</td>
                                <td colspan="1" rowspan="1">156</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
            </sec>
            <sec>
                <title>Isolation, cloning and sequencing of PCR products</title>
                <p>Portions of genomic DNA were PCR amplified and sequenced directly or products cloned into standard pGEM TA vectors (Promega). Amplified or cloned PCR products were sequenced at the Centre for Applied Genomics (
                    <ext-link ext-link-type="uri" xlink:href="http://www.tcag.ca/">http://www.tcag.ca/</ext-link>, Toronto, Ontario). Sequence alignments were generated using CLC Sequence Viewer 6.4 software (CLC bioA/S; 
                    <ext-link ext-link-type="uri" xlink:href="http://www.clcbio.com">www.clcbio.com</ext-link>).</p>
            </sec>
            <sec>
                <title>qPCR methods</title>
                <p>Quantitative PCR was performed on a Bio-Rad Real-Time thermal cycler CFX96 attached to a computer running CFX Manager. SsoFast EvaGreen Supermix (Bio-Rad) was used according to manufacturer&#x2019;s instructions. A series of primers either flanking or internal to the insertion sequences were used to generate control and experimental amplicons. The positive control was a PCR product amplified from the Columbia accession, spanning the indel sequence of interest by ~700&#x2013;900bp. The positive control was gel purified and used to generate a standard curve for conversion of C(t) value to copy number of the insertion sequence and the external reference sequence. External reference primers immediately flanked the indel markers. Insertion sequences were detected using one external reference primer paired with a primer homologous to sequences within the insertion itself. Primer sequences and amplicon product sizes are listed in 
                    <xref ref-type="table" rid="T2">Table 2</xref>. The colors indicated in the first column (insertion-deletion marker) correspond to the colors used for the qPCR-generated bar graphs.</p>
                <table-wrap id="T2" orientation="portrait" position="anchor">
                    <label>Table 2. </label>
                    <caption>
                        <title>List of primer sets used for qPCR analyses.</title>
                        <p>Primer positions, left and right primer sequences and expected amplicon sizes are indicated for each marker. Colors correspond to those used in 
                            <xref ref-type="fig" rid="f5">Figure 5B</xref> and 
                            <xref ref-type="fig" rid="f6">Figure 6B</xref>.</p>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Insertion-deletion marker</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Primer position</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Left primer sequence</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Right primer sequence</th>
                                <th align="left" colspan="1" rowspan="1">Product size in
                                    <break/>base pairs</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td colspan="1" rowspan="3" style="background-color:#FF0000" valign="middle">F6D8</td>
                                <td colspan="1" rowspan="1">Positive control</td>
                                <td colspan="1" rowspan="1">ctgaccagcaaattctcaagg</td>
                                <td colspan="1" rowspan="1">tgagcaggtgaaacagatgg</td>
                                <td colspan="1" rowspan="1">766</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">External reference</td>
                                <td colspan="1" rowspan="1">aagtttaaaacgaaaactttataaaatacc</td>
                                <td colspan="1" rowspan="1">tttcgtgttcgtggttttca</td>
                                <td colspan="1" rowspan="1">214</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">Within insertion</td>
                                <td colspan="1" rowspan="1">aaacaagtgcatgttgcg</td>
                                <td colspan="1" rowspan="1">tttcgtgttcgtggttttca</td>
                                <td colspan="1" rowspan="1">266</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="3" style="background-color:#FFFF00" valign="middle">F15H11</td>
                                <td colspan="1" rowspan="1">Positive control</td>
                                <td colspan="1" rowspan="1">ctccactaactcccgttattcc</td>
                                <td colspan="1" rowspan="1">gaacaatcgggccacatatag</td>
                                <td colspan="1" rowspan="1">701</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">External reference</td>
                                <td colspan="1" rowspan="1">tttcgtcacttttcaaaactaac</td>
                                <td colspan="1" rowspan="1">gtgtgtgtgtgtgtgtgtgctc</td>
                                <td colspan="1" rowspan="1">151</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">Within insertion</td>
                                <td colspan="1" rowspan="1">tgatgattttggattgaacgtc</td>
                                <td colspan="1" rowspan="1">gtgtgtgtgtgtgtgtgtgctc</td>
                                <td colspan="1" rowspan="1">201</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="3" style="background-color:#3366FF" valign="middle">T14G11</td>
                                <td colspan="1" rowspan="1">Positive control</td>
                                <td colspan="1" rowspan="1">gagttgtgttccagggccta</td>
                                <td colspan="1" rowspan="1">tttgttgtgcgaattcattg</td>
                                <td colspan="1" rowspan="1">897</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">External reference</td>
                                <td colspan="1" rowspan="1">cacaaaaattaaggaataataaatgttctc</td>
                                <td colspan="1" rowspan="1">tttgttccatttataagcgtttctc</td>
                                <td colspan="1" rowspan="1">143</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">Within insertion</td>
                                <td colspan="1" rowspan="1">ttgtcccattttatttgatgtttg</td>
                                <td colspan="1" rowspan="1">tttgttccatttataagcgtttctc</td>
                                <td colspan="1" rowspan="1">176</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="3" style="background-color:#008000" valign="middle">T6H20</td>
                                <td colspan="1" rowspan="1">Positive control</td>
                                <td colspan="1" rowspan="1">tttcctgtttgggatctgag</td>
                                <td colspan="1" rowspan="1">tcaggagatagtccaccatgc</td>
                                <td colspan="1" rowspan="1">839</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">External reference</td>
                                <td colspan="1" rowspan="1">tgggcttaccctgttcatggag</td>
                                <td colspan="1" rowspan="1">gcagagaaaccaatgcattttca</td>
                                <td colspan="1" rowspan="1">151</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">Within insertion</td>
                                <td colspan="1" rowspan="1">tgggcttaccctgttcatggag</td>
                                <td colspan="1" rowspan="1">ccagaaaccgagtctctaagatttca</td>
                                <td colspan="1" rowspan="1">259</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="3" style="background-color:#FF6FCF" valign="middle">MGI19</td>
                                <td colspan="1" rowspan="1">Positive control</td>
                                <td colspan="1" rowspan="1">atatgcttgtcagtgagggaag</td>
                                <td colspan="1" rowspan="1">gaattcgacaggagcgtgaag</td>
                                <td colspan="1" rowspan="1">800</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">External reference</td>
                                <td colspan="1" rowspan="1">gaacaatttgtggaaaaatggaa</td>
                                <td colspan="1" rowspan="1">cctagtttcatgtgcatatatgtc</td>
                                <td colspan="1" rowspan="1">181</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">Within insertion</td>
                                <td colspan="1" rowspan="1">gaacaatttgtggaaaaatggaa</td>
                                <td colspan="1" rowspan="1">tgacatgtactcaccgcaatg</td>
                                <td colspan="1" rowspan="1">212</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
            </sec>
        </sec>
        <sec sec-type="results">
            <title>Results</title>
            <sec>
                <title>Mutant 
                    <italic toggle="yes">hth</italic> plants are susceptible to higher rates of out-crossing</title>
                <p>Homozygous 
                    <italic toggle="yes">hth</italic> mutant Arabidopsis plants were previously shown to give rise to wild type (wt) progeny at relatively high frequencies
                    <sup>
                        <xref ref-type="bibr" rid="ref-22">22</xref>,
                        <xref ref-type="bibr" rid="ref-29">29</xref>
                    </sup>. Although an intrinsic mechanism was proposed
                    <sup>
                        <xref ref-type="bibr" rid="ref-22">22</xref>
                    </sup>, cross-pollination with neighboring plants was subsequently put forward as the more likely explanation for the appearance of these wt revertant offspring
                    <sup>
                        <xref ref-type="bibr" rid="ref-26">26</xref>,
                        <xref ref-type="bibr" rid="ref-27">27</xref>
                    </sup>. To test the susceptibility of 
                    <italic toggle="yes">hth</italic> plants to out-crossing under our growth conditions, experiments were conducted using a pollen donor harboring a dominant gene conferring resistance to the herbicide glufosinate. Herbicide-resistant transgenic lines were grown together with 
                    <italic toggle="yes">hth</italic> and 
                    <italic toggle="yes">eceriferum-10 (cer-10)</italic>
                    <sup>
                        <xref ref-type="bibr" rid="ref-32">32</xref>
                    </sup> floral fusion mutants and wt Landsberg plants. These analyses confirmed that the majority of 
                    <italic toggle="yes">hth</italic> mutant plants did not cross-pollinate. However, when cross-pollination was detected, frequencies varied considerably between individual 
                    <italic toggle="yes">hth</italic> mutant plants. Mutants with floral fusion phenotypes were predisposed to higher pollen capture than wild type plants (0.02&#x2013;0.43% for 
                    <italic toggle="yes">hth-4, 8 and 10</italic> mutants, 0.89% for 
                    <italic toggle="yes">cer10</italic> mutants, 0.01% for wt plants). In addition, factors such as donor-recipient proximity, the severity of the floral fusion phenotype, growth chamber airflow patterns and plant handling influenced the propensity to cross-pollinate. Nevertheless, growing 
                    <italic toggle="yes">hth</italic> mutant F2 plants in the complete absence of 
                    <italic toggle="yes">HTH</italic> pollen donors did not eliminate wt progeny from F3 progeny pools and, on average, 1.53% of F3 progeny were phenotypically wt for 
                    <italic toggle="yes">HTH</italic> despite being derived from self-fertilized homozygous F2 
                    <italic toggle="yes">hth</italic> mutant parent plants (2/133 
                    <italic toggle="yes">hth-4</italic>, 2/131 
                    <italic toggle="yes">hth-8</italic> and 2/127 
                    <italic toggle="yes">hth-10</italic> gave rise to wt F3 progeny). Under our laboratory conditions, out-crossing could not be completely eliminated within 
                    <italic toggle="yes">hth</italic> mutant populations if mutants were grown together with wt plants, even if every 
                    <italic toggle="yes">hth</italic> mutant plant was shielded in transparent plastic tubes.</p>
                <p>While conducting segregation analyses and scoring offspring for herbicide resistance, a single 
                    <italic toggle="yes">hth</italic> mutant plant with a large phenotypically wt floral sector was identified (
                    <xref ref-type="fig" rid="f2">Figure 2</xref>). Sampling of shoot tissues confirmed that phenotype corresponded to genotype and that both mutant 
                    <italic toggle="yes">hth-4</italic> and wt 
                    <italic toggle="yes">HTH</italic> alleles could be detected in tissue derived from this large wt sector (
                    <xref ref-type="fig" rid="f2">Figure 2B</xref>).</p>
                <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                    <label>Figure 2. </label>
                    <caption>
                        <title>Molecular analysis of a mutant 
                            <italic toggle="yes">hth-4</italic> plant showing a large wt sector.</title>
                        <p>(
                            <bold>A</bold>) Two mutant branches (white boxes) flank a phenotypically wt flower branch (magenta box). Examples of normal wt (
                            <italic toggle="yes">HTH/HTH</italic>) and mutant (
                            <italic toggle="yes">hth/hth</italic>) flowers are shown on the right. (
                            <bold>B</bold>) DNA was extracted from tissue samples and allele-specific PCR-based molecular markers used to determine genotype. The wt branch scored as heterozygous (
                            <italic toggle="yes">hth-4/HTH-4</italic>), while mutant branches scored as homozygous for the 
                            <italic toggle="yes">hth-4</italic> allele.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/752/0151474e-d7c7-4ae0-9528-62a770282145_figure2.gif"/>
                </fig>
                <p>The identification of this sectored individual provided the first phenotypic evidence that 
                    <italic toggle="yes">hth</italic> plants were capable of producing somatic sectors. This finding suggested that perhaps some of the wt revertants originally found among 
                    <italic toggle="yes">hth</italic> mutant progeny might have arisen from genetically heterozygous sectors on the parent plant
                    <sup>
                        <xref ref-type="bibr" rid="ref-22">22</xref>
                    </sup>. Since well over 300,000 mutant plants were screened in the course of our out-crossing experiments and only one plant with a very large phenotypically wt sector found such as that shown in 
                    <xref ref-type="fig" rid="f2">Figure 2B</xref>, we reasoned that if sectoring does occur, the vast majority of sectors would be too small to result in a visible phenotype. This possibility prompted us to test whether novel genotypes could be detected in tissue samples obtained from single 
                    <italic toggle="yes">hth</italic> plants.</p>
            </sec>
            <sec>
                <title>Single plants can have multiple genotypes</title>
                <p>For these experiments we chose to focus exclusively on molecular markers consisting of genomic DNA sequence tracts between 45&#x2013;94 nucleotides in length that are either present or absent in the Columbia and Landsberg Arabidopsis accessions (insertion-deletion polymorphic markers or indels; 
                    <xref ref-type="fig" rid="f1">Figure 1</xref>). In choosing to use indel markers we reasoned that deletions would be recalcitrant to enzyme repair or modification and therefore would help differentiate between enzyme-based mechanisms such as the one put forth by Comai and Cartwright
                    <sup>
                        <xref ref-type="bibr" rid="ref-24">24</xref>
                    </sup> and a template-directed mechanism like the one previously proposed
                    <sup>
                        <xref ref-type="bibr" rid="ref-22">22</xref>
                    </sup>. Hybrid lines were constructed between Columbia and Landsberg accessions and descendants used as experimental material. For all of the indel markers used in this study, Columbia is homozygous for the insertion.</p>
                <p>Initially, F3 seed progeny derived from hybrid F2 parent lines with known indel marker profiles were screened to test whether or not these markers were stable. All F2 parent plants were reared in plastic tubes. When marker profiles were compared between 
                    <italic toggle="yes">hth-4</italic> parent plants and their F3 adult offspring, 2.16% [6/277] deviated from the expected profile. This frequency is approximately 5 times higher than baseline rates (0.02&#x2013;0.43%) seen in outcrossing experiments described above. When F3 progeny were assayed as seedlings, similar frequencies were seen, with 2.5% [15/600] of the F3 seedlings showing discordant marker profiles. Altogether 600 seedlings were tested using a total of 30 seedlings per F2 plant (eleven 
                    <italic toggle="yes">hth-4</italic>, five 
