<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.9251.1</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                    <subj-group>
                        <subject>Applied Microbiology</subject>
                    </subj-group>
                    <subj-group>
                        <subject>Medical Microbiology</subject>
                    </subj-group>
                    <subj-group>
                        <subject>Methods for Diagnostic &amp; Therapeutic Studies</subject>
                    </subj-group>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>Ability of device to collect bacteria from cough aerosols generated by adults with cystic fibrosis</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 1; peer review: 2 approved]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Ku</surname>
                        <given-names>David N.</given-names>
                    </name>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Ku</surname>
                        <given-names>Sarah K.</given-names>
                    </name>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Helfman</surname>
                        <given-names>Beth</given-names>
                    </name>
                    <xref ref-type="aff" rid="a3">3</xref>
                    <xref ref-type="aff" rid="a4">4</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>McCarty</surname>
                        <given-names>Nael A.</given-names>
                    </name>
                    <xref ref-type="aff" rid="a3">3</xref>
                    <xref ref-type="aff" rid="a4">4</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Wolff</surname>
                        <given-names>Bernard J.</given-names>
                    </name>
                    <xref ref-type="aff" rid="a5">5</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Winchell</surname>
                        <given-names>Jonas M.</given-names>
                    </name>
                    <xref ref-type="aff" rid="a5">5</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Anderson</surname>
                        <given-names>Larry J.</given-names>
                    </name>
                    <xref ref-type="aff" rid="a6">6</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Georgia Institute of Technology, Atlanta, GA, 30332, USA</aff>
                <aff id="a2">
                    <label>2</label>MD Innovate, Inc, Decatur, GA, 30030, USA</aff>
                <aff id="a3">
                    <label>3</label>Emory Children&#x2019;s Center for Cystic Fibrosis Research, Emory University, Atlanta, GA, 30322, USA</aff>
                <aff id="a4">
                    <label>4</label>Department of Pediatrics, Emory University, Atlanta, 30322, USA</aff>
                <aff id="a5">
                    <label>5</label>Respiratory Diseases Branch, Centers for Disease Control and Prevention, Atlanta, GA, 30333, USA</aff>
                <aff id="a6">
                    <label>6</label>Division of Infectious Diseases, Department of Pediatrics, Emory University and Children&#x2019;s Healthcare of Atlanta, Atlanta, GA, 30322, USA</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:david.ku@me.gatech.edu">david.ku@me.gatech.edu</email>
                </corresp>
                <fn fn-type="con">
                    <p>David N. Ku, Nael A. McCarty, Bernard J. Wolff, Jonas M. Winchell, and Larry J. Anderson served as scientific advisors. Beth Helfman collected data and provided and cared for study patients. Sarah K. Ku wrote and edited much of the manuscript. All authors agreed to the final content of the article.</p>
                </fn>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>Dr. David N. Ku, Sarah K. Ku, and Dr. Larry J. Anderson are co-inventors on the PneumoniaCheck&amp;trade; patent licensed to MD Innovate, Inc. from US Centers for Disease Control and Prevention and Georgia Tech Research Corporation.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>5</day>
                <month>8</month>
                <year>2016</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2016</year>
            </pub-date>
            <volume>5</volume>
            <elocation-id>1920</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>27</day>
                    <month>7</month>
                    <year>2016</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2016 Ku DN et al.</copyright-statement>
                <copyright-year>2016</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/5-1920/pdf"/>
            <abstract>
                <p>
                    <bold>Background</bold>: Identifying lung pathogens and acute spikes in lung counts remain a challenge in the treatment of patients with cystic fibrosis (CF). Bacteria from the deep lung may be sampled from aerosols produced during coughing.</p>
                <p>
                    <bold>Methods</bold>: A new device was used to collect and measure bacteria levels from cough aerosols of patients with CF. Sputum and oral specimens were also collected and measured for comparison. 
                    <italic toggle="yes">Pseudomonas aeruginosa</italic>, 
                    <italic toggle="yes">Staphylococcus aureus</italic>, 
                    <italic toggle="yes">Klebsiella pneumoniae</italic>, and 
                    <italic toggle="yes">Streptococcus mitis</italic> were detected in specimens using Real-Time Polymerase Chain Reaction (RT-PCR) molecular assays.</p>
                <p>
                    <bold>Results</bold>: Twenty adult patients with CF and 10 healthy controls participated. CF related bacteria (CFRB) were detected in 13/20 (65%) cough specimens versus 15/15 (100%) sputum specimens. Commensal 
                    <italic toggle="yes">S. mitis</italic> was present in 0/17 (0%, p=0.0002) cough specimens and 13/14 (93%) sputum samples. In normal controls, no bacteria were collected in cough specimens but 4/10 (40%) oral specimens were positive for CFRB.</p>
                <p>
                    <bold>Conclusions</bold>: Non-invasive cough aerosol collection may detect lower respiratory pathogens in CF patients, with similar specificity and sensitivity to rates detected by BAL, without contamination by oral CFRB or commensal bacteria.</p>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>Cystic fibrosis</kwd>
                <kwd>aerosols</kwd>
                <kwd>specimen collection</kwd>
                <kwd>respiratory infections</kwd>
                <kwd>etiology</kwd>
            </kwd-group>
            <funding-group>
                <funding-statement>Supported by internal grants from US Centers for Disease Control and Prevention and Emory University Hospital.</funding-statement>
                <funding-statement>
                    <italic>The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.</italic>
                </funding-statement>
            </funding-group>
        </article-meta>
    </front>
    <body>
        <sec sec-type="intro">
            <title>Introduction</title>
            <p>The etiology of lower respiratory tract infections in the lungs is difficult to determine, in part because a good quality specimen from the site of the infection is not readily available
                <sup>
                    <xref ref-type="bibr" rid="ref-1">1</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-4">4</xref>
                </sup>. Access to such a specimen would be an important advance in the monitoring and treatment of cystic fibrosis (CF), as well as other lower respiratory tract infections, such as pneumonia, tuberculosis, asthma, lung cancer, etc. Presently, oropharyngeal (OP), sputum, and bronchoalveolar lavage (BAL) specimens are typically used to monitor CF patients. OP specimens may be appropriate for detecting viruses, but are not ideal for most bacterial pathogens. Sputum is commonly collected to monitor CF but often contains contaminants and cystic fibrosis related bacteria (CFRB) from the upper respiratory tract. The difficulty some patients have in producing an acceptable sputum specimen further decreases the value of these samples, often causing the physician to treat the patient empirically
                <sup>
                    <xref ref-type="bibr" rid="ref-1">1</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-4">4</xref>
                </sup>. BAL provides a specimen from the lungs but is an invasive procedure that cannot be routinely used. BAL specimens may also collect contaminants from the upper respiratory tract
                <sup>
                    <xref ref-type="bibr" rid="ref-5">5</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-7">7</xref>
                </sup>.</p>
            <p>An alternative source for a lung specimen is from aerosols generated during coughs
                <sup>
                    <xref ref-type="bibr" rid="ref-8">8</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-12">12</xref>
                </sup>. Studies show that one cough can generate as many as 66,000 expelled particles
                <sup>
                    <xref ref-type="bibr" rid="ref-10">10</xref>,
                    <xref ref-type="bibr" rid="ref-13">13</xref>
                </sup>. Patients that have lower respiratory tract infections can infect others through respiratory dispersion of pathogens in aerosols generated by coughing or sneezing. Coughing produces a higher concentration of pathogens from the lower lungs than normal exhalation or sneezing
                <sup>
                    <xref ref-type="bibr" rid="ref-8">8</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-13">13</xref>
                </sup>. A new cough specimen collection device (PneumoniaCheck&#x2122;, 
                <xref ref-type="fig" rid="f1">Figure 1</xref>) collects aerosols from the lungs onto a micropore filter while minimizing contamination from the upper respiratory tract. Microbiology or molecular assays can then be used to detect pathogens collected on the device&#x2019;s filter.</p>
            <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                <label>Figure 1. </label>
                <caption>
                    <title>PneumoniaCheck&#x2122; specimen storage and transport container.</title>
                </caption>
                <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/9959/799a2f5b-b8b9-476e-b460-583cae829a0d_figure1.gif"/>
            </fig>
            <p>The device uses a reservoir to separate oral contents from deep lung aerosols using fluid mechanics for separation (
                <xref ref-type="fig" rid="f2">Figure 2</xref>). The initial volume of air that comes from exhalation or coughing is contaminated air from the upper respiratory tract, also known as anatomic dead space. When a patient coughs into the device, this air from the upper airways first flows into the reservoir (
                <xref ref-type="fig" rid="f2">Figure 2a</xref>). The exhaled air flows to the reservoir first as it has the least resistance compared to the filter at the end of the device. This reservoir has a volume of 250 ml, approximately 100 ml greater than the volume of anatomic dead space in the average adult
                <sup>
                    <xref ref-type="bibr" rid="ref-15">15</xref>
                </sup>, which ensures that all of the upper airway aerosols are completely separated out. The expanded reservoir is inelastic, creating a back-pressure, so subsequent exhaled breath is forced through the microbial filter (
                <xref ref-type="fig" rid="f2">Figure 2b</xref>). Therefore, only lung aerosol contents are collected onto the filter and are free from upper airway contamination.</p>
            <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                <label>Figure 2. </label>
                <caption>
                    <title>PneumoniaCheck&#x2122; fluid mechanics airway separation.</title>
                    <p>(
                        <bold>a</bold>) Contaminated upper airway particles from the mouth initially fill up air reservoir. (
                        <bold>b</bold>) Then, uncontaminated lower airway particles from the lungs are captured onto filter.</p>
                </caption>
                <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/9959/799a2f5b-b8b9-476e-b460-583cae829a0d_figure2.gif"/>
            </fig>
            <p>A previous study demonstrated that the device&#x2019;s filter is &gt;99% effective in collecting airborne bacteria (approximately 3.1 &#x03bc;m in diameter) and viruses (approximately 2.8 &#x03bc;m in diameter)
                <sup>
                    <xref ref-type="bibr" rid="ref-16">16</xref>
                </sup>. Sampling from normal individual controls showed zero collection of oral contents on the filter, even with up to 15 ml of liquid in the mouth (simulating sputum). The PneumoniaCheck&#x2122; device has been shown to significantly separate the lower airway gas from the upper airway gas based on oxygen and alcohol levels (p&lt;0.0001)
                <sup>
                    <xref ref-type="bibr" rid="ref-16">16</xref>
                </sup>.</p>
            <p>CF is a genetic disease that affects the lungs of approximately 28,000 children and adults in the United States each year
                <sup>
                    <xref ref-type="bibr" rid="ref-17">17</xref>
                </sup>. People with CF often have chronic lung infections and require regular monitoring to ensure that bacterial colonization does not develop into infection
                <sup>
                    <xref ref-type="bibr" rid="ref-26">26</xref>,
                    <xref ref-type="bibr" rid="ref-27">27</xref>
                </sup>. We used specimens from sputum and coughs to compare their abilities to capture, identify, and quantify relative levels of lung bacteria in adult CF patients. The goal of this study is to determine if the cough device can capture lung pathogens from adult patients with chronic lung infection while simultaneously excluding oral bacteria.</p>
        </sec>
        <sec sec-type="materials | methods">
            <title>Materials and methods</title>
            <sec sec-type="subjects">
                <title>Subjects</title>
                <p>Patients with CF (n=20) aged &gt;18 years old were recruited from the Emory Cystic Fibrosis Center Adult Clinic in Atlanta, Georgia. The Emory Institutional Review Board (H08353) approved the study and participants provided their written, informed consent. The sample size was sufficiently powered to demonstrate statistical significance for lower lung sampling without oral contamination. Tests of paired proportions were conducted using an exact form of the McNemar test to compare the presence of CFRB between two samples (i.e. cough and sputum). The Wilcoxon signed rank test was used to compare cycle threshold (
                    <italic toggle="yes">C
                        <sub>T</sub>
                    </italic>) values between the different methods of sampling. The 
                    <italic toggle="yes">C
                        <sub>T</sub>
                    </italic> value of 60 was used as the upper limit of detection for all PCR assays to determine relative quantity of bacteria in each specimen.</p>
            </sec>
            <sec>
                <title>Clinical measurements</title>
                <p>Throat swabs and cough device specimens were collected from 10 healthy, non-smoking subjects for normal controls. Separately, a sputum specimen and cough device specimen were each collected from 20 adult patients with CF. Cough device specimen collection preceded sputum specimen collection in order to help induce sputum. Specimen collections were supervised and emergency equipment was readily available. 
                    <italic toggle="yes">Streptococcus mitis</italic> is a commensal bacterium that is found in the mouth but not in the lungs
                    <sup>
                        <xref ref-type="bibr" rid="ref-14">14</xref>
                    </sup>. 
                    <italic toggle="yes">Streptococcus pneumoniae</italic> and 
                    <italic toggle="yes">Staphylococcus aureus</italic> are also commonly found in the oral cavity
                    <sup>
                        <xref ref-type="bibr" rid="ref-3">3</xref>
                    </sup>. 
                    <italic toggle="yes">Pseudomonas aeruginosa</italic>, 
                    <italic toggle="yes">Staphylococcus aureus</italic> and 
                    <italic toggle="yes">Klebsiella pneumoniae</italic> are cystic fibrosis related bacteria (CFRB)
                    <sup>
                        <xref ref-type="bibr" rid="ref-18">18</xref>&#x2013;
                        <xref ref-type="bibr" rid="ref-20">20</xref>
                    </sup>. Oral and cough specimens were analyzed for these bacteria to determine levels of oral contamination.</p>
            </sec>
            <sec>
                <title>Determining sufficient aerosol collection</title>
                <p>Fennelly&#x2019;s Cough Aerosol Sampling System (CASS)
                    <sup>
                        <xref ref-type="bibr" rid="ref-29">29</xref>,
                        <xref ref-type="bibr" rid="ref-30">30</xref>
                    </sup> and Knibbs&#x2019; Distance Rig
                    <sup>
                        <xref ref-type="bibr" rid="ref-13">13</xref>
                    </sup> have demonstrated that cough particles can carry substantial concentrations of bacteria from lower respiratory infections. A previous article on the cough collection device describes the ability of the device to selectively sample from the lower lungs while excluding oral contaminants
                    <sup>
                        <xref ref-type="bibr" rid="ref-16">16</xref>
                    </sup>. The cough device used in this study provides a less cumbersome option to Fennelly&#x2019;s and Knibbs&#x2019; methods for lung specimen collection. Each patient coughed 10 times into the device to ensure sufficient aerosol collection.</p>
            </sec>
            <sec>
                <title>Microbiology</title>
                <p>Microbiology culturing has several limitations that decrease the efficiency and effectiveness of rapid diagnosis
                    <sup>
                        <xref ref-type="bibr" rid="ref-24">24</xref>
                    </sup>. Throat, sputum, and cough specimens were all analyzed using molecular PCR methods. All specimens were processed in a BSL 2 safety cabinet. The cough device filter was removed, placed into a 2 ml sterile freezer vial, and stored at -80&#x00b0;C. Respiratory secretions captured on the filter were removed by hydrating the filter with 1mL of lysis buffer (MagNA Pure LC lysis buffer; Roche Applied Science, Indianapolis, IN), vortexing, incubating for 5 min at room temperature, and collected using a pipette. Fluid remaining in the filter was collected by placing the filter in a sterile Costar SpinX microfuge tube with a 0.45 micron filter (Corning Inc., Corning, NY), centrifuging for 1 min at 10,000 rpm, and retrieved using a pipette. The residual fluid was then combined with original collected fluid and then 400 &#x03bc;L was extracted on the MagNA Pure Compact Instrument (Roche Applied Science) per the manufacturer&#x2019;s instructions. The extracted nucleic acid was eluted into 100 &#x03bc;L of elution buffer and stored at -80&#x00b0;C for qPCR testing.</p>
