<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.9708.1</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                    <subj-group>
                        <subject>Bioinformatics</subject>
                    </subj-group>
                    <subj-group>
                        <subject>Genitourinary Cancers</subject>
                    </subj-group>
                    <subj-group>
                        <subject>Genomics</subject>
                    </subj-group>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>Differentially correlated genes in co-expression networks control phenotype transitions</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 1; peer review: 1 approved, 2 approved with reservations]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Thomas</surname>
                        <given-names>Lina D.</given-names>
                    </name>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Vyshenska</surname>
                        <given-names>Dariia</given-names>
                    </name>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Shulzhenko</surname>
                        <given-names>Natalia</given-names>
                    </name>
                    <xref ref-type="aff" rid="a3">3</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Yambartsev</surname>
                        <given-names>Anatoly</given-names>
                    </name>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Morgun</surname>
                        <given-names>Andrey</given-names>
                    </name>
                    <xref ref-type="corresp" rid="c2">b</xref>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Instituto de Matem&#x00e1;tica e Estat&#x00ed;stica, Universidade de S&#x00e3;o Paulo, S&#x00e3;o Paulo, Brazil</aff>
                <aff id="a2">
                    <label>2</label>College of Pharmacy, Oregon State University, Corvallis, USA</aff>
                <aff id="a3">
                    <label>3</label>College of Veterinary Medicine, Oregon State University, Corvallis, USA</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:yambar@ime.usp.br">yambar@ime.usp.br</email>
                </corresp>
                <corresp id="c2">
                    <label>b</label>
                    <email xlink:href="mailto:andriy.morgun@oregonstate.edu">andriy.morgun@oregonstate.edu</email>
                </corresp>
                <fn fn-type="con">
                    <p>LDT ran the data analysis and DV ran the experimental analysis. LDT, DV, AY and AM conceived the analysis and wrote the paper. NS helped with discussions and revised the first manuscript.</p>
                </fn>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>22</day>
                <month>11</month>
                <year>2016</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2016</year>
            </pub-date>
            <volume>5</volume>
            <elocation-id>2740</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>10</day>
                    <month>11</month>
                    <year>2016</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2016 Thomas LD et al.</copyright-statement>
                <copyright-year>2016</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/5-2740/pdf"/>
            <abstract>
                <p>Background: Co-expression networks are a tool widely used for analysis of &#x201c;Big Data&#x201d; in biology that can range from transcriptomes to proteomes, metabolomes and more recently even microbiomes. Several methods were proposed to answer biological questions interrogating these networks. Differential co-expression analysis is a recent approach that measures how gene interactions change when a biological system transitions from one state to another. Although the importance of differentially co-expressed genes to identify dysregulated pathways has been noted, their role in gene regulation is not well studied. Herein we investigated differentially co-expressed genes in a relatively simple mono-causal process (B lymphocyte deficiency) and in a complex multi-causal system (cervical cancer).</p>
                <p>Methods: Co-expression networks of B cell deficiency (Control and BcKO) were reconstructed using Pearson correlation coefficient for two 
                    <italic toggle="yes">mus musculus</italic> datasets: B10.A strain (12 normal, 12 BcKO) and BALB/c strain (10 normal, 10 BcKO). Co-expression networks of cervical cancer (normal and cancer) were reconstructed using local partial correlation method for five datasets (total of 64 normal, 148 cancer). Differentially correlated pairs were identified along with the location of their genes in BcKO and in cancer networks. Minimum Shortest Path and Bi-partite Betweenness Centrality where statistically evaluated for differentially co-expressed genes in corresponding networks.</p>
                <p>Results: We show that in B cell deficiency the differentially co-expressed genes are highly enriched with immunoglobulin genes (causal genes). In cancer we found that differentially co-expressed genes act as &#x201c;bottlenecks&#x201d; rather than causal drivers with most flows that come from the key driver genes to the peripheral genes passing through differentially co-expressed genes. Using 
                    <italic toggle="yes">in vitro</italic> knockdown experiments for two out of 14 differentially co-expressed genes found in cervical cancer (FGFR2 and CACYBP), we showed that they play regulatory roles in cancer cell growth.</p>
                <p>Conclusion: Identifying differentially co-expressed genes in co-expression networks is an important tool in detecting regulatory genes involved in alterations of phenotype.</p>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>co-expression networks</kwd>
                <kwd>differential co-expression analysis</kwd>
                <kwd>biological state transition</kwd>
            </kwd-group>
            <funding-group>
                <award-group id="fund-1">
                    <funding-source>National Science Foundation</funding-source>
                    <award-id>1412557</award-id>
                </award-group>
                <award-group id="fund-2">
                    <funding-source>Funda&#x00e7;&#x00e3;o de Amparo &#x00e0; Pesquisa do Estado de S&#x00e3;o Paulo</funding-source>
                    <award-id>2013/24516-6</award-id>
                </award-group>
                <award-group id="fund-3">
                    <funding-source>Funda&#x00e7;&#x00e3;o de Amparo &#x00e0; Pesquisa do Estado de S&#x00e3;o Paulo</funding-source>
                    <award-id>2013/14722-8</award-id>
                </award-group>
                <award-group id="fund-4">
                    <funding-source>Funda&#x00e7;&#x00e3;o de Amparo &#x00e0; Pesquisa do Estado de S&#x00e3;o Paulo</funding-source>
                    <award-id>2013/06223-1</award-id>
                </award-group>
                <funding-statement>This work was supported by Funda&#x00e7;&#x00e3;o de Amparo &#x00e0; Pesquisa do Estado de S&#x00e3;o Paulo (FAPESP), grants 2013/06223-1, 2013/14722-8 and 2013/24516-6 and by NSF grant 1412557.</funding-statement>
                <funding-statement>
                    <italic>The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.</italic>
                </funding-statement>
            </funding-group>
        </article-meta>
    </front>
    <body>
        <sec sec-type="intro">
            <title>Introduction</title>
            <p>Recent technological advances have moved the focus of biologists from how to measure biological parameters to how to analyze and interpret tens of thousands of measurements, frequently called omics data. The first solutions for such a problem were limited to hierarchical clustering
                <sup>
                    <xref ref-type="bibr" rid="ref-1">1</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-3">3</xref>
                </sup> and simple comparisons between classes of data through the identification of differentially expressed genes (DEGs)
                <sup>
                    <xref ref-type="bibr" rid="ref-4">4</xref>,
                    <xref ref-type="bibr" rid="ref-5">5</xref>
                </sup>. Nowadays, reconstruction and interrogation of biological networks have become a widely used approach to get insights from different types of omics data
