<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.2-99.v3</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                    <subj-group>
                        <subject>Evolutionary/Comparative Genetics</subject>
                    </subj-group>
                    <subj-group>
                        <subject>Genomics</subject>
                    </subj-group>
                    <subj-group>
                        <subject>Microbial Evolution &amp; Genomics</subject>
                    </subj-group>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>Polycistronic transcription of fused cassettes and identification of translation initiation signals in an unusual gene cassette array from 
                    <italic>Pseudomonas aeruginosa</italic>
                </article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 3; peer review: 2 approved]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Fonseca</surname>
                        <given-names>&#x00c9;rica L.</given-names>
                    </name>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Vicente</surname>
                        <given-names>Ana Carolina Paulo</given-names>
                    </name>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Laborat&#x00f3;rio de Gen&#x00e9;tica Molecular de Microrganismos, Instituto Oswaldo Cruz, Rio de Janeiro, 4365, Brazil</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:ericafon@ioc.fiocruz.br">ericafon@ioc.fiocruz.br</email>
                </corresp>
                <fn fn-type="con">
                    <p>ELF and ACPV conceived the study and designed the experiments. ELF carried out the research and prepared the first draft of the manuscript. All authors were involved in the revision of the draft manuscript and have agreed to the final content.</p>
                </fn>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No relevant competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>27</day>
                <month>11</month>
                <year>2015</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2013</year>
            </pub-date>
            <volume>2</volume>
            <elocation-id>99</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>25</day>
                    <month>11</month>
                    <year>2015</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2015 Fonseca &#x00c9;L and Vicente ACP</copyright-statement>
                <copyright-year>2015</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/3.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/2-99/pdf"/>
            <abstract>
                <p>The gene cassettes found in class 1 integrons are generally promoterless units composed by an open reading frame (ORF), a short 5&#x2019; untranslated region (UTR) and a 3&#x2019; recombination site (
                    <italic toggle="yes">attC</italic>). Fused gene cassettes are generated by partial or total loss of the 
                    <italic toggle="yes">attC</italic> from the first cassette in an array, creating, in some cases, a fusion with the ORF from the next cassette. These structures are rare and little is known about their mechanisms of mobilization and expression. The aim of this study was to evaluate the dynamic of mobilization and transcription of the 
                    <italic toggle="yes">gcu14</italic>-
                    <italic toggle="yes">bla</italic>
                    <sub>GES-1</sub>/
                    <italic toggle="yes">aacA4</italic> gene cassette array, which harbours a fused gene cassette represented by 
                    <italic toggle="yes">bla</italic>
                    <sub>GES-1</sub>/
                    <italic toggle="yes">aacA4</italic>. The cassette array was analysed by Northern blot and real-time reverse transcription-polymerase chain reaction (RT-PCR) in order to assess the transcription mechanism of 
                    <italic toggle="yes">bla</italic>
                    <sub>GES-1</sub>/
                    <italic toggle="yes">aacA4</italic> fused cassette. Also, inverse polymerase chain reactions (PCR) were performed to detect the free circular forms of 
                    <italic toggle="yes">gcu14</italic>, 
                    <italic toggle="yes">bla</italic>
                    <sub>GES-1</sub> and 
                    <italic toggle="yes">aacA4</italic>. The Northern blot and real time RT-PCR revealed a polycistronic transcription, in which the fused cassette 
                    <italic toggle="yes">bla</italic>
                    <sub>GES-1</sub>/ 
                    <italic toggle="yes">aacA4</italic> is transcribed as a unique gene, while 
                    <italic toggle="yes">gcu14</italic> (with a canonical 
                    <italic toggle="yes">attC</italic> recombination site) has a monocistronic transcription. The 
                    <italic toggle="yes">gcu14</italic> cassette, closer to the weak configuration of cassette promoter (PcW), had a higher transcription level than 
                    <italic toggle="yes">bla</italic>
                    <sub>GES-1</sub>/
                    <italic toggle="yes">aacA4</italic>, indicating that the cassette position affects the transcript amounts. The presence of ORF-11 at 
                    <italic toggle="yes">attI1</italic>, immediately preceding 
                    <italic toggle="yes">gcu14</italic>, and of a Shine-Dalgarno sequence upstream 
                    <italic toggle="yes">bla</italic>
                    <sub>GES-1</sub>/
                    <italic toggle="yes">aacA4</italic> composes a scenario for the occurrence of array translation. Inverse PCR generated amplicons corresponding to 
                    <italic toggle="yes">gcu14</italic>, 
                    <italic toggle="yes">gcu14</italic>-
                    <italic toggle="yes">aacA4</italic> and 
                    <italic toggle="yes">gcu14</italic>-
                    <italic toggle="yes">bla</italic>
                    <sub>GES-1</sub>/
                    <italic toggle="yes">aacA4</italic> free circular forms, but not to 
                    <italic toggle="yes">bla</italic>
                    <sub>GES-1</sub> and 
                    <italic toggle="yes">aacA4</italic> alone, indicating that the GES-1 truncated 
                    <italic toggle="yes">attC</italic> is not substrate of integrase activity and that these genes are mobilized together as a unique cassette. This study was original in showing the transcription of fused cassettes and in correlating cassette position with transcription.</p>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>gene cassette</kwd>
                <kwd>clase 1 integrons</kwd>
                <kwd>fused gene cassette</kwd>
                <kwd>transcription</kwd>
            </kwd-group>
            <funding-group>
                <funding-statement>This work was supported by the CNPq and FAPERJ fellowship and Oswaldo Cruz Institute Grant.</funding-statement>
            </funding-group>
        </article-meta>
        <notes>
            <sec sec-type="version-changes">
                <label>Revised</label>
                <title>Amendments from Version 2</title>
                <p>Taking into account the Dr. Partridge recommendations, a new version of figure 2 was provided in order to make clearer the differences between the canonical and truncated GES-1 attC sites. In this new version of the figure, all points raised by Dr. Partridge were addressed.</p>
            </sec>
        </notes>
    </front>
    <body>
        <sec sec-type="intro">
            <title>Introduction</title>
            <p>Class 1 integrons are capable of inserting, excising and rearranging gene cassettes by a site-specific recombination mechanism. These assembly platforms can also act as expression systems due to the presence of a promoter region (Pc), which drives the expression of genes captured by integron
                <sup>
                    <xref ref-type="bibr" rid="ref-1">1</xref>
                </sup>. Moreover, naturally occurring integrons may have a second promoter (P2), which is activated by the insertion of three G residues between -35 and -10 hexamers
                <sup>
                    <xref ref-type="bibr" rid="ref-1">1</xref>
                </sup>. Gene cassettes are generally promoterless units associated with a recombination site (
                <italic toggle="yes">attC</italic> or 59-be), which confers the ability of each structure to be mobilized independently
                <sup>
                    <xref ref-type="bibr" rid="ref-2">2</xref>
                </sup>, and the Left Hand (LH &#x2013; 1L and 2L core sites) and Right Hand (RH &#x2013; 1R and 2R core sites) domains from 
                <italic toggle="yes">attC</italic> sites are crucial for this mobilization
                <sup>
                    <xref ref-type="bibr" rid="ref-3">3</xref>
                </sup>. Studies focusing on gene cassette translation in the context of integrons are rare, however, it was recently showed that 
                <italic toggle="yes">attC</italic> sites regulate the translation of downstream cassettes due to their peculiar sequences composed by imperfect inverted repeats that form stem-loop structures. These secondary structures prevent ribosome progression throughout mRNA, reflecting in a decreased expression of more distal genes regarding Pc
                <sup>
                    <xref ref-type="bibr" rid="ref-4">4</xref>
                </sup>. Conversely, TIR (Translation Initiation Region)-deficient gene cassettes could have their expression promoted by the presence of ORF-11
                <sup>
                    <xref ref-type="bibr" rid="ref-5">5</xref>
                </sup>. This ORF, when present, is found at the 
                <italic toggle="yes">attI</italic> site preceding the gene cassette array. It codes for 11 amino acids and harbours its own Shine-Dalgarno (SD) sequence. Therefore, the ORF-11 recruits the ribosomes and, through an event of coupled translation, the subsequent TIR-deficient gene cassette could be expressed
                <sup>
                    <xref ref-type="bibr" rid="ref-4">4</xref>,
                    <xref ref-type="bibr" rid="ref-5">5</xref>
                </sup>. Gene cassettes can be found inserted in integrons or in other secondary sites, or free in the cytoplasm as a closed circle, in which the 5&#x2019; end (5&#x2019; UTR) and the 
                <italic toggle="yes">attC</italic> recombination site are covalently linked
                <sup>
                    <xref ref-type="bibr" rid="ref-6">6</xref>
                </sup>.</p>
            <p>As demonstrated previously, several stress conditions could evoke the activation of the SOS response resulting in integron-integrase expression
                <sup>
                    <xref ref-type="bibr" rid="ref-7">7</xref>
                </sup>. Therefore, under stress, the integrase activity increases, favoring the occurrence of integration/excision/rearrangements events.</p>
            <p>Although rare, fused cassettes may be generated by partial or total loss of the first 
