<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="other" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.5676.2</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Correspondence</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                    <subj-group>
                        <subject>Coronary Artery Disease</subject>
                    </subj-group>
                    <subj-group>
                        <subject>Heart Failure</subject>
                    </subj-group>
                    <subj-group>
                        <subject>Methods for Diagnostic &amp; Therapeutic Studies</subject>
                    </subj-group>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>
                    <italic>APOC3</italic> may not be a predictor of risk of ischemic vascular disease in the Chinese population</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 2; peer review: 3 approved]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="no" equal-contrib="yes">
                    <name>
                        <surname>Tang</surname>
                        <given-names>Liang</given-names>
                    </name>
                    <xref ref-type="aff" rid="a1">1</xref>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no" equal-contrib="yes">
                    <name>
                        <surname>Cheng</surname>
                        <given-names>Zhi-Peng</given-names>
                    </name>
                    <xref ref-type="aff" rid="a1">1</xref>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Wang</surname>
                        <given-names>Qing-Yun</given-names>
                    </name>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Zeng</surname>
                        <given-names>Wei</given-names>
                    </name>
                    <xref ref-type="aff" rid="a1">1</xref>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Liu</surname>
                        <given-names>Hui</given-names>
                    </name>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Wu</surname>
                        <given-names>Ying-Ying</given-names>
                    </name>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Hu</surname>
                        <given-names>Bei</given-names>
                    </name>
                    <xref ref-type="aff" rid="a1">1</xref>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Hu</surname>
                        <given-names>Yu</given-names>
                    </name>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Institute of Hematology, Tongji Medical College, Union Hospital, Huazhong University of Science and Technology, Wuhan, 430022, China</aff>
                <aff id="a2">
                    <label>2</label>Collaborative Innovation Center of Hematology, Union Hospital, Huazhong University of Science and Technology, Wuhan, 430022, China</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:dr_huyu@126.com">dr_huyu@126.com</email>
                </corresp>
                <fn id="fn1">
                    <p>*Equal contribution</p>
                </fn>
                <fn fn-type="con">
                    <p>YH and LT chose the article for correspondence and evaluated the data in the manuscript. LT, ZPC, QYW, WZ, HL, YYW, and BH performed experiments. LT and ZPC wrote the manuscript. YH supervised the process and critically edited the manuscript.</p>
                </fn>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>22</day>
                <month>12</month>
                <year>2014</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2014</year>
            </pub-date>
            <volume>3</volume>
            <elocation-id>270</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>22</day>
                    <month>12</month>
                    <year>2014</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2014 Tang L et al.</copyright-statement>
                <copyright-year>2014</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/3-270/pdf"/>
            <abstract>
                <p>The genetic background of ischemic vascular disease is actively being explored. Several studies have shown that inhibition of 
                    <italic toggle="yes">APOC3</italic> significantly reduces plasma levels of apolipoprotein C3 and triglycerides. Recently, the TG and HDL Working Group and J&#x00f8;rgensen 
                    <italic toggle="yes">et al.</italic> reported that loss-of-function mutations in 
                    <italic toggle="yes">APOC3</italic> are associated with decreased triglyceride levels and a reduced risk of ischemic vascular disease in European and African individuals. We performed a replication study in 4470 Chinese participants. The coding regions of 
                    <italic toggle="yes">APOC3</italic> were amplified and re-sequenced. However, only synonymous and intronic variants with no functional consequences were identified. None of the loss-of-function mutations reported in European and African individuals were observed. Therefore, 
                    <italic toggle="yes">APOC3</italic> may not be an ideal predictor for risk of ischemic vascular disease in the Chinese population.</p>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>ischemic vascular disease</kwd>
                <kwd>risk prediction</kwd>
                <kwd>APOC3</kwd>
            </kwd-group>
            <funding-group>
                <funding-statement>This study was supported by grants from the National Natural Sciences Foundation of China (No. 81370622 and No. 81400099) and the Independent Innovation Foundation of Huazhong University of Science and Technology (No. 01-18-530045, 2013QN213).</funding-statement>
                <funding-statement>
                    <italic>The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.</italic>
                </funding-statement>
            </funding-group>
        </article-meta>
        <notes>