                <sup>
                    <xref ref-type="bibr" rid="ref-6">6</xref>,
                    <xref ref-type="bibr" rid="ref-7">7</xref>
                </sup>.</p>
            <p>After establishing co-expression networks for different states of one biological system, differential co-expression analysis investigates their structural changes when a system goes through a state transition. This analysis, first proposed more than a decade ago
                <sup>
                    <xref ref-type="bibr" rid="ref-8">8</xref>,
                    <xref ref-type="bibr" rid="ref-9">9</xref>
                </sup>, identifies the pairs of genes that have their interaction changed during such transition. Several later publications have suggested different algorithms and statistics to determine differential gene co-expression
                <sup>
                    <xref ref-type="bibr" rid="ref-10">10</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-27">27</xref>
                </sup>. Fewer studies, however, attempted to evaluate the biological significance of these changes
                <sup>
                    <xref ref-type="bibr" rid="ref-18">18</xref>,
                    <xref ref-type="bibr" rid="ref-21">21</xref>
                </sup>. Also, to the best of our knowledge, there have been no studies that would investigate how this approach performs depending on the type and complexity of the biological system analyzed.</p>
            <p>Commonly, a state transition of a biological system is related to perturbation of a set of genes, which propagates through network interactions and affects other genes. Thus, there is a possibility that differentially co-expressed (DC) genes (directly or indirectly) contribute to the propagation of perturbations. In order to investigate the role of DC genes in a state transition of a biological system, we considered two biological processes
                <sup>
                    <xref ref-type="bibr" rid="ref-28">28</xref>,
                    <xref ref-type="bibr" rid="ref-29">29</xref>
                </sup> previously analyzed by our group. The first one (B cell deficiency in mice) is a homogenous, one-causal-factor process, while the second one (cervical cancer) represents a heterogeneous multi-causal system.</p>
            <p>In this work, a co-expression network is an undirected graph, where the set of nodes consists of a set of DEGs, and a pair of nodes is connected if there is a significant correlation between them. Differential co-expression analysis is done by identifying the pairs of genes that suffer significant changes in correlation between two states. Throughout this paper such pairs are called differentially correlated pairs (DCPs) and the genes forming these pairs are considered DC genes.</p>
        </sec>
        <sec sec-type="results">
            <title>Results</title>
            <sec>
                <title>B cell deficiency</title>
                <p>We started by analyzing the B cell knockout (BcKO) data
                    <sup>
                        <xref ref-type="bibr" rid="ref-28">28</xref>
                    </sup>, which represents a relatively simple experimental model with only one causal factor (B lymphocytes) and homogenous subject groups since this experiment was performed in highly inbred strains of mice.</p>
                <p>In order to select the nodes to reconstruct the co-expression networks (BcKO and Control) we compared gene expression in jejunum between BcKO and control mice and found 509 DEGs (
                    <xref ref-type="other" rid="DS0">Dataset 1</xref>). Next, the edges for each network were determined using significantly correlated pairs of DEGs (
                    <xref ref-type="fig" rid="f1">Figure 1</xref>). To identify DCPs we used the method introduced in
                    <sup>
                        <xref ref-type="bibr" rid="ref-21">21</xref>
                    </sup> which compares correlations in the BcKO group and in the Control group. Eighty DCPs were found (
                    <xref ref-type="other" rid="DS1">Dataset 2</xref>), of which 56 represent correlation gains (edges which were not present in Control network but showed up in BcKO) and 24 represent losses.</p>
                <supplementary-material id="DS0" orientation="portrait" position="float" xlink:href="https://f1000researchdata.s3.amazonaws.com/datasets/9708/5c951bf9-5cb2-4861-9e38-8339d30da036_Dataset1.csv">
                    <label>Differentially expressed genes from BcKO study</label>
                    <caption>
                        <p>Contains p-values, ratios of expression means, combined Fisher&#x2019;s p-value, fdr, direction of regulation, whether it is Ig gene and whether it is DC gene.</p>
                    </caption>
                </supplementary-material>
                <supplementary-material id="DS1" orientation="portrait" position="float" xlink:href="https://f1000researchdata.s3.amazonaws.com/datasets/9708/330f3dde-1d9d-449d-be45-47bf9b79b1a7_Dataset2.csv">
                    <label>Differentially correlated pairs from BcKO study</label>
                    <caption>
                        <p>Contains information such as &#x201c;change direction&#x201d; (whether each pair gained or lost correlation/edge), &#x201c;sign of local partial correlation&#x201d; in BcKO data and control data, &#x201c;regulation&#x201d; (whether each gene of each pair is up- or down-regulated in BcKO), &#x201c;number of Ig genes&#x201d; in each pair.</p>
                    </caption>
                </supplementary-material>
                <p>Now we investigate whether network structural changes, herein represented by DCPs, are related to actual causes of global change in gene expression. In the previous study
                    <sup>
                        <xref ref-type="bibr" rid="ref-28">28</xref>
                    </sup>, it was shown that intestinal gene expression alterations in BcKO mice are mostly dependent on the ability of B lymphocytes to produce antibodies. Therefore, we analyzed the presence of immunoglobulin coding genes (Ig genes, see 
                    <xref ref-type="other" rid="DS2">Dataset 3</xref>) among differentially expressed genes (26 Ig genes among 509 DEGs) in DCPs. We observed that 72% (39 out of 54) of correlation gain DCPs are formed by at least one Ig gene, (
                    <xref ref-type="fig" rid="f2">Figure 2A</xref>). Moreover, we found strong enrichment for Ig genes among DC genes in correlation gain (24% (15 out of 63) of DC genes are Ig genes vs 2.7% (11 out of 415) of other DEGs are Ig genes), while no enrichment was observed for correlation lost as a result of B cell deficiency (
                    <xref ref-type="fig" rid="f2">Figure 2B</xref>). Thus, these results support the idea that differentially expressed genes that acquire correlations during transition from one biological state to another have a high chance to play causal roles in such transition.</p>
                <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                    <label>Figure 1. </label>
                    <caption>
                        <title>Co-expression networks for BcKO data.</title>
                        <p>The nodes are composed by DEGs and the edges represent significant correlations between nodes. The causal genes (immunoglobulin genes) and the DCP edges are concentrated in the high connectivity region with several causal genes forming DCPs.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/10464/e26c9a3e-2592-4e56-bc24-33d51ce9854f_figure1.gif"/>
                </fig>
                <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                    <label>Figure 2. </label>
                    <caption>
                        <p>
                            <bold>A</bold>) 78 Differentially Correlated Pairs (DCPs) were found, of which 54 represent correlation gains (edges which were not present in Control network but showed up in BcKO) and 24 represent correlation losses. The table stratifies the set of pairs representing correlation gains and losses according to the amount of Ig genes (0, 1 or 2) present in a pair. Note that 39 out of 54 of correlation gain DCPs are formed by at least one Ig gene while only 2 out of 22 correlation losses have at least one Ig gene. 