                <italic toggle="yes">attC</italic>, retaining both complete coding regions and, therefore, creating permanent gene arrays comparable to bacterial operons
                <sup>
                    <xref ref-type="bibr" rid="ref-8">8</xref>
                </sup>. The functionality of such structures has been indirectly inferred by the resistance profile of transformants carrying the fusion
                <sup>
                    <xref ref-type="bibr" rid="ref-9">9</xref>
                </sup>; however, the transcription itself has never been verified.</p>
            <p>This study showed the dynamics of fused cassette mobilization, the co-transcription of the 
                <italic toggle="yes">gcu14</italic>-
                <italic toggle="yes">bla</italic>
                <sub>GES-1</sub>/
                <italic toggle="yes">aacA4</italic> cassette array and the effect of cassette position on transcription levels in 
                <italic toggle="yes">Pseudomonas aeruginosa</italic> wild lineages carrying class 1 integrons. Moreover, the presence of translation signals in this gene cassette array was determined.</p>
        </sec>
        <sec sec-type="materials | methods">
            <title>Material and methods</title>
            <p>An unknown Open Reading Frame (ORF), 
                <italic toggle="yes">gcu14</italic> (
                <underline>g</underline>ene 
                <underline>c</underline>assette of 
                <underline>u</underline>nknown function), followed by the fused cassette 
                <italic toggle="yes">bla</italic>
                <sub>GES-1</sub>/
                <italic toggle="yes">aacA4</italic>, created by partial loss of GES-1 
                <italic toggle="yes">attC</italic> were present in integrons from clinical 
                <italic toggle="yes">P. aeruginosa</italic> isolates (PS1 and PS26)
                <sup>
                    <xref ref-type="bibr" rid="ref-10">10</xref>
                </sup>. Total RNA was extracted and purified according to the manufacturer&#x2019;s instructions with the SV 96 Total RNA Isolation System (Promega). Northern blot using 7 &#x03bc;g of total RNA from PS1 and PS26 was performed in order to detect the transcript originated from 
                <italic toggle="yes">gcu14</italic>-
                <italic toggle="yes">bla</italic>
                <sub>GES-1</sub>/
                <italic toggle="yes">aacA4</italic> cassette array. After electrophoresis in a denaturing-formaldehyde 1.5% agarose gel, the total RNA was transferred to the Hybond-N
                <sup>+</sup> nylon membrane (GE Healthcare) by upward capillary transfer. An amplicon of 519bp corresponding to part of the 
                <italic toggle="yes">bla</italic>
                <sub>GES-1</sub> gene was used as a probe (
                <xref ref-type="table" rid="T1">Table 1</xref>) in hybridization assay. The GES probe was labeled with the AlkPhos Direct Labelling kit (GE Healthcare) and hybridized with the target RNA immobilized on the Hybond-N
                <sup>+</sup> membrane as recommended. The chemiluminescence was detected with the 
                <italic toggle="yes">CDP</italic>-Star detection reagent (GE Healthcare) according to manufactures. Immediately after applying the detection reagents, the blot was drained, incubated five minutes at room temperature and exposed to the Hyperfilm ECL (GE Healthcare) for 60 minutes at room temperature.</p>
            <table-wrap id="T1" orientation="portrait" position="anchor">
                <label>Table 1. </label>
                <caption>
                    <title>Primers used in conventional, inverse and real-time PCR reactions.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="left" colspan="1" rowspan="1">Primer</th>
                            <th align="left" colspan="1" rowspan="1">Primer sequence (5' &#x2013; 3')</th>
                            <th align="left" colspan="1" rowspan="1">Size (bp)</th>
                            <th align="left" colspan="1" rowspan="1">Target</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td align="center" colspan="4" rowspan="1">
                                <bold>Primers for conventional PCR</bold>
                            </td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">Ges F
                                <break/>Ges R</td>
                            <td colspan="1" rowspan="1">GCGTTTTGCAATGTGCTC
                                <break/>CCAGTTTTCTCTCCAACAACC</td>
                            <td colspan="1" rowspan="1">519</td>
                            <td colspan="1" rowspan="1">Internal fragment of
                                <break/>
                                <italic toggle="yes">bla</italic>
                                <sub>GES</sub> gene</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="4" rowspan="1">
                                <bold>Primers for inverse PCR</bold>
                            </td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">Gcu14 FSQ
                                <break/>Gcu14 RSQ</td>
                            <td colspan="1" rowspan="1">AGCAATCAACACACAGGGG
                                <break/>CTCGCGTAAATGCACCGCTT</td>
                            <td colspan="1" rowspan="1">130</td>
                            <td colspan="1" rowspan="1">
                                <italic toggle="yes">gcu14</italic> circular form</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">GES FSQ
                                <break/>GES RSQ</td>
                            <td colspan="1" rowspan="1">CAAGTTATTACACAACTCAT
                                <break/>AGTGCGTGAATGAAGCGCAT</td>
                            <td colspan="1" rowspan="1">110</td>
                            <td colspan="1" rowspan="1">
                                <italic toggle="yes">bla</italic>
                                <sub>GES-1</sub> circular form</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">AACA4 FSQ
                                <break/>AACA4 RSQ</td>
                            <td colspan="1" rowspan="1">GCCAGGCATTCGAGCGAACAC
                                <break/>ATTTAGCCACTCACATAGAGC</td>
                            <td colspan="1" rowspan="1">188</td>
                            <td colspan="1" rowspan="1">
                                <italic toggle="yes">aacA4</italic> circular form</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="4" rowspan="1">
                                <bold>Primers and probes for real time PCR (TaqMan)</bold>
                            </td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">RpsL F
                                <break/>RpsL R
                                <break/>
Probe</td>
                            <td colspan="1" rowspan="1">GCCTGCGCTGCAAAACT
                                <break/>TTTCGGCGTGGTGGTGTAT
                                <break/>TCGTGGCGTATGCACC</td>
                            <td colspan="1" rowspan="1">67</td>
                            <td colspan="1" rowspan="1">
                                <italic toggle="yes">rpsL</italic> transcripts</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">Gcu14 F
                                <break/>Gcu14 R
                                <break/>Probe</td>
                            <td colspan="1" rowspan="1">CATGCGCTTCTTGGTTCGT
                                <break/>ACGCCAGCTTGGATGCAA
                                <break/>ATGCCACGAGACCTT</td>
                            <td colspan="1" rowspan="1">56</td>
                            <td colspan="1" rowspan="1">
                                <italic toggle="yes">gcu14</italic> transcripts</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">Ges F2
                                <break/>Ges R2
                                <break/>Probe</td>
                            <td colspan="1" rowspan="1">GTGCAGCTTAGCGACAATGG
                                <break/>CACAGAGTCGCCAATTTTACGA
                                <break/>AATTGCAGCAGGTCCGCC</td>
                            <td colspan="1" rowspan="1">99</td>
                            <td colspan="1" rowspan="1">
                                <italic toggle="yes">bla</italic>
                                <sub>GES-1</sub> transcripts</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">AacA4 F
                                <break/>AacA4 R
                                <break/>Probe</td>
                            <td colspan="1" rowspan="1">CAAGCGTTTTAGCGCAAGAGT
                                <break/>TCGGCTCTCCATTCAGCATTG
                                <break/>CCGTCACTCCATACATTG</td>
                            <td colspan="1" rowspan="1">59</td>
                            <td colspan="1" rowspan="1">
                                <italic toggle="yes">aacA4</italic> transcripts</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">Ges F3
                                <break/>AacA4 R2
                                <break/>Probe</td>
                            <td colspan="1" rowspan="1">TCCTGAGCACGGACAAATAG
                                <break/>TCATAGAGCATCGCAAGGTC
                                <break/>TTCCGTCACACTGCGCCTCA</td>
                            <td colspan="1" rowspan="1">134</td>
                            <td colspan="1" rowspan="1">Polycistronic transcripts</td>
                        </tr>
                    </tbody>
                </table>
            </table-wrap>
            <p>In order to verify whether the relative position of gene cassettes on the variable region plays a role in transcription level, real-time RT-PCR reactions using the TaqMan System (Applied Biosystems) were performed with primers and probes detailed in 
                <xref ref-type="table" rid="T1">Table 1</xref>. The 
                <italic toggle="yes">rpsL</italic> gene of the 
                <italic toggle="yes">P. aeruginosa</italic> chromosome was amplified by PCR (
                <xref ref-type="table" rid="T1">Table 1</xref>) and used as a reference gene for normalization. The relative quantification (RQ) results were presented as ratios of gene transcription between the target gene (cassettes) and the reference gene (
                <italic toggle="yes">rpsL</italic>), which were obtained according to the following equation: RQ=2
                <sup>-&#x0394;CT</sup>, where CT is the value corresponding to the crossing point of the amplification curve with the threshold and &#x0394;CT=CT target gene minus CT reference gene. The effect of cassette position on gene transcription was considered significant when the ratios obtained between RQ values (RQ value of cassette 1/RQ value of cassette 2) were &#x2265;2.0, taking into account the standard deviation intervals.</p>
            <p>In order to induce cassette excision from integrons, PS1 and PS26 strains
                <sup>
                    <xref ref-type="bibr" rid="ref-10">10</xref>