                    <italic toggle="yes">hth-7</italic>, two 
                    <italic toggle="yes">hth-8</italic> and two 
                    <italic toggle="yes">hth-10</italic> F2 plants). Of the 15 F3 seedlings that tested positive for at least one non-parental marker, 7 had acquired insertions.</p>
                <p>To test whether the observed genetic discordance between parent and offspring was due to sectoring, multiple tissue samples were collected from individual adult plants and indel marker profiles compared between these different samples. Molecular analyses confirmed that some tissue samples taken from individual 
                    <italic toggle="yes">hth</italic> mutant plants had novel marker profiles. For the plant shown in 
                    <xref ref-type="fig" rid="f3">Figure 3A</xref>, seven out of eight samples scored as expected and were homozygous for the Landsberg deletion marker, however, one sample produced two amplicon products, one of which co-migrated with the Landsberg deletion allele and a larger amplicon that co-migrated with Columbia insertion allele.</p>
                <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                    <label>Figure 3. </label>
                    <caption>
                        <title>Molecular analysis of an adult mutant plant and bisected mutant and wt seedlings.</title>
                        <p>(
                            <bold>A</bold>) DNA was extracted from multiple tissue samples and PCR-amplified using F8D20 primers. A novel PCR amplicon product corresponding in size to the insertion allele (C) was detected in 
                            <italic toggle="yes">hth-7</italic> tissue sample 3 (arrow). (
                            <bold>B</bold>) Sterile seeds were sown onto petri plates (top left) and 5-day old seedlings cut at the root-shoot junction (illustrated in the top right panel) and genotyped individually. DNA extracted from shoot (S) and root (R) samples derived from individual 
                            <italic toggle="yes">hth-3</italic> or wt seedlings were PCR-amplified using F12K11 and F4C21 primers, respectively. Samples were loaded in pairs (indicated by horizontal bars). Novel amplicon bands were detected in five seedling samples (arrows) that correspond in size to the insertion allele (C). In one 
                            <italic toggle="yes">hth-3</italic> sample, both organs (S, R) had a novel band, while a novel amplicon was detected only in the root in a second sample. In three cases, DNA extracted from wt seedlings gave rise to novel bands corresponding in size to the insertion allele (C) (arrows, S). In both cases, the parent plant was homozygous for the deletion allele (L) at the corresponding marker. Heterozygote (H), no DNA control sample (ND).</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/752/0151474e-d7c7-4ae0-9528-62a770282145_figure3.gif"/>
                </fig>
                <p>To test whether sectors could be detected earlier in development, the molecular genotype of shoots and roots of single seedlings grown under sterile conditions were compared to one another. On the assumption that wild type plants would not produce sectors, identical tests were also conducted on wt hybrid lines as negative controls. In the majority of cases, as expected, there was a perfect correspondence between the molecular profiles of root and shoot. However, in some cases, individual seedlings were found to have molecular signatures that differed between the two organ systems (10/44 
                    <italic toggle="yes">hth-3</italic>; 1/50 
                    <italic toggle="yes">hth-4</italic>; 9/76 
                    <italic toggle="yes">hth-7</italic>; 
                    <xref ref-type="fig" rid="f3">Figure 3B</xref>). Surprisingly, wt hybrid seedlings also showed novel genotypes when roots and shoots from the same seedling were compared (10/184 wt hybrids; 
                    <xref ref-type="fig" rid="f3">Figure 3B</xref>).</p>
            </sec>
            <sec>
                <title>Markers are discordant with parental DNA sequences</title>
                <p>A subset of amplicon samples were subjected to DNA sequence analyses in order to determine their molecular features. Sequence analyses of DNA clones derived from individuals where the non-parental amplicon co-migrated with the smaller deletion allele showed identity with the Landsberg deletion marker (
                    <xref ref-type="fig" rid="f4">Figure 4</xref>). In two instances, polymorphisms immediately upstream of the deletion were also detected (
                    <xref ref-type="fig" rid="f4">Figure 4A</xref>). As indicated, the Landsberg accession differs from Columbia at these exact three nucleotides. DNA sequence analysis of novel amplicons that co-migrated with the larger insertion allele showed that this seedling shoot had acquired a 54-nucleotide insertion that shares identity with the Columbia reference genome (
                    <xref ref-type="fig" rid="f4">Figure 4B</xref>). This same insertion was absent in the F2 parent plant. These particular seedlings descended from the same wt hybrid parent plant as the F3 progeny whose profiles are shown in 
                    <xref ref-type="fig" rid="f3">Figure 3B</xref>.</p>
                <fig fig-type="figure" id="f4" orientation="portrait" position="float">
                    <label>Figure 4. </label>
                    <caption>
                        <title>DNA sequence alignments showing F8D20 and MSA6 indel loci.</title>
                        <p>(
                            <bold>A</bold>) The F2 
                            <italic toggle="yes">hth-3</italic> parent (F2 
                            <italic toggle="yes">hth</italic>) shares sequence identity with 2 of 3 DNA clones isolated from this single 
                            <italic toggle="yes">hth-3</italic> seedling (F3 R2 and F3 S1). DNA sequence data obtained from a root clone (F3 R1) shares identity with the Landsberg sequence (Ler), including 3 flanking sequence polymorphisms (arrows) and a corresponding 85 base-pair deletion. The Columbia reference sequence (Col) is shown on the top line of the alignment. (
                            <bold>B</bold>) The 
                            <italic toggle="yes">HTH</italic> wt hybrid parent (F2 wt) shares sequence identity with 2 of 3 DNA clones isolated from this single seedling (F3 S2 and F3 R1). DNA sequence data obtained from one shoot clone (F3 S1), however, reveals a 54 base-pair insertion sequence (junctions shown by arrows) and shares identity with the Columbia reference sequence (Col).</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/752/0151474e-d7c7-4ae0-9528-62a770282145_figure4.gif"/>
                </fig>
            </sec>
            <sec>
                <title>Sectors have complex genotypes</title>
                <p>To obtain an estimate of sector size, tissue samples were subjected to quantitative assays where the copy number of a genomic reference sequence immediately flanking the marker of interest was compared to the copy number of a sequence internal to that particular insertion marker (
                    <xref ref-type="fig" rid="f5">Figure 5</xref> and 
                    <xref ref-type="fig" rid="f6">Figure 6</xref>). Hybrid plants verified to be homozygous for a deletion at specific indel markers were subjected to the quantitative assays. The quantitative polymerase chain reaction (qPCR) data reveal two remarkable findings. First, the majority of tissue samples collected from individual 
                    <italic toggle="yes">hth</italic> mutant plants tested positive for the presence of at least one insertion marker (
                    <xref ref-type="fig" rid="f5">Figure 5</xref>). In addition, multiple insertion sequences could be detected in many of the tissue samples tested (
                    <xref ref-type="fig" rid="f5">Figure 5B</xref>). In most instances the copy number of any given insertion sequence, relative to the reference, was very low (less than one copy per 1000). Second, wt hybrid plants also showed evidence of sectors with novel genotypes (
                    <xref ref-type="fig" rid="f6">Figure 6</xref>). Only two out of four wt plants tested, however, showed evidence of novel insertions.</p>
                <fig fig-type="figure" id="f5" orientation="portrait" position="float">
                    <label>Figure 5. </label>
                    <caption>
                        <title>Relative genomic copy number of insertion sequences in a 
                            <italic toggle="yes">hth-7</italic> mutant plant.</title>
                        <p>(
                            <bold>A</bold>) DNA was extracted from branches 1&#x2013;7 of this 
                            <italic toggle="yes">hth-7</italic> mutant plant and amplified using qPCR or standard PCR reactions. (
                            <bold>B</bold>) Graphical representation of qPCR results using four different indel markers (F6D8 (red), F15H11 (yellow), T14G11 (blue), and T6H20 (green)). Colored bars show the number of insertion sequences per 1000 copies of the reference sequence (lines indicate standard error of the mean, n=3). All 7 samples showed novel insertion sequences. (
                            <bold>C</bold>) Standard PCR-amplification using T6H20 primers showed amplicons that corresponded exclusively to the deletion allele (L). Primer positions (arrows) relative to the T6H20 indel (green box) are depicted to the right of the gel image. (
                            <bold>D</bold>) Pooled amplicon product from T6H20 reference primers demonstrate that this region was amplified equally in all samples, as was the positive control (+). The reference sequence is upstream of the T6H20 insertion marker, as depicted on the right. (
                            <bold>E</bold>) Quantitative PCR using a primer anchored within the T6H20 indel gave rise to amplicons that corresponded in size to the positive control (+). No product was amplified from sample six. T6H20 indel (green box), Columbia (C), Landsberg (L), heterozygote (H), no DNA control sample (ND).</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/752/0151474e-d7c7-4ae0-9528-62a770282145_figure5.gif"/>
                </fig>
                <p id="B1">
                    <media content-type="figshare" orientation="portrait" position="float" xlink:href="http://dx.doi.org/10.6084/m9.figshare.104576"/>
                </p>
                <p id="B2">
                    <media content-type="figshare" orientation="portrait" position="float" xlink:href="http://dx.doi.org/10.6084/m9.figshare.104577"/>
                </p>
                <p id="B3">
                    <media content-type="figshare" orientation="portrait" position="float" xlink:href="http://dx.doi.org/10.6084/m9.figshare.104578"/>
                </p>
                <p id="B4">
                    <media content-type="figshare" orientation="portrait" position="float" xlink:href="http://dx.doi.org/10.6084/m9.figshare.104579"/>
                </p>
                <p id="B5">
                    <media content-type="figshare" orientation="portrait" position="float" xlink:href="http://dx.doi.org/10.6084/m9.figshare.104580"/>
                </p>
                <fig fig-type="figure" id="f6" orientation="portrait" position="float">
                    <label>Figure 6. </label>
                    <caption>
                        <title>Relative genomic copy number of insertion sequences in two wild type plants.</title>
                        <p>(
                            <bold>A</bold>) DNA was extracted from branches 1&#x2013;5 of two wt hybrid plants (9B and 10B) and amplified using qPCR. (
                            <bold>B</bold>) Graphical representation of qPCR results using three different indel markers ((F15H11 (yellow), T14G11 (blue), and MGI19 (pink)). Colored bars show the number of insertion sequences per 1000 copies of the reference sequence (lines indicate standard error of the mean, n=3). Novel insertion sequences could be detected in all 10 samples.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/752/0151474e-d7c7-4ae0-9528-62a770282145_figure6.gif"/>
                </fig>
                <p id="B6">
                    <media content-type="figshare" orientation="portrait" position="float" xlink:href="http://dx.doi.org/10.6084/m9.figshare.104581"/>
                </p>
                <p id="B7">
                    <media content-type="figshare" orientation="portrait" position="float" xlink:href="http://dx.doi.org/10.6084/m9.figshare.104582"/>
                </p>
                <p id="B8">
                    <media content-type="figshare" orientation="portrait" position="float" xlink:href="http://dx.doi.org/10.6084/m9.figshare.104583"/>
                </p>
            </sec>
        </sec>
        <sec sec-type="discussion">
            <title>Discussion</title>
            <p>By employing classical genetic approaches in conjunction with low and high-resolution molecular methods, we show that one Arabidopsis plant can have multiple genotypes. We have found instances of intra-organismal variation in different genetic backgrounds, in plants reared in different growth chambers, at different developmental stages and under sterile growth conditions. Furthermore, the incidence of sectoring and genetic discordance appears to be in some way conditioned by the 
                <italic toggle="yes">hth</italic> mutant background as we found a consistently higher frequency of genetic discordance within single 
                <italic toggle="yes">hth</italic> plants as compared to 
                <italic toggle="yes">HTH</italic> wt plants. This was also true for shoot and root systems compared between aseptically grown seedlings and for tissue samples taken from adult plants and subjected to qPCR. Of critical importance, in showing that single Arabidopsis plants are genetic mosaics, experimental error due to cross-pollination and seed contamination can be completely discounted. To the best of our knowledge, this is the first report that documents the spontaneous but targeted appearance of unique genomic insertions at multiple discreet loci in single plants.</p>
            <p>Only two other cases of spontaneous genomic insertions have been reported in plants that similarly could not be explained by any previously known mechanism. In both cases the insertion was non-random and targeted a specific locus. In the case of flax, the insertion sequence was 5.7 kilobase pairs in size
                <sup>
                    <xref ref-type="bibr" rid="ref-16">16</xref>
                </sup> while in rice the insertion was comparatively small, being only 34 base pairs in size
                <sup>
                    <xref ref-type="bibr" rid="ref-33">33</xref>
                </sup>. Our data suggest that these reported cases of spontaneous genomic insertion events, like the sequence changes reported here, occur by a process intrinsic to the plant. As before, we propose the possibility that Arabidopsis plants harbor a cryptic store of sequence templates that can overwrite the parentally contributed genomes by a template-directed mechanism
                <sup>
                    <xref ref-type="bibr" rid="ref-22">22</xref>
                </sup>.</p>
            <p>If intrinsic drivers of genetic variation exist in inbreeding plant species, have additional incidents of cryptic genetic variation been documented in other systems? We believe that in soybean and cauliflower such events have indeed been reported and presented as cases of enigmatic phenotypic variation
                <sup>
                    <xref ref-type="bibr" rid="ref-8">8</xref>,
                    <xref ref-type="bibr" rid="ref-9">9</xref>,
                    <xref ref-type="bibr" rid="ref-34">34</xref>
                </sup>. In other studies, molecular data have been featured. Again in flax, for example, molecular assays have demonstrated that heritable phenotypic changes induced by environmental shifts are accompanied by reproducible locus-specific copy number changes in genomic DNA
                <sup>
                    <xref ref-type="bibr" rid="ref-16">16</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-18">18</xref>
                </sup>. In soybean, reproducible non-random changes in restriction length polymorphic markers induced by 
                <italic toggle="yes">in vitro</italic>
                <sup>
                    <xref ref-type="bibr" rid="ref-35">35</xref>,
                    <xref ref-type="bibr" rid="ref-36">36</xref>
                </sup> culturing of root explants have also been documented
                <sup>
                    <xref ref-type="bibr" rid="ref-19">19</xref>
                </sup>. Genomic changes manifesting similar hallmarks of biased sequence alterations have also been described in rice
                <sup>
                    <xref ref-type="bibr" rid="ref-21">21</xref>,
                    <xref ref-type="bibr" rid="ref-33">33</xref>
                </sup> and corn
                <sup>
                    <xref ref-type="bibr" rid="ref-37">37</xref>