            <sec sec-type="version-changes">
                <label>Revised</label>
                <title>Amendments from Version 1</title>
                <p>We have added some important limitations into the new version, according to the three reviewers.</p>
            </sec>
        </notes>
    </front>
    <body>
        <sec>
            <title>Correspondence</title>
            <p>The genetic basis of ischemic vascular disease such as coronary artery disease is actively being explored. Most studies have focused on susceptibility factors contributing to an increased risk
                <sup>
                    <xref ref-type="bibr" rid="ref-1">1</xref>
                </sup>, while only a few studies have identified protective variants conferring reduced risk
                <sup>
                    <xref ref-type="bibr" rid="ref-2">2</xref>
                </sup>. Recently, the TG and HDL Working Group and J&#x00f8;rgensen 
                <italic toggle="yes">et al.</italic> reported that loss-of-function mutations in 
                <italic toggle="yes">APOC3</italic> are associated with decreased triglyceride levels and a reduced risk of ischemic vascular disease in individuals of European and African ancestry
                <sup>
                    <xref ref-type="bibr" rid="ref-3">3</xref>,
                    <xref ref-type="bibr" rid="ref-4">4</xref>
                </sup>. Approximately 1 in 150 individuals were heterozygous carriers of at least one of the four mutations: R19X, A43T, IVS2+1G&#x2192;A, and IVS3+1G&#x2192;T. Heterozygous carriers for these mutations had a significantly lower incidence of ischemic vascular disease as compared to non-carriers (hazard ratio = 0.59). Triglyceride and circulating 
                <italic toggle="yes">APOC3</italic> levels in the carriers were only 61% and 54% of those in non-carriers, respectively. These critical findings prompted us to undertake a replication study in China, where over one million people are affected by cardiovascular diseases each year (
                <ext-link ext-link-type="uri" xlink:href="http://www.nhfpc.gov.cn/">http://www.nhfpc.gov.cn/</ext-link>).</p>
            <p>A total of 4470 unrelated Chinese participants were enrolled, including 1488 healthy controls, 1050 patients with ischemic stroke, 628 patients with coronary artery disease, and 1304 patients with venous thrombosis, which could also be exacerbated by effects on the coagulation system resulting from elevated triglyceride levels. The 1488 healthy controls and 1050 patients with ischemic stroke were described in a previous study
                <sup>
                    <xref ref-type="bibr" rid="ref-5">5</xref>
                </sup>. Briefly, healthy individuals did not present any relevant medical history or family history of ischemic vascular disease. Ischemic stroke was confirmed by brain computed tomography (CT) and/or brain magnetic resonance imaging (MRI). The 1304 patients with venous thrombosis were described previously
                <sup>
                    <xref ref-type="bibr" rid="ref-6">6</xref>
                </sup>. Thrombosis was confirmed by objective investigations such as color Doppler ultrasonography and/or CT angiography. Patients with coronary artery disease were enrolled in our hospital from September 2013 to March 2014. Coronary artery disease was validated by angiographic evidence of at least one segment of a major coronary with over 50% organic stenosis. The characteristics of the 628 patients with coronary artery disease are summarized in 
                <xref ref-type="table" rid="T1">Table 1</xref>. Written informed consent was obtained from all participants, and the study was approved by the Ethics Committee of Union Hospital affiliated with Huazhong University of Science and Technology (Approval number 2013-03-0052).</p>
            <table-wrap id="T1" orientation="portrait" position="anchor">
                <label>Table 1. </label>
                <caption>
                    <title>Characteristics of the 628 patients with coronary artery disease.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="left" colspan="1" rowspan="1">Characteristic</th>
                            <th align="left" colspan="1" rowspan="1">Number</th>
                            <th align="left" colspan="1" rowspan="1">Percentage</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td colspan="1" rowspan="1">Onset age (yr, mean)</td>
                            <td colspan="1" rowspan="1">61.6 &#x00b1; 10.8</td>
                            <td colspan="1" rowspan="1"/>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&lt;40</td>
                            <td colspan="1" rowspan="1">11</td>
                            <td colspan="1" rowspan="1">1.7%</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x2265;40 and &lt;60</td>
                            <td colspan="1" rowspan="1">256</td>
                            <td colspan="1" rowspan="1">40.8%</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x2265;60</td>
                            <td colspan="1" rowspan="1">361</td>
                            <td colspan="1" rowspan="1">57.5%</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">Sex</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;male</td>
                            <td colspan="1" rowspan="1">408</td>
                            <td colspan="1" rowspan="1">65.0%</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;female</td>
                            <td colspan="1" rowspan="1">220</td>
                            <td colspan="1" rowspan="1">35.0%</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">Coronary artery disease</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;angina pectoris</td>
                            <td colspan="1" rowspan="1">422</td>
                            <td colspan="1" rowspan="1">67.2%</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;myocardial infarction</td>