                </sup> were submitted to thermal stress during the log growth phase to induce integrase activity. Cells were grown on Luria-Bertani (LB) broth medium (OXOID) at 37&#x00b0;C for two hours. Subsequently, the bacterial cultures were submitted to a heat shock at 4&#x00b0;C for 30 minutes and immediately incubated at 42&#x00b0;C for another 30 minutes. Briefly, the total DNA from PS1 and PS26 cultured under thermal stress were obtained with the Wizard Genomic DNA purification kit (Promega) following manufacturer recommendations and used as templates in inverse PCR reactions. The inverse PCR was performed with primers facing outwards towards the ends of 
                <italic toggle="yes">gcu14</italic>, 
                <italic toggle="yes">bla</italic>
                <sub>GES-1</sub> and 
                <italic toggle="yes">aacA4</italic> so that only circular gene cassette configurations would be amplified. The reactions targeting the circular forms of 
                <italic toggle="yes">gcu14</italic>, 
                <italic toggle="yes">bla</italic>
                <sub>GES-1</sub>, 
                <italic toggle="yes">aacA4</italic> and 
                <italic toggle="yes">bla</italic>
                <sub>GES-1</sub>/
                <italic toggle="yes">aacA4</italic> fusion was performed with primers and combinations described in 
                <xref ref-type="table" rid="T1">Table 1</xref>. The inverse PCR was performed using Platinum 
                <italic toggle="yes">Taq</italic> DNA Polymerase reagents (Invitrogen), and the following components were added to a sterile 0.2-mL tube: 5 &#x00b5;L of 10X PCR buffer (1X final concentration); 1 &#x00b5;L of 10mM dNTP mixture (0.2 mM each); 1.5 &#x00b5;L of 50mM MgCl
                <sub>2</sub> (1.5 mM final concentration); 2 &#x00b5;L of 15 &#x00b5;M of each primer (30 &#x00b5;M each); 100 ng of template DNA; 0.3 &#x00b5;L of Platinum 
                <italic toggle="yes">Taq</italic> DNA Polymerase (1U final concentration). The tubes were incubated in the Eppendorf MasterCycler (Eppendorf) at 94&#x00b0;C for 2 minutes and PCR amplification was performed in 40 cycles consisting of: 94&#x00b0;C for 30 seconds; 55&#x00b0;C for 30 seconds; and 72&#x00b0;C for 3 minutes. The amplicons generated with the inverse PCR were purified using Wizard SV Gel and PCR Clean-Up system kit (Promega) and directly sequenced on both strands. Sequencing reactions were performed with Big Dye Terminator RR Mix (Applied Biosystems) in an ABI 3730 XL DNA Analyzer (Applied Biosystems). Nucleotide sequences were compared to those available in the GenBank database accessible on the National Center for Biotechnology Information website (
                <ext-link ext-link-type="uri" xlink:href="http://www.ncbi.nlm.nih.gov">http://www.ncbi.nlm.nih.gov</ext-link>). All primers used in PCR, sequencing and real time RT-PCR are described in 
                <xref ref-type="table" rid="T1">Table 1</xref>.</p>
            <p>Analyses 
                <italic toggle="yes">in silico</italic> were performed to search for a potential promoter for 
                <italic toggle="yes">gcu14</italic> gene cassette. The 5&#x2019;UTR from 
                <italic toggle="yes">gcu14</italic> were submitted to the promoter predictor programs Neural Network for Promoter Prediction version 2.2 (Berkeley Drosophila Genome Project, 
                <ext-link ext-link-type="uri" xlink:href="http://www.fruitfly.org/index.html">http://www.fruitfly.org/index.html</ext-link>) and BPROM (SoftBerry, 
                <ext-link ext-link-type="uri" xlink:href="http://linux1.softberry.com/berry.phtml">http://linux1.softberry.com/berry.phtml</ext-link>). Results with the highest scores were selected as candidates for a putative promoter.</p>
        </sec>
        <sec sec-type="results | discussions">
            <title>Results and discussion</title>
            <p>The integrons analysed in this study harbored the weak Pc configuration (PcW)
                <sup>
                    <xref ref-type="bibr" rid="ref-11">11</xref>
                </sup>, and they carry the 
                <italic toggle="yes">gcu14</italic> as the first gene cassette (see reference 
                <xref ref-type="bibr" rid="ref-12">12</xref> for nomenclature), which has not been reported so far. Considering that transcription initiates from the Pc promoter placed upstream the cassette array, both monocistronic and full length polycistronic transcripts could be identified. In fact, Northern blot and hybridization assays revealed a unique signal of approximately 2,300 bases, which corresponds to the co-transcription of the entire array (
                <italic toggle="yes">gcu14</italic>-
                <italic toggle="yes">bla</italic>
                <sub>GES-1</sub>/
                <italic toggle="yes">aacA4</italic>) (
                <xref ref-type="fig" rid="f1">Figure 1</xref>). This result is in agreement with previous work in which the occurrence of transcripts containing more than one gene cassette was observed by Northern blot analysis
                <sup>
                    <xref ref-type="bibr" rid="ref-1">1</xref>
                </sup>. Moreover, this finding gives support to the lack of 
                <italic toggle="yes">attC</italic> function in terminating transcription of downstream gene cassettes as demonstrated previously
                <sup>
                    <xref ref-type="bibr" rid="ref-4">4</xref>
                </sup>.</p>
            <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                <label>Figure 1. </label>
                <caption>
                    <title>Northern blot analysis of 
                        <italic toggle="yes">gcu14</italic>-
                        <italic toggle="yes">bla</italic>
                        <sub>GES-1</sub>/
                        <italic toggle="yes">aacA4</italic> gene cassette array from 
                        <italic toggle="yes">P. aerginosa</italic> class 1 integron.</title>
                    <p>The full length transcript (2,300 bases), corresponding to the entire gene cassette array, hybridized with the GES probe (arrow). The fragment sizes of the RNA marker (Promega) used in RNA electrophoresis are indicated.</p>
                </caption>
                <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/8053/f1db9e5a-e05d-4311-8326-309d762b55fa_figure1.gif"/>
            </fig>
            <p>This fusion retained both entire coding regions and, due to a possible erroneous recombination event, the 
                <italic toggle="yes">bla</italic>
                <sub>GES-1</sub> 
                <italic toggle="yes">attC</italic> site was replaced by part of the 
                <italic toggle="yes">attI1</italic> site (
                <ext-link ext-link-type="uri" xlink:href="http://www.ncbi.nlm.nih.gov/nuccore/89515717">DQ236170</ext-link>)
                <sup>
                    <xref ref-type="bibr" rid="ref-10">10</xref>
                </sup>, reducing it to the 6bp from the 1L core site (
                <xref ref-type="fig" rid="f2">Figure 2</xref>). Taking into account that the region responsible for stem-loop formation was missing in GES-1 
                <italic toggle="yes">attC</italic> and the participation of this site in terminating translation
                <sup>
                    <xref ref-type="bibr" rid="ref-4">4</xref>
                </sup>, our findings indirectly suggested that 
                <italic toggle="yes">bla</italic>
                <sub>GES-1</sub> and 
                <italic toggle="yes">aacA4</italic> translation is occurring in a unique step.</p>
            <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                <label>Figure 2. </label>
                <caption>
                    <title>Sequences of the canonical (AF355189) and the truncated (this study) GES-1 
                        <italic toggle="yes">attC</italic> sites.</title>
                    <p>The underlined uppercase letters represent the 
                        <italic toggle="yes">bla</italic>
                        <sub>GES-1</sub> and 
                        <italic toggle="yes">aacA4</italic> partial coding regions. Italicized lowercase letters highlighted in grey define the 
                        <italic toggle="yes">attC</italic> sites, and their core sites (1L, 2L, 2R, 1R) are in boldface and underlined. The vertical arrows show the recombination point and the beginning of the next cassette.</p>
                </caption>
                <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/8053/f1db9e5a-e05d-4311-8326-309d762b55fa_figure2.gif"/>
            </fig>
            <p>The strains were submitted to thermal stress conditions in order to verify the dynamics of mobilization of 
                <italic toggle="yes">gcu14</italic>-
                <italic toggle="yes">bla</italic>
                <sub>GES-1</sub>/
                <italic toggle="yes">aacA4</italic> gene cassettes. Since the excision event depends on the recognition of the LH and RH domains of the 
                <italic toggle="yes">attC</italic> site, and that the 2L core site and the entire RH domain are missing in GES-1 
                <italic toggle="yes">attC</italic> (
                <xref ref-type="fig" rid="f2">Figure 2</xref>), it is expected that the 
                <italic toggle="yes">bla</italic>
                <sub>GES-1</sub>/
                <italic toggle="yes">aacA4</italic> excision occurs only at the 
                <italic toggle="yes">aacA4 attC</italic> site, and that this structure is excised together as a unique cassette.</p>
            <p>Positive results were obtained for the 
                <italic toggle="yes">gcu14</italic>, 
                <italic toggle="yes">gcu14</italic>-
                <italic toggle="yes">aacA4</italic> and 
                <italic toggle="yes">gcu14</italic>-
                <italic toggle="yes">bla</italic>
                <sub>GES-1</sub>/
                <italic toggle="yes">aacA4</italic> circular forms, but not for 
                <italic toggle="yes">bla</italic>
                <sub>GES-1</sub> and 
                <italic toggle="yes">aacA4</italic> alone. This finding indicates that the GES-1 
                <italic toggle="yes">attC</italic> is not functional and that the fused gene cassette is excised as a unique cassette. Moreover, the presence of 
                <italic toggle="yes">gcu14</italic>-
                <italic toggle="yes">aacA4</italic> circular form suggests that this strain carries a second integron containing this gene cassette arrangement. Sequencing assessed the recombination point where excision occurred, confirming the occurrence of free circular forms (
                <xref ref-type="fig" rid="f2">Figure 3</xref>). This is in agreement with the presence of the PcW configuration, in which the corresponding 
                <italic toggle="yes">intI1</italic> gene codes for a high efficient integrase
                <sup>
                    <xref ref-type="bibr" rid="ref-11">11</xref>
                </sup>. The lack of activity of a truncated 
                <italic toggle="yes">attC</italic> had also been observed before when associated with 