                </sup> hybrids, as well as in Arabidopsis
                <sup>
                    <xref ref-type="bibr" rid="ref-38">38</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-40">40</xref>
                </sup>.</p>
            <p>In long-lived arborescent plants, intra-organism genetic variation has been demonstrated in a variety of systems
                <sup>
                    <xref ref-type="bibr" rid="ref-3">3</xref>,
                    <xref ref-type="bibr" rid="ref-36">36</xref>,
                    <xref ref-type="bibr" rid="ref-41">41</xref>
                </sup>. The fitness benefits have also been validated using models that test whether the production of genetically divergent modules is an effective strategy for achieving adaptive co-evolution with organisms that feed on or infect the plant
                <sup>
                    <xref ref-type="bibr" rid="ref-35">35</xref>,
                    <xref ref-type="bibr" rid="ref-42">42</xref>,
                    <xref ref-type="bibr" rid="ref-43">43</xref>
                </sup>. Models testing fitness benefits of module-level selection show that this is an effective strategy for achieving adaptive co-evolution between long-lived trees and short-lived herbivores when individual tree branches diverge genetically
                <sup>
                    <xref ref-type="bibr" rid="ref-35">35</xref>
                </sup>. Furthermore, this held true across a range of assumptions, even when reproduction was predominantly asexual. However, the fitness benefits were only fully realized for sufficiently long-lived trees that experienced strong selection
                <sup>
                    <xref ref-type="bibr" rid="ref-35">35</xref>
                </sup>. This fitness paradox is not exclusive to plants but also is relevant to organisms outside of the plant kingdom that have remained evolutionarily robust even though reproduction is predominantly asexual
                <sup>
                    <xref ref-type="bibr" rid="ref-43">43</xref>
                </sup>.</p>
            <p>For a short-lived organism such as Arabidopsis, what adaptive value would within-organism genetic variation have? One possibility is that this heterogeneity offsets the predicted decline in genetic variation that should result from inbreeding. Plant development is open-ended and reiterative, allowing for the continuous output of repetitive units or modules that function to support the growth and reproduction of the individual. When combined with developmental plasticity and the absence of a sequestered germ line, modular development may actually drive plants toward becoming genetically heterogeneous
                <sup>
                    <xref ref-type="bibr" rid="ref-41">41</xref>,
                    <xref ref-type="bibr" rid="ref-43">43</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-45">45</xref>
                </sup>. As posited by Whitham and Slobodchikoff
                <sup>
                    <xref ref-type="bibr" rid="ref-3">3</xref>
                </sup>, somatic sector formation permits the introduction of genetic variants into the gene pool either through vegetative propagation or through sexual reproduction. As these authors point out, germ line cells are derived from somatic tissues that arise late in the developmental history of the plant and therefore somatic mutations are more likely to introduce genetic variation than mutations that arise in the gametes
                <sup>
                    <xref ref-type="bibr" rid="ref-3">3</xref>,
                    <xref ref-type="bibr" rid="ref-4">4</xref>,
                    <xref ref-type="bibr" rid="ref-46">46</xref>
                </sup>. By expanding the window of tolerance for genetic variation, plants may be afforded a better adaptive strategy given lifestyle constraints. The versatility of modular development combined with tolerance for genetic variation may allow plants to adapt at rates tailored to pathogen life cycles
                <sup>
                    <xref ref-type="bibr" rid="ref-1">1</xref>
                </sup> or to relatively expanded time scales, such as those affecting climate change. Even though self-fertilization is thought to have evolved approximately one million years ago
                <sup>
                    <xref ref-type="bibr" rid="ref-12">12</xref>
                </sup>, Arabidopsis plants have not suffered the consequential genetic erosion but have continued to thrive.</p>
            <p>In addition to benefiting from a natural tendency toward genetic heterogeneity, the plant genome itself is thought to buffer the cost of having limited genetic diversity. In wild relatives of Arabidopsis the genome is thought to be highly dynamic and to respond to changes in environmental conditions or other extrinsic factors
                <sup>
                    <xref ref-type="bibr" rid="ref-42">42</xref>,
                    <xref ref-type="bibr" rid="ref-47">47</xref>
                </sup>. Genome responses include elevated rates of homologous recombination that persist for multiple generations
                <sup>
                    <xref ref-type="bibr" rid="ref-48">48</xref>
                </sup>, changes in copy number
                <sup>
                    <xref ref-type="bibr" rid="ref-49">49</xref>
                </sup> and modulation of epigenetic gene regulation
                <sup>
                    <xref ref-type="bibr" rid="ref-50">50</xref>
                </sup>. Pervasive genetic buffering
                <sup>
                    <xref ref-type="bibr" rid="ref-46">46</xref>,
                    <xref ref-type="bibr" rid="ref-51">51</xref>
                </sup> ensures that phenotypes with potentially deleterious consequences are attenuated. In addition to the genome responses listed above, our findings suggest that an intrinsic source of genetic variation can be leveraged to enhance the diversity in genetic output achieved by Arabidopsis plants.</p>
            <p>In considering alternate template-dependent mechanisms, such as gene conversion or homologous recombination, none can account for the 
                <italic toggle="yes">de novo</italic> appearance of unique sequence insertions. Nevertheless, it is possible that the insertion or deletion of small DNA sequence tracts, as described here, could reflect the activity of transposable elements
                <sup>
                    <xref ref-type="bibr" rid="ref-52">52</xref>,
                    <xref ref-type="bibr" rid="ref-53">53</xref>
                </sup>. However, numerous lines of evidence argue against this possibility. For instance, when novel amplicons were detected, they co-migrated with their corresponding insertion or deletion allele and did not show size heterogeneity, as would have been expected for transposon-driven excision or insertion events. Sequence data confirm that deletion events reproducibly eliminate a fixed length of sequence while insertion events reproducibly introduce a fixed sequence tract and both events repeatedly target precise genomic sites. Insertion and deletion events do not appear to produce obvious junction sites with altered nucleotides. Similarly, insertion events introduce sequences that share identity with the Columbia reference genome and do not appear to be chimeric gene or genome fragments. Furthermore, transposable element-mediated events cannot account for the fact that these insertion sequences appear to be generated 
                <italic toggle="yes">de novo</italic> since no comparable conserved region of homology exists elsewhere in the host genome, as demonstrated by our qPCR data. Lastly, as determined by DNA database searches, none of the indel markers used in this study share significant sequence homology with annotated Arabidopsis transposable elements.</p>
            <p>If the genome of an intensely studied model organism such as Arabidopsis is subject to modification by the template-directed mechanism we propose, why has this phenomenon not been described previously? Our research shows that target choice and methodological approach are critical in differentiating these genomic events from other processes that also modify DNA sequences. Based on our findings, the only genomic targets that are truly diagnostic of this phenomenon are deletions. To the best of our knowledge, deletion alleles have been used in genetic studies precisely because they are known to be stable and not to revert but have not been used to study phenomena related to epigenetic inheritance. There is no generalized precedent for genetic instability of deletions and assuming otherwise would go against an established biological paradigm. Polymorphic molecular markers such as single nucleotides, simple sequence repeats, or insertions that are subject to alterations by other processes will not provide sufficient resolution to differentiate mechanism, even though they are also likely targets for this process. In particular, our findings may explain why genome sequencing efforts have failed to register these sequence deviations or, if detected, why they may have been attributed to sequencing error and eliminated during curation. One possibility that immediately emerges from this prediction is that raw sequence data contained in existing genome database archives may already contain evidence of extra-genomic sequence information, revealed by features such as highly biased loci-specific "errors".</p>
            <p>Collectively, our genetic and molecular data show that many, and perhaps most, insertion events occur somatically in both seedlings and adult plants. Sectoring may therefore be a constitutive process that takes place throughout development but may be limited such that, at any given time, only a few cells host these genetic changes. Importantly, this may explain why sequence changes seen in revertant 
                <italic toggle="yes">hth</italic> progeny have rarely been found to affect both alleles. Although sexual transmission of non-parental markers clearly does occur
                <sup>
                    <xref ref-type="bibr" rid="ref-22">22</xref>
                </sup>, the fact that we have not found 
                <italic toggle="yes">HTH/HTH</italic> progeny among seed-derived offspring suggests that sectors populating the gamete forming lineages are unstable or very rare. The qPCR data are consistent with this supposition. However, it is also possible that mechanistic differences exist between somatic and germ line tissues or that insertion events remain dynamic, limiting sexually transmitted changes to those that stabilize. It is also possible that certain genetic backgrounds condition this process as suggested by the greater number of events detected in 
                <italic toggle="yes">hth</italic> mutants.</p>
            <p>In addition to validating our genetic and molecular data, the qPCR results extend those findings and suggest that the genetic make up of individuals can be surprisingly complex. Our data show that each plant can produce multiple discreet sectors, at many different growing points and each with unique marker profiles. This finding implies that sectoring may be a relatively common occurrence, even in wt genetic backgrounds. Since the adult plants used for these experiments were left largely intact and only a small proportion of the plant sampled, many more sectors may have been present than quantified. As such, it is possible that our current census underestimates the frequency with which these smaller islands of genetic variation arise. Although sectors are more readily detected using qPCR, this method cannot distinguish, for example, between copy number variation within a small cluster of cells versus multiple cells that remain strictly diploid and are clonally related. Similarly, it is not possible to distinguish whether one sector hosts the full complement of genetic sequence changes, whether independent events occur in multiple discreet sectors, or if sectors overlap. Visualization of sectors in living tissue or tissue sections should help distinguish between these possibilities.</p>
            <p>In addition to models demonstrating the fitness benefits of module-level selection
                <sup>
                    <xref ref-type="bibr" rid="ref-35">35</xref>
                </sup>, computational models provide surprisingly strong support for an ancestrally based "error-correcting" mechanism such as the one we propose to exist in Arabidopsis plants
                <sup>
                    <xref ref-type="bibr" rid="ref-54">54</xref>
                </sup>. In these constrained-optimization simulations, the evolutionary benefit of "genetic repair" strategies was compared between populations that access repair templates derived either from parents, grandparents or great-grandparents. Interestingly, a grandparent- or great grandparent-based genetic repair strategy is strongly favored over parental repair strategies. Furthermore, simulation results show that using a randomly selected template consistently gave superior results to those achieved using templates from the fittest parent or grandparent. From a biological perspective, such a strategy has considerable merit. Retaining a cache of templates derived from grandparental lineages would guarantee greater allele diversity precisely because the reservoir of allele variants would be deeper and allele redundancy would be less likely to occur. Random selection of templates would be the most parsimonious strategy to affect genome repair, again because it would promote diversity across alleles and between individuals. Since only those individuals that survived in previous generations would contribute to these cached templates, represented alleles would be biased to those that have proven robust under a spectrum of selective pressures.</p>
            <p>In summary, the research presented here brings to light five striking findings. First, individual Arabidopsis plants are capable of producing somatic sectors during the course of normal vegetative development. Second, those sectors can have distinct and unique marker profiles and can differ in single nucleotide composition, can acquire small DNA insertions or can experience DNA sequence loss. Third, the 
                <italic toggle="yes">de novo</italic> appearance of genomic insertions supports our original contention that cryptic sequence templates drive some of these changes
                <sup>
                    <xref ref-type="bibr" rid="ref-22">22</xref>
                </sup>. Fourth, this phenomenon can be detected in wt genetic backgrounds raising the possibility that many Arabidopsis lab strains may be genetic mosaics. Finally, this process is genome-wide, impacting all 5 chromosomes, whether or not the target loci reside within genes or between genes.</p>
            <p>Our data expand on the ideas put forth by Whitham and Slobodchikoff
                <sup>
                    <xref ref-type="bibr" rid="ref-3">3</xref>
                </sup> and suggest that sector formation, even in a short-lived organism like Arabidopsis, may be a normal part of development and, furthermore, that the formation of sectors serves to capture novel genetic variation, irrespective of the source of that variation. Models testing the benefit of within organism genetic heterogeneity suggest that the average fitness of the population increases if some individuals within that population are genetic mosaics
                <sup>
                    <xref ref-type="bibr" rid="ref-35">35</xref>
                </sup>. As our data show, not all individuals in the populations we tested showed evidence of genetically distinct sectors but for those individuals that did, the number of sectors varied greatly. Our findings raise the possibility that inbreeding plants and, perhaps other organisms that predominantly propagate asexually, may sequester cryptic sources of genetic variation that can be harnessed to promote greater genetic diversity.</p>
        </sec>
    </body>
    <back>
        <ack>
            <title>Acknowledgements</title>
            <p>We thank K. Cuddington, H. Engelhardt, D. Enstone, S. Goggi, B. Moffatt, D. O&#x2019;Donoghue, R. Palmer, D. Rose and J. Witt for insightful discussions and for sharing their perspectives and expertise. We thank L. Hoyles and J. Waite for helpful discussions and technical assistance. SJL would especially like to thank members of the Department of Biology, the Faculty of Science and UW administration for their continued encouragement and support.</p>
        </ack>
        <ref-list>
            <ref id="ref-1">
                <label>1</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Todesco</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Balasubramanian</surname>
                            <given-names>S</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Hu</surname>
                            <given-names>TT</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Natural allelic variation underlying a major fitness trade-off in 
                        <italic toggle="yes">Arabidopsis thaliana</italic>.</article-title>
                    <source>
						