                <p>The sputum specimen was mixed with 1 mL of phosphate buffered saline (PBS), homogenized with pipetting and vortexing, mixed with a 12.5 mM equal volume of freshly prepared dithiothreitol (DTT, No Weigh&#x2122; format, Fisher Scientific), and incubated at room temperature for 30 min with periodic vortexing. The resultant solution was divided into 400 &#x03bc;L aliquots and stored at -80&#x00b0;C. A 400 &#x03bc;L aliquot of the processed sample was then extracted on the MagNA Pure Compact Instrument and stored as described above.</p>
                <p>The extracted nucleic acid was tested for 
                    <italic toggle="yes">P. aeruginosa</italic>, 
                    <italic toggle="yes">S. aureus</italic>, 
                    <italic toggle="yes">K. pneumoniae</italic>, and 
                    <italic toggle="yes">S. mitis</italic> targets by individual real-time PCR assays. The primer and probe sequences for these assays have been previously described
                    <sup>
                        <xref ref-type="bibr" rid="ref-25">25</xref>
                    </sup>. The 
                    <italic toggle="yes">S. mitis</italic> primers are: Forward TTTTGTCATCTAGCCTTGC; Reverse GCAGTCATATCATCACCTTC and Probe ACTTGGGCAATCCCGACAGATTCTAAC, with a 5' FAM reporter and a 3' BHQ quencher. The PCR reactions were done with 5 &#x03bc;l of extracted nucleic acid from the specimens plus 12.5 &#x03bc;l of PerfeCTa Multiplex qPCR SuperMix (catalog no. 95063-200; Quanta BioSciences), 0.5 &#x03bc;M final concentrations of each primer, 0.1 &#x03bc;M final concentration of the probe, and nuclease-free water (catalog no. P1193; Promega) to a final reaction volume of 25 &#x03bc;L. Real-time PCR reactions were performed using an ABI 7500 standard machine (Life Technologies, Carlsbad, CA) with enzyme activation at 95&#x00b0;C for 5 min, followed by 45 cycles of 95&#x00b0;C for 15 seconds and 60&#x00b0;C for 1 min. All specimens from CF patients were run in duplicate for each target. The 
                    <italic toggle="yes">C
                        <sub>T</sub>
                    </italic> values for individual PCR assays were used as an indication of the relative quantity of bacteria in the specimen.</p>
            </sec>
        </sec>
        <sec sec-type="results">
            <title>Results</title>
            <p>All subjects completed specimen collection safely. Ten healthy subjects were used for controls. Sputum and cough specimens were successfully collected from 20 adult patients with CF, with the exception of five patients who could not produce a sputum specimen.</p>
            <p>Normal controls demonstrated a high incidence of false positives from oral sampling, shown in 
                <xref ref-type="table" rid="T1">Table 1</xref>. Bacteria were isolated from throat swabs in 4/10 (40%) normal, healthy control subjects. 
                <italic toggle="yes">S. pneumoniae</italic> was positive in 2/10 (20%) oral specimens and 
                <italic toggle="yes">S. aureus</italic> was positive in 3/10 (30%) oral specimens, with one subject positive for both bacteria. In contrast, 0/10 (0%, p=0.0313) cough specimens were positive for bacteria in normal controls. The calculated true negative rate or specificity for sputum specimens was 60% and 100% for cough specimens.</p>
            <table-wrap id="T1" orientation="portrait" position="anchor">
                <label>Table 1. </label>
                <caption>
                    <title>Detection of bacteria in throat and cough specimens from normal, healthy controls.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="center" colspan="1" rowspan="1"/>
                            <th align="center" colspan="1" rowspan="1">Throat</th>
                            <th align="center" colspan="1" rowspan="1">Cough</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">1</td>
                            <td align="center" colspan="1" rowspan="1">
                                <italic toggle="yes">S. aureus</italic>
                            </td>
                            <td align="center" colspan="1" rowspan="1">Negative</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">2</td>
                            <td align="center" colspan="1" rowspan="1">Negative</td>
                            <td align="center" colspan="1" rowspan="1">Negative</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">3</td>
                            <td align="center" colspan="1" rowspan="1">Negative</td>
                            <td align="center" colspan="1" rowspan="1">Negative</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">4</td>
                            <td align="center" colspan="1" rowspan="1">
                                <italic toggle="yes">S. aureus</italic>
                            </td>
                            <td align="center" colspan="1" rowspan="1">Negative</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">5</td>
                            <td align="center" colspan="1" rowspan="1">
                                <italic toggle="yes">S. aureus</italic>, 
                                <italic toggle="yes">S. pneumoniae</italic>
                            </td>
                            <td align="center" colspan="1" rowspan="1">Negative</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">6</td>
                            <td align="center" colspan="1" rowspan="1">Negative</td>
                            <td align="center" colspan="1" rowspan="1">Negative</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">7</td>
                            <td align="center" colspan="1" rowspan="1">Negative</td>
                            <td align="center" colspan="1" rowspan="1">Negative</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">8</td>
                            <td align="center" colspan="1" rowspan="1">
                                <italic toggle="yes">S. pneumoniae</italic>
                            </td>
                            <td align="center" colspan="1" rowspan="1">Negative</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">9</td>
                            <td align="center" colspan="1" rowspan="1">Negative</td>
                            <td align="center" colspan="1" rowspan="1">Negative</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">10</td>
                            <td align="center" colspan="1" rowspan="1">Negative</td>
                            <td align="center" colspan="1" rowspan="1">Negative</td>
                        </tr>
                    </tbody>
                </table>
            </table-wrap>
            <p>Specificity in the CF patients was similar. For the CF patients, 
                <italic toggle="yes">S. mitis</italic> was isolated from 13/14 (93%) sputum specimens but in none of the cough specimens (0%, p=0.0002). The cough specimens collected no 
                <italic toggle="yes">S. mitis</italic>. CFRB was collected in both specimen types. 
                <italic toggle="yes">P. aeruginosa</italic> was isolated from 13/15 (87%) sputum specimens and 9/20 (45%) cough specimens (p=0.0213). 
                <italic toggle="yes">S. aureus</italic> was isolated from 9/15 (60%) sputum specimens and 3/20 (15%) cough specimens. 
                <italic toggle="yes">K. pneumoniae</italic> was isolated from 2/15 (13%) sputum specimens and 3/20 (15%) cough specimens.</p>
            <p>In aggregate, sputum specimens were positive for CFRB in 15/15 (100%) samples. Cough specimens were positive for CFRB in 13/20 (65%) samples. The sputum specimens had a 93% rate of oral commensals. Sputum specimens were positive for three or more pathogens in 2/15 (13%) samples, and positive for two or more pathogens in 7/15 (47%) samples. In contrast, cough specimens had no commensals and were positive in 65% of the CF patients. The cough specimens were positive for two or more pathogens in 2/20 (10%, p&lt;0.05) specimens and no cough specimens were positive for three or more pathogens. The results of these real-time PCR identifications are listed in 
                <xref ref-type="table" rid="T2">Table 2</xref>.</p>
            <table-wrap id="T2" orientation="portrait" position="anchor">
                <label>Table 2. </label>
                <caption>
                    <title>Detection of bacteria in sputum and cough specimens from adult CF patients.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th colspan="1" rowspan="1"/>
                            <th align="center" colspan="3" rowspan="1">Sputum</th>
                            <th align="center" colspan="3" rowspan="1">Cough</th>
                        </tr>
                        <tr>
                            <th colspan="1" rowspan="1"/>
                            <th align="center" colspan="1" rowspan="1">n=15*</th>
                            <th align="center" colspan="1" rowspan="1">%</th>
                            <th align="center" colspan="1" rowspan="1">
                                <italic toggle="yes">C
                                    <sub>T</sub>
                                </italic>
                                <break/>range</th>
                            <th align="center" colspan="1" rowspan="1">n=20</th>
                            <th align="center" colspan="1" rowspan="1">%</th>
                            <th align="center" colspan="1" rowspan="1">
                                <italic toggle="yes">C
                                    <sub>T</sub>
                                </italic>
                                <break/>range</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td colspan="1" rowspan="1">
                                <bold>
                                    <italic toggle="yes">P. aeruginosa</italic>
                                </bold>
                            </td>
                            <td align="center" colspan="1" rowspan="1">13/15</td>
                            <td align="center" colspan="1" rowspan="1">87%</td>
                            <td align="center" colspan="1" rowspan="1">18&#x2013;33</td>
                            <td align="center" colspan="1" rowspan="1">2/20</td>
                            <td align="center" colspan="1" rowspan="1">45%</td>
                            <td align="center" colspan="1" rowspan="1">33&#x2013;42</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">
                                <bold>
                                    <italic toggle="yes">S. aureus</italic>
                                </bold>
                            </td>
                            <td align="center" colspan="1" rowspan="1">9/15</td>
                            <td align="center" colspan="1" rowspan="1">60%</td>
                            <td align="center" colspan="1" rowspan="1">24&#x2013;38</td>
                            <td align="center" colspan="1" rowspan="1">3/20</td>
                            <td align="center" colspan="1" rowspan="1">15%</td>
                            <td align="center" colspan="1" rowspan="1">36&#x2013;40</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">
                                <bold>
                                    <italic toggle="yes">K. pneumoniae</italic>
                                </bold>
                            </td>
                            <td align="center" colspan="1" rowspan="1">2/15</td>
                            <td align="center" colspan="1" rowspan="1">13%</td>
                            <td align="center" colspan="1" rowspan="1">37&#x2013;38</td>
                            <td align="center" colspan="1" rowspan="1">3/20</td>
                            <td align="center" colspan="1" rowspan="1">15%</td>
                            <td align="center" colspan="1" rowspan="1">39&#x2013;43</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">
                                <bold>CFRB total</bold>
                            </td>
                            <td align="center" colspan="1" rowspan="1">15/15</td>
                            <td align="center" colspan="1" rowspan="1">100%</td>
                            <td align="center" colspan="1" rowspan="1">18&#x2013;38</td>
                            <td align="center" colspan="1" rowspan="1">13/20</td>
                            <td align="center" colspan="1" rowspan="1">65%</td>
                            <td align="center" colspan="1" rowspan="1">33&#x2013;43</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">
                                <bold>2+ pathogens</bold>
                            </td>
                            <td align="center" colspan="1" rowspan="1">7/15</td>
                            <td align="center" colspan="1" rowspan="1">47%</td>
                            <td align="center" colspan="1" rowspan="1">18&#x2013;38</td>
                            <td align="center" colspan="1" rowspan="1">2/20</td>
                            <td align="center" colspan="1" rowspan="1">10%</td>
                            <td align="center" colspan="1" rowspan="1">36&#x2013;43</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">
                                <bold>3+ pathogens</bold>
                            </td>
                            <td align="center" colspan="1" rowspan="1">2/15</td>
                            <td align="center" colspan="1" rowspan="1">13%</td>
                            <td align="center" colspan="1" rowspan="1">18&#x2013;38</td>
                            <td align="center" colspan="1" rowspan="1">0/20</td>
                            <td align="center" colspan="1" rowspan="1">0%</td>
                            <td align="center" colspan="1" rowspan="1">N/A</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">
                                <bold>
                                    <italic toggle="yes">S. mitis</italic>
                                </bold>
                            </td>
                            <td align="center" colspan="1" rowspan="1">13/14&#x2020;</td>
                            <td align="center" colspan="1" rowspan="1">93%</td>
                            <td align="center" colspan="1" rowspan="1">24&#x2013;41</td>
                            <td align="center" colspan="1" rowspan="1">0/17&#x00a7;</td>
                            <td align="center" colspan="1" rowspan="1">0%</td>
                            <td align="center" colspan="1" rowspan="1">N/A</td>
                        </tr>
                    </tbody>
                </table>
                <table-wrap-foot>
                    <fn>
                        <p>* Five patients were unable to produce viable sputum specimens</p>
                        <p>&#x2020; Six sputum specimens were not tested for 
                            <italic toggle="yes">S. mitis</italic>
                        </p>
                        <p>&#x00a7; Three cough specimens were not tested for 
                            <italic toggle="yes">S. mitis</italic>
                        </p>
                    </fn>
                </table-wrap-foot>
            </table-wrap>
            <p>
                <italic toggle="yes">C
                    <sub>T</sub>
                </italic> values are inversely proportional to the quantity of bacteria in a sample, i.e. small values indicate higher quantities of colony forming units (CFU). For the CFRB samples, 
                <italic toggle="yes">P. aeruginosa C
                    <sub>T</sub>
                </italic> values ranged from 18&#x2013;33 in sputum specimens and 33&#x2013;42 in cough specimens. 
                <italic toggle="yes">S. aureus C
                    <sub>T</sub>
                </italic> values ranged from 24&#x2013;38 in sputum specimens and 36&#x2013;40 in cough specimens. For both 
                <italic toggle="yes">P. aeruginosa</italic> and 
                <italic toggle="yes">S. aureus</italic> the cough and sputum specimens significantly differed in 
                <italic toggle="yes">C
                    <sub>T</sub>
                </italic> values (p=0.0017 and 0.0092, respectively). 
                <italic toggle="yes">K. pneumoniae C
                    <sub>T</sub>
                </italic> values ranged from 37&#x2013;38 in sputum specimens and 39&#x2013;43 in cough specimens. Thus, the 
                <italic toggle="yes">C
                    <sub>T</sub>
                </italic> values for cough specimens were consistently higher than those of sputum. Note that the cough filter samples from normal controls exhibited no pathogens up to 
                <italic toggle="yes">C
                    <sub>T</sub>
                </italic> values of 60.</p>
        </sec>
        <sec sec-type="discussion">
            <title>Discussion</title>
            <p>It is widely recognized that a simple, safe, non-invasive, low maintenance, inexpensive, widely accessible sampler is needed for the collection of lower respiratory pathogens
                <sup>
                    <xref ref-type="bibr" rid="ref-34">34</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-37">37</xref>
                </sup>.</p>
            <p>Collection of lower lung contents by coughing is much easier than BAL specimen collection. The method is convenient for patients who are already inclined to cough and they reported that the use of the device helped clear their lungs. Cough specimens may provide a non-invasive yet specific sample for in-home surveillance to watch for spikes in lung pathogens in patients with CF. Use of the device to collect cough aerosols has the potential to provide a clean alternative to oral samples for detecting lower lung pathogens.</p>
            <p>As is well known, commonly used samples of sputum or OP swabs show strong contamination in the upper airway
                <sup>
                    <xref ref-type="bibr" rid="ref-3">3</xref>,
                    <xref ref-type="bibr" rid="ref-4">4</xref>
                </sup>. Nearly all of the sputum specimens were positive for the oral commensal 
                <italic toggle="yes">S. mitis</italic>. In contrast, none of the cough specimens were positive for 
                <italic toggle="yes">S. mitis</italic>. This difference in the commensal 
                <italic toggle="yes">S. mitis</italic> between sputum and cough specimens reiterates the unreliability and low specificity of sputum
                <sup>
                    <xref ref-type="bibr" rid="ref-3">3</xref>,
                    <xref ref-type="bibr" rid="ref-4">4</xref>
                </sup>. Further, not all patients can produce an adequate sputum sample. Examining the 12 subjects with paired sputum and 
                <italic toggle="yes">S. mitis</italic> results, 8/12 (67%) sputum and cough specimens had concordant positives, although six of these eight were positive for additional bacteria in sputum. These six sputum specimens with multiple bacteria likely indicate false positives from oral contamination rather than co-infection.</p>
            <p>The number of concordant sputum and cough specimens (2/12, 17%) was small. Conversely, the pathogen detected in the cough specimen was different from that observed in the sputum specimen. 2/12 (17%) sputum specimens did not identify bacteria that were identified in cough specimens, possibly reflecting masked readings associated with commensal distraction. The differences demonstrate that the cough device is not just collecting sputum.</p>
            <p>
                <italic toggle="yes">P. aeruginosa</italic> is the most common bacterium found in lungs of adult CF patients
                <sup>
                    <xref ref-type="bibr" rid="ref-19">19</xref>
                </sup>, and was also the most prevalent bacterium collected in our cohort. 13/20 (65%) cough specimens were positive for CFRB. This incidence and distribution of pathogens in CF is similar to the 59% positive for CFRB in BAL sampling