                            <bold>B</bold>) The 78 DCPs are formed by a total of 94 Differentially Co-expressed genes (DC genes). 58 DC genes participate only in correlation gain DCPs, 31 only in correlation loss DCPs and 5 of them participate in both correlation gain and loss DCPs. The results show enrichment for Ig genes among DC genes in correlation gain: 24% (15 out of 63 (=58+5)) of DC genes are Ig genes vs 2.7% (11 out of 415) of other DEGs are Ig genes (p value &lt; 0.001). Meanwhile no enrichment was observed for correlation loss as a result of B cell deficiency: 3% (1 out of 36 (=31+5)) of DC genes are Ig genes vs 2.7% (11 out of 415) of other DEGs are Ig genes.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/10464/e26c9a3e-2592-4e56-bc24-33d51ce9854f_figure2.gif"/>
                </fig>
                <supplementary-material id="DS2" orientation="portrait" position="float" xlink:href="https://f1000researchdata.s3.amazonaws.com/datasets/9708/4284186c-9a8b-4a8f-8eee-671c1b80add9_Dataset3.csv">
                    <label>Causal genes from BcKO study</label>
                    <caption>
                        <p>Contains the Ig genes considered causal along with annotation and whether they are considered DC genes or not.</p>
                    </caption>
                </supplementary-material>
            </sec>
            <sec>
                <title>Cervical cancer</title>
                <p>
                    <bold>
                        <italic toggle="yes">Analysis of gene expression data.</italic>
                    </bold> In order to study differentially co-expressed genes in a more complex biological model we turned to cancer. It is well known that cancers of the same clinically/morphological type can be very different on molecular levels. One of the most studied causes for such diversity is the different sets of chromosomal aberrations and mutations harbored by tumors otherwise defined as the same cancer. In previous study
                    <sup>
                        <xref ref-type="bibr" rid="ref-29">29</xref>
                    </sup>, we have found 36 cervical cancer driver genes located in multiple chromosomal aberrations (
                    <xref ref-type="other" rid="DS3">Dataset 4</xref>). Thus we decided to use cervical cancer data from 
                    <xref ref-type="bibr" rid="ref-29">29</xref> for investigation of the role of DCPs in complex biological processes due to its heterogeneity and previously acquired knowledge of essential causal genes.</p>
                <supplementary-material id="DS3" orientation="portrait" position="float" xlink:href="https://f1000researchdata.s3.amazonaws.com/datasets/9708/fda26649-ab61-438b-b71b-5388be4107d6_Dataset4.csv">
                    <label>Causal genes from cervical cancer study</label>
                    <caption>
                        <p>Contains the chromosomal aberration genes considered causal along with annotation and whether they are considered DC genes or not.</p>
                    </caption>
                </supplementary-material>
                <p>We used the DEGs between tumor and normal tissue as the nodes of the co-expression networks. Since the number of samples (five datasets, 148 tumor samples and 67 normal samples) was larger than in BcKO study (two datasets, 22 paired samples), we used the partial correlation coefficient as a measure of co-expression (
                    <xref ref-type="fig" rid="f3">Figure 3</xref>). The potential advantage of using partial correlation is that it aims to infer edges that are a result of direct regulatory relations
                    <sup>
                        <xref ref-type="bibr" rid="ref-6">6</xref>
                    </sup>. Partial correlations were calculated through the Local Partial Correlation (LCP) method
                    <sup>
                        <xref ref-type="bibr" rid="ref-30">30</xref>
                    </sup> (
                    <xref ref-type="other" rid="mm">Material and Methods</xref>).</p>
                <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                    <label>Figure 3. </label>
                    <caption>
                        <title>Co-expression networks for cervical cancer data.</title>
                        <p>The nodes are composed by DEGs and the edges represent significant local partial correlation between nodes. A few causal genes (key drivers) and DCP edges are located in the high connectivity region, but scattered throughout the network. Only one key driver is amongst the genes in DCPs.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/10464/e26c9a3e-2592-4e56-bc24-33d51ce9854f_figure3.gif"/>
                </fig>
                <p>In this study seven DCPs composed of 14 DC genes were found. Interestingly, all DCPs were differential correlations gained in tumors (
                    <xref ref-type="table" rid="T1">Table 1</xref>). Only one of the 36 key drivers (CEP70) was identified among the 14 DC genes. Accordingly, no enrichment of key driver genes among DC genes was detected in this analysis.</p>
                <table-wrap id="T1" orientation="portrait" position="anchor">
                    <label>Table 1. </label>
                    <caption>
                        <title>DCPs &#x2013; cancer (* key drivers).</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Gene
                                    <break/>symbol 1</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Gene
                                    <break/>symbol 2</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Change
                                    <break/>direction</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Sign of local partial
                                    <break/>correlation in tumor</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Regulation 1</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Regulation 2</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">ANP32E</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CACYBP</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Gained edge</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&gt; 0</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">UP</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">UP</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CENPN</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">DHFR</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Gained edge</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&gt; 0</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">UP</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">UP</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">C10orf68</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">FGFR2</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Gained edge</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&gt; 0</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">DN</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">DN</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">AK2</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">HNRNPR</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Gained edge</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&gt; 0</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">UP</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">UP</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CEP70*</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">SEPHS1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Gained edge</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&gt; 0</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">UP</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">UP</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">NIPAL2</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TRPM3</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Gained edge</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&gt; 0</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">DN</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">DN</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">They stem
                                    <break/>ARHGEF12</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">ZSCAN18</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Gained edge</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">&gt; 0</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">DN</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">DN</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <p>Even though we observed that DCPs are not necessarily formed by key drivers, it is known from literature that most of the DC genes found play regulatory roles in other types of cancer
                    <sup>
                        <xref ref-type="bibr" rid="ref-31">31</xref>&#x2013;
                        <xref ref-type="bibr" rid="ref-48">48</xref>
                    </sup>. Thus we hypothesized that DCPs are located downstream of key drivers and can be responsible for changes of regulatory chain events coming from the key drivers and spreading throughout the network. In order to verify this hypothesis, we investigated how close DC genes are to key drivers and whether their &#x201c;signal flow&#x201d;
                    <sup>
                        <xref ref-type="bibr" rid="ref-49">49</xref>
                    </sup> in the tumor co-expression network is stronger than that of the other genes. In order to verify this hypothesis we investigated two network measures: Minimum Shortest Path and Bi-partite Betweenness Centrality.</p>
                <p>First we compared the shortest paths from key driver genes to DC genes and to all other DEGs in the network. We found that DC genes are located statistically closer than the rest of genes in the network to key drivers (
                    <xref ref-type="fig" rid="f4">Figure 4A</xref>, Wilcoxon test &lt; 0.014 and Permutation test &lt; 0.021). Then we used Bi-partite Betweenness Centrality
                    <sup>
                        <xref ref-type="bibr" rid="ref-6">6</xref>
                    </sup> as a measure of the signal flow from key drivers to peripheral genes (genes with only one edge)
                    <sup>
                        <xref ref-type="bibr" rid="ref-6">6</xref>
                    </sup>. We evaluated this measure for DC genes and remaining DEGs and observed that DC genes had much higher values than other genes in the network. 