                        <italic toggle="yes">Nature.</italic>
					</source>
                    <year>2010</year>;<volume>465</volume>(<issue>7298</issue>):<fpage>632</fpage>&#x2013;<lpage>636</lpage>.
                    <pub-id pub-id-type="pmid">20520716</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nature09083</pub-id>
                    <pub-id pub-id-type="pmcid">3055268</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-2">
                <label>2</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Szymkowiak</surname>
                            <given-names>EJ</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Sussex</surname>
                            <given-names>IM</given-names>
                        </name>
					</person-group>:
                    <article-title>What chimeras can tell us about plant development.</article-title>
                    <source>
						
                        <italic toggle="yes">Annu Rev Plant Physiol Plant Mol Biol.</italic>
					</source>
                    <year>1996</year>;<volume>47</volume>:<fpage>351</fpage>&#x2013;<lpage>376</lpage>.
                    <pub-id pub-id-type="pmid">15012293</pub-id>
                    <pub-id pub-id-type="doi">10.1146/annurev.arplant.47.1.351</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-3">
                <label>3</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Whitham</surname>
                            <given-names>TG</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Slobodchikoff</surname>
                            <given-names>CN</given-names>
                        </name>
					</person-group>:
                    <article-title>Evolution by individuals, plant-herbivore interactions, and mosaics of genetic-variability - the adaptive significance of somatic mutations in plants.</article-title>
                    <source>
						