                            <td colspan="1" rowspan="1">206</td>
                            <td colspan="1" rowspan="1">32.8%</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">Family history</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;yes</td>
                            <td colspan="1" rowspan="1">32</td>
                            <td colspan="1" rowspan="1">5.1%</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;no</td>
                            <td colspan="1" rowspan="1">596</td>
                            <td colspan="1" rowspan="1">94.9%</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">Current smoker</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;yes</td>
                            <td colspan="1" rowspan="1">157</td>
                            <td colspan="1" rowspan="1">25.0%</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;no</td>
                            <td colspan="1" rowspan="1">471</td>
                            <td colspan="1" rowspan="1">75.0%</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">Drinking</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;yes</td>
                            <td colspan="1" rowspan="1">79</td>
                            <td colspan="1" rowspan="1">12.6%</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;no</td>
                            <td colspan="1" rowspan="1">549</td>
                            <td colspan="1" rowspan="1">87.4%</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">Hypertension</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;yes</td>
                            <td colspan="1" rowspan="1">425</td>
                            <td colspan="1" rowspan="1">67.7%</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;no</td>
                            <td colspan="1" rowspan="1">203</td>
                            <td colspan="1" rowspan="1">32.3%</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">Type 2 diabetes</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;yes</td>
                            <td colspan="1" rowspan="1">175</td>
                            <td colspan="1" rowspan="1">27.9%</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;no</td>
                            <td colspan="1" rowspan="1">453</td>
                            <td colspan="1" rowspan="1">72.1%</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">Fasting serum lipid levels</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;TC</td>
                            <td colspan="1" rowspan="1">3.97 &#x00b1; 0.99 mmol/L</td>
                            <td colspan="1" rowspan="1"/>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;TG</td>
                            <td colspan="1" rowspan="1">1.55 &#x00b1; 1.05 mmol/L</td>
                            <td colspan="1" rowspan="1"/>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;HDL-C</td>
                            <td colspan="1" rowspan="1">1.19 &#x00b1; 0.29 mmol/L</td>
                            <td colspan="1" rowspan="1"/>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;LDL-C</td>
                            <td colspan="1" rowspan="1">2.07 &#x00b1; 0.76 mmol/L</td>
                            <td colspan="1" rowspan="1"/>
                        </tr>
                    </tbody>
                </table>
                <table-wrap-foot>
                    <fn>
                        <p>TC, total cholesterol; TG, triglycerides; HDL-C, high density lipoprotein cholesterol; LDL-C, low density lipoprotein cholesterol.</p>
                    </fn>
                    <fn>
                        <p>The diagnosis of myocardial infarction was based on typical chest pain with a duration over 30 min, on electrocardiographic patterns, and on increased creatine kinase MB isoenzyme and troponin I levels. Hypertension is defined as systolic blood pressure &#x2265; 140 mmHg and/or diastolic blood pressure &#x2265; 90 mmHg. Type 2 diabetes were clarified using the 1999 WHO criteria, including fasting plasma glucose &#x2265; 7.0 mmol/L, 2-hour oral glucose tolerance test plasma glucose &#x2265; 11.1 mmol/L or ongoing therapy for diabetes.</p>
                    </fn>
                </table-wrap-foot>
            </table-wrap>
            <p>Blood samples were collected into a vacutainer tube containing 0.105 mol/L trisodium citrate and were then centrifuged at 2000 g for 15 minutes. Genomic DNA was isolated using a salt precipitation method and was then used for sequencing. The four exons and the flanking intronic regions of 
                <italic toggle="yes">APOC3</italic> were amplified by PCR and then sequenced on an Applied Biosystems ABI 3730 Genetic Analyzer, as previously described
                <sup>
                    <xref ref-type="bibr" rid="ref-3">3</xref>
                </sup>. The oligonucleotide pairs and annealing temperatures employed in PCR and sequencing are shown in 
                <xref ref-type="table" rid="T2">Table 2</xref>. In this study, we identified only synonymous and intronic variants, with no functional consequences, and similar genotype distributions across the groups (
                <xref ref-type="table" rid="T3">Table 3</xref>). None of the loss-of-function mutations reported in European and African individuals were observed in the current cohort. Therefore, the genetic background of ischemic vascular disease is highly variable among different ethnic groups, and 
                <italic toggle="yes">APOC3</italic> may not be an ideal predictor of risk of ischemic vascular disease in the Chinese population.</p>
            <table-wrap id="T2" orientation="portrait" position="anchor">
                <label>Table 2. </label>
                <caption>
                    <title>Primers and annealing temperatures for PCR and sequencing.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="left" colspan="1" rowspan="1">Exon</th>
                            <th align="left" colspan="1" rowspan="1">Forward primer (5'-3')</th>