                    <xref ref-type="fig" rid="f4">Figure 4B</xref> illustrates a comparison of boxplots of bi-partite betweenness centrality between these two groups concerning DCPs and the rest (non DCPs, non-key drivers, non-peripheral). We can observe that the bi-partite betweenness centralities of DCPs are concentrated in higher values than the rest. Mann-Whitney test gave us a p-value of 7.868 X 10
                    <sup>-5</sup>, which gives us evidence that the distribution of Bi-Partite Betweenness Centrality in DCP genes is higher. For more details see 
                    <xref ref-type="other" rid="SM1">Figure S2</xref>. Thus, altogether these results suggest that DC genes might be &#x201c;bottlenecks&#x201d;, that is, required to transmit a signal from key drivers to other genes in the network, therefore, supplement the hypothesis of a regulatory role of DC genes (
                    <xref ref-type="other" rid="SM1">Figure S1</xref>).</p>
                <fig fig-type="figure" id="f4" orientation="portrait" position="float">
                    <label>Figure 4. </label>
                    <caption>
                        <title>Topological properties of Differentially Correlated Genes (DCGs).</title>
                        <p>
                            <bold>A</bold>) Barplot of the shortest path to the causal genes and originated in either the genes in DCPs (in orange) or the non DCP genes (in blue). The distribution in orange is concentrated in lower values. 
                            <bold>B</bold>) Boxplot comparing the values of Bipartite Betweenness Centrality of the genes in DCPs (in orange) and the non-DCP genes (in blue). The boxplot on the left is concentrated in higher values.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/10464/e26c9a3e-2592-4e56-bc24-33d51ce9854f_figure4.gif"/>
                </fig>
                <p>
                    <bold>
                        <italic toggle="yes">Knockdown experiments.</italic>
                    </bold> In addition, data from other cancers provide indirect support for the idea of regulatory role of DC genes in cervical cancer
                    <sup>
                        <xref ref-type="bibr" rid="ref-31">31</xref>&#x2013;
                        <xref ref-type="bibr" rid="ref-48">48</xref>
                    </sup>. However, since a role of these DC genes in carcinogenesis was not as straightforward as for immunoglobulin genes in B cell deficiency, we decided to perform experimental tests. Among the DC genes found for cervical cancer, there were seven up-regulated and seven down-regulated in cancer. Therefore, for validation experiments we chose one down-regulated (FGFR2) and one up-regulated (CACYBP) gene that have not been previously studied in cervical cancer for regulatory properties, but have a potential connection with cell death or proliferation based on their Gene Ontology annotations. In order to test if FGFR2 and CACYBP play critical regulatory roles in cancer pathogenesis, we evaluated the effect on 
                    <italic toggle="yes">in vitro</italic> knockdown of these genes on cell proliferation in a cervical carcinoma cell line.</p>
                <p>First, we tested two cervical cancer cell lines (Hela and ME180) and found that only ME180 had detectable expression levels of both genes. In order to perform these tests, we evaluated siRNAs and observed that they were able to knock down expression of both genes by at least 70% (
                    <xref ref-type="fig" rid="f5">Figure 5A</xref>). CACYBP is up-regulated in tumor tissue, as compared to normal tissue (
                    <xref ref-type="fig" rid="f5">Figure 5B</xref>). Consequently, if CACYBP has regulatory potential, as predicted by our analysis, it should function as an oncogene promoting cell proliferation. Therefore, the knockdown of this gene should result in a decrease of cell growth/survival. Since FGFR2 was found down-regulated in cervical carcinomas (
                    <xref ref-type="fig" rid="f5">Figure 5B</xref>) its potential regulatory role would be as a tumor suppressor. Therefore, the knockdown of this gene is expected to increase cell growth. The subsequent analysis of cell proliferation confirmed our predictions for both genes: knockdown of CACYBP led to a decrease of cell growth, while knockdown of FGFR2 induced higher cell proliferation (
                    <xref ref-type="fig" rid="f5">Figure 5C</xref>). Thus, these results provide additional support to our 
                    <italic toggle="yes">in silico</italic> prediction that DC genes may play a regulatory role in cell proliferation related to tumor growth.</p>
                <fig fig-type="figure" id="f5" orientation="portrait" position="float">
                    <label>Figure 5. </label>
                    <caption>
                        <title>Experimental evaluation of DCGs in cervical cancer.</title>
                        <p>
                            <bold>A</bold>) Efficacy of FGFR2 and CACYBP siRNA knockdown. qRT-PCR with primers for GAPDH as the internal control was used to determine expression and efficacy of FGFR2 and CACYBP specific siRNA knockdown in endothelial cells (ME180). ME180 cells were harvested 72 h after transfection with vehicle (Lipofectamine) and either scrambled control or targeting siRNA. 
                            <bold>B</bold>) Gene expression of FGFR2 and CACYBP (mean +/- standard deviation) for tumor and normal samples from five datasets used in the analysis. Since FGFR2 was found down-regulated in tumor tissue, its potential regulatory role would be as a tumor suppressor. However, CACYBP is up-regulated, thus CACYBP should function as an oncogene promoting cell proliferation. 