                        <italic toggle="yes">Oecologia.</italic>
					</source>
                    <year>1981</year>;<volume>49</volume>(<issue>3</issue>):<fpage>287</fpage>&#x2013;<lpage>292</lpage>.
                    <pub-id pub-id-type="doi">10.1007/BF00347587</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-4">
                <label>4</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Satina</surname>
                            <given-names>S</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Blakeslee</surname>
                            <given-names>AF</given-names>
                        </name>
					</person-group>:
                    <article-title>Periclinal chimeras in Datura stramonium in relation to development of leaf and flower.</article-title>
                    <source>
						
                        <italic toggle="yes">Am J Bot.</italic>
					</source>
                    <year>1941</year>;<volume>28</volume>(<issue>10</issue>):<fpage>862</fpage>&#x2013;<lpage>871</lpage>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.jstor.org/discover/10.2307/2436864?uid=3738256&amp;uid=2&amp;uid=4&amp;sid=21102483747141">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-5">
                <label>5</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Youngson</surname>
                            <given-names>NA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Whitelaw</surname>
                            <given-names>E</given-names>
                        </name>
					</person-group>:
                    <article-title>Transgenerational epigenetic effects.</article-title>
                    <source>
						
                        <italic toggle="yes">Annu Rev Genomics Hum Genet.</italic>
					</source>
                    <year>2008</year>;<volume>9</volume>:<fpage>233</fpage>&#x2013;<lpage>257</lpage>.
                    <pub-id pub-id-type="pmid">18767965</pub-id>
                    <pub-id pub-id-type="doi">10.1146/annurev.genom.9.081307.164445</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-6">
                <label>6</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Hopkin</surname>
                            <given-names>M</given-names>
                        </name>
					</person-group>:
                    <article-title>Biodiversity: Frozen futures.</article-title>
                    <source>
						
                        <italic toggle="yes">Nature.</italic>
					</source>
                    <year>2008</year>;<volume>452</volume>(<issue>7186</issue>):<fpage>404</fpage>&#x2013;<lpage>405</lpage>.
                    <pub-id pub-id-type="pmid">18368094</pub-id>
                    <pub-id pub-id-type="doi">10.1038/452404a</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-7">
                <label>7</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Walck</surname>
                            <given-names>J</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Dixon</surname>
                            <given-names>K</given-names>
                        </name>
					</person-group>:
                    <article-title>Time to future-proof plants in storage.</article-title>
                    <source>
						
                        <italic toggle="yes">Nature.</italic>
					</source>
                    <year>2009</year>;<volume>462</volume>(<issue>7274</issue>):<fpage>721</fpage>.
                    <pub-id pub-id-type="pmid">20010667</pub-id>
                    <pub-id pub-id-type="doi">10.1038/462721a</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-8">
                <label>8</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Fasoula</surname>
                            <given-names>VA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Boerma</surname>
                            <given-names>HR</given-names>
                        </name>
					</person-group>:
                    <article-title>Divergent selection at ultra-low plant density for seed protein and oil content within soybean cultivars.</article-title>
                    <source>
						
                        <italic toggle="yes">Field Crops Research.</italic>
					</source>
                    <year>2005</year>;<volume>91</volume>(<issue>2&#x2013;3</issue>):<fpage>217</fpage>&#x2013;<lpage>229</lpage>.
                    <pub-id pub-id-type="doi">10.1016/j.fcr.2004.07.018</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-9">
                <label>9</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Fasoula</surname>
                            <given-names>VA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Boerma</surname>
                            <given-names>HR</given-names>
                        </name>
					</person-group>:
                    <article-title>Intra-cultivar variation for seed weight and other agronomic traits within three elite soybean cultivars.</article-title>
                    <source>
						
                        <italic toggle="yes">Crop Sci.</italic>
					</source>
                    <year>2007</year>;<volume>47</volume>(<issue>1</issue>):<fpage>367</fpage>&#x2013;<lpage>373</lpage>.
                    <pub-id pub-id-type="doi">10.2135/cropsci2005.09.0334</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-10">
                <label>10</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Yates</surname>
                            <given-names>JL</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Boerma</surname>
                            <given-names>HR</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Fasoula</surname>
                            <given-names>VA</given-names>
                        </name>
					</person-group>:
                    <article-title>SSR-marker analysis of the intracultivar phenotypic variation discovered within 3 soybean cultivars.</article-title>
                    <source>
						
                        <italic toggle="yes">J Hered.</italic>
					</source>
                    <year>2012</year>;<volume>103</volume>(<issue>4</issue>):<fpage>570</fpage>&#x2013;<lpage>578</lpage>.
                    <pub-id pub-id-type="pmid">22547666</pub-id>
                    <pub-id pub-id-type="doi">10.1093/jhered/ess015</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-11">
                <label>11</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Rasmusson</surname>
                            <given-names>DC</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Phillips</surname>
                            <given-names>RL</given-names>
                        </name>
					</person-group>:
                    <article-title>Plant breeding progress and genetic diversity from 
                        <italic toggle="yes">de novo</italic> variation and elevated epistasis.</article-title>
                    <source>
						
                        <italic toggle="yes">Crop Sci.</italic>
					</source>
                    <year>1997</year>;<volume>37</volume>(<issue>2</issue>):<fpage>303</fpage>&#x2013;<lpage>310</lpage>.
                    <pub-id pub-id-type="doi">10.2135/cropsci1997.0011183X003700020001x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-12">
                <label>12</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Tang</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Toomajian</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Sherman-Broyles</surname>
                            <given-names>S</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>The evolution of selfing in 
                        <italic toggle="yes">Arabidopsis thaliana</italic>.</article-title>
                    <source>
						
                        <italic toggle="yes">Science.</italic>
					</source>
                    <year>2007</year>;<volume>317</volume>(<issue>5841</issue>):<fpage>1070</fpage>&#x2013;<lpage>1072</lpage>.
                    <pub-id pub-id-type="pmid">17656687</pub-id>
                    <pub-id pub-id-type="doi">10.1126/science.1143153</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-13">
                <label>13</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Barrett</surname>
                            <given-names>SC</given-names>
                        </name>
					</person-group>:
                    <article-title>The evolution of plant sexual diversity.</article-title>
                    <source>
						
                        <italic toggle="yes">Nat Rev Genet.</italic>
					</source>
                    <year>2002</year>;<volume>3</volume>(<issue>4</issue>):<fpage>274</fpage>&#x2013;<lpage>284</lpage>.
                    <pub-id pub-id-type="pmid">11967552</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nrg776</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-14">
                <label>14</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Clark</surname>
                            <given-names>RM</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Schweikert</surname>
                            <given-names>G</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Toomajian</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Common sequence polymorphisms shaping genetic diversity in 
                        <italic toggle="yes">Arabidopsis thaliana</italic>.</article-title>
                    <source>
						
                        <italic toggle="yes">Science.</italic>
					</source>
                    <year>2007</year>;<volume>317</volume>(<issue>5836</issue>):<fpage>338</fpage>&#x2013;<lpage>342</lpage>.
                    <pub-id pub-id-type="pmid">17641193</pub-id>
                    <pub-id pub-id-type="doi">10.1126/science.1138632</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-15">
                <label>15</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Cullis</surname>
                            <given-names>CA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Swami</surname>
                            <given-names>S</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Song</surname>
                            <given-names>Y</given-names>
                        </name>
					</person-group>:
                    <article-title>RAPD polymorphisms detected among the flax genotrophs.</article-title>
                    <source>
						
                        <italic toggle="yes">Plant Mol Biol.</italic>
					</source>
                    <year>1999</year>;<volume>41</volume>(<issue>6</issue>):<fpage>795</fpage>&#x2013;<lpage>800</lpage>.
                    <pub-id pub-id-type="pmid">10737144</pub-id>
                    <pub-id pub-id-type="doi">10.1023/A:1006385606163</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-16">
                <label>16</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Chen</surname>
                            <given-names>Y</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Schneeberger</surname>
                            <given-names>RG</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Cullis</surname>
                            <given-names>CA</given-names>
                        </name>
					</person-group>:
                    <article-title>A site-specific insertion sequence in flax genotrophs induced by environment.</article-title>
                    <source>
						
                        <italic toggle="yes">New Phytol.</italic>
					</source>
                    <year>2005</year>;<volume>167</volume>(<issue>1</issue>):<fpage>171</fpage>&#x2013;<lpage>180</lpage>.
                    <pub-id pub-id-type="pmid">15948840</pub-id>
                    <pub-id pub-id-type="doi">10.1111/j.1469-8137.2005.01398.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-17">
                <label>17</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Chen</surname>
                            <given-names>Y</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Lowenfeld</surname>
                            <given-names>R</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Cullis</surname>
                            <given-names>C</given-names>
                        </name>						
					</person-group>:
                    <article-title>An environmentally induced adaptive (?) insertion in flax.</article-title>
                    <source>
						