                            <th align="left" colspan="1" rowspan="1">Reverse primer (5'-3')</th>
                            <th align="left" colspan="1" rowspan="1">AT (&#x00ba;C)</th>
                            <th align="left" colspan="1" rowspan="1">Product
                                <break/>size (bp)</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td colspan="1" rowspan="1">1</td>
                            <td colspan="1" rowspan="1">GCCTTTACTCCAAACACCCC</td>
                            <td colspan="1" rowspan="1">AGTGCTTCTCCAGGCTTGCT</td>
                            <td colspan="1" rowspan="1">58</td>
                            <td colspan="1" rowspan="1">602</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">2 and 3</td>
                            <td colspan="1" rowspan="1">CCTTCTGAGAGCCCGTATTAGC</td>
                            <td colspan="1" rowspan="1">CCGCAGCAGCCTGACAAA</td>
                            <td colspan="1" rowspan="1">58</td>
                            <td colspan="1" rowspan="1">646</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">4</td>
                            <td colspan="1" rowspan="1">GGGGCATAAACATCTGAGGT</td>
                            <td colspan="1" rowspan="1">CTACCAGAAGGTGGATAGAGC</td>
                            <td colspan="1" rowspan="1">58</td>
                            <td colspan="1" rowspan="1">693</td>
                        </tr>
                    </tbody>
                </table>
                <table-wrap-foot>
                    <fn>
                        <p>AT, annealing temperature. The accession number of 
                            <italic toggle="yes">APOC3</italic> reference sequence in GenBank is NG_008949.1.</p>
                    </fn>
                </table-wrap-foot>
            </table-wrap>
            <table-wrap id="T3" orientation="portrait" position="anchor">
                <label>Table 3. </label>
                <caption>
                    <title>
						
                        <italic toggle="yes">APOC3</italic> variants identified in the 4470 Chinese participants.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="left" colspan="1" rowspan="1">Variables</th>
                            <th align="left" colspan="1" rowspan="1">dbSNP ID</th>
                            <th align="left" colspan="1" rowspan="1">Control group
                                <break/>n = 1488</th>
                            <th align="left" colspan="1" rowspan="1">Ischemic stroke
                                <break/>n = 1050</th>
                            <th align="left" colspan="1" rowspan="1">Coronary heart disease
                                <break/>n = 628</th>
                            <th align="left" colspan="1" rowspan="1">Venous thrombosis
                                <break/>n = 1304</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td colspan="1" rowspan="1">Age (yr, mean)</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1">61.2 &#x00b1; 12.8</td>
                            <td colspan="1" rowspan="1">62.2 &#x00b1; 12.3</td>
                            <td colspan="1" rowspan="1">61.6 &#x00b1; 10.8</td>
                            <td colspan="1" rowspan="1">51.7 &#x00b1; 13.8</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">Male, n (%)</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1">978 (65.7%)</td>
                            <td colspan="1" rowspan="1">691 (65.8%)</td>
                            <td colspan="1" rowspan="1">408 (65.0%)</td>
                            <td colspan="1" rowspan="1">638 (48.9%)</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">Variants, n (%)
                                <sup>b</sup>
                            </td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;c.10C&gt;A (p.Arg4=)</td>
                            <td colspan="1" rowspan="1">novel</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;CC</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1">1485 (99.8%)</td>
                            <td colspan="1" rowspan="1">1048 (99.8%)</td>
                            <td colspan="1" rowspan="1">627 (99.8%)</td>
                            <td colspan="1" rowspan="1">1301 (99.8%)</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;CA</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1">3 (0.2%)</td>
                            <td colspan="1" rowspan="1">2 (0.2%)</td>
                            <td colspan="1" rowspan="1">1 (0.2%)</td>
                            <td colspan="1" rowspan="1">3 (0.2%)</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;P value</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1">0.95</td>
                            <td colspan="1" rowspan="1">0.84</td>
                            <td colspan="1" rowspan="1">0.87</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;c.99G&gt;A (p.Gln33=)</td>
                            <td colspan="1" rowspan="1">rs200557528</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;GG</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1">1481 (99.5%)</td>
                            <td colspan="1" rowspan="1">1046 (99.6%)</td>
                            <td colspan="1" rowspan="1">625 (99.5%)</td>
                            <td colspan="1" rowspan="1">1296 (99.4%)</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;GA</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1">7 (0.5%)</td>
                            <td colspan="1" rowspan="1">4 (0.4%)</td>
                            <td colspan="1" rowspan="1">3 (0.5%)</td>
                            <td colspan="1" rowspan="1">8 (0.6%)</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;P value</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1">0.73</td>
                            <td colspan="1" rowspan="1">0.98</td>
                            <td colspan="1" rowspan="1">0.61</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;c.102T&gt;C (p.Gly34=)</td>