                <sup>
                    <xref ref-type="bibr" rid="ref-22">22</xref>,
                    <xref ref-type="bibr" rid="ref-23">23</xref>
                </sup>. Prior series of BAL specimens in similar populations have yielded positive CFRB of 59&#x2013;85%, similar to the 65% positivity from the cough device illustrating comparable sensitivity
                <sup>
                    <xref ref-type="bibr" rid="ref-22">22</xref>,
                    <xref ref-type="bibr" rid="ref-23">23</xref>
                </sup>.</p>
            <p>Collection of exhaled aerosols has been studied by several previous groups. An alternate device for aerosol collection is the RTube&#x2122;; however, it varies greatly in design and function
                <sup>
                    <xref ref-type="bibr" rid="ref-28">28</xref>
                </sup>. The RTube&#x2122; system is designed to collect from all exhaled breath that condenses
                <sup>
                    <xref ref-type="bibr" rid="ref-28">28</xref>
                </sup> while PneumoniaCheck&#x2122; is designed to collect particulate sized lung aerosols and separate out the mouth contents
                <sup>
                    <xref ref-type="bibr" rid="ref-16">16</xref>
                </sup>. The majority of exhaled gas passes out of the end of the RTube&#x2122; as only water condensate is intended to be collected. Exhaled breath condensate can be a useful specimen for identifying pH levels, but is generally not viewed as a reliable specimen for identifying lower respiratory infections
                <sup>
                    <xref ref-type="bibr" rid="ref-34">34</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-37">37</xref>
                </sup>.</p>
            <p>Wainwright 
                <italic toggle="yes">et al</italic>., reported detecting 
                <italic toggle="yes">P. aeruginosa</italic> in cough aerosols by culture
                <sup>
                    <xref ref-type="bibr" rid="ref-12">12</xref>
                </sup>. They reported 25/28 (89%) positive in a mixed population of children and adults with CF using a cough aerosol sampling system (CASS) for 5 minutes with each subject
                <sup>
                    <xref ref-type="bibr" rid="ref-12">12</xref>
                </sup>. Similarly, Knibbs 
                <italic toggle="yes">et al.</italic> reported that 14/18 (78%) patients aerosolized 
                <italic toggle="yes">P. aeruginosa</italic> that remained viable and presumably transmissive up to 45 minutes after coughs sampled on an Anderson impactor
                <sup>
                    <xref ref-type="bibr" rid="ref-13">13</xref>
                </sup>. Knibbs 
                <italic toggle="yes">et al</italic>. used conventional microbiology cultures to quantify colony forming units. Both of these studies used a specially constructed aerosol sampler that is expensive, cumbersome, and difficult to use in a clinical setting. For these studies, patients cough into a standard mouthpiece and aerosols are sucked into impactors using vacuum air pumps. The CASS system was not designed for routine use in clinical settings and the mouthpiece was not designed to exclude oral contents. These designs differ from PneumoniaCheck&#x2122;, which has a mouthpiece designed to specifically exclude oral contaminants
                <sup>
                    <xref ref-type="bibr" rid="ref-16">16</xref>
                </sup>. The high incidence of 
                <italic toggle="yes">P. aeruginosa</italic>, using the snorkel type mouthpiece and tubing, may reflect some collection of oral contents using CASS.</p>
            <p>RT-PCR may be used to quantify the amount of pathogens in a sample. As more material is collected on the filter, the 
                <italic toggle="yes">C
                    <sub>T</sub>
                </italic> counts will drop similar to the inverse of CFUs
                <sup>
                    <xref ref-type="bibr" rid="ref-32">32</xref>
                </sup>. It should be noted that an aerosolized lung specimen should have higher 
                <italic toggle="yes">C
                    <sub>T</sub>
                </italic> values compared to the liquid specimens of sputum due to a lack of contamination and the small physical volume of aerosols. 
                <italic toggle="yes">C
                    <sub>T</sub>
                </italic> values in the sputum specimens ranged from 19&#x2013;38, whereas the range in cough specimens was 33&#x2013;43 (p&lt;0.001, 
                <xref ref-type="table" rid="T3">Table 3</xref>). Nonetheless, 
                <italic toggle="yes">C
                    <sub>T</sub>
                </italic> values in all positive cough specimens are significantly lower than the baseline of &gt;60 for normal controls. While the 
                <italic toggle="yes">C
                    <sub>T</sub>
                </italic> values are higher for the cough specimens, the background noise level of the virgin filter is &gt;60, allowing limits of detection by PCR that may be more sensitive to lung CFRB.</p>
            <table-wrap id="T3" orientation="portrait" position="anchor">
                <label>Table 3. </label>
                <caption>
                    <title>
                        <italic toggle="yes">C
                            <sub>T</sub>
                        </italic> values of sputum and cough specimens grouped by pathogen.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="center" colspan="1" rowspan="1">Subject</th>
                            <th align="center" colspan="2" rowspan="1">
                                <italic toggle="yes">P. aeruginosa</italic>
                            </th>
                            <th align="center" colspan="2" rowspan="1">
                                <italic toggle="yes">S. aureus</italic>
                            </th>
                            <th align="center" colspan="2" rowspan="1">
                                <italic toggle="yes">K. pneumoniae</italic>
                            </th>
                            <th align="center" colspan="2" rowspan="1">
                                <italic toggle="yes">S. mitis</italic>
                            </th>
                        </tr>
                        <tr>
                            <th align="center" colspan="1" rowspan="1">#</th>
                            <th align="center" colspan="1" rowspan="1">Sputum</th>
                            <th align="center" colspan="1" rowspan="1">Cough</th>
                            <th align="center" colspan="1" rowspan="1">Sputum</th>
                            <th align="center" colspan="1" rowspan="1">Cough</th>
                            <th align="center" colspan="1" rowspan="1">Sputum</th>
                            <th align="center" colspan="1" rowspan="1">Cough</th>
                            <th align="center" colspan="1" rowspan="1">Sputum</th>
                            <th align="center" colspan="1" rowspan="1">Cough</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">1</td>
                            <td align="center" colspan="1" rowspan="1">22</td>
                            <td align="center" colspan="1" rowspan="1">33</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">41</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">2</td>
                            <td align="center" colspan="1" rowspan="1">N/A</td>
                            <td align="center" colspan="1" rowspan="1">42</td>
                            <td align="center" colspan="1" rowspan="1">N/A</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">N/A</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">N/A</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">3</td>
                            <td align="center" colspan="1" rowspan="1">32</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">32</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">4</td>
                            <td align="center" colspan="1" rowspan="1">21</td>
                            <td align="center" colspan="1" rowspan="1">41</td>
                            <td align="center" colspan="1" rowspan="1">36</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">24</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">5</td>
                            <td align="center" colspan="1" rowspan="1">N/A</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">N/A</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">N/A</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">N/A</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">6</td>
                            <td align="center" colspan="1" rowspan="1">18</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">41</td>
                            <td align="center" colspan="1" rowspan="1">32</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">7</td>
                            <td align="center" colspan="1" rowspan="1">N/A</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">N/A</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">N/A</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">N/A</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">8</td>
                            <td align="center" colspan="1" rowspan="1">N/A</td>
                            <td align="center" colspan="1" rowspan="1">35</td>
                            <td align="center" colspan="1" rowspan="1">N/A</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">N/A</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">N/A</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">9</td>
                            <td align="center" colspan="1" rowspan="1">N/A</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">N/A</td>
                            <td align="center" colspan="1" rowspan="1">36</td>
                            <td align="center" colspan="1" rowspan="1">N/A</td>
                            <td align="center" colspan="1" rowspan="1">43</td>
                            <td align="center" colspan="1" rowspan="1">31</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">10</td>
                            <td align="center" colspan="1" rowspan="1">19</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">38</td>
                            <td align="center" colspan="1" rowspan="1">40</td>
                            <td align="center" colspan="1" rowspan="1">37</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">N/A</td>
                            <td align="center" colspan="1" rowspan="1">N/A</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">11</td>
                            <td align="center" colspan="1" rowspan="1">19</td>
                            <td align="center" colspan="1" rowspan="1">42</td>
                            <td align="center" colspan="1" rowspan="1">27</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">38</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">N/A</td>
                            <td align="center" colspan="1" rowspan="1">N/A</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">12</td>
                            <td align="center" colspan="1" rowspan="1">20</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">30</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">13</td>
                            <td align="center" colspan="1" rowspan="1">33</td>
                            <td align="center" colspan="1" rowspan="1">39</td>
                            <td align="center" colspan="1" rowspan="1">30</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">33</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">14</td>
                            <td align="center" colspan="1" rowspan="1">33</td>
                            <td align="center" colspan="1" rowspan="1">40</td>
                            <td align="center" colspan="1" rowspan="1">24</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">33</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">15</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">37</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">32</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">16</td>
                            <td align="center" colspan="1" rowspan="1">25</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">31</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">17</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">33</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">39</td>
                            <td align="center" colspan="1" rowspan="1">27</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">18</td>
                            <td align="center" colspan="1" rowspan="1">25</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">29</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">19</td>
                            <td align="center" colspan="1" rowspan="1">25</td>
                            <td align="center" colspan="1" rowspan="1">39</td>
                            <td align="center" colspan="1" rowspan="1">29</td>
                            <td align="center" colspan="1" rowspan="1">39</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">29</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                        </tr>
                        <tr>
                            <td align="center" colspan="1" rowspan="1">20</td>
                            <td align="center" colspan="1" rowspan="1">22</td>
                            <td align="center" colspan="1" rowspan="1">42</td>
                            <td align="center" colspan="1" rowspan="1">34</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">-</td>
                            <td align="center" colspan="1" rowspan="1">N/A</td>
                        </tr>
                    </tbody>
                </table>
            </table-wrap>
            <p>One can utilize the 
                <italic toggle="yes">C
                    <sub>T</sub>
                </italic> values to compare relative amounts of pathogens being coughed by an individual patient compared with a population
                <sup>
                    <xref ref-type="bibr" rid="ref-32">32</xref>,
                    <xref ref-type="bibr" rid="ref-33">33</xref>
                </sup>. Jones-L&#x00f3;pez 
                <italic toggle="yes">et al.</italic> found that both CF and TB patients can produce aerosols with viable pathogens, but the amount of pathogens produced by individuals varies greatly
                <sup>
                    <xref ref-type="bibr" rid="ref-31">31</xref>
                </sup>. Patients with high amounts of 
                <italic toggle="yes">M. tuberculosis</italic> in cough aerosols were more likely to have transmitted to others
                <sup>
                    <xref ref-type="bibr" rid="ref-30">30</xref>
                </sup>. Those that produce large amounts of pathogens in coughs may be more efficient transmitters, e.g. &#x201c;superspreaders&#x201d;
                <sup>
                    <xref ref-type="bibr" rid="ref-13">13</xref>,
                    <xref ref-type="bibr" rid="ref-30">30</xref>
                </sup>. The quantity of pathogens in a cough may be a critical metric in transmission of infectious disease, controlling epidemics, and monitoring colonization. In the Jones-L&#x00f3;pez 
                <italic toggle="yes">et al</italic>. study, the amount of aerosolized 
                <italic toggle="yes">M. tuberculosis</italic> fell dramatically after three weeks of treatment. Therefore, a cough specimen could also be used to monitor levels of resistant bacteria, if present.</p>
            <p>Published guidelines for CF patients suggest acquiring quarterly respiratory specimens to monitor lung infections
                <sup>
                    <xref ref-type="bibr" rid="ref-26">26</xref>,
                    <xref ref-type="bibr" rid="ref-27">27</xref>
                </sup>. Cough specimens may be a more specific and sensitive method for monitoring colonization and determining infectivity. Additional studies could explore this application further by comparing 
                <italic toggle="yes">C
                    <sub>T</sub>
                </italic> values with symptoms. If a CF patient is monitored on a regular basis using cough specimens, a sudden decrease in 
                <italic toggle="yes">C
                    <sub>T</sub>
                </italic> value may indicate a change in pathogen burden
                <sup>
                    <xref ref-type="bibr" rid="ref-32">32</xref>,
                    <xref ref-type="bibr" rid="ref-33">33</xref>
                </sup>. The 
                <italic toggle="yes">C
                    <sub>T</sub>
                </italic> value of pathogen burden in cough aerosols may be useful as a measurement to determine if the lung burden is growing.</p>
            <p>This study has several limitations. Our study included only adult patients; thus, we cannot comment on the aerosol production during coughing by pediatric patients. This study reports on 20 patients. Most studies in the literature have a similar number of subjects, since lower respiratory identification has always been an enormous challenge
                <sup>
                    <xref ref-type="bibr" rid="ref-12">12</xref>,
                    <xref ref-type="bibr" rid="ref-13">13</xref>
                </sup>. Future studies may evaluate the benefits of requiring more coughs or coughing for a specified amount of time, such as 5 minutes, to establish 
                <italic toggle="yes">C
                    <sub>T</sub>
                </italic> thresholds for this new method of specimen collection. The RT-PCR molecular assays used in this study are not available at all hospitals, although a few commercial laboratories can provide clinical respiratory identification services.</p>
        </sec>
        <sec sec-type="conclusions">
            <title>Conclusion</title>
            <p>In summary, we have shown that a new device can collect lung pathogens from adult patients with CF from cough aerosols with identification using molecular assays. The device excludes oral contaminants showing higher specificity than sputum samples. Identifying causative pathogens in the lower respiratory tract is likely to play a significant role in patient management
                <sup>
                    <xref ref-type="bibr" rid="ref-24">24</xref>
                </sup>. The data in this study suggest an alternative to sputum collection for the identification of lower respiratory pathogens.</p>
        </sec>
        <sec>
            <title>Consent</title>
            <p>Written informed consent was obtained by all participants through Institutional Review Board Protocol #000-2492 approved by Georgia Institute of Technology, Emory University, and US Centers for Disease Control and Prevention.</p>
        </sec>
        <sec>
            <title>Data availability</title>
            <p>All raw data are provided in the tables above.</p>
        </sec>
    </body>
    <back>
        <ref-list>
            <ref id="ref-1">
                <label>1</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Burns</surname>
                            <given-names>MW</given-names>
                        </name>						
					</person-group>:
                    <article-title>Precipitins to Klebsiella and Other Enterobacteria in the Serum of Patients with Chronic Respiratory Disorders.</article-title>
                    <source>
						