                        <italic toggle="yes">Int J Genet Mol Biol.</italic>
					</source>
                    <year>2009</year>;<volume>1</volume>(<issue>3</issue>):<fpage>038</fpage>&#x2013;<lpage>047</lpage>.
                    <ext-link ext-link-type="uri" xlink:href="http://academicjournals.org/article/article1379511958_Chen et al..pdf">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-18">
                <label>18</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Schneeberger</surname>
                            <given-names>RG</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Cullis</surname>
                            <given-names>CA</given-names>
                        </name>
					</person-group>:
                    <article-title>Specific DNA alterations associated with the environmental induction of heritable changes in flax.</article-title>
                    <source>
						
                        <italic toggle="yes">Genetics.</italic>
					</source>
                    <year>1991</year>;<volume>128</volume>:<fpage>619</fpage>&#x2013;<lpage>630</lpage>.
                    <pub-id pub-id-type="pmid">1678726</pub-id>
                    <pub-id pub-id-type="pmcid">1204535</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-19">
                <label>19</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Roth</surname>
                            <given-names>EJ</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Frazier</surname>
                            <given-names>BL</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Apuya</surname>
                            <given-names>NR</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Genetic-variation in an inbred plant - variation in tissue-cultures of soybean [
                        <italic toggle="yes">Glycine-max</italic> (L) Merill].</article-title>
                    <source>
						
                        <italic toggle="yes">Genetics.</italic>
					</source>
                    <year>1989</year>;<volume>121</volume>(<issue>2</issue>):<fpage>359</fpage>&#x2013;<lpage>368</lpage>.
                    <pub-id pub-id-type="pmid">2567263</pub-id>
                    <pub-id pub-id-type="pmcid">1203623</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-20">
                <label>20</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Oh</surname>
                            <given-names>TJ</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Cullis</surname>
                            <given-names>MA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Kunert</surname>
                            <given-names>K</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Genomic changes associated with somaclonal variation in banana (
                        <italic toggle="yes">Musa</italic> spp).</article-title>
                    <source>
						
                        <italic toggle="yes">Physiol Plant.</italic>
					</source>
                    <year>2007</year>;<volume>129</volume>(<issue>4</issue>):<fpage>766</fpage>&#x2013;<lpage>774</lpage>.
                    <pub-id pub-id-type="doi">10.1111/j.1399-3054.2007.00858.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-21">
                <label>21</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Xu</surname>
                            <given-names>PZ</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Yuan</surname>
                            <given-names>S</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>Y</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Genome-wide high-frequency non-Mendelian loss of heterozygosity in rice.</article-title>
                    <source>
						
                        <italic toggle="yes">Genome.</italic>
					</source>
                    <year>2007</year>;<volume>50</volume>(<issue>3</issue>):<fpage>297</fpage>&#x2013;<lpage>302</lpage>.
                    <pub-id pub-id-type="pmid">17502903</pub-id>
                    <pub-id pub-id-type="doi">10.1139/G07-005</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-22">
                <label>22</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Lolle</surname>
                            <given-names>SJ</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Victor</surname>
                            <given-names>JL</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Young</surname>
                            <given-names>JM</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Genome-wide non-mendelian inheritance of extra-genomic information in Arabidopsis.</article-title>
                    <source>
						
                        <italic toggle="yes">Nature.</italic>
					</source>
                    <year>2005</year>;<volume>434</volume>(<issue>7032</issue>):<fpage>505</fpage>&#x2013;<lpage>509</lpage>.
                    <pub-id pub-id-type="pmid">15785770</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nature03380</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-23">
                <label>23</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Chaudhury</surname>
                            <given-names>A</given-names>
                        </name>
					</person-group>:
                    <article-title>Plant genetics - Hothead healer and extragenomic information.</article-title>
                    <source>
						
                        <italic toggle="yes">Nature.</italic>
					</source>
                    <year>2005</year>;<volume>437</volume>(<issue>7055</issue>):<fpage>E1</fpage>.
                    <pub-id pub-id-type="pmid">16136082</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nature04062</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-24">
                <label>24</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Comai</surname>
                            <given-names>L</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Cartwright</surname>
                            <given-names>RA</given-names>
                        </name>
					</person-group>:
                    <article-title>A toxic mutator and selection alternative to the non-Mendelian RNA cache hypothesis for hothead reversion.</article-title>
                    <source>
						
                        <italic toggle="yes">Plant Cell.</italic>
					</source>
                    <year>2005</year>;<volume>17</volume>(<issue>11</issue>):<fpage>2856</fpage>&#x2013;<lpage>2858</lpage>.
                    <pub-id pub-id-type="pmid">16267378</pub-id>
                    <pub-id pub-id-type="doi">10.1105/tpc.105.036293</pub-id>
                    <pub-id pub-id-type="pmcid">1276014</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-25">
                <label>25</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Krishnaswamy</surname>
                            <given-names>L</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Peterson</surname>
                            <given-names>T</given-names>
                        </name>
					</person-group>:
                    <article-title>An alternate hypothesis to explain the high frequency of "revertants" in 
                        <italic toggle="yes">hothead</italic> mutants in Arabidopsis.</article-title>
                    <source>
						
                        <italic toggle="yes">Plant Biol (Stuttg).</italic>
					</source>
                    <year>2007</year>;<volume>9</volume>(<issue>1</issue>):<fpage>30</fpage>&#x2013;<lpage>31</lpage>.
                    <pub-id pub-id-type="pmid">17048144</pub-id>
                    <pub-id pub-id-type="doi">10.1055/s-2006-924563</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-26">
                <label>26</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Mercier</surname>
                            <given-names>R</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Jolivet</surname>
                            <given-names>S</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Vignard</surname>
                            <given-names>J</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Outcrossing as an explanation of the apparent unconventional genetic behavior of 
                        <italic toggle="yes">Arabidopsis thaliana hth</italic> mutants.</article-title>
                    <source>
						
                        <italic toggle="yes">Genetics.</italic>
					</source>
                    <year>2008</year>;<volume>180</volume>(<issue>4</issue>):<fpage>2295</fpage>&#x2013;<lpage>2297</lpage>.
                    <pub-id pub-id-type="pmid">18845842</pub-id>
                    <pub-id pub-id-type="doi">10.1534/genetics.108.095208</pub-id>
                    <pub-id pub-id-type="pmcid">2600959</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-27">
                <label>27</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Peng</surname>
                            <given-names>P</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Chan</surname>
                            <given-names>SW</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Shah</surname>
                            <given-names>GA</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Plant genetics: increased outcrossing in 
                        <italic toggle="yes">hothead</italic> mutants.</article-title>
                    <source>
						
                        <italic toggle="yes">Nature.</italic>
					</source>
                    <year>2006</year>;<volume>443</volume>(<issue>7110</issue>):<fpage>E8</fpage>.
                    <pub-id pub-id-type="pmid">17006468</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nature05251</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-28">
                <label>28</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Ray</surname>
                            <given-names>A</given-names>
                        </name>
					</person-group>:
                    <article-title>Plant genetics - RNA cache genome trash?</article-title>
                    <source>
						
                        <italic toggle="yes">Nature.</italic>
					</source>
                    <year>2005</year>;<volume>437</volume>(<issue>7055</issue>):<fpage>E1</fpage>&#x2013;<lpage>E2</lpage>.
                    <pub-id pub-id-type="pmid">16136081</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nature04063</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-29">
                <label>29</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Lolle</surname>
                            <given-names>SJ</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Hsu</surname>
                            <given-names>W</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Pruitt</surname>
                            <given-names>RE</given-names>
                        </name>
					</person-group>:
                    <article-title>Genetic analysis of organ fusion in 
                        <italic toggle="yes">Arabidopsis thaliana</italic>.</article-title>
                    <source>
						
                        <italic toggle="yes">Genetics.</italic>
					</source>
                    <year>1998</year>;<volume>149</volume>(<issue>2</issue>):<fpage>607</fpage>&#x2013;<lpage>619</lpage>.
                    <pub-id pub-id-type="pmid">9611177</pub-id>
                    <pub-id pub-id-type="pmcid">1460157</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-30">
                <label>30</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Xiang</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Han</surname>
                            <given-names>P</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Lutziger</surname>
                            <given-names>I</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>A mini binary vector series for plant transformation.</article-title>
                    <source>
						
                        <italic toggle="yes">Plant Mol Biol.</italic>
					</source>
                    <year>1999</year>;<volume>40</volume>(<issue>4</issue>):<fpage>711</fpage>&#x2013;<lpage>717</lpage>.
                    <pub-id pub-id-type="pmid">10480394</pub-id>
                    <pub-id pub-id-type="doi">10.1023/A:1006201910593</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-31">
                <label>31</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Edwards</surname>
                            <given-names>K</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Johnstone</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Thompson</surname>
                            <given-names>C</given-names>
                        </name>
					</person-group>:
                    <article-title>A simple and rapid method for the preparation of plant genomic DNA for PCR analysis.</article-title>
                    <source>
						
                        <italic toggle="yes">Nucleic Acids Res.</italic>
					</source>
                    <year>1991</year>;<volume>19</volume>(<issue>6</issue>):<fpage>1349</fpage>.
                    <pub-id pub-id-type="pmid">2030957</pub-id>
                    <pub-id pub-id-type="doi">10.1093/nar/19.6.1349</pub-id>
                    <pub-id pub-id-type="pmcid">333874</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-32">
                <label>32</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Koornneef</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Hanhart</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Thiel</surname>
                            <given-names>F</given-names>
                        </name>
					</person-group>:
                    <article-title>A genetic and phenotypic description of 
                        <italic toggle="yes">Eceriferum (cer)</italic> mutants in 
                        <italic toggle="yes">Arabidopsis thaliana</italic>.</article-title>
                    <source>
						
                        <italic toggle="yes">J Hered.</italic>
					</source>
                    <year>1989</year>;<volume>80</volume>(<issue>2</issue>):<fpage>118</fpage>&#x2013;<lpage>122</lpage>.
                    <ext-link ext-link-type="uri" xlink:href="http://jhered.oxfordjournals.org/content/80/2/118.short">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-33">
                <label>33</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Gao</surname>
                            <given-names>D</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>He</surname>
                            <given-names>B</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Zhou</surname>
                            <given-names>Y</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Genetic and molecular analysis of a purple sheath somaclonal mutant in japonica rice.</article-title>
                    <source>
						