                            <td colspan="1" rowspan="1">rs4520</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;TT</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1">655 (44.0%)</td>
                            <td colspan="1" rowspan="1">456 (43.4%)</td>
                            <td colspan="1" rowspan="1">278 (44.3%)</td>
                            <td colspan="1" rowspan="1">582 (44.6%)</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;TC</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1">641 (43.1%)</td>
                            <td colspan="1" rowspan="1">449 (42.8%)</td>
                            <td colspan="1" rowspan="1">272 (43.3%)</td>
                            <td colspan="1" rowspan="1">566 (43.4%)</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;CC</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1">192 (12.9%)</td>
                            <td colspan="1" rowspan="1">145 (13.8%)</td>
                            <td colspan="1" rowspan="1">78 (12.4%)</td>
                            <td colspan="1" rowspan="1">156 (12.0%)</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;P value</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1">0.80</td>
                            <td colspan="1" rowspan="1">0.95</td>
                            <td colspan="1" rowspan="1">0.75</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;c.179+57G&gt;A</td>
                            <td colspan="1" rowspan="1">rs2070667</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;GG</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1">1098 (73.8%)</td>
                            <td colspan="1" rowspan="1">776 (73.9%)</td>
                            <td colspan="1" rowspan="1">454 (72.3%)</td>
                            <td colspan="1" rowspan="1">967 (74.2%)</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;GA</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1">329 (22.1%)</td>
                            <td colspan="1" rowspan="1">235 (22.4%)</td>
                            <td colspan="1" rowspan="1">148 (23.6%)</td>
                            <td colspan="1" rowspan="1">286 (21.9%)</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;AA</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1">61 (4.1%)</td>
                            <td colspan="1" rowspan="1">39 (3.7%)</td>
                            <td colspan="1" rowspan="1">26 (4.1%)</td>
                            <td colspan="1" rowspan="1">51 (3.9%)</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;P value</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1">0.88</td>
                            <td colspan="1" rowspan="1">0.76</td>
                            <td colspan="1" rowspan="1">0.96</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;c.240G&gt;A (p.Lys80=)</td>
                            <td colspan="1" rowspan="1">novel</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;GG</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1">1483 (99.7%)</td>
                            <td colspan="1" rowspan="1">1047 (99.7%)</td>
                            <td colspan="1" rowspan="1">626 (99.7%)</td>
                            <td colspan="1" rowspan="1">1301 (99.8%)</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;GA</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1">5 (0.3%)</td>
                            <td colspan="1" rowspan="1">3 (0.3%)</td>
                            <td colspan="1" rowspan="1">2 (0.3%)</td>
                            <td colspan="1" rowspan="1">3 (0.2%)</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;P value</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1">0.82</td>
                            <td colspan="1" rowspan="1">0.95</td>
                            <td colspan="1" rowspan="1">0.60</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;c.*40G&gt;C</td>
                            <td colspan="1" rowspan="1">rs5128</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;GG</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1">763 (51.3%)</td>
                            <td colspan="1" rowspan="1">535 (51.0%)</td>
                            <td colspan="1" rowspan="1">328 (52.2%)</td>
                            <td colspan="1" rowspan="1">665 (51.0%)</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;GC</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1">562 (37.8%)</td>
                            <td colspan="1" rowspan="1">394 (37.5%)</td>
                            <td colspan="1" rowspan="1">240 (38.2%)</td>
                            <td colspan="1" rowspan="1">494 (37.9%)</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;CC</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1">163 (10.9%)</td>
                            <td colspan="1" rowspan="1">121 (11.5%)</td>
                            <td colspan="1" rowspan="1">60 (9.6%)</td>
                            <td colspan="1" rowspan="1">145 (11.1%)</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;P value</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1">0.90</td>
                            <td colspan="1" rowspan="1">0.64</td>
                            <td colspan="1" rowspan="1">0.98</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;c.*71G&gt;T</td>
                            <td colspan="1" rowspan="1">rs4225</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;GG</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1">1006 (67.6%)</td>
                            <td colspan="1" rowspan="1">703 (66.9%)</td>
                            <td colspan="1" rowspan="1">416 (66.2%)</td>
                            <td colspan="1" rowspan="1">880 (67.5%)</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;GT</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1">414 (27.8%)</td>
                            <td colspan="1" rowspan="1">304 (29.0%)</td>
                            <td colspan="1" rowspan="1">180 (28.7%)</td>