                            <bold>C</bold>) Evaluation of cell proliferation inhibition using xCelligence System. Proliferation data (cell index) was obtained at 72 h after transfection with Lipofectamine and either scrambled control or targeting siRNA. Inhibition index was calculated (two step normalization of cell index): inhibition index &gt; 0 &#x2013; cells transfected with targeting siRNA showed decrease in proliferation; &lt; 0 &#x2013; showed increase in proliferation; = 0 &#x2013; no difference from control was found. One sided T test for mean (&lt; 0 for FGFR2 and &gt; 0 for CACYBP) was applied and returned statistically significant p-values for both of them (0.0258 for FGFR2 and 0.01978 for CACYBP).</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/10464/e26c9a3e-2592-4e56-bc24-33d51ce9854f_figure5.gif"/>
                </fig>
                <supplementary-material id="DS4" orientation="portrait" position="float" xlink:href="https://f1000researchdata.s3.amazonaws.com/datasets/9708/0ac3f0e3-7790-44ba-8d48-556b17584aab_Dataset5_2.zip">
                    <label>Cytoscape Edges and Nodes tables from network in Figure 1</label>
                    <caption>
                        <p>The datasets are sufficient to reproduce 
                            <xref ref-type="fig" rid="f2">Figure 2</xref>.</p>
                    </caption>
                </supplementary-material>
                <supplementary-material id="DS5" orientation="portrait" position="float" xlink:href="https://f1000researchdata.s3.amazonaws.com/datasets/9708/e84b8895-725a-4da4-8531-2bbd96850bf7_Dataset6_1.zip">
                    <label>Cytoscape Edges and Nodes tables from network in Figure 3</label>
                    <caption>
                        <p>The datasets are sufficient to reproduce 
                            <xref ref-type="fig" rid="f4">Figure 4</xref>.</p>
                    </caption>
                </supplementary-material>
                <supplementary-material id="DS6" orientation="portrait" position="float" xlink:href="https://f1000researchdata.s3.amazonaws.com/datasets/9708/672d9e99-0b47-4a3d-b3a2-2c99e8ead955_Dataset7_2.zip">
                    <label>Raw data for Figure 5A,C</label>
                    <caption>
                        <p>Raw data for 
                            <xref ref-type="fig" rid="f5">Figure 5A</xref>:</p>
                        <p>qRT PCR siRNA test.</p>
                        <p>Instrument Type: steponeplus</p>
                        <p>Passive Reference: ROX</p>
                        <p>Analysis Type: Singleplex</p>
                        <p>Endogenous Control: GAPDH</p>
                        <p>RQ Min/Max Confidence Level: 95.0</p>
                        <p>Reference Sample: A</p>
                        <p>Raw data for 
                            <xref ref-type="fig" rid="f5">Figure 5C</xref>:</p>
                        <p>Three xCellingence experiments.</p>
                    </caption>
                </supplementary-material>
            </sec>
        </sec>
        <sec sec-type="discussion">
            <title>Discussion</title>
            <p>In the current study, the differential co-expression analysis
                <sup>
                    <xref ref-type="bibr" rid="ref-21">21</xref>
                </sup> was applied to two relatively well-investigated biological systems
                <sup>
                    <xref ref-type="bibr" rid="ref-28">28</xref>,
                    <xref ref-type="bibr" rid="ref-29">29</xref>
                </sup> in order to evaluate the potential importance of genes found using differential correlation analyses. Overall, the obtained results support the idea that DC genes play a regulatory role. While in B cell deficiency DCPs were found highly enriched with immunoglobulin genes (i.e. causal genes for alterations in the gut) we did not observe enrichment for key driver genes in cervical cancers. Rather, DCPs of cervical cancer seem to be located downstream of causal genes. Indeed, those DCPs have been found closer to key regulators than other genes in the network, actually representing &#x201c;bottlenecks&#x201d; for communication between driver genes previously published in 
                <xref ref-type="bibr" rid="ref-29">29</xref> and the rest of the network (
                <xref ref-type="fig" rid="f4">Figure 4</xref>). Furthermore, some differentially co-expressed genes in cervical cancer have been previously implicated in processes such as metastasis, oncogenic autophagy and apoptosis. For example, CACYBP has been shown to promote colorectal cancer metastasis
                <sup>
                    <xref ref-type="bibr" rid="ref-31">31</xref>
                </sup>, TRPM3 was observed to play a role in oncogenic autophagy in clear cell renal cell carcinoma
                <sup>
                    <xref ref-type="bibr" rid="ref-32">32</xref>,
                    <xref ref-type="bibr" rid="ref-33">33</xref>
                </sup>, and AK2 was reported to activate apoptotic pathway
                <sup>
                    <xref ref-type="bibr" rid="ref-34">34</xref>
                </sup>. Several genes are investigated for prognostic value for cancers such as myeloma
                <sup>
                    <xref ref-type="bibr" rid="ref-35">35</xref>
                </sup>, lymphoma
                <sup>
                    <xref ref-type="bibr" rid="ref-36">36</xref>
                </sup>, breast
                <sup>
                    <xref ref-type="bibr" rid="ref-37">37</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-41">41</xref>
                </sup> and gastrointestinal
                <sup>
                    <xref ref-type="bibr" rid="ref-42">42</xref>,
                    <xref ref-type="bibr" rid="ref-43">43</xref>
                </sup> cancers. At least two genes were previously proposed as targets for anti-cancer agents: DHFR
                <sup>
                    <xref ref-type="bibr" rid="ref-44">44</xref>
                </sup> and FGFR2
                <sup>
                    <xref ref-type="bibr" rid="ref-45">45</xref>
                </sup>. Moreover, CACYBP and ZSCAN18 were also reported as putative tumor suppressor genes in renal cell carcinoma
                <sup>
                    <xref ref-type="bibr" rid="ref-30">30</xref>,
                    <xref ref-type="bibr" rid="ref-46">46</xref>,
                    <xref ref-type="bibr" rid="ref-47">47</xref>
                </sup>. In addition, we have tested two DC genes and confirmed their regulatory role (FGFR2 as a tumor suppressor and CACYBP as a potential oncogene in cervical cancer) by manipulating their expression 
                <italic toggle="yes">in vitro</italic>. Altogether, published observations and our experimental validation for these two genes support the idea that DC genes revealed in the current study play a regulatory role and can be candidate targets for cervical cancer treatment.</p>
            <p>Interestingly, while in the model of B cell deficiency, the DC genes are highly enriched with causal regulatory genes, there was only one key driver in cervical cancer (CEP70), despite the DC genes in this system still seeming to play a regulatory role overall. Such a difference is potentially related to the fact that the mouse system studied in 
                <xref ref-type="bibr" rid="ref-28">28</xref> is highly homogeneous (inbred mice) with only one cause of alterations (i.e. absence of B lymphocytes). Cervical cancer, however, is a heterogeneous system with different chromosomal aberrations and consequently turned-on expression of different driver genes in different patients. Therefore, we can speculate that differential correlations point to regulatory genes that are shared by majority of samples. This hypothesis warrants further investigation, especially considering that DCPs could represent common therapeutic targets for tumors that originated as a result of different genomic or epi-genomic events.</p>
            <p>In conclusion, this study provided additional evidence for the previously suggested idea
                <sup>
                    <xref ref-type="bibr" rid="ref-8">8</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-27">27</xref>
                </sup> that genes presenting alterations in correlation patterns between different phenotypes (i.e. states of biological system) play a critical regulatory role in transitions from one state to another. Furthermore, although our results do not allow for full generalization, they indicate that gain and not loss of correlations connects critical genes involved in transitions to new phenotypes. However, further studies are required to understand how changes in correlation patterns can point to genes with critical capacity to guide a biological system into certain state/phenotype.</p>
        </sec>
        <sec sec-type="materials | methods">
            <title id="mm">Material and methods</title>
            <sec>
                <title>Preparation of microarray data</title>
                <p>
                    <bold>
                        <italic toggle="yes">BcKO.</italic>
                    </bold> All microarray data were analyzed using BRB Array-Tools developed by the Biometric Research Branch of the National Cancer Institute under the direction of R. Simon (