                <italic toggle="yes">aadA10</italic>
                <sup>
                    <xref ref-type="bibr" rid="ref-13">13</xref>
                </sup>. However, Ramirez and colleagues
                <sup>
                    <xref ref-type="bibr" rid="ref-14">14</xref>
                </sup> showed that the integrase was able to recognize and mediate excision of a truncated site associated to 
                <italic toggle="yes">aadA1</italic>, indicating that the genetic context of such truncated sites could influence their role in IntI1 recognition and mobilization.</p>
            <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                <label>Figure 3. </label>
                <caption>
                    <title>Schematic representation of the free circular form cassette array resulted from the inverse PCR assay.</title>
                    <p>
						(
                        <bold>A</bold>) inserted/linearized form of integron harbouring the fused cassettes. Arrows show the gene transcription orientation. Thin arrows represent the annealing sites of the inverse PCR and sequencing primers whose generated product corresponded to the cassette circular form illustrated in (
                        <bold>B</bold>). (
                        <bold>B</bold>) Illustration of the free circular form of gene cassettes represented in (
                        <bold>A</bold>). Thin arrows show the primers used to obtain the inverse PCR product (GES FSQ and GES RSQ) and the primers used in sequencing (AACA4 FSQ and GES RSQ) that revealed the excision in block of the entire gene cassette arrangement (
                        <italic toggle="yes">gcu14</italic>-
                        <italic toggle="yes">bla</italic>
                        <sub>GES-1</sub>/
                        <italic toggle="yes">aacA4</italic>) from integron (red curved line).</p>
                </caption>
                <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/8053/f1db9e5a-e05d-4311-8326-309d762b55fa_figure3.gif"/>
            </fig>
            <p>The relative quantification performed by real time RT-PCR revealed that PS1 and PS26 presented very similar RQ values for 
                <italic toggle="yes">gcu14</italic>-
                <italic toggle="yes">bla</italic>
                <sub>GES-1</sub>/
                <italic toggle="yes">aacA4</italic> transcription (
                <xref ref-type="fig" rid="f4">Figure 4</xref>). This result was expected since integrons from these two strains have the same backbone, including the Pc promoter, and are at the same genetic environment
                <sup>
                    <xref ref-type="bibr" rid="ref-10">10</xref>
                </sup>.</p>
            <fig fig-type="figure" id="f4" orientation="portrait" position="float">
                <label>Figure 4. </label>
                <caption>
                    <title>Transcription level of 
                        <italic toggle="yes">gcu14</italic>-
                        <italic toggle="yes">bla</italic>
                        <sub>GES-1</sub>/
                        <italic toggle="yes">aacA4</italic> gene cassette array.</title>
                    <p>The relative quantification values obtained by real time RT-PCR are indicated for each gene cassette and for the fusion 
                        <italic toggle="yes">bla</italic>
                        <sub>GES-1</sub>/
                        <italic toggle="yes">aacA4</italic> when considered as a unique gene.</p>
                </caption>
                <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/8053/f1db9e5a-e05d-4311-8326-309d762b55fa_figure4.gif"/>
            </fig>
            <p>
                <italic toggle="yes">gcu14</italic>, the first cassette in integrons with the weak PcW configuration, presented approximately two-fold higher transcription when compared to 
                <italic toggle="yes">bla</italic>
                <sub>GES-1</sub> and 
                <italic toggle="yes">aacA4</italic> separately or when the fused cassette 
                <italic toggle="yes">bla</italic>
                <sub>GES-1</sub>/
                <italic toggle="yes">aacA4</italic> was considered (
                <xref ref-type="fig" rid="f4">Figure 4</xref>). The same RQ value obtained for 
                <italic toggle="yes">bla</italic>
                <sub>GES-1</sub>, 
                <italic toggle="yes">aacA4</italic> and the fusion reveals that these two ORFs are transcribed as a unique gene. The lower transcript amount of 
                <italic toggle="yes">bla</italic>
                <sub>GES-1</sub>/
                <italic toggle="yes">aacA4</italic> compared to 
                <italic toggle="yes">gcu14</italic> lies on the distance between these gene cassettes and Pc, which is one of the determinants influencing cassette transcription
                <sup>
                    <xref ref-type="bibr" rid="ref-1">1</xref>,
                    <xref ref-type="bibr" rid="ref-7">7</xref>
                </sup>, and it shows the effect of cassette position on expression levels.</p>
            <p>A putative promoter for 
                <italic toggle="yes">gcu14</italic> (-35 TTGATG [17 bp] -10 TGTTAC) was found 45 bp upstream from its start codon, which has the potential to influence transcription. Moreover, the ORF-11, which enhances the translation efficiency of downstream TIR-deficient cassettes inserted in integrons
                <sup>
                    <xref ref-type="bibr" rid="ref-5">5</xref>
                </sup>, was found at the 
                <italic toggle="yes">attI1</italic> region preceding the TIR-deficient 
                <italic toggle="yes">gcu14</italic> gene cassette. This ORF contained its own Shine-Dalgarno (SD) sequence placed 8 bp upstream of the ATG codon. The ribosome at the ORF-11 stop codon could, therefore, be carried along the mRNA by lateral diffusion, reinitiating translation at the 
                <italic toggle="yes">gcu14</italic> start codon. A potential SD sequence was identified 10 bp upstream of the fused cassette 
                <italic toggle="yes">bla</italic>
                <sub>GES-1</sub>/
                <italic toggle="yes">aacA4</italic>. In addition, the loss of the GES-1 
                <italic toggle="yes">attC</italic> region, which is involved in stem-loop formation, may enhance the chances of 
                <italic toggle="yes">aacA4</italic> translation, since this 
                <italic toggle="yes">attC,</italic> reduced to the 6bp of the 1L core site, no longer constitutes a physical barrier to ribosome progression
                <sup>
                    <xref ref-type="bibr" rid="ref-4">4</xref>
                </sup>. Together, these findings create a scenario for the occurrence of 
                <italic toggle="yes">gcu14</italic>-
                <italic toggle="yes">bla</italic>
                <sub>GES-1</sub>/
                <italic toggle="yes">aacA4</italic> expression in PS1 and PS26, which then provides a possible explanation for their resistance profile to &#x03b2;-lactams and aminoglycosides that has been observed elsewhere
                <sup>
                    <xref ref-type="bibr" rid="ref-10">10</xref>
                </sup>.</p>
            <media content-type="figshare" orientation="portrait" position="float" xlink:href="http://dx.doi.org/10.6084/m9.figshare.651717"/>
        </sec>
        <sec sec-type="conclusions">
            <title>Conclusions</title>
            <p>Fused cassettes have been found in class 1 integrons
                <sup>
                    <xref ref-type="bibr" rid="ref-9">9</xref>,
                    <xref ref-type="bibr" rid="ref-13">13</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-18">18</xref>
                </sup>; however, the transcription of such structures has rarely been addressed. This work showed the transcription pattern of a fused cassette as a polycistronic mRNA and that these unusual structures are excised as a unique cassette. The mobilization in block of the entire 
                <italic toggle="yes">gcu14</italic>-
                <italic toggle="yes">bla</italic>
                <sub>GES-1</sub>/
                <italic toggle="yes">aacA4</italic> array together with its active transcription, and the presence of translational signatures demonstrate the potential for dissemination and expression of multidrug resistance, in a one-step fashion, to other bacteria. Therefore, such events could represent a threat to public health and to the establishment of efficient antibiotic regiments.</p>
            <sec>
                <title>Nucleotide sequence accession number</title>
                <p>The sequence of the cassette array composed by the fusion has been deposited in the GenBank database under accession number 
                    <ext-link ext-link-type="uri" xlink:href="http://www.ncbi.nlm.nih.gov/nuccore/DQ236170">DQ236170</ext-link>. The sequence obtained from the inverse PCR amplicon, showing the circular form gene organization, was submitted to GenBank under accession number 
                    <ext-link ext-link-type="uri" xlink:href="http://www.ncbi.nlm.nih.gov/nuccore/KT336477">KT336477</ext-link>.</p>
            </sec>
        </sec>
        <sec>
            <title>Data availability</title>
            <p>The data referenced by this article are under copyright with the following copyright statement: Copyright: &#x00ef;&#x00bf;&#x00bd; 2015 Fonseca &#x00c9;L and Vicente ACP</p>
            <p>Data associated with the article are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication).
                <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/publicdomain/zero/1.0/"/>
            </p>
            <p>
                <italic toggle="yes">Figshare:</italic> Polycistronic transcription of fused cassettes and identification of translation initiation signals in an unusual gene cassette array from 
                <italic toggle="yes">Pseudomonas aeruginosa</italic> doi:  
                <ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.6084/m9.figshare.651717">http://dx.doi.org/10.6084/m9.figshare.651717</ext-link>
                <sup>
                    <xref ref-type="bibr" rid="ref-19">19</xref>
                </sup>
            </p>
        </sec>
    </body>
    <back>
        <ack>
            <title>Acknowledgements</title>
            <p>We thank those involved in PDTIS platform to enable us to do the sequencing and real-time relative quantification analysis work.</p>
        </ack>
        <ref-list>
            <ref id="ref-1">
                <label>1</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Collis</surname>
                            <given-names>CM</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Hall</surname>
                            <given-names>RM</given-names>
                        </name>
					</person-group>:
                    <article-title>Expression of antibiotic resistance genes in the integrated cassettes of integrons.</article-title>
                    <source>
						