                        <italic toggle="yes">The Lancet.</italic>
					</source>
                    <year>1968</year>;<volume>1</volume>(<issue>7539</issue>):<fpage>383</fpage>&#x2013;<lpage>385</lpage>.
                    <pub-id pub-id-type="pmid">4169973</pub-id>
                    <pub-id pub-id-type="doi">10.1016/S0140-6736(68)91353-6</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-2">
                <label>2</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Goddard</surname>
                            <given-names>AF</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Staudinger</surname>
                            <given-names>BJ</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Dowd</surname>
                            <given-names>SE</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Direct sampling of cystic fibrosis lungs indicates that DNA-based analyses of upper-airway specimens can misrepresent lung microbiota.</article-title>
                    <source>
						
                        <italic toggle="yes">Proc Natl Acad Sci U S A.</italic>
					</source>
                    <year>2012</year>;<volume>109</volume>(<issue>34</issue>):<fpage>13769</fpage>&#x2013;<lpage>13774</lpage>.
                    <pub-id pub-id-type="pmid">22872870</pub-id>
                    <pub-id pub-id-type="doi">10.1073/pnas.1107435109</pub-id>
                    <pub-id pub-id-type="pmcid">3427132</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-3">
                <label>3</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Lentino</surname>
                            <given-names>JR</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Lucks</surname>
                            <given-names>DA</given-names>
                        </name>
					</person-group>:
                    <article-title>Nonvalue of Sputum Culture in the Management of Lower Respiratory Tract Infections.</article-title>
                    <source>
						