                    <ext-link ext-link-type="uri" xlink:href="http://linus.nci.nih.gov/BRB-ArrayTools.html">http://linus.nci.nih.gov/BRB-ArrayTools.html</ext-link>). Array data were filtered to limit analysis to probes with greater than 50% of samples showing spot intensities of &gt;10 and spot sizes &gt;10 pixels, and a median normalization was applied.</p>
                <p>
                    <bold>
                        <italic toggle="yes">Cervical cancer.</italic>
                    </bold> Same as in cervical cancer
                    <sup>
                        <xref ref-type="bibr" rid="ref-29">29</xref>
                    </sup>. The data were analyzed using BRB Array-Tools using the original normalization used in three studies
                    <sup>
                        <xref ref-type="bibr" rid="ref-50">50</xref>&#x2013;
                        <xref ref-type="bibr" rid="ref-52">52</xref>
                    </sup> and median normalization over entire the array for the fourth study
                    <sup>
                        <xref ref-type="bibr" rid="ref-53">53</xref>
                    </sup>. For all studies, we only considered genes found in at least 70% of arrays.</p>
            </sec>
            <sec>
                <title>Filtering and meta-analysis of microarray data</title>
                <p>In every analysis (DEGs, DCPs and networks), filter of direction (same sign of correspondent parameter &#x2013; difference of mean, difference of correlation, correlation and partial correlation) was required in a fixed number of datasets (2 out of 2 in BcKO and 3 out of 5 in cervical cancer). Then meta-analysis was done through Fisher combined probability test
                    <sup>
                        <xref ref-type="bibr" rid="ref-54">54</xref>
                    </sup>. Next, the pairs with false discovery rate (fdr)
                    <sup>
                        <xref ref-type="bibr" rid="ref-55">55</xref>
                    </sup> lower than a threshold are chosen. At last, only the pairs that pass PUC
                    <sup>
                        <xref ref-type="bibr" rid="ref-56">56</xref>
                    </sup> are considered correlated and therefore represent edges in the network.</p>
            </sec>
            <sec>
                <title>Analysis of microarray data</title>
                <p>
                    <bold>
                        <italic toggle="yes">BcKO.</italic>
                    </bold> DEGs between groups of samples were identified by random variance paired t-test p-value lower than 5% with adjustment for multiple hypotheses by setting the fdr below 10% in BRB Array-Tools
                    <bold>.</bold> Co-expression networks (BcKO and Control) were inferred through Pearson correlation with p-value &lt; 20% and fdr adjustment below 2.5%. DCPs were calculated for pairs that were initially correlated (p-value &lt; 20%) in at least one state. Then differences of Pearson correlation were tested following
                    <sup>
                        <xref ref-type="bibr" rid="ref-21">21</xref>
                    </sup> with a p-value below 10% and fdr &lt; 2%. At last only the DCPs that showed up in one of the networks were selected.</p>
                <p>
                    <bold>
                        <italic toggle="yes">Cervical cancer.</italic>
                    </bold> DEGs were retrieved from a cervical cancer paper
                    <sup>
                        <xref ref-type="bibr" rid="ref-29">29</xref>
                    </sup>. Correlation networks and DCPs followed the same procedure and in BcKO but with different p-values (correlation p-value &lt; 10% with fdr &lt; 10
                    <sup>-8</sup> and difference of correlation p-value &lt; 10% with fdr &lt; 0.25%). Partial correlation was computed using local partial correlation method
                    <sup>
                        <xref ref-type="bibr" rid="ref-30">30</xref>
                    </sup>. The initial significance was p-value lower than 40% and then fdr &lt; 5%.</p>
                <p>For more details about the thresholds used, see 
                    <xref ref-type="other" rid="SM1">Table S3</xref> and 
                    <xref ref-type="other" rid="SM1">Table S4</xref>.</p>
            </sec>
            <sec>
                <title>Local partial correlation network</title>
                <p>Two aspects of cervical cancer data motivated us to use local partial correlation for this system. First of all, we have more samples throughout five datasets (see 
                    <xref ref-type="other" rid="SM1">Supplementary Table S1</xref> and 
                    <xref ref-type="other" rid="SM1">Supplementary Table S2</xref>) which allows us to have more confidence in our results and second we already know that tumors in general present heterogeneous causal factors. The partial correlation approach gives us the alternative to only consider edges that represent direct regulatory relations.</p>
                <p>In this paper we used the new approach developed in 
                    <xref ref-type="bibr" rid="ref-30">30</xref> called local partial correlation. This approach was elaborated specially for cases when there are more variables than samples, which happens regularly in genetics and is a serious problem in classical statistics. First we calculate the correlation network. Then for each significantly correlated pair the inverse method is applied exclusively to the correlation sub-matrix formed only by the closest neighbors of the pair along with the genes forming the pair, 
                    <xref ref-type="fig" rid="f6">Figure 6</xref>. If the number of closest neighbors is still higher than the number of samples n, then we decreasingly rank the correlations of the neighbors to either genes in the pair and select the first n/2 neighbors. For each sub- matrix, we only keep the partial correlation value regarding the pair that formed that sub- matrix and then calculate its p-value also based on the sub- matrix. R script for calculation is available in 
                    <xref ref-type="other" rid="SM1">Supplementary Material</xref>.</p>
                <fig fig-type="figure" id="f6" orientation="portrait" position="float">
                    <label>Figure 6. </label>
                    <caption>
                        <title>Local partial correlation scheme: we calculate the LPC for pair 
                            <italic toggle="yes">X</italic>
                            <sub>2</sub>, 
                            <italic toggle="yes">X</italic>
                            <sub>5</sub>, (red nodes/edge).</title>
                        <p>The neighborhood of this pair is the set of nodes 
                            <italic toggle="yes">X</italic>
                            <sub>3</sub>, 
                            <italic toggle="yes">X</italic>
                            <sub>6</sub>, 
                            <italic toggle="yes">X</italic>
                            <sub>8</sub>, 
                            <italic toggle="yes">X</italic>
                            <sub>9</sub> (black nodes/edges). 
                            <italic toggle="yes">X</italic>
                            <sub>1</sub>, 
                            <italic toggle="yes">X</italic>
                            <sub>4</sub>, 
                            <italic toggle="yes">X</italic>
                            <sub>7</sub> (blue nodes) are significantly correlated with the black nodes (blue edges), but not with the red nodes. Thus the inverse method is applied exclusively to the correlation sub-matrix formed only by the genes 
                            <italic toggle="yes">X</italic>
                            <sub>2</sub>, 
                            <italic toggle="yes">X</italic>
                            <sub>5</sub>, 
                            <italic toggle="yes">X</italic>
                            <sub>3</sub>, 
                            <italic toggle="yes">X</italic>
                            <sub>6</sub>, 
                            <italic toggle="yes">X</italic>
                            <sub>8</sub>, 
                            <italic toggle="yes">X</italic>
                            <sub>9</sub>. In correlation matrices the gray entries are statistically non-significant empirical correlations.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/10464/e26c9a3e-2592-4e56-bc24-33d51ce9854f_figure6.gif"/>
                </fig>
                <p>Partial correlations were estimated only for the significant (Pearson) correlations in co-expression network. Thus the same definition of DCPs (by Pearson correlation) can still represent structural changes as long as it remains present in one of the two networks.</p>
                <p>
                    <xref ref-type="fig" rid="f3">Figure 3</xref> illustrates the local partial correlation network for cervical cancer using only tumor data. It has 578 connected nodes and 824 edges.</p>
            </sec>
            <sec>
                <title>Minimum shortest path</title>
                <p>The shortest path is a method that calculates distances between 2 nodes in a network. It consists of the minimum number of edges connecting 2 nodes. In this case we want to know the minimum number of edges connecting one node, either DCP gene or not, to a group of nodes: the key drivers 
                    <xref ref-type="fig" rid="f7">Figure 7</xref>. For each gene we calculate the shortest path to all key drivers and get the minimum value. Then we compare the minimum shortest path to key drivers coming from DCP genes and the remaining genes. 