                        <italic toggle="yes">Antimicrob Agents Chemother.</italic>
					</source>
                    <year>1995</year>;<volume>39</volume>(<issue>1</issue>):<fpage>155</fpage>&#x2013;<lpage>162</lpage>.
                    <pub-id pub-id-type="pmid">7695299</pub-id>
                    <pub-id pub-id-type="doi">10.1128/AAC.39.1.155</pub-id>
                    <pub-id pub-id-type="pmcid">162502</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-2">
                <label>2</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Collis</surname>
                            <given-names>CM</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Hall</surname>
                            <given-names>RM</given-names>
                        </name>
					</person-group>:
                    <article-title>Site-specific deletion and rearrangement of integron insert genes catalyzed by the integron DNA integrase.</article-title>
                    <source>
						
                        <italic toggle="yes">J Bacteriol.</italic>
					</source>
                    <year>1992</year>;<volume>174</volume>(<issue>5</issue>):<fpage>1574</fpage>&#x2013;<lpage>1585</lpage>.
                    <pub-id pub-id-type="pmid">1311297</pub-id>
                    <pub-id pub-id-type="pmcid">206553</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-3">
                <label>3</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Stokes</surname>
                            <given-names>HW</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>O'Gorman</surname>
                            <given-names>DB</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Recchia</surname>
                            <given-names>GD</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title> Structure and function of 59-base element recombination sites associated with mobile gene cassettes.</article-title>
                    <source>
						