                        <italic toggle="yes">J Clin Microbiol.</italic>
					</source>
                    <year>1987</year>;<volume>25</volume>(<issue>5</issue>):<fpage>758</fpage>&#x2013;<lpage>762</lpage>.
                    <pub-id pub-id-type="pmid">2438299</pub-id>
                    <pub-id pub-id-type="pmcid">266084</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-4">
                <label>4</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Rosenfeld</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Emerson</surname>
                            <given-names>J</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Accurso</surname>
                            <given-names>F</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Diagnostic accuracy of oropharyngeal cultures in infants and young children with cystic fibrosis.</article-title>
                    <source>
						
                        <italic toggle="yes">Pediatr Pulmonol.</italic>
					</source>
                    <year>1999</year>;<volume>28</volume>(<issue>5</issue>):<fpage>321</fpage>&#x2013;<lpage>328</lpage>.
                    <pub-id pub-id-type="pmid">10536062</pub-id>
                    <pub-id pub-id-type="doi">10.1002/(SICI)1099-0496(199911)28:5&lt;321::AID-PPUL3&gt;3.0.CO;2-V</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-5">
                <label>5</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Gilchrist</surname>
                            <given-names>FJ</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Salamat</surname>
                            <given-names>S</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Clayton</surname>
                            <given-names>S</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Bronchoalveolar lavage in children with cystic fibrosis: how many lobes should be sampled?</article-title>
                    <source>
						