                            <td colspan="1" rowspan="1">368 (28.2%)</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;TT</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1">68 (4.6%)</td>
                            <td colspan="1" rowspan="1">43 (4.1%)</td>
                            <td colspan="1" rowspan="1">32 (5.1%)</td>
                            <td colspan="1" rowspan="1">56 (4.3%)</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;P value</td>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1"/>
                            <td colspan="1" rowspan="1">0.73</td>
                            <td colspan="1" rowspan="1">0.79</td>
                            <td colspan="1" rowspan="1">0.92</td>
                        </tr>
                    </tbody>
                </table>
                <table-wrap-foot>
                    <fn>
                        <p>dbSNP, single nucleotide polymorphism database of the National Center for Biotechnology Information (
                            <ext-link ext-link-type="uri" xlink:href="http://www.ncbi.nlm.nih.gov/projects/SNP">http://www.ncbi.nlm.nih.gov/projects/SNP</ext-link>).</p>
                    </fn>
                    <fn>
                        <p>Comparisons between the controls and each case group were assessed with the use of the chi-square test. A two tailed P&lt;0.05 was considered significant.</p>
                    </fn>
                </table-wrap-foot>
            </table-wrap>
            <p>However, there are some limitations in this study. First, we only analyzed the coding sequence, as in the studies carried out in European and African individuals. Potential effects from large deletions and mutations in regulatory regions of the gene cannot be excluded. Previous studies have revealed two promoter polymorphisms (T-455C and C-482T) that affect the expression of 
                <italic toggle="yes">APOC3.</italic> However, their relationship with coronary artery disease was not observed in a Han Chinese population
                <sup>
                    <xref ref-type="bibr" rid="ref-7">7</xref>
                </sup>. Second, the consequences of the synonymous mutations and the intronic mutations identified here were only predicted by an on-line bioinformatics tool (
                <ext-link ext-link-type="uri" xlink:href="http://www.fruitfly.org/seq_tools/splice.html">http://www.fruitfly.org/seq_tools/splice.html</ext-link>). Third, the triglyceride levels were not available for the patients with venous thrombosis. Thus, the triglyceride levels according to the genotypes were not further analyzed. Nevertheless, considering the relatively large sample size, we suggest that functional variants in 
                <italic toggle="yes">APOC3</italic> could be very rare in China. Further studies are warranted to understand the genetic basis governing triglyceride levels and conferring protective effects on ischemic vascular disease in the Chinese population.</p>
        </sec>
        <sec>
            <title>Consent</title>
            <p>Written informed consent to publish these data has been obtained by each participant.</p>
        </sec>
    </body>
    <back>
        <ref-list>
            <ref id="ref-1">
                <label>1</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Peden</surname>
                            <given-names>JF</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Farrall</surname>
                            <given-names>M</given-names>
                        </name>
					</person-group>:
                    <article-title>Thirty-five common variants for coronary artery disease: the fruits of much collaborative labour.</article-title>
                    <source>
						
                        <italic toggle="yes">Hum Mol Genet.</italic>
					</source>
                    <year>2011</year>;<volume>20</volume>(<issue>R2</issue>):<fpage>R198</fpage>&#x2013;<lpage>205</lpage>.
                    <pub-id pub-id-type="pmid">21875899</pub-id>
                    <pub-id pub-id-type="doi">10.1093/hmg/ddr384</pub-id>
                    <pub-id pub-id-type="pmcid">3179381</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-2">
                <label>2</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Golovkin</surname>
                            <given-names>AS</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Ponasenko</surname>
                            <given-names>AV</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Khutornaya</surname>
                            <given-names>MV</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Association of TLR and TREM-1 gene polymorphisms with risk of coronary artery disease in a Russian population.</article-title>
                    <source>
						
                        <italic toggle="yes">Gene.</italic>
					</source>
                    <year>2014</year>;<volume>550</volume>(<issue>1</issue>):<fpage>101</fpage>&#x2013;<lpage>9</lpage>.
                    <pub-id pub-id-type="pmid">25128583</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.gene.2014.08.022</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-3">
                <label>3</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>J&#x00f8;rgensen</surname>
                            <given-names>AB</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Frikke-Schmidt</surname>
                            <given-names>R</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Nordestgaard</surname>
                            <given-names>BG</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Loss-of-function mutations in 
                        <italic toggle="yes">APOC3</italic> and risk of ischemic vascular disease.</article-title>
                    <source>
						
                        <italic toggle="yes">N Engl J Med.</italic>
					</source>
                    <year>2014</year>;<volume>371</volume>(<issue>1</issue>):<fpage>32</fpage>&#x2013;<lpage>41</lpage>.