                    <xref ref-type="fig" rid="f4">Figure 4A</xref> shows that the minimum shortest path to key drivers tend to be smaller when originated in DCP genes.</p>
                <fig fig-type="figure" id="f7" orientation="portrait" position="float">
                    <label>Figure 7. </label>
                    <caption>
                        <title>In this example we show how to calculate the distance (length of shortest path) between the gene 
                            <italic toggle="yes">G</italic>
                            <sub>2</sub> and group of genes 
                            <italic toggle="yes">D</italic>
                            <sub>1</sub>, 
                            <italic toggle="yes">D</italic>
                            <sub>2</sub>, 
                            <italic toggle="yes">D</italic>
                            <sub>3</sub>, 
                            <italic toggle="yes">D</italic>
                            <sub>4</sub> (nodes in red).</title>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/10464/e26c9a3e-2592-4e56-bc24-33d51ce9854f_figure7.gif"/>
                </fig>
            </sec>
            <sec>
                <title>Bi-partite betweenness centrality</title>
                <p>Betweenness Centrality measures the node&#x2019;s centrality in a network by counting the number of shortest paths from all vertices to all other vertices that pass through that node. A gene with high betweenness centrality has a great influence on the transfer of signal through the network 
                    <xref ref-type="fig" rid="f8">Figure 8</xref>.</p>
                <fig fig-type="figure" id="f8" orientation="portrait" position="float">
                    <label>Figure 8. </label>
                    <caption>
                        <title>Here we explain how to calculate bi-partite betweenness centrality 
                            <bold>(bc)</bold> between groups 
                            <monospace>
                                <italic toggle="yes">A</italic>
                            </monospace> and 
                            <monospace>
                                <italic toggle="yes">B</italic>
                            </monospace>.</title>
                        <p>Note that the node 
                            <italic toggle="yes">D</italic> has bigger bc because all shortest paths connecting nodes in group 
                            <monospace>
                                <italic toggle="yes">A</italic>
                            </monospace> to nodes in group 
                            <monospace>
                                <italic toggle="yes">B</italic>
                            </monospace> pass through the node 
                            <italic toggle="yes">D</italic>.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/10464/e26c9a3e-2592-4e56-bc24-33d51ce9854f_figure8.gif"/>
                </fig>
                <p>However we are interested in the signal passing from key drivers throughout the network. For this reason we decided to apply the measure previously developed by our lab
                    <sup>
                        <xref ref-type="bibr" rid="ref-6">6</xref>
                    </sup> called Bi-partite Betweenness Centrality. It measures the amount of shortest path going from all genes in one group of vertices to all genes in a different group of vertices. In our case, the groups of genes are the key drivers and the peripheral genes (genes connected to only one edge).</p>
            </sec>
        </sec>
        <sec>
            <title>Experimental design</title>
            <sec>
                <title>FGFR2 and CACYBP knockdown experiment</title>
                <p>ME180 cells were transfected with FGFR2-, CACYBP-specific siRNA or control siRNA using Lipofectamine RNAiMAX Transfection Reagent. Cell growth rate during 72h after siRNA transfection was measured using xCelligence system as described below.</p>
                <p>
                    <bold>
                        <italic toggle="yes">Evaluation of siRNA efficacy in knocking down the gene targets.</italic>
                    </bold> ME180 cell line was obtained from Dr. Pulivarthi H. Rao. It was cultured in RPMI medium with 10% FBS and 1% Penicillin-Streptomycin added. The cells were seeded at density 4000 cells per well in 96 F-bottom plates (seeding procedure was done according to ATCC protocol for ME180 cell line) and with cell culture media 200 ul per well. 24 hours after seeding, cells were transfected with one of the three siRNA, see 
                    <xref ref-type="table" rid="T2">Table 2</xref>.</p>
                <table-wrap id="T2" orientation="portrait" position="anchor">
                    <label>Table 2. </label>
                    <caption>
                        <title>Suppliers.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Target</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Supplier</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Supplier ID</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">FGFR2</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">ThermoFisher</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">s5173</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CACYBP</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">ThermoFisher</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">s25819</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Non-targeting
                                    <break/>siRNA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Dharmacon</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">D-001810-01-05</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <p>Before transfection, 100 uL of media was taken from each well. Transfection procedure was done according to Lipofectamine RNAiMAX Reagent protocol (Protocol Pub. No. MAN0007825 Rev. 1.0). 3pM of siRNA per well and Lipofectamine 0.6 uL per well were delivered in 20uL. 80 uL of fresh cell culture media was added to each well.</p>
                <p>Cells were collected 72 h after transfection using Lysis buffer from RNeasy Mini Kit (QIAGEN). RNA extraction was done using RNeasy Mini Kit (QIAGEN) according to the manufacturer&#x2019;s protocol (no Dnase treatment step was done). Concentrations of RNA measured with Qubit RNA BR Assay Kit. cDNA was done using Bio-Rad iScript cDNA Kit according to the manufacturer&#x2019;s protocol.</p>
                <p>Quantitative Real-Time PCR was done for the samples using QuantiFast SYBR Green PCR Kit and GAPDH as a control gene. Primers for the targets you can see in the 
                    <xref ref-type="table" rid="T3">Table 3</xref>.</p>
                <table-wrap id="T3" orientation="portrait" position="anchor">
                    <label>Table 3. </label>
                    <caption>
                        <title>Primers and Targets.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Target</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Forward/
                                    <break/>Reverse</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Primer sequence (5' -&gt; 3')</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">FGFR2</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Forward</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AACAGTTTCGGCTGAGTCCAG</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">FGFR2</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Reverse</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GCCCAGTGTCAGCTTATCTCTT</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CACYBP</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Forward</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CTCTGTGGAAGGCAGTTCAAA</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CACYBP</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Reverse</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TCAGGTAATCCCACCTTGTGTT</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">GAPDH</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Forward</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GGAGCGAGATCCCTCCAAAAT</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">GAPDH</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Reverse</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GGCTGTTGTCATACTTCTCATGG</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <p>qRT PCR set up: sample was heated to 95&#x00b0;C, followed by 40 cycles of 95&#x00b0;C for 10 sec and 60&#x00b0;C for 30 sec.</p>
                <p>
                    <bold>
                        <italic toggle="yes">Evaluation of cell growth after knock down of gene targets.</italic>
                    </bold> CACYBP is up-regulated in tumor tissue, as compared to normal tissue (