                        <italic toggle="yes">Arch Dis Child.</italic>
					</source>
                    <year>2011</year>;<volume>96</volume>:<fpage>215</fpage>&#x2013;<lpage>217</lpage>.
                    <pub-id pub-id-type="pmid">20930010</pub-id>
                    <pub-id pub-id-type="doi">10.1136/adc.2009.177618</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-6">
                <label>6</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Willner</surname>
                            <given-names>D</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Haynes</surname>
                            <given-names>MR</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Furlan</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Spatial distribution of microbial communities in the cystic fibrosis lung.</article-title>
                    <source>
						
                        <italic toggle="yes">ISME J.</italic>
					</source>
                    <year>2012</year>;<volume>6</volume>(<issue>2</issue>):<fpage>471</fpage>&#x2013;<lpage>474</lpage>.
                    <pub-id pub-id-type="pmid">21796216</pub-id>
                    <pub-id pub-id-type="doi">10.1038/ismej.2011.104</pub-id>
                    <pub-id pub-id-type="pmcid">3260497</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-7">
                <label>7</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Wimberley</surname>
                            <given-names>N</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Faling</surname>
                            <given-names>LJ</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Bartlett</surname>
                            <given-names>JG</given-names>
                        </name>
					</person-group>:
                    <article-title>A Fiberoptic Bronchoscopy Technique to Obtain Uncontaminated Lower Airway Secretions for Bacterial Culture.</article-title>
                    <source>
						
                        <italic toggle="yes">Am Rev Respir Dis.</italic>
					</source>
                    <year>1979</year>;<volume>119</volume>(<issue>3</issue>):<fpage>337</fpage>&#x2013;<lpage>343</lpage>.
                    <pub-id pub-id-type="pmid">375784</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-8">
                <label>8</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Couch</surname>
                            <given-names>RB</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Cate</surname>
                            <given-names>TR</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Douglas</surname>
                            <given-names>RG</given-names>
                            <suffix>Jr</suffix>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Effect of Route of Inoculation on Experimental Respiratory Viral Disease in Volunteers and Evidence for Airborne Transmission.</article-title>
                    <source>
						
                        <italic toggle="yes">Bacteriol Rev.</italic>
					</source>
                    <year>1966</year>;<volume>30</volume>(<issue>3</issue>):<fpage>517</fpage>&#x2013;<lpage>529</lpage>.
                    <pub-id pub-id-type="pmid">5920335</pub-id>
                    <pub-id pub-id-type="pmcid">378233</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-9">
                <label>9</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Couch</surname>
                            <given-names>RB</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Cate</surname>
                            <given-names>TR</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Gerone</surname>
                            <given-names>PJ</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Production of Illness with a Small-Particle Aerosol of Coxsackie A
                        <sub>21</sub>.</article-title>
                    <source>
						
                        <italic toggle="yes">J Clin Invest.</italic>
					</source>
                    <year>1965</year>;<volume>44</volume>(<issue>4</issue>):<fpage>535</fpage>&#x2013;<lpage>542</lpage>.
                    <pub-id pub-id-type="pmid">14278169</pub-id>
                    <pub-id pub-id-type="doi">10.1172/JCI105166</pub-id>
                    <pub-id pub-id-type="pmcid">292521</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-10">
                <label>10</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Gerone</surname>
                            <given-names>PJ</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Couch</surname>
                            <given-names>RB</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Keefer</surname>
                            <given-names>GV</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Assessment of Experimental and Natural Viral Aerosols.</article-title>
                    <source>
						
                        <italic toggle="yes">Bacteriol Rev.</italic>
					</source>
                    <year>1966</year>;<volume>30</volume>(<issue>3</issue>):<fpage>576</fpage>&#x2013;<lpage>584</lpage>.
                    <pub-id pub-id-type="pmid">5917337</pub-id>
                    <pub-id pub-id-type="pmcid">378244</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-11">
                <label>11</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Lee</surname>
                            <given-names>N</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Chan</surname>
                            <given-names>PK</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Hui</surname>
                            <given-names>DS</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Viral loads and duration of viral shedding in adult patients hospitalized with influenza.</article-title>
                    <source>
						
                        <italic toggle="yes">J Infect Dis.</italic>
					</source>
                    <year>2009</year>;<volume>200</volume>(<issue>4</issue>):<fpage>492</fpage>&#x2013;<lpage>500</lpage>.
                    <pub-id pub-id-type="pmid">19591575</pub-id>
                    <pub-id pub-id-type="doi">10.1086/600383</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-12">
                <label>12</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Wainwright</surname>
                            <given-names>CE</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>France</surname>
                            <given-names>MW</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>O&#x2019;Rourke</surname>
                            <given-names>P</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Cough-generated aerosols of 
                        <italic toggle="yes">Pseudomonas aeruginosa</italic> and other Gram-negative bacteria from patients with cystic fibrosis.</article-title>
                    <source>
						
                        <italic toggle="yes">Thorax.</italic>
					</source>
                    <year>2009</year>;<volume>64</volume>(<issue>11</issue>):<fpage>926</fpage>&#x2013;<lpage>931</lpage>.
                    <pub-id pub-id-type="pmid">19574243</pub-id>
                    <pub-id pub-id-type="doi">10.1136/thx.2008.112466</pub-id>
                    <pub-id pub-id-type="pmcid">2764123</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-13">
                <label>13</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Knibbs</surname>
                            <given-names>LD</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Johnson</surname>
                            <given-names>GR</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Kidd</surname>
                            <given-names>TJ</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Viability of 
                        <italic toggle="yes">Pseudomonas aeruginosa</italic> in cough aerosols generated by persons with cystic fibrosis.</article-title>
                    <source>
						
                        <italic toggle="yes">Thorax.</italic>
					</source>
                    <year>2014</year>;<volume>69</volume>(<issue>8</issue>):<fpage>740</fpage>&#x2013;<lpage>745</lpage>.
                    <pub-id pub-id-type="pmid">24743559</pub-id>
                    <pub-id pub-id-type="doi">10.1136/thoraxjnl-2014-205213</pub-id>
                    <pub-id pub-id-type="pmcid">4112489</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-14">
                <label>14</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Liljemark</surname>
                            <given-names>WF</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Gibbons</surname>
                            <given-names>RJ</given-names>
                        </name>
					</person-group>:
                    <article-title>Proportional distribution and relative adherence of streptococcus miteor (
                        <italic toggle="yes">mitis</italic>) on various surfaces in the human oral cavity.</article-title>
                    <source>
						
                        <italic toggle="yes">Infect Immun.</italic>
					</source>
                    <year>1972</year>;<volume>6</volume>(<issue>5</issue>):<fpage>852</fpage>&#x2013;<lpage>859</lpage>.
                    <pub-id pub-id-type="pmid">4637299</pub-id>
                    <pub-id pub-id-type="pmcid">422620</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-15">
                <label>15</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Hart</surname>
                            <given-names>MC</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Orzalesi</surname>
                            <given-names>MM</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Cook</surname>
                            <given-names>CD</given-names>
                        </name>
					</person-group>:
                    <article-title>Relation between anatomic respiratory dead space and body size and lung volume.</article-title>
                    <source>
						
                        <italic toggle="yes">J Appl Physiol.</italic>
					</source>
                    <year>1963</year>;<volume>18</volume>(<issue>3</issue>):<fpage>519</fpage>&#x2013;<lpage>522</lpage>.
                    <ext-link ext-link-type="uri" xlink:href="http://jap.physiology.org/content/18/3/519">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-16">
                <label>16</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Scholz</surname>
                            <given-names>TL</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Midha</surname>
                            <given-names>PA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Anderson</surname>
                            <given-names>LJ</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>PneumoniaCheck: A Device for Sampling Lower Airway Aerosols.</article-title>
                    <source>
						
                        <italic toggle="yes">J Med Devices.</italic>
					</source>
                    <year>2010</year>;<volume>4</volume>(<issue>4</issue>):<fpage>041005</fpage>.
                    <pub-id pub-id-type="doi">10.1115/1.4002760</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-17">
                <label>17</label>
                <mixed-citation publication-type="book">
                    <source>Cystic Fibrosis Foundation Patient Registry: 2013 Annual Data Report to the Center Directors.</source>Bethesda, Maryland.<year>2014</year>.</mixed-citation>
            </ref>
            <ref id="ref-18">
                <label>18</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Furness</surname>
                            <given-names>JC</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Habeb</surname>
                            <given-names>A</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Spencer</surname>
                            <given-names>DA</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>To the editor: Bronchoalveolar lavage (BAL) in pediatric cystic fibrosis (CF): its clinical use modified by audit in a regional CF center.</article-title>
                    <source>
						