                        <italic toggle="yes">Plant Cell Rep.</italic>
					</source>
                    <year>2011</year>;<volume>30</volume>(<issue>5</issue>):<fpage>901</fpage>&#x2013;<lpage>911</lpage>.
                    <pub-id pub-id-type="pmid">21249365</pub-id>
                    <pub-id pub-id-type="doi">10.1007/s00299-011-1004-3</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-34">
                <label>34</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Chable</surname>
                            <given-names>V</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Rival</surname>
                            <given-names>A</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Cadot</surname>
                            <given-names>V</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>"Aberrant" plants in cauliflower: 1. Phenotype and heredity.</article-title>
                    <source>
						
                        <italic toggle="yes">Euphytica.</italic>
					</source>
                    <year>2008</year>;<volume>164</volume>(<issue>2</issue>):<fpage>325</fpage>&#x2013;<lpage>337</lpage>.
                    <pub-id pub-id-type="doi">10.1007/s10681-008-9660-2</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-35">
                <label>35</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Folse</surname>
                            <given-names>HJ</given-names>
                            <suffix>3rd</suffix>
                        </name>
						
                        <name name-style="western">
                            <surname>Roughgarden</surname>
                            <given-names>J</given-names>
                        </name>
					</person-group>:
                    <article-title>Direct Benefits of Genetic Mosaicism and Intraorganismal Selection: Modeling Coevolution Between a Long-Lived Tree and a Short-Lived Herbivore.</article-title>
                    <source>
						
                        <italic toggle="yes">Evolution.</italic>
					</source>
                    <year>2012</year>;<volume>66</volume>(<issue>4</issue>):<fpage>1091</fpage>&#x2013;<lpage>1113</lpage>.
                    <pub-id pub-id-type="pmid">22486691</pub-id>
                    <pub-id pub-id-type="doi">10.1111/j.1558-5646.2011.01500.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-36">
                <label>36</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Thomson</surname>
                            <given-names>JD</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Herre</surname>
                            <given-names>EA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Hamrick</surname>
                            <given-names>JL</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Genetic Mosaics in Strangler Fig Trees - Implications for Tropical Conservation.</article-title>
                    <source>
						
                        <italic toggle="yes">Science.</italic>
					</source>
                    <year>1991</year>;<volume>254</volume>(<issue>5035</issue>):<fpage>1214</fpage>&#x2013;<lpage>1216</lpage>.
                    <pub-id pub-id-type="pmid">17776412</pub-id>
                    <pub-id pub-id-type="doi">10.1126/science.254.5035.1214</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-37">
                <label>37</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Tracy</surname>
                            <given-names>WF</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Talbert</surname>
                            <given-names>LE</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Gerdes</surname>
                            <given-names>JT</given-names>
                        </name>
					</person-group>:
                    <article-title>Molecular variation and F-1 performance among strains of the sweet corn inbred P39.</article-title>
                    <source>
						
                        <italic toggle="yes">Crop Sci.</italic>
					</source>
                    <year>2000</year>;<volume>40</volume>(<issue>6</issue>):<fpage>1763</fpage>&#x2013;<lpage>1768</lpage>.
                    <ext-link ext-link-type="uri" xlink:href="http://openagricola.nal.usda.gov/Record/IND22904362">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-38">
                <label>38</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Yi</surname>
                            <given-names>H</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Richards</surname>
                            <given-names>EJ</given-names>
                        </name>
					</person-group>:
                    <article-title>Phenotypic instability of Arabidopsis alleles affecting a disease Resistance gene cluster.</article-title>
                    <source>
						
                        <italic toggle="yes">BMC Plant Biol.</italic>
					</source>
                    <year>2008</year>;<volume>8</volume>:<fpage>36</fpage>.
                    <pub-id pub-id-type="pmid">18410684</pub-id>
                    <pub-id pub-id-type="doi">10.1186/1471-2229-8-36</pub-id>
                    <pub-id pub-id-type="pmcid">2374787</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-39">
                <label>39</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Yi</surname>
                            <given-names>H</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Richards</surname>
                            <given-names>EJ</given-names>
                        </name>
					</person-group>:
                    <article-title>Gene duplication and hypermutation of the pathogen Resistance gene 
                        <italic toggle="yes">SNC1</italic> in the Arabidopsis 
                        <italic toggle="yes">bal</italic> variant.</article-title>
                    <source>
						
                        <italic toggle="yes">Genetics.</italic>
					</source>
                    <year>2009</year>;<volume>183</volume>(<issue>4</issue>):<fpage>1227</fpage>&#x2013;<lpage>1234</lpage>.
                    <pub-id pub-id-type="pmid">19797048</pub-id>
                    <pub-id pub-id-type="doi">10.1534/genetics.109.105569</pub-id>
                    <pub-id pub-id-type="pmcid">2787416</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-40">
                <label>40</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Jiang</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Mithani</surname>
                            <given-names>A</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Gan</surname>
                            <given-names>X</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Regenerant Arabidopsis Lineages Display a Distinct Genome-Wide Spectrum of Mutations Conferring Variant Phenotypes.</article-title>
                    <source>
						
                        <italic toggle="yes">Curr Biol.</italic>
					</source>
                    <year>2011</year>;<volume>21</volume>(<issue>16</issue>):<fpage>1385</fpage>&#x2013;<lpage>1390</lpage>.
                    <pub-id pub-id-type="pmid">21802297</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.cub.2011.07.002</pub-id>
                    <pub-id pub-id-type="pmcid">3162137</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-41">
                <label>41</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Lopez</surname>
                            <given-names>CMR</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Wetten</surname>
                            <given-names>AC</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Wilkinson</surname>
                            <given-names>MJ</given-names>
                        </name>
					</person-group>:
                    <article-title>Progressive erosion of genetic and epigenetic variation in callus-derived cocoa (
                        <italic toggle="yes">Theobroma cacao</italic>) plants.</article-title>
                    <source>
						
                        <italic toggle="yes">New Phytol.</italic>
					</source>
                    <year>2010</year>;<volume>186</volume>(<issue>4</issue>):<fpage>856</fpage>&#x2013;<lpage>868</lpage>.
                    <pub-id pub-id-type="pmid">20406408</pub-id>
                    <pub-id pub-id-type="doi">10.1111/j.1469-8137.2010.03242.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-42">
                <label>42</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Boyko</surname>
                            <given-names>A</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Kovalchuk</surname>
                            <given-names>I</given-names>
                        </name>
					</person-group>:
                    <article-title>Genome instability and epigenetic modification - heritable responses to environmental stress?</article-title>
                    <source>
						
                        <italic toggle="yes">Curr Opin Plant Biol.</italic>
					</source>
                    <year>2011</year>;<volume>14</volume>(<issue>3</issue>):<fpage>260</fpage>&#x2013;<lpage>266</lpage>.
                    <pub-id pub-id-type="pmid">21440490</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.pbi.2011.03.003</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-43">
                <label>43</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Pineda-Krch</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Lehtila</surname>
                            <given-names>K</given-names>
                        </name>
					</person-group>:
                    <article-title>Costs and benefits of genetic heterogeneity within organisms.</article-title>
                    <source>
						
                        <italic toggle="yes">J Evol Biol.</italic>
					</source>
                    <year>2004</year>;<volume>17</volume>(<issue>6</issue>):<fpage>1167</fpage>&#x2013;<lpage>1177</lpage>.
                    <pub-id pub-id-type="pmid">15525396</pub-id>
                    <pub-id pub-id-type="doi">10.1111/j.1420-9101.2004.00808.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-44">
                <label>44</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Pineda-Krch</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Fagerstrom</surname>
                            <given-names>T</given-names>
                        </name>
					</person-group>:
                    <article-title>On the potential for evolutionary change in meristematic cell lineages through intraorganismal selection.</article-title>
                    <source>
						
                        <italic toggle="yes">J Evol Biol.</italic>
					</source>
                    <year>1999</year>;<volume>12</volume>(<issue>4</issue>):<fpage>681</fpage>&#x2013;<lpage>688</lpage>.
                    <pub-id pub-id-type="doi">10.1046/j.1420-9101.1999.00066.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-45">
                <label>45</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Fagerstrom</surname>
                            <given-names>T</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Briscoe</surname>
                            <given-names>DA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Sunnucks</surname>
                            <given-names>P</given-names>
                        </name>
					</person-group>:
                    <article-title>Evolution of mitotic cell-lineages in multicellular organisms.</article-title>
                    <source>
						
                        <italic toggle="yes">Trends Ecol Evol.</italic>
					</source>
                    <year>1998</year>;<volume>13</volume>(<issue>3</issue>):<fpage>117</fpage>&#x2013;<lpage>120</lpage>.
                    <pub-id pub-id-type="pmid">21238227</pub-id>
                    <pub-id pub-id-type="doi">10.1016/S0169-5347(97)01314-1</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-46">
                <label>46</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Sangster</surname>
                            <given-names>TA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Salathia</surname>
                            <given-names>N</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Lee</surname>
                            <given-names>HN</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>HSP90-buffered genetic variation is common in 
                        <italic toggle="yes">Arabidopsis thaliana</italic>.</article-title>
                    <source>
						
                        <italic toggle="yes">Proc Natl Acad Sci U S A.</italic>
					</source>
                    <year>2008</year>;<volume>105</volume>(<issue>8</issue>):<fpage>2969</fpage>&#x2013;<lpage>2974</lpage>.
                    <pub-id pub-id-type="pmid">18287064</pub-id>
                    <pub-id pub-id-type="doi">10.1073/pnas.0712210105</pub-id>
                    <pub-id pub-id-type="pmcid">2268569</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-47">
                <label>47</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Yao</surname>
                            <given-names>YL</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Kovalchuk</surname>
                            <given-names>I</given-names>
                        </name>
					</person-group>:
                    <article-title>Abiotic stress leads to somatic and heritable changes in homologous recombination frequency, point mutation frequency and microsatellite stability in Arabidopsis plants.</article-title>
                    <source>
						
                        <italic toggle="yes">Mutat Res.</italic>
					</source>
                    <year>2011</year>;<volume>707</volume>(<issue>1&#x2013;2</issue>):<fpage>61</fpage>&#x2013;<lpage>66</lpage>.
                    <pub-id pub-id-type="pmid">21236268</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.mrfmmm.2010.12.013</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-48">
                <label>48</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Molinier</surname>
                            <given-names>J</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Ries</surname>
                            <given-names>G</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Zipfel</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Transgeneration memory of stress in plants.</article-title>
                    <source>
						