                    <pub-id pub-id-type="pmid">24941082</pub-id>
                    <pub-id pub-id-type="doi">10.1056/NEJMoa1308027</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-4">
                <label>4</label>
                <mixed-citation publication-type="journal">
                    <collab>The TG and HDL Working Group of the Exome Sequencing Project, National Heart, Lung, and Blood Institute</collab>:
                    <article-title>Loss-of-function mutations in 
                        <italic toggle="yes">APOC3</italic>, triglycerides, and coronary disease.</article-title>
                    <source>
						
                        <italic toggle="yes">N Engl J Med.</italic>
					</source>
                    <year>2014</year>;<volume>371</volume>(<issue>1</issue>):<fpage>22</fpage>&#x2013;<lpage>31</lpage>.
                    <pub-id pub-id-type="pmid">24941081</pub-id>
                    <pub-id pub-id-type="doi">10.1056/NEJMoa1307095</pub-id>
                    <pub-id pub-id-type="pmcid">4180269</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-5">
                <label>5</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Lu</surname>
                            <given-names>X</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Tang</surname>
                            <given-names>L</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Xu</surname>
                            <given-names>K</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Novel association of a PROC variant with ischemic stroke in a Chinese Han population.</article-title>
                    <source>
						
                        <italic toggle="yes">Hum Genet.</italic>
					</source>
                    <year>2013</year>;<volume>132</volume>(<issue>1</issue>):<fpage>69</fpage>&#x2013;<lpage>77</lpage>.
                    <pub-id pub-id-type="pmid">22976599</pub-id>
                    <pub-id pub-id-type="doi">10.1007/s00439-012-1225-8</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-6">
                <label>6</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Tang</surname>
                            <given-names>L</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>HF</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Lu</surname>
                            <given-names>X</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Common genetic risk factors for venous thrombosis in the Chinese population.</article-title>
                    <source>
						
                        <italic toggle="yes">Am J Hum Genet.</italic>
					</source>
                    <year>2013</year>;<volume>92</volume>(<issue>2</issue>):<fpage>177</fpage>&#x2013;<lpage>187</lpage>.
                    <pub-id pub-id-type="pmid">23332921</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.ajhg.2012.12.013</pub-id>
                    <pub-id pub-id-type="pmcid">3567266</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-7">
                <label>7</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Yu</surname>
                            <given-names>J</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Huang</surname>
                            <given-names>J</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Liang</surname>
                            <given-names>Y</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Lack of association between apolipoprotein C3 gene polymorphisms and risk of coronary heart disease in a Han population in East China.</article-title>
                    <source>
						
                        <italic toggle="yes">Lipids Health Dis.</italic>
					</source>
                    <year>2011</year>;<volume>10</volume>:<fpage>200</fpage>.
                    <pub-id pub-id-type="pmid">22054125</pub-id>
                    <pub-id pub-id-type="doi">10.1186/1476-511X-10-200</pub-id>
                    <pub-id pub-id-type="pmcid">3221453</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report7130">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.6399.r7130</article-id>
            <title-group>
                <article-title>Reviewer response for version 2</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Zhang</surname>
                        <given-names>Bin</given-names>
                    </name>
                    <xref ref-type="aff" rid="r7130a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r7130a1">
                    <label>1</label>Genomic Medicine Institute, Lerner Research Institute of Cleveland Clinic, Cleveland, OH, USA</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>23</day>
                <month>12</month>
                <year>2014</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2014 Zhang B</copyright-statement>
                <copyright-year>2014</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport7130" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.5676.2"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>Authors addressed the main concerns. No further comments.</p>
            <p>Reviewer Expertise:</p>
            <p>NA</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report6866">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.6066.r6866</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Zhang</surname>
                        <given-names>Bin</given-names>
                    </name>
                    <xref ref-type="aff" rid="r6866a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r6866a1">
                    <label>1</label>Genomic Medicine Institute, Lerner Research Institute of Cleveland Clinic, Cleveland, OH, USA</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>10</day>
                <month>12</month>
                <year>2014</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2014 Zhang B</copyright-statement>
                <copyright-year>2014</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport6866" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.5676.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>The authors performed a confirmatory study for the recently reported protective effects of loss-of-function mutations in 
                <italic>APOC3</italic> in the Chinese population. Not a single loss-of-function mutation was identified in exons and exon-intron junctions of 
                <italic>APOC3</italic> in a total of 4470 study subjects. The authors concluded that 