                        <italic toggle="yes">Pediatr Pulmonol.</italic>
					</source>
                    <year>2002</year>;<volume>33</volume>(<issue>3</issue>):<fpage>234</fpage>.
                    <pub-id pub-id-type="pmid">11836806</pub-id>
                    <pub-id pub-id-type="doi">10.1002/ppul.10052</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-19">
                <label>19</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Lyczak</surname>
                            <given-names>JB</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Cannon</surname>
                            <given-names>CL</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Pier</surname>
                            <given-names>GB</given-names>
                        </name>
					</person-group>:
                    <article-title>Lung infections associated with cystic fibrosis.</article-title>
                    <source>
						
                        <italic toggle="yes">Clin Microbiol Rev.</italic>
					</source>
                    <year>2002</year>;<volume>15</volume>(<issue>2</issue>):<fpage>194</fpage>&#x2013;<lpage>222</lpage>.
                    <pub-id pub-id-type="pmid">11932230</pub-id>
                    <pub-id pub-id-type="doi">10.1128/CMR.15.2.194-222.2002</pub-id>
                    <pub-id pub-id-type="pmcid">118069</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-20">
                <label>20</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Ramsey</surname>
                            <given-names>BW</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Wentz</surname>
                            <given-names>KR</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Smith</surname>
                            <given-names>AL</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Predictive value of oropharyngeal cultures for identifying lower airway bacteria in cystic fibrosis patients.</article-title>
                    <source>
						
                        <italic toggle="yes">Am Rev Respir Dis.</italic>
					</source>
                    <year>1991</year>;<volume>144</volume>(<issue>2</issue>):<fpage>331</fpage>&#x2013;<lpage>337</lpage>.
                    <pub-id pub-id-type="pmid">1859056</pub-id>
                    <pub-id pub-id-type="doi">10.1164/ajrccm/144.2.331</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-21">
                <label>21</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Armstrong</surname>
                            <given-names>DS</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Grimwood</surname>
                            <given-names>K</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Carlin</surname>
                            <given-names>JB</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Bronchoalveolar lavage or oropharyngeal cultures to identify lower respiratory pathogens in infants with cystic fibrosis.</article-title>
                    <source>
						
                        <italic toggle="yes">Pediatr Pulmonol.</italic>
					</source>
                    <year>1996</year>;<volume>21</volume>(<issue>5</issue>):<fpage>267</fpage>&#x2013;<lpage>275</lpage>.
                    <pub-id pub-id-type="pmid">8726151</pub-id>
                    <pub-id pub-id-type="doi">10.1002/(SICI)1099-0496(199605)21:5&lt;267::AID-PPUL1&gt;3.0.CO;2-K</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-22">
                <label>22</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Harris</surname>
                            <given-names>JK</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>De Groote</surname>
                            <given-names>MA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Sagel</surname>
                            <given-names>SD</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Molecular identification of bacteria in bronchoalveolar lavage fluid from children with cystic fibrosis.</article-title>
                    <source>
						
                        <italic toggle="yes">Proc Natl Acad Sci U S A.</italic>
					</source>
                    <year>2007</year>;<volume>104</volume>(<issue>51</issue>):<fpage>20529</fpage>&#x2013;<lpage>20533</lpage>.
                    <pub-id pub-id-type="pmid">18077362</pub-id>
                    <pub-id pub-id-type="doi">10.1073/pnas.0709804104</pub-id>
                    <pub-id pub-id-type="pmcid">2154465</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-23">
                <label>23</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Zemanick</surname>
                            <given-names>ET</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Wagner</surname>
                            <given-names>BD</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Harris</surname>
                            <given-names>JK</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Pulmonary exacerbations in cystic fibrosis with negative bacterial cultures.</article-title>
                    <source>
						
                        <italic toggle="yes">Pediatr Pulmonol.</italic>
					</source>
                    <year>2010</year>;<volume>45</volume>(<issue>6</issue>):<fpage>569</fpage>&#x2013;<lpage>577</lpage>.
                    <pub-id pub-id-type="pmid">20503282</pub-id>
                    <pub-id pub-id-type="doi">10.1002/ppul.21221</pub-id>
                    <pub-id pub-id-type="pmcid">2937349</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-24">
                <label>24</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Oosterheert</surname>
                            <given-names>JJ</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Bonten</surname>
                            <given-names>MJ</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Buskens</surname>
                            <given-names>E</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Algorithm to determine cost savings of targeting antimicrobial therapy based on results of rapid diagnostic testing.</article-title>
                    <source>
						
                        <italic toggle="yes">J Clin Microbiol.</italic>
					</source>
                    <year>2003</year>;<volume>41</volume>(<issue>10</issue>):<fpage>4708</fpage>&#x2013;<lpage>4713</lpage>.
                    <pub-id pub-id-type="pmid">14532208</pub-id>
                    <pub-id pub-id-type="doi">10.1128/JCM.41.10.4708-4713.2003 </pub-id>
                    <pub-id pub-id-type="pmcid">254365</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-25">
                <label>25</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Emery</surname>
                            <given-names>SL</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Erdman</surname>
                            <given-names>DD</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Bowen</surname>
                            <given-names>MD</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Real-time reverse transcription-polymerase chain reaction assay for SARS-associated coronavirus.</article-title>
                    <source>
						
                        <italic toggle="yes">Emer Infect Dis.</italic>
					</source>
                    <year>2004</year>;<volume>10</volume>(<issue>2</issue>):<fpage>311</fpage>&#x2013;<lpage>316</lpage>.
                    <pub-id pub-id-type="pmid">15030703</pub-id>
                    <pub-id pub-id-type="doi">10.3201/eid1002.030759</pub-id>
                    <pub-id pub-id-type="pmcid">3322901</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-26">
                <label>26</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Saiman</surname>
                            <given-names>L</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Siegel</surname>
                            <given-names>J</given-names>
                        </name>						
					</person-group>,
                    <collab>Cystic Fibrosis Foundation</collab>:
                    <article-title>Infection control recommendations for patients with cystic fibrosis: microbiology, important pathogens, and infection control practices to prevent patient-to-patient transmission.</article-title>
                    <source>
						
                        <italic toggle="yes">Infect Control Hosp Epidemiol.</italic>
					</source>
                    <year>2003</year>;<volume>24</volume>(<issue>5 Suppl</issue>):<fpage>S6</fpage>&#x2013;<lpage>52</lpage>.
                    <pub-id pub-id-type="pmid">12789902</pub-id>
                    <pub-id pub-id-type="doi">10.1086/503485</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-27">
                <label>27</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Yankaskas</surname>
                            <given-names>JR</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Marshall</surname>
                            <given-names>BC</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Sufian</surname>
                            <given-names>B</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Cystic fibrosis adult care: consensus conference report.</article-title>
                    <source>
						
                        <italic toggle="yes">Chest.</italic>
					</source>
                    <year>2004</year>;<volume>125</volume>(<issue>1 Suppl</issue>):<fpage>1S</fpage>&#x2013;<lpage>39S</lpage>.
                    <pub-id pub-id-type="pmid">14734689</pub-id>
                    <pub-id pub-id-type="doi">10.1378/chest.125.1_suppl.1S</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-28">
                <label>28</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Soyer</surname>
                            <given-names>OU</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Dizdar</surname>
                            <given-names>EA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Keskin</surname>
                            <given-names>O</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Comparison of two methods for exhaled breath condensate collection.</article-title>
                    <source>
						
                        <italic toggle="yes">Allergy.</italic>
					</source>
                    <year>2006</year>;<volume>61</volume>(<issue>8</issue>):<fpage>1016</fpage>&#x2013;<lpage>1018</lpage>.
                    <pub-id pub-id-type="pmid">16867057</pub-id>
                    <pub-id pub-id-type="doi">10.1111/j.1398-9995.2006.01064.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-29">
                <label>29</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Fennelly</surname>
                            <given-names>KP</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Martyny</surname>
                            <given-names>JW</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Fulton</surname>
                            <given-names>KE</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Cough-generated aerosols of 
                        <italic toggle="yes">Mycobacterium tuberculosis</italic>: a new method to study infectiousness.</article-title>
                    <source>
						
                        <italic toggle="yes">Am J Respir Crit Care Med.</italic>
					</source>
                    <year>2004</year>;<volume>169</volume>(<issue>5</issue>):<fpage>604</fpage>&#x2013;<lpage>609</lpage>.
                    <pub-id pub-id-type="pmid">14656754</pub-id>
                    <pub-id pub-id-type="doi">10.1164/rccm.200308-1101OC</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-30">
                <label>30</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Fennelly</surname>
                            <given-names>KP</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Jones-L&#x00f3;pez</surname>
                            <given-names>EC</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Ayakaka</surname>
                            <given-names>I</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Variability of infectious aerosols produced during coughing by patients with pulmonary tuberculosis.</article-title>
                    <source>
						
                        <italic toggle="yes">Am J Respir Crit Care Med.</italic>
					</source>
                    <year>2012</year>;<volume>186</volume>(<issue>5</issue>):<fpage>450</fpage>&#x2013;<lpage>457</lpage>.
                    <pub-id pub-id-type="pmid">22798319</pub-id>
                    <pub-id pub-id-type="doi">10.1164/rccm.201203-0444OC</pub-id>
                    <pub-id pub-id-type="pmcid">3443801</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-31">
                <label>31</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Jones-L&#x00f3;pez</surname>
                            <given-names>EC</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Namugga</surname>
                            <given-names>O</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Mumbowa</surname>
                            <given-names>F</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Cough aerosols of 
                        <italic toggle="yes">Mycobacterium tuberculosis</italic> predict new infection: a household contact study.</article-title>
                    <source>
						