                        <italic toggle="yes">Mol Microbiol.</italic>
					</source>
                    <year>1997</year>;<volume>26</volume>(<issue>4</issue>):<fpage>731</fpage>&#x2013;<lpage>745</lpage>.
                    <pub-id pub-id-type="pmid">9427403</pub-id>
                    <pub-id pub-id-type="doi">10.1046/j.1365-2958.1997.6091980.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-4">
                <label>4</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Jacquier</surname>
                            <given-names>H</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Zaoui</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Sanson-le Pors</surname>
                            <given-names>MJ</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title> Translation regulation of integrons gene cassette expression by the 
                        <italic toggle="yes">attC</italic> sites.</article-title>
                    <source>
						
                        <italic toggle="yes">Mol Microbiol.</italic>
					</source>
                    <year>2009</year>;<volume>72</volume>(<issue>6</issue>):<fpage>1475</fpage>&#x2013;<lpage>1486</lpage>.
                    <pub-id pub-id-type="pmid">19486293</pub-id>
                    <pub-id pub-id-type="doi">10.1111/j.1365-2958.2009.06736.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-5">
                <label>5</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Hanau-Ber&#x00e7;ot</surname>
                            <given-names>B</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Podglagen</surname>
                            <given-names>I</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Casin</surname>
                            <given-names>I</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>An intrinsic control element for translational initiation in class 1 integrons.</article-title>
                    <source>
						
                        <italic toggle="yes">Mol Microbiol.</italic>
					</source>
                    <year>2002</year>;<volume>44</volume>(<issue>1</issue>):<fpage>119</fpage>&#x2013;<lpage>130</lpage>.
                    <pub-id pub-id-type="pmid">11967073</pub-id>
                    <pub-id pub-id-type="doi">10.1046/j.1365-2958.2002.02843.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-6">
                <label>6</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Recchia</surname>
                            <given-names>GD</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Hall</surname>
                            <given-names>RM</given-names>
                        </name>
					</person-group>:
                    <article-title>Plasmid evolution by acquisition of mobile gene cassettes:  plasmid pIE723 contains the 
                        <italic toggle="yes">aadB</italic> gene cassette precisely inserted at a secondary site in the incQ plasmid RSF1010.</article-title>
                    <source>
						
                        <italic toggle="yes">Mol Microbiol.</italic>
					</source>
                    <year>1995</year>;<volume>15</volume>(<issue>1</issue>):<fpage>179</fpage>&#x2013;<lpage>187</lpage>.
                    <pub-id pub-id-type="pmid">7752893</pub-id>
                    <pub-id pub-id-type="doi">10.1111/j.1365-2958.1995.tb02232.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-7">
                <label>7</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Hocquet</surname>
                            <given-names>D</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Llanes</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Thouverez</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Evidence for induction of integron-based antibiotic resistance by the SOS response in a clinical setting.</article-title>
                    <source>
						
                        <italic toggle="yes">PLoS Pathog.</italic>
					</source>
                    <year>2012</year>;<volume>8</volume>(<issue>6</issue>):<fpage>e1002778</fpage>.
                    <pub-id pub-id-type="pmid">22719259</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.ppat.1002778</pub-id>
                    <pub-id pub-id-type="pmcid">3375312</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-8">
                <label>8</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Recchia</surname>
                            <given-names>GD</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Hall</surname>
                            <given-names>RM</given-names>
                        </name>
					</person-group>:
                    <article-title>Gene cassettes:  a new class of mobile element.</article-title>
                    <source>
						
                        <italic toggle="yes">Microbiology.</italic>
					</source>
                    <year>1995</year>;<volume>141</volume>(<issue>Pt 12</issue>):<fpage>3015</fpage>&#x2013;<lpage>3027</lpage>.
                    <pub-id pub-id-type="pmid">8574395</pub-id>
                    <pub-id pub-id-type="doi">10.1099/13500872-141-12-3015</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-9">
                <label>9</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Mendes</surname>
                            <given-names>RE</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Toleman</surname>
                            <given-names>MA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Ribeiro</surname>
                            <given-names>J</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Integron carrying a novel metallo-beta-lactamase gene, 
                        <italic toggle="yes">bla</italic>
                        <sub>IMP-16</sub>, and a fused form of aminoglycoside-resistant gene 
                        <italic toggle="yes">aac(6')-30/aac(6')-Ib'</italic>: report from the SENTRY Antimicrobial Surveillance Program.</article-title>
                    <source>
						
                        <italic toggle="yes">Antimicrob Agents Chemother.</italic>
					</source>
                    <year>2004</year>;<volume>48</volume>(<issue>12</issue>):<fpage>4693</fpage>&#x2013;<lpage>4702</lpage>.
                    <pub-id pub-id-type="pmid">15561846</pub-id>
                    <pub-id pub-id-type="doi">10.1128/AAC.48.12.4693-4702.2004</pub-id>
                    <pub-id pub-id-type="pmcid">529210</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-10">
                <label>10</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>da Fonseca</surname>
                            <given-names>EL</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Vieira</surname>
                            <given-names>VV</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Cipriano</surname>
                            <given-names>R</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Emergence of 
                        <italic toggle="yes">bla</italic>
                        <sub>GES-5</sub> in clinical colistin-only-sensitive (COS) 
                        <italic toggle="yes">Pseudomonas aeruginosa</italic> strain in Brazil.</article-title>
                    <source>
						