                        <italic toggle="yes">Nature.</italic>
					</source>
                    <year>2006</year>;<volume>442</volume>(<issue>7106</issue>):<fpage>1046</fpage>&#x2013;<lpage>1049</lpage>.
                    <pub-id pub-id-type="pmid">16892047</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nature05022</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-49">
                <label>49</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>DeBolt</surname>
                            <given-names>S</given-names>
                        </name>
					</person-group>:
                    <article-title>Copy Number Variation Shapes Genome Diversity in Arabidopsis Over Immediate Family Generational Scales.</article-title>
                    <source>
						
                        <italic toggle="yes">Genome Biol Evol.</italic>
					</source>
                    <year>2010</year>;<volume>2</volume>:<fpage>441</fpage>&#x2013;<lpage>453</lpage>.
                    <pub-id pub-id-type="pmid">20624746</pub-id>
                    <pub-id pub-id-type="doi">10.1093/gbe/evq033</pub-id>
                    <pub-id pub-id-type="pmcid">2997553</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-50">
                <label>50</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Lang-Mladek</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Popova</surname>
                            <given-names>O</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Kiok</surname>
                            <given-names>K</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Transgenerational Inheritance and Resetting of Stress-Induced Loss of Epigenetic Gene Silencing in Arabidopsis.</article-title>
                    <source>
						
                        <italic toggle="yes">Mol Plant.</italic>
					</source>
                    <year>2010</year>;<volume>3</volume>(<issue>3</issue>):<fpage>594</fpage>&#x2013;<lpage>602</lpage>.
                    <pub-id pub-id-type="pmid">20410255</pub-id>
                    <pub-id pub-id-type="doi">10.1093/mp/ssq014</pub-id>
                    <pub-id pub-id-type="pmcid">2877484</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-51">
                <label>51</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Queitsch</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Sangster</surname>
                            <given-names>TA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Lindquist</surname>
                            <given-names>S</given-names>
                        </name>
					</person-group>:
                    <article-title>Hsp90 as a capacitor of phenotypic variation.</article-title>
                    <source>
						
                        <italic toggle="yes">Nature.</italic>
					</source>
                    <year>2002</year>;<volume>417</volume>(<issue>6889</issue>):<fpage>618</fpage>&#x2013;<lpage>624</lpage>.
                    <pub-id pub-id-type="pmid">12050657</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nature749</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-52">
                <label>52</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Lisch</surname>
                            <given-names>D</given-names>
                        </name>
					</person-group>:
                    <article-title>Epigenetic Regulation of Transposable Elements in Plants.</article-title>
                    <source>
						
                        <italic toggle="yes">Annu Rev Plant Biol.</italic>
					</source>
                    <year>2009</year>;<volume>60</volume>:<fpage>43</fpage>&#x2013;<lpage>66</lpage>.
                    <pub-id pub-id-type="pmid">19007329</pub-id>
                    <pub-id pub-id-type="doi">10.1146/annurev.arplant.59.032607.092744</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-53">
                <label>53</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Tenaillon</surname>
                            <given-names>MI</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Hollister</surname>
                            <given-names>JD</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Gaut</surname>
                            <given-names>BS</given-names>
                        </name>
					</person-group>:
                    <article-title>A triptych of the evolution of plant transposable elements.</article-title>
                    <source>
						
                        <italic toggle="yes">Trends Plant Sci.</italic>
					</source>
                    <year>2010</year>;<volume>15</volume>(<issue>8</issue>):<fpage>471</fpage>&#x2013;<lpage>478</lpage>.
                    <pub-id pub-id-type="pmid">20541961</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.tplants.2010.05.003</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-54">
                <label>54</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>FitzGerald</surname>
                            <given-names>A</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>O'Donoghue</surname>
                            <given-names>DP</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Liu</surname>
                            <given-names>XY</given-names>
                        </name>
					</person-group>:
                    <article-title>Genetic Repair Strategies Inspired by 
                        <italic toggle="yes">Arabidopsis thaliana</italic>.</article-title>In: Coyle L, Freyne J, editors.
                    <source>
						
                        <italic toggle="yes">Artificial Intelligence and Cognitive Science.</italic>
					</source>
                    <year>2010</year>;<volume>6206</volume>:<fpage>61</fpage>&#x2013;<lpage>71</lpage>.
                    <pub-id pub-id-type="doi">10.1007/978-3-642-17080-5_9</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report746">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.752.r746</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Oppenheimer</surname>
                        <given-names>David</given-names>
                    </name>
                    <xref ref-type="aff" rid="r746a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r746a1">
                    <label>1</label>Department of Botany, University of Florida, Gainesville, FL, USA</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>31</day>
                <month>1</month>
                <year>2013</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2013 Oppenheimer D</copyright-statement>
                <copyright-year>2013</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport746" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.2-5.v1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>In the current manuscript, Lolle and colleagues show that plants can spontaneously produce mosaic sectors, and they show that insertion sequences can arise de-novo. Importantly, growing the hth plants in the absence of pollen donors did not eliminate the appearance of HTH plants in the next generation. It is hard to come up with a model for how one could get 1.5% wt plants unless the researchers were covered in wt pollen while tending to the isolated hth plants. It would be useful for the authors to remind the reader that the hth mutants are in the Ler background.</p>
            <p>The authors should state the degree to which they tried to eliminate PCR contamination (setting up reactions in UV-sterilized hoods, positive displacement pipets, etc.).</p>
            <p>Some important questions/comments:
                <list list-type="bullet">
                    <list-item>
                        <p>What are the allele-specific molecular markers used to genotype the plant shown in Figure 1B? Is the marker used one of the Col/Ler indel markers? What tissues do the individual lanes represent (individual flowers, stem tissue, etc.)?&#x00a0;</p>
                    </list-item>
                    <list-item>
                        <p>On Page 8, the authors reared the plants in plastic cones, which they conceded does not eliminate outcrossing. Although the frequency of deviation from the expected profile is significantly higher than that due to outcrossing, it would have been better to grow the plants in isolation. This will remain an important criticism, as outcrossing frequencies rely on many variables, and it is possible (albeit difficult) to completely eliminate the possibility of outcrossing.</p>
                    </list-item>
                    <list-item>
                        <p>On page 8, the authors should clarify the experimental details to make it easy for the readers to follow. The authors should state (if I am following it correctly) that: homozygous Ler hth mutants were crossed with Col wt plants to generate the F1 plants. F1 plants were grown and allowed to set seed. The F2 plants were screened for hth mutants which were saved for F3 analysis. All the markers listed in Figure 2 were used to genotype the individual F2 plants. The individual F2 plants chosen for further study showed the homozygous Ler indel pattern. F3 seedlings were analyzed to address whether or not the marker patterns were stable.</p>
                    </list-item>
                    <list-item>
                        <p>The key results in Figure 3 cannot be explained by outcrossing, period.&#x00a0;</p>
                    </list-item>
                    <list-item>
                        <p>Page 8, Change "Markers are discordance&#x2026;" to "Markers are discordant&#x2026;"</p>
                    </list-item>
                    <list-item>
                        <p>Page 9, &#x2018;targeted appearance of unique genomic insertions&#x2019;: it might be better to say &#x2018;re-appearance of the allele from a previous generation&#x2019;.</p>
                    </list-item>
                </list>
            </p>
            <p>General:</p>
            <p>Since HTH has not been cloned yet, this adds an additional layer of complexity to the story. Nonetheless, molecular data were completely absent when transposable elements were discovered, so the identity of HTH is not crucial to the story of de novo genomic changes other than to further understand the nature of the reversion events.</p>
            <p>The key aspects of the Peng and Mercier papers were that neither lab was able to find revertants when the plants were grown in isolation. These authors then concluded that there was no non-mendelian mechanism at work, and therefore the rest of the arguments were moot. However, the inability to reproduce the phenomenon does not mean that the phenomenon does not exist; it only means that the Peng and Mercier labs were not able to reproduce the appropriate growth conditions to see the effect. This is not unexpected given that an uncharacterized stress response may be at play here leading to the reversion phenotype.</p>
            <p>In my own work with particular
                <italic> Arabidopsis</italic> mutants that are mostly sterile, we do see revertant sectors, albeit rarely. With one particular mutant, a single inflorescence showed many full seed pods even though the other inflorescences on the same plant showed completely empty pods. Clearly this is not seed or pollen contamination. We have yet to follow up on this rare observation, mainly because it is hard to study rare phenomena.</p>
            <p>Reviewer Expertise:</p>
            <p>NA</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report745">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.752.r745</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Kovalchuk</surname>
                        <given-names>Igor</given-names>
                    </name>
                    <xref ref-type="aff" rid="r745a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r745a1">
                    <label>1</label>University of Lethbridge, Lethbridge, AB, Canada</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>31</day>
                <month>1</month>
                <year>2013</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2013 Kovalchuk I</copyright-statement>
                <copyright-year>2013</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport745" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.2-5.v1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>There is nothing 'wrong' with the paper, although this research is still quite controversial. I would still like to see the mRNA and DNA from 
                <italic>hth</italic> individual plants to be sequenced and compared. Also, if genetic recombination mechanism is in play and if mRNA needs to be converted to cDNA for integration, one could show that some of the mutants involved in recombination or in reverse transcription would be impaired in the process of acquisition of new alleles.</p>
            <p>All the experiments were done correctly, but as I said the story is far from completion.</p>
            <p>Reviewer Expertise:</p>
            <p>NA</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report729">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.752.r729</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Pereira</surname>
                        <given-names>Andy</given-names>
                    </name>
                    <xref ref-type="aff" rid="r729a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0003-1378-4273</uri>
                </contrib>
                <aff id="r729a1">
                    <label>1</label>University of Arkansas, Fayetteville, AR, USA</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>30</day>
                <month>1</month>
                <year>2013</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2013 Pereira A</copyright-statement>
                <copyright-year>2013</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport729" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.2-5.v1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>This paper describes the occurrence of somatic sectors in
                <italic> hth</italic> mutant genotypes, with the frequency of rare visible sectors at a specific locus being 1/300,000. However, if there is a selective advantage during development, such sectors might be higher and could also produce clonal selected events and easily be identified by PCR.</p>
            <p>The data provide adequate support against contamination by outcrossing as a possible explanation of the results.</p>
            <p>Minor comment: should change the word 'vernalized' to 'stratified' in the Methods section, sentence beginning "Arabidopsis seeds derived from these stocks..."</p>
            <p>Reviewer Expertise:</p>
            <p>NA</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
</article>