                        <italic toggle="yes">Am J Respir Crit Care Med.</italic>
					</source>
                    <year>2013</year>;<volume>187</volume>(<issue>9</issue>):<fpage>1007</fpage>&#x2013;<lpage>1015</lpage>.
                    <pub-id pub-id-type="pmid">23306539</pub-id>
                    <pub-id pub-id-type="doi">10.1164/rccm.201208-1422OC</pub-id>
                    <pub-id pub-id-type="pmcid">3707366</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-32">
                <label>32</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Mehta</surname>
                            <given-names>T</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>McGrath</surname>
                            <given-names>E</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Bheemreddy</surname>
                            <given-names>S</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Detection of oseltamivir resistance during treatment of 2009 H1N1 influenza virus infection in immunocompromised patients: utility of cycle threshold values of qualitative real-time reverse transcriptase PCR.</article-title>
                    <source>
						
                        <italic toggle="yes">J Clin Microbiol.</italic>
					</source>
                    <year>2010</year>;<volume>48</volume>(<issue>11</issue>):<fpage>4326</fpage>&#x2013;<lpage>4328</lpage>.
                    <pub-id pub-id-type="pmid">20844229</pub-id>
                    <pub-id pub-id-type="doi">10.1128/JCM.01190-10</pub-id>
                    <pub-id pub-id-type="pmcid">3020826</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-33">
                <label>33</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Espy</surname>
                            <given-names>MJ</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Uhl</surname>
                            <given-names>JR</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Sloan</surname>
                            <given-names>LM</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Real-time PCR in clinical microbiology: applications for routine laboratory testing.</article-title>
                    <source>
						
                        <italic toggle="yes">Clin Microbiol Rev.</italic>
					</source>
                    <year>2006</year>;<volume>19</volume>(<issue>1</issue>):<fpage>165</fpage>&#x2013;<lpage>256</lpage>.
                    <pub-id pub-id-type="pmid">16418529</pub-id>
                    <pub-id pub-id-type="doi">10.1128/CMR.19.1.165-256.2006</pub-id>
                    <pub-id pub-id-type="pmcid">1360278</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-34">
                <label>34</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Xu</surname>
                            <given-names>Z</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Shen</surname>
                            <given-names>F</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>X</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Molecular and microscopic analysis of bacteria and viruses in exhaled breath collected using a simple impaction and condensing method.</article-title>
                    <source>
						
                        <italic toggle="yes">PLoS One.</italic>
					</source>
                    <year>2012</year>;<volume>7</volume>(<issue>7</issue>):<fpage>e41137</fpage>.
                    <pub-id pub-id-type="pmid">22848436</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0041137</pub-id>
                    <pub-id pub-id-type="pmcid">3405091</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-35">
                <label>35</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Houspie</surname>
                            <given-names>L</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>De Coster</surname>
                            <given-names>S</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Keyaerts</surname>
                            <given-names>E</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Exhaled breath condensate sampling is not a new method for detection of respiratory viruses.</article-title>
                    <source>
						
                        <italic toggle="yes">Virol J.</italic>
					</source>
                    <year>2011</year>;<volume>8</volume>:<fpage>98</fpage>.
                    <pub-id pub-id-type="pmid">21375748</pub-id>
                    <pub-id pub-id-type="doi">10.1186/1743-422X-8-98</pub-id>
                    <pub-id pub-id-type="pmcid">3059288</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-36">
                <label>36</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Fabian</surname>
                            <given-names>P</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>McDevitt</surname>
                            <given-names>JJ</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>DeHaan</surname>
                            <given-names>WH</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Influenza virus in human exhaled breath: an observational study.</article-title>
                    <source>
						
                        <italic toggle="yes">PLoS One.</italic>
					</source>
                    <year>2008</year>;<volume>3</volume>(<issue>7</issue>):<fpage>e2691</fpage>.
                    <pub-id pub-id-type="pmid">18628983</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0002691</pub-id>
                    <pub-id pub-id-type="pmcid">2442192</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-37">
                <label>37</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Huynh</surname>
                            <given-names>KN</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Oliver</surname>
                            <given-names>BG</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Stelzer</surname>
                            <given-names>S</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>A new method for sampling and detection of exhaled respiratory virus aerosols.</article-title>
                    <source>
						
                        <italic toggle="yes">Clin Infect Dis.</italic>
					</source>
                    <year>2008</year>;<volume>46</volume>(<issue>1</issue>):<fpage>93</fpage>&#x2013;<lpage>95</lpage>.
                    <pub-id pub-id-type="pmid">18171219</pub-id>
                    <pub-id pub-id-type="doi">10.1086/523000</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report16745">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.9959.r16745</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Griffith</surname>
                        <given-names>David E</given-names>
                    </name>
                    <xref ref-type="aff" rid="r16745a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r16745a1">
                    <label>1</label>Division of Infectious Diseases &amp; Global Medicine, Department of Medicine, Comprehensive Heart and Lung Disease, The University of Texas Health Center at Tyler, Tyler, TX, USA</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>3</day>
                <month>10</month>
                <year>2016</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2016 Griffith DE</copyright-statement>
                <copyright-year>2016</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport16745" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.9251.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>Comment #1: I am not familiar with the term Cycle Threshold, &#x201c;
                <italic>C
                    <sub>T</sub>
                </italic>&#x201d;. The term is introduced in the first paragraph of the Methods and then mentioned again in the last paragraph of the Methods. It would have been helpful to me to have had a brief discussion of this term in the Introduction or Methods. The 
                <italic>C
                    <sub>T</sub>
                </italic> values were discussed in full paragraphs in the Results and Discussion sections so it is clearly an important metric for this study and there could be other readers not familiar with 
                <italic>C
                    <sub>T</sub>
                </italic>.</p>
            <p> Comment #2: Evaluation of microbiologic results in bronchiectasis patients is difficult. First, there is no &#x201c;gold standard&#x201d; test for identifying potential respiratory pathogens in the lungs of these patients. Microbiome studies suggest that a large number of potential respiratory pathogens populate the lungs of these patients but do not help determine which one(s) are responsible for symptoms or clinical deterioration and therefore might benefit from therapy. Similarly, microbiology results from BAL do not necessarily identify pathogens responsible for symptoms and clinical deterioration. I think these observations are pertinent with regard to the sensitivity and specificity claims of the authors. In Table 1, it is apparent that mouth flora is not sampled with the cough technique avoiding an important mechanism of specimen contamination. In Table 2, however, there is poor concordance between sputum and cough with regard to 
                <italic>Pseudomonas</italic> and 
                <italic>Staph</italic>, with these 2 potential pathogens isolated more commonly with sputum than cough. One interpretation of that observation is that sputum is more sensitive than cough for recovering potential respiratory pathogens in CF. The more frequent isolation of multiple respiratory pathogens with sputum could be interpreted the same way especially in light of the microbiome data. I am unsure where the authors believe the source of the &#x201c;excess&#x201d; 
                <italic>Pseudomonas</italic> and 
                <italic>Staph</italic> (as well as the specimens with multiple pathogens) is for sputum patients?&#x00a0; Are they suggesting these &#x201c;excess&#x201d; isolates are &#x201c;contaminants&#x201d;?</p>
            <p> Comment #3: I think the authors have convincingly shown that the PneumoniaCheck&#x2122; device avoids upper airway bacterial contamination during specimen collection with cough in CF patients. I think their findings with regard to the number and type of CF related respiratory pathogens and the clinical significance of those pathogens remains to be elucidated.</p>
            <p>Reviewer Expertise:</p>
            <p>NA</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report16100">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.9959.r16100</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Kalin</surname>
                        <given-names>Mats</given-names>
                    </name>
                    <xref ref-type="aff" rid="r16100a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r16100a1">
                    <label>1</label>Department of Infectious Diseases, Karolinska Institutet, Stockholm, Sweden</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>21</day>
                <month>9</month>
                <year>2016</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2016 Kalin M</copyright-statement>
                <copyright-year>2016</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport16100" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.9251.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>Ku 
                <italic>et al,&#x00a0;</italic>describe the experiences with a newly designed device for collecting cough specimens from patients with CF. The device is constructed with the intention that dead space air, presumably containing a high concentration of oral contaminants, should be collected separately, while on the other hand cough material from the lower lungs is to be collected on a specific filter constructed so that bacteria should be trapped in such a way that the material may be used for RT-PCR.</p>
            <p> </p>
            <p> Title, abstract, methods and material are clearly described as is results. Discussion is adequate and relevant.</p>
            <p> </p>
            <p> The presented results indicate high specificity with low risk of oral contaminants in cough specimens than in sputum from 20 adult CF individuals. Actually only 12 patients produced a sputum specimen, so it is a small study. However the differences were significant.</p>
            <p> </p>
            <p> Sensitivity cannot be assessed with the way the study was carried out, but comparison with other studies indicate satisfactory results.&#x00a0;Thus, the device seems to permit improved analysis of quantitative bacteriology in&#x00a0;lower lung specimens from&#x00a0;CF patients. The device is described as simple to use and is suggested to be used to follow lower respiratory tract microbiology in&#x00a0;CF patients, so that increased concentrations of significant bacterial pathogens may be noted. This may be a step forward for the management of these patients. Further studies, including pediatric studies, are needed to corroborate the findings in this study and to explore the advantages of longitudinal follow up of CF patients</p>
            <p> </p>
            <p> PCR may not suffice all the time, since bacterial resistance may have to be detected and specified in order to find an adequate treatment alternative. Needless to say this is an increasing problem.</p>
            <p>Reviewer Expertise:</p>
            <p>NA</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
</article>