                        <italic toggle="yes">J Antimicrob Chemother.</italic>
					</source>
                    <year>2007</year>;<volume>59</volume>(<issue>3</issue>):<fpage>576</fpage>&#x2013;<lpage>577</lpage>.
                    <pub-id pub-id-type="pmid">17284538</pub-id>
                    <pub-id pub-id-type="doi">10.1093/jac/dkl517</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-11">
                <label>11</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Jov&#x00e9;</surname>
                            <given-names>T</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Da Re</surname>
                            <given-names>S</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Denis</surname>
                            <given-names>F</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Inverse correlation between promoter strength and excision activity in class 1 integrons.</article-title>
                    <source>
						
                        <italic toggle="yes">PLoS Genet.</italic>
					</source>
                    <year>2010</year>;<volume>6</volume>(<issue>1</issue>):<fpage>e1000793</fpage>.
                    <pub-id pub-id-type="pmid">20066027</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pgen.1000793</pub-id>
                    <pub-id pub-id-type="pmcid">2791841</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-12">
                <label>12</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Partridge</surname>
                            <given-names>SR</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Tsafnat</surname>
                            <given-names>G</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Coiera</surname>
                            <given-names>E</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Gene cassettes and cassette arrays in mobile resistance integrons.</article-title>
                    <source>
						
                        <italic toggle="yes">FEMS Microbiol Rev.</italic>
					</source>
                    <year>2009</year>;<volume>33</volume>(<issue>4</issue>):<fpage> 757</fpage>&#x2013;<lpage>784</lpage>.
                    <pub-id pub-id-type="pmid">19416365</pub-id>
                    <pub-id pub-id-type="doi">10.1111/j.1574-6976.2009.00175.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-13">
                <label>13</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Partridge</surname>
                            <given-names>SR</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Collis</surname>
                            <given-names>CM</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Hall</surname>
                            <given-names>RM</given-names>
                        </name>
					</person-group>:
                    <article-title>Class 1 integron containing a new gene cassette, 
                        <italic toggle="yes">aadA10</italic>, associated with Tn
                        <italic toggle="yes">1404</italic> from R151.</article-title>
                    <source>
						
                        <italic toggle="yes">Antimicrob Agents Chemother.</italic>
					</source>
                    <year>2002</year>;<volume>46</volume>(<issue>8</issue>):<fpage>2400</fpage>&#x2013;<lpage>2408</lpage>.
                    <pub-id pub-id-type="pmid">12121911</pub-id>
                    <pub-id pub-id-type="doi">10.1128/AAC.46.8.2400-2408.2002</pub-id>
                    <pub-id pub-id-type="pmcid">127381</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-14">
                <label>14</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Ramirez</surname>
                            <given-names>MS</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Parenteau</surname>
                            <given-names>TR</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Centron</surname>
                            <given-names>D</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Functional characterization of Tn
                        <italic toggle="yes">1331</italic> gene cassettes.</article-title>
                    <source>
						
                        <italic toggle="yes">J Antimicrob Chemother.</italic>
					</source>
                    <year>2008</year>;<volume>62</volume>(<issue>4</issue>):<fpage>669</fpage>&#x2013;<lpage>673</lpage>.
                    <pub-id pub-id-type="pmid">18632872</pub-id>
                    <pub-id pub-id-type="doi">10.1093/jac/dkn279</pub-id>
                    <pub-id pub-id-type="pmcid">2536708</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-15">
                <label>15</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Poirel</surname>
                            <given-names>L</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Le Thomas</surname>
                            <given-names>I</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Naas</surname>
                            <given-names>T</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Biochemical sequence analyses of GES-1, a novel class A extended-spectrum beta-lactamase, and the class 1 integron In52 from 
                        <italic toggle="yes">Klebsiella pneumoniae</italic>.</article-title>
                    <source>
						
                        <italic toggle="yes">Antimicrob Agents Chemother.</italic>
					</source>
                    <year>2000</year>;<volume>44</volume>(<issue>3</issue>):<fpage>622</fpage>&#x2013;<lpage>632</lpage>.
                    <pub-id pub-id-type="pmid">10681329</pub-id>
                    <pub-id pub-id-type="doi">10.1128/AAC.44.3.622-632.2000</pub-id>
                    <pub-id pub-id-type="pmcid">89737</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-16">
                <label>16</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>C&#x00e9;ntron</surname>
                            <given-names>D</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Roy</surname>
                            <given-names>PH</given-names>
                        </name>
					</person-group>:
                    <article-title>Presence of a group II intron in a multiresistant 
                        <italic toggle="yes">Serratia marcescens</italic> strain that harbors three integrons and a novel gene fusion.</article-title>
                    <source>
						
                        <italic toggle="yes">Antimicrob Agents Chemother.</italic>
					</source>
                    <year>2002</year>;<volume>46</volume>(<issue>5</issue>):<fpage>1402</fpage>&#x2013;<lpage>1409</lpage>.
                    <pub-id pub-id-type="pmid">11959575</pub-id>
                    <pub-id pub-id-type="doi">10.1128/AAC.46.5.1402-1409.2002</pub-id>
                    <pub-id pub-id-type="pmcid">127176</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-17">
                <label>17</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Dubois</surname>
                            <given-names>V</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Poirel</surname>
                            <given-names>L</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Marie</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Molecular characterization of a novel class 1 integron containing 
                        <italic toggle="yes">bla</italic>
                        <sub>GES-1</sub> and a fused product of 
                        <italic toggle="yes">aac3-Ib/aac6'-Ib'</italic> gene cassettes in 
                        <italic toggle="yes">Pseudomonas aeruginosa</italic>.</article-title>
                    <source>
						
                        <italic toggle="yes">Antimicrob Agents Chemother.</italic>
					</source>
                    <year>2002</year>;<volume>46</volume>(<issue>3</issue>):<fpage>638</fpage>&#x2013;<lpage>645</lpage>.
                    <pub-id pub-id-type="pmid">11850242</pub-id>
                    <pub-id pub-id-type="doi">10.1128/AAC.46.3.638-645.2002</pub-id>
                    <pub-id pub-id-type="pmcid">127466</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-18">
                <label>18</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Walsh</surname>
                            <given-names>TR</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Toleman</surname>
                            <given-names>MA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Hryniewicz</surname>
                            <given-names>W</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Evolution of an integron carrying 
                        <italic toggle="yes">bla</italic>
                        <sub>VIM-2</sub> in Eastern Europe:  report from the SENTRY Antimicrobial Surveillance Program.</article-title>
                    <source>
						
                        <italic toggle="yes">J Antimicrob Chemother.</italic>
					</source>
                    <year>2003</year>;<volume>52</volume>(<issue>1</issue>):<fpage>116</fpage>&#x2013;<lpage>119</lpage>.
                    <pub-id pub-id-type="pmid">12805257</pub-id>
                    <pub-id pub-id-type="doi">10.1093/jac/dkg299</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-19">
                <label>19</label>
                <mixed-citation publication-type="data">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Fonseca</surname>
                            <given-names>&#x00c9;L</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Vicente</surname>
                            <given-names>ACP</given-names>
                        </name>
					</person-group>:
                    <article-title>RQ fused cassette raw data for 
                        <italic toggle="yes">Pseudomonas aeruginosa</italic> isolates PS1 and PS26.</article-title>
                    <source>
						