                <italic>APOC3</italic> is not a good predictor of risk of ischemic vascular disease in the Chinese population.</p>
            <p>This is a worthwhile study and the information, although negative, is certainly useful. However, based on the data reported in the paper, it is premature to conclude that functional variants in 
                <italic>APOC3</italic> are very rare and/or not related to ischemic vascular disease in the Chinese population. The data merely conclude that detrimental mutations are very rare in the sequenced regions of 
                <italic>APOC3</italic> gene in the Chinese population. Potential effects from large deletions of the gene and mutations in regulatory regions of the gene cannot be excluded. In fact, there have been reports of promoter polymorphisms that affect the expression of 
                <italic>APOC3</italic> (ref. 28-31 in J&#x00f8;rgensen et. al). Unless additional, more comprehensive mutational studies are performed in the cohort, conclusions should be modified to reflect the limitations of the current study.</p>
            <p>There have been examples of synonymous mutations that affect the translation of mRNA and therefore affect the protein level. Also, intronic mutations distant from splice sites could affect splicing. Authors should clearly state reasons why they believe that the variants identified in the study have no functional consequences.</p>
            <p>References should be added to the end of the second sentence of the paper (while only &#x201c;a&#x201d; few studies have identified protective variants conferring reduced risk).</p>
            <p>Reviewer Expertise:</p>
            <p>NA</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report6920">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.6066.r6920</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Ruan</surname>
                        <given-names>Chang-Geng</given-names>
                    </name>
                    <xref ref-type="aff" rid="r6920a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r6920a1">
                    <label>1</label>Key Laboratory of Thrombosis and Haemostasis, Ministry of Health, Suzhou, China</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>5</day>
                <month>12</month>
                <year>2014</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2014 Ruan CG</copyright-statement>
                <copyright-year>2014</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport6920" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.5676.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>Two very recent landmark large-scale studies show that loss-of-function mutations in APOC3 are associated with lower levels of plasma triglycerides, and carriers of these mutations have a reduced risk of coronary heart disease in European and African individuals. Tang 
                <italic>et al</italic>. performed a timely replication study in 4,470 Chinese individuals. Unexpectedly, no loss-of-function mutations identified in the European and African populations were found in the Chinese population. This important study not only highlights the difference in genetic susceptibility to cardiovascular disease in different ethnic populations, but also suggests that APOC3 variants are not applicable to the Chinese population to predict risk for ischemic vascular disease.</p>
            <p>APOC3 may still be an important regulator of lipid metabolism in Chinese, and novel variants of this gene remain to be identified in this ethnic population. Consequently, the authors need to change their conclusion from &#x201c;Therefore, 
                <italic>APOC3</italic> may not be an ideal predictor for risk of ischemic vascular disease in the Chinese population&#x201d; to &#x201c;Therefore, 
                <italic>APOC3</italic> variants identified in the European and African population may not be an ideal predictor for risk of ischemic vascular disease in the Chinese population&#x201d;.</p>
            <p>Reviewer Expertise:</p>
            <p>NA</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report6688">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.6066.r6688</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Corral</surname>
                        <given-names>Javier</given-names>
                    </name>
                    <xref ref-type="aff" rid="r6688a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r6688a1">
                    <label>1</label>Centro Regional de Hemodonaci&#x00f3;n, Universidad de Murcia, Murcia, Spain</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>13</day>
                <month>11</month>
                <year>2014</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2014 Corral J</copyright-statement>
                <copyright-year>2014</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport6688" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.5676.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>Despite being a negative study, the information in this article is valuable. It describes a study that found no relevant mutation in 
                <italic>APOC3</italic> among a large number of Chinese subjects (4470), including 1488 healthy controls, 1050 patients with ischemic stroke, 628 patients with coronary artery disease, and 1304 patients with venous thrombosis. Actually, no one with the loss-of-function mutations reported in European and African individuals was identified in this study. Only synonymous and intronic variants were discovered. The authors indicated that these variants have no functional consequences, but no data are shown. At the least the TG levels according to the genotype might be shown in table 2.</p>
            <p>The authors must indicate that other genetic defects, such a gross deletions or regulatory mutations not identified by sequencing methods or by analysis of exons, may cause a loss-of-function of 
                <italic>APOC3</italic> and might be associated with decreased triglyceride levels and a reduced risk of ischemic vascular disease. Actually, selection of subjects with decreased triglyceride levels and a deeper analysis of this gene might be a better strategy to identify these genetic variants potentially involved in TG levels and risk of ischemic vascular disease. Accordingly, I think the authors might change the title of the article.</p>
            <p>Reviewer Expertise:</p>
            <p>NA</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
</article>