                        <italic toggle="yes">Figshare.</italic>
					</source>
                    <year>2013</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.6084/m9.figshare.651717">Data Source</ext-link>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report11365">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.8053.r11365</article-id>
            <title-group>
                <article-title>Reviewer response for version 3</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Partridge</surname>
                        <given-names>Sally</given-names>
                    </name>
                    <xref ref-type="aff" rid="r11365a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r11365a1">
                    <label>1</label>Sydney West Area Health Service, Sydney, NSW, Australia</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>30</day>
                <month>11</month>
                <year>2015</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2015 Partridge S</copyright-statement>
                <copyright-year>2015</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport11365" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.2-99.v3"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>The grey shading to indicate the attC site should not start until the start of 1L and the portion derived from attI1 is still not indicated.</p>
            <p>Reviewer Expertise:</p>
            <p>NA</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report10226">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.3720.r10226</article-id>
            <title-group>
                <article-title>Reviewer response for version 2</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Partridge</surname>
                        <given-names>Sally</given-names>
                    </name>
                    <xref ref-type="aff" rid="r10226a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r10226a1">
                    <label>1</label>Sydney West Area Health Service, Sydney, NSW, Australia</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>18</day>
                <month>11</month>
                <year>2015</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2015 Partridge S</copyright-statement>
                <copyright-year>2015</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport10226" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.2-99.v2"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>This manuscript has been improved and the points I raised have been addressed, but I have some comments about the new Fig. 2:
                <list list-type="order">
                    <list-item>
                        <p>The underlined uppercase letters indicating the blaGES-1 coding region should extend until the stop codon at position 914.</p>
                    </list-item>
                    <list-item>
                        <p>ttagat of the IR site shown for the complete blaGES-1 attC is really part of the adjacent 3'-CS in AF355189 (most of the 1R core site belonging to the blaGES cassette (TTAGAC) is found at the start of the linear cassette). I would suggest ending this sequence after the first g of this site.</p>
                    </list-item>
                    <list-item>
                        <p>The partial 1L of the truncated blaGES cassette (924-9), the nucleotides derived from the attI1 site (930-6) and 1R of the aacA4 cassette (937-42) should be indicated. I would suggest ending the sequence of the truncated cassette after 1R of aacA4, as the alignment of the complete attC with the start of the aacA4 cassette beyond this point is not really useful.</p>
                    </list-item>
                </list>
            </p>
            <p>Reviewer Expertise:</p>
            <p>NA</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
        <sub-article article-type="response" id="comment1700-10226">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Fonseca</surname>
                            <given-names>Erica</given-names>
                        </name>
                        <aff>Instituto Oswaldo Cruz, Brazil</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>There is no competing interests</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>19</day>
                    <month>11</month>
                    <year>2015</year>
                </pub-date>
            </front-stub>
            <body>
                <p>Reviewer: The underlined uppercase letters indicating the blaGES-1 coding region should extend until the stop codon at position 914.</p>
                <p>Response: Reviewer is right. This was corrected in the figure. Actually, the figure was modified in order to make clearer the differences between the canonical GES-1 attC and the truncated GES-1 attC found in this study.</p>
                <p>Reviewer: ttagat of the IR site shown for the complete blaGES-1 attC is really part of the adjacent 3'-CS in AF355189 (most of the 1R core site belonging to the blaGES cassette (TTAGAC) is found at the start of the linear cassette). I would suggest ending this sequence after the first g of this site.</p>
                <p>Response: We agree and this was corrected in the new figure.</p>
                <p>Reviewer: The partial 1L of the truncated blaGES cassette (924-9), the nucleotides derived from the attI1 site (930-6) and 1R of the aacA4 cassette (937-42) should be indicated. I would suggest ending the sequence of the truncated cassette after 1R of aacA4, as the alignment of the complete attC with the start of the aacA4 cassette beyond this point is not really useful.</p>
                <p>Response: We agree and this was modified in the new figure.</p>
            </body>
        </sub-article>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report10563">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.3720.r10563</article-id>
            <title-group>
                <article-title>Reviewer response for version 2</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Ber&#x00e7;ot</surname>
                        <given-names>B&#x00e9;atrice</given-names>
                    </name>
                    <xref ref-type="aff" rid="r10563a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r10563a1">
                    <label>1</label>Service de Bact&#x00e9;riologie-Virologie, H&#x00f4;pital de Bic&#x00ea;tre, Paris, France</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>28</day>
                <month>9</month>
                <year>2015</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2015 Ber&#x00e7;ot B</copyright-statement>
                <copyright-year>2015</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport10563" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.2-99.v2"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>I have read the updated paper which is clear and well written.&#x00a0;Little is known in transcription of fused cassettes and these experimental data highlighted that the two genes are cotranscripted and mobilized together.&#x00a0;The author answered all my request and I have &#x00a0;not supplementary remarks</p>
            <p>Reviewer Expertise:</p>
            <p>NA</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report961">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.903.r961</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Ber&#x00e7;ot</surname>
                        <given-names>B&#x00e9;atrice</given-names>
                    </name>
                    <xref ref-type="aff" rid="r961a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r961a1">
                    <label>1</label>Service de Bact&#x00e9;riologie-Virologie, H&#x00f4;pital de Bic&#x00ea;tre, Paris, France</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>21</day>
                <month>5</month>
                <year>2013</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2013 Ber&#x00e7;ot B</copyright-statement>
                <copyright-year>2013</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport961" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.2-99.v1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>This work is conducted to address the transcription of the fused gene cassette 
                <italic>bla</italic>
                <sub>GES-1</sub>/
                <italic>aacA4.</italic> This arrangement is rare but not exceptional in a class 1 integron. In this work, the experimentation confirmed that the three gene cassettes harbored in this class 1 integron were expressed together from a unique polycistronic transcript.</p>
            <p>It seems that the authors have observed a circular form containing the 
                <italic>gcu14</italic> gene cassette associated with the 
                <italic>aacA4</italic> gene cassette. Could they explain this arrangement? Is it possible that the 
                <italic>Pseudomonas</italic> isolates harbored another class 1 integron containing the 
                <italic>gcu14</italic> gene followed by&#x00a0;the
                <italic> aacA4</italic> gene?</p>
            <p>The authors have to provide in the paper the classical length of the 
                <italic>bla</italic>
                <sub>GES-1</sub> 
                <italic>attC </italic>site, which is 110bp and contained the 1L, 2L, 2R and 1R sequences-shown in bold.&#x00a0;</p>
            <p>TTGACGCCC&#x00a0;
                <bold>GTCTAAC</bold>
                <bold>&#x00a0;</bold>AATTC&#x00a0;
                <bold>GTTCAAGC</bold>
                <bold>&#x00a0;</bold>CGACGTTGCTTCGTGGCGGCGCTTGCGTGCTACGCTAAGCTTCGCACGCCGCTTGCCACTGCGCACCGCG&#x00a0;
                <bold>GCTTAAC</bold>
                <bold>&#x00a0;</bold>TCAGGC&#x00a0;
                <bold>GTTAGNC</bold>
            </p>
            <p>In the 
                <italic>Pseudomonas </italic>SP26 and PS1 isolates, the 
                <italic>bla</italic>
                <sub>GES- 1</sub> 
                <italic>attC</italic> site is reduced to the 6 bp of 1 L box.</p>
            <p>TTGACGCCC&#x00a0;
                <bold>GTCTAA</bold>
                <bold>&#x00a0;</bold>AACAAAGTTAGGCATCACAAAGTACAGCATC
                <bold>&#x00a0;
                    <italic>GTG</italic>
                </bold>
            </p>
            <p>So, the distance from of the stop of
                <italic> bla</italic>
                <sub>GES-1</sub> to the start codon of the 
                <italic>aacA4 </italic>gene is 46bp. The translational start codon of 
                <italic>aacA4</italic> gene is erroneous in the Genbank data base (
                <ext-link ext-link-type="uri" xlink:href="http://www.ncbi.nlm.nih.gov/nucest/DC236170">DC236170</ext-link>). Indeed, it has been determined by N-terminal amino acid sequencing to be a GTG (in italic in the sequence above) and the beginning of the cassette was 24 bp before [
                <ext-link ext-link-type="uri" xlink:href="http://www.ncbi.nlm.nih.gov/pubmed/11967073">Hanau-Bercot B. et al., 2002</ext-link>].</p>
            <p>-Could&#x00a0;the Genbank&#x00a0;annotation be&#x00a0;modified&#x00a0;as explained above?</p>
            <p>-The Appendex is not necessary and should be deleted.</p>
            <p>-In the sentence page 4, line 13, &#x201c;The single copy of 
                <italic>rpsL</italic> gene of 
                <italic>Pseudomonas</italic>...&#x201d;, should be replaced by &#x201c;the 
                <italic>rpsL</italic> gene of 
                <italic>Pseudomonas</italic> (see&#x00a0;
                <ext-link ext-link-type="uri" xlink:href="http://www.ncbi.nlm.nih.gov/pubmed/22545126">Bodilis et al., 2012</ext-link>)</p>
            <p>-In the conclusion, page 6, change &#x201c;never&#x201d; to &#x201c;rarely&#x201d;.</p>
            <p>Reviewer Expertise:</p>
            <p>NA</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
        <sub-article article-type="response" id="comment1498-961">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Fonseca</surname>
                            <given-names>Erica</given-names>
                        </name>
                        <aff>Instituto Oswaldo Cruz, Brazil</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>There is no competing interests</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>5</day>
                    <month>8</month>
                    <year>2015</year>
                </pub-date>
            </front-stub>
            <body>
                <p>It seems that the authors have observed a circular form containing the gcu14 gene cassette associated with the aacA4 gene cassette. Could they explain this arrangement? Is it possible that the Pseudomonas isolates harbored another class 1 integron containing the gcu14 gene followed by the aacA4 gene?</p>
                <p>
                    <bold>Response:</bold> Yes, the presence of the gcu14-aacA4 circular form indicates that this strain harbours a second integron composed by the gcu14-aacA4 arrangement. However, this result does not invalidate our main conclusion, which is that the truncated GES-1 attC site is not functional and this gene is only mobilized when recombination occurs in aacA4 attC. A brief explanation was included in the text (Results section).</p>
                <p>The authors have to provide in the paper the classical length of the 
                    <italic>bla</italic>
                    <sub>GES-1</sub> 
                    <italic>attC </italic>site, which is 110bp and contained the 1L, 2L, 2R and 1R sequences-shown in bold.</p>
                <p>
                    <bold>Response:</bold> A figure showing the truncated and the complete canonical 
                    <italic>attC</italic> from GES1 was included in the new version.</p>
                <p>So, the distance from of the stop of blaGES-1 to the start codon of the aacA4 gene is 46bp. The translational start codon of aacA4 gene is erroneous in the Genbank data base (DC236170). Indeed, it has been determined by N-terminal amino acid sequencing to be a GTG (in italic in the sequence above) and the beginning of the cassette was 24 bp before [Hanau-Bercot B. et al., 2002].</p>
                <p>-Could the Genbank annotation be modified as explained above?</p>
                <p>
                    <bold>Response:</bold> We performed this modification and the updated sequence regarding the beginning of aacA4 gene is already accessible on GenBank database under the same accession number (DQ236170).</p>
                <p>-The Appendex is not necessary and should be deleted.</p>
                <p>
                    <bold>Response:</bold> The appendix is only for helping referees in their evaluation. It will not be published.</p>
                <p>-In the sentence page 4, line 13, &#x201c;The single copy of rpsL gene of Pseudomonas...&#x201d;, should be replaced by &#x201c;the rpsL gene of Pseudomonas (see Bodilis et al., 2012).</p>
                <p>
                    <bold>Response:</bold> this was modified in the new version of the manuscript.</p>
                <p>In the conclusion, page 6, change &#x201c;never&#x201d; to &#x201c;rarely&#x201d;.</p>
                <p>
                    <bold>Response:</bold> this was modified in the new version of the manuscript.</p>
            </body>
        </sub-article>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report920">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.903.r920</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Partridge</surname>
                        <given-names>Sally</given-names>
                    </name>
                    <xref ref-type="aff" rid="r920a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r920a1">
                    <label>1</label>Sydney West Area Health Service, Sydney, NSW, Australia</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>2</day>
                <month>5</month>
                <year>2013</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2013 Partridge S</copyright-statement>
                <copyright-year>2013</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport920" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.2-99.v1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>This paper looks at expression of genes in a gene cassette array that includes a fused cassette and at the excision of cassette from this array. Polycistronic transcripts from cassette arrays and the excision of other fused cassettes have previously been noted by others, as cited in this paper. The sequences in Appendix 1 need to be annotated properly, rather than just the results of searches given, and the point illustrated by each sequence needs to be explained to make it possible to assess whether they support the conclusions drawn in the paper.&#x00a0;</p>
            <p>Some reorganisation (moving some information in the Results and Discussion to the Introduction) would help to make the paper easier to follow and the Conclusions section is very short and could be expanded. The English could also be improved and the manuscript checked for typos etc.&#x00a0;</p>
            <p>A few specific points also need correcting or clarifying:
                <list list-type="bullet">
                    <list-item>
                        <p>Abstract Line 5- fused cassettes do not always have fused orfs (e.g. 
                            <italic>aacA1</italic>/
                            <italic>orfG</italic>)</p>
                    </list-item>
                    <list-item>
                        <p>Abstract 6th Line from end and Results and Discussion p. 5 1st Line of 2nd paragraph &#x2013; what is in the 
                            <italic>gcu14</italic>-
                            <italic>aacA4</italic> circular form? Should this be 
                            <italic>bla</italic>GES-1/
                            <italic>aacA4</italic>?</p>
                    </list-item>
                    <list-item>
                        <p>&#x00a0;Materials and Methods Line 1 &#x2013; this needs rewording to explain that gcu is a gene cassette of unknown function.</p>
                    </list-item>
                    <list-item>
                        <p>Results and Discussion p. 4 &#x2013; the fusion here is the type where part of the 
                            <italic>bla</italic>GES-14 attC site is replaced by part of the 
                            <italic>attI1</italic> site (see ref. 14). The LH and RH domains are part of the 
                            <italic>attC</italic> site, rather than flanking it. The 5&#x2032;&#x00a0;UTR contains 6 bp of the 
                            <italic>attC</italic> site.</p>
                    </list-item>
                    <list-item>
                        <p>&#x00a0;Results and Discussion p. 5 &#x2013; most of the 1L core site and the 1R core site of the 
                            <italic>bla</italic>GES
                            <italic> attC</italic> site are present.&#x00a0;</p>
                    </list-item>
                    <list-item>
                        <p>&#x00a0;Results and Discussion p. 6 &#x2013; the deletion of part of the
                            <italic> attC</italic> site doesn&#x2019;t bring the
                            <italic> aacA4</italic> gene much closer to Pc and ref. 14 makes slightly different point (that expression of the downstream cassette may be enhanced).</p>
                    </list-item>
                </list>
            </p>
            <p>Formatting&#x00a0;&#x201c;14&#x201d; of
                <italic> gcu14</italic> and &#x201c;A4&#x201d; of 
                <italic>aacA4</italic> should be in italics.Transposon, gene and species names etc are not correctly formatted in the references.</p>
            <p>Reviewer Expertise:</p>
            <p>NA</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
        <sub-article article-type="response" id="comment1499-920">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Fonseca</surname>
                            <given-names>Erica</given-names>
                        </name>
                        <aff>Instituto Oswaldo Cruz, Brazil</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>There is no competing interests</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>5</day>
                    <month>8</month>
                    <year>2015</year>
                </pub-date>
            </front-stub>
            <body>
                <p>The sequences in Appendix 1 need to be annotated properly, rather than just the results of searches given, and the point illustrated by each sequence needs to be explained to make it possible to assess whether they support the conclusions drawn in the paper.</p>
                <p>
                    <bold>Response:</bold> The sequence resulted from inverse PCR product, showing the circular form of the gcu14-blaGES-1-aacA4 array, was submitted to GenBank under accession number KT336477. This information was included in the text. Moreover, we provided a new figure showing a schematic representation of primer targeting sites used in inverse PCR in order to make easier for the reviewers comprehend our strategy and results.</p>
                <p>Some reorganisation (moving some information in the Results and Discussion to the Introduction) would help to make the paper easier to follow and the Conclusions section is very short and could be expanded. The English could also be improved and the manuscript checked for typos etc.</p>
                <p>
                    <bold>Response:</bold> We agree that some points from results and discussion section would be more adequate in the introduction section, and they were moved in the new version of the manuscript (Page 3, lines 59-60 and 65-70; page 4, lines 71-76 in the new version).</p>
                <p>The English was reviewed by a native spoken-English, and the conclusion was expanded.</p>
                <p>A few specific points also need correcting or clarifying:</p>
                <p>Abstract Line 5- fused cassettes do not always have fused orfs (e.g. aacA1/orfG)</p>
                <p>
                    <bold>Response:</bold> We agree and it was modified: We affirmed that only in some cases fused orfs can be created.</p>
                <p>Abstract 6th Line from end and Results and Discussion p. 5 1st Line of 2nd paragraph &#x2013; what is in the gcu14-aacA4 circular form? Should this be blaGES-1/aacA4?</p>
                <p>
                    <bold>Response:</bold> The presence of the gcu14-aacA4 circular form indicates that this strain harbours a second integron composed by the gcu14-aacA4 arrangement. However, this result does not invalidate our main conclusion, which is that the truncated GES-1 attC site is not functional and this gene is only mobilized when recombination occurs in aacA4 attC. A brief explanation was included in the text (Results section).</p>
                <p>&#x00a0;&#x00a0;&#x00a0;&#x00a0; Materials and Methods Line 1 &#x2013; this needs rewording to explain that gcu is a gene cassette of unknown function.</p>
                <p>
                    <bold>Response:</bold> It was included in the text.</p>
                <p>&#x00a0;&#x00a0;&#x00a0; Results and Discussion p. 4 &#x2013; the fusion here is the type where part of the blaGES-1 attC site is replaced by part of the attI1 site (see ref. 14). The LH and RH domains are part of the attC site, rather than flanking it. The 5&#x2032; UTR contains 6 bp of the attC site.</p>
                <p>
                    <bold>Response:</bold> We change the text emphasizing that the attC was replaced by part of attI1.</p>
                <p>&#x00a0;The referee is right; LH and RH domains are part of the attC site, rather than flanking it. This general idea concerning attC site and its domains was modified throughout the text.</p>
                <p>&#x00a0;&#x00a0;&#x00a0;&#x00a0; Results and Discussion p. 5 &#x2013; most of the 1L core site and the 1R core site of the blaGES attC site are present.</p>
                <p>
                    <bold>Response:</bold> In fact, only the 1L core site is present in the truncated attC. We included a figure (figure 2) in this new version showing this.</p>
                <p>&#x00a0;&#x00a0;&#x00a0;&#x00a0; Results and Discussion p. 6 &#x2013; the deletion of part of the attC site doesn&#x2019;t bring the aacA4 gene much closer to Pc and ref. 14 makes slightly different point (that expression of the downstream cassette may be enhanced).</p>
                <p>
                    <bold>Response:</bold> The referee is right. This statement was removed.</p>
                <p>Formatting &#x201c;14&#x201d; of gcu14 and &#x201c;A4&#x201d; of aacA4 should be in italics. Transposon, gene and species names etc are not correctly formatted in the references.</p>
                <p>
                    <bold>Response:</bold> All formatting errors were properly corrected.</p>
            </body>
        </sub-article>
    </sub-article>
</article>