                    <xref ref-type="fig" rid="f5">Figure 5B</xref>). Consequently, if CACYBP has regulatory potential, as predicted by our analysis, it should function as an oncogene promoting cell proliferation. Therefore, the knockdown of this gene should result in a decrease of cell growth/survival. Since FGFR2 was found down-regulated in cervical carcinomas (
                    <xref ref-type="fig" rid="f5">Figure 5B</xref>) its potential regulatory role would be as a tumor suppressor. Therefore, the knockdown of this gene is expected to increase cell growth.</p>
                <p>Cell growth was evaluated using xCelligence system (The RTCA DP Instrument) using manufacturer&#x2019;s protocol. ME180 was cultured in RPMI media with 10% FBS and 1% Penicillin-Streptomycin added. The cells were seeded at density 4000 cells per well (E-Plate 16) in 200 uL of cell culture media.</p>
                <p>24 hours after seeding, the experiment was paused for transfecton. Before transfection, 100 uL of media was taken from each well. Transfection procedure was done according to Lipofectamine RNAiMAX Reagent protocol (Protocol Pub. No. MAN0007825 Rev. 1.0). 3pM of siRNA per well and Lipofectamine 0.6 uL per well were delivered in 20uL; 80 uL of fresh cell culture media was added to each well. Plate was placed back in the slot and cell growth was evaluated for another 72 h.</p>
                <p>
                    <bold>
                        <italic toggle="yes">Cell index normalization.</italic>
                    </bold> To evaluate cell growth rate cell index was transformed into Inhibition index in two steps:

                    <list list-type="bullet">
                        <list-item>
                            <label>1.</label>
                            <p>Cell indexes for all wells were exported to the excel file. For each treatment (including non-targeting siRNA transfected wells) we extracted cell index average for all wells at 20 h after seeding (
                                <italic toggle="yes">Cell Index Before Treatment</italic>) and at 96 h after seeding (
                                <italic toggle="yes">Cell Index After Treatment</italic>). To normalize cell index to initial cell number differences for each of the treatments we used the following formula:</p>
                            <p>
                                <disp-formula id="e1">
                                    <mml:math display="block" id="math1">
                                        <mml:mrow>
                                            <mml:mtext mathvariant="bold">After/Before</mml:mtext>
                                            <mml:mspace width="0.2em"/>
                                            <mml:mtext mathvariant="bold">Treatment</mml:mtext>
                                            <mml:mspace width="0.2em"/>
                                            <mml:mtext mathvariant="bold">Normalized</mml:mtext>
                                            <mml:mspace width="0.2em"/>
                                            <mml:mtext mathvariant="bold">Cell</mml:mtext>
                                            <mml:mspace width="0.2em"/>
                                            <mml:mtext mathvariant="bold">Index</mml:mtext>
                                            <mml:mspace width="0.2em"/>
                                            <mml:mtext mathvariant="bold">(A/B</mml:mtext>
                                            <mml:mspace width="0.2em"/>
                                            <mml:mtext mathvariant="bold">Index)</mml:mtext>
                                            <mml:mo>=</mml:mo>
                                            <mml:mfrac>
                                                <mml:mrow>
                                                    <mml:mi>CellindexAfterTreatment</mml:mi>
                                                </mml:mrow>
                                                <mml:mrow>
                                                    <mml:mi>CellindexBeforeTreatment</mml:mi>
                                                </mml:mrow>
                                            </mml:mfrac>
                                        </mml:mrow>
                                    </mml:math>
                                </disp-formula>
                            </p>
                        </list-item>
                        <list-item>
                            <label>2.</label>
                            <p>In next step we normalized each treatment with targeting siRNA to treatment with non-targeting siRNA. For this purpose in each experiment A/B Index from treatment (siRNA targeting either FGFR2 or CACYBP) was normalized to A/B Index from control treatment using the following formula:</p>
                            <p>
                                <disp-formula id="e2">
                                    <mml:math display="block" id="math2">
                                        <mml:mrow>
                                            <mml:mtext mathvariant="bold">Inhibition</mml:mtext>
                                            <mml:mspace width="0.2em"/>
                                            <mml:mtext mathvariant="bold">Index</mml:mtext>
                                            <mml:mo>=</mml:mo>
                                            <mml:mfrac>
                                                <mml:mrow>
                                                    <mml:mi>Control</mml:mi>
                                                    <mml:mspace width="0.2em"/>
                                                    <mml:mi>A/B</mml:mi>
                                                    <mml:mspace width="0.2em"/>
                                                    <mml:mi>Index&#x2013;Treatment</mml:mi>
                                                    <mml:mspace width="0.2em"/>
                                                    <mml:mi>A/B</mml:mi>
                                                    <mml:mspace width="0.2em"/>
                                                    <mml:mi>Index</mml:mi>
                                                </mml:mrow>
                                                <mml:mrow>
                                                    <mml:mi>Control</mml:mi>
                                                    <mml:mspace width="0.2em"/>
                                                    <mml:mi>A/B</mml:mi>
                                                    <mml:mspace width="0.2em"/>
                                                    <mml:mi>Index</mml:mi>
                                                </mml:mrow>
                                            </mml:mfrac>
                                        </mml:mrow>
                                    </mml:math>
                                </disp-formula>
                            </p>
                        </list-item>
                    </list>
                </p>
                <p>Final evaluation of growth was done according to the value of Inhibition Index:</p>
                <p>&gt;0 &#x2013; there is a decrease in growth;</p>
                <p>0 &#x2013; no difference between treated with targeting and treated with non-targeting siRNA;</p>
                <p>&lt;0 &#x2013; there is a growth after treating with targeting siRNA.</p>
            </sec>
        </sec>
        <sec>
            <title>Data availability</title>
            <p>The data referenced by this article are under copyright with the following copyright statement: Copyright: &#x00ef;&#x00bf;&#x00bd; 2016 Thomas LD et al.</p>
            <p>Data associated with the article are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication).
                <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/publicdomain/zero/1.0/"/>
            </p>
            <p>
                <bold>BcKO:</bold> Gene expression files containing array data from 
                <xref ref-type="bibr" rid="ref-28">28</xref> are available under the GSE23934 superseries in the Gene Expression Omnibus (GEO) data repository. We worked with two groups of samples: B10.A littermates and BALB/C (Table S1).</p>
            <p>
                <bold>Cervical cancer:</bold> We have used the same datasets as in previous study
                <sup>
                    <xref ref-type="bibr" rid="ref-29">29</xref>
                </sup> available at GEO: GSE7410
                <sup>
                    <xref ref-type="bibr" rid="ref-50">50</xref>
                </sup>, GSE6791
                <sup>
                    <xref ref-type="bibr" rid="ref-51">51</xref>
                </sup>, GSE7803
                <sup>
                    <xref ref-type="bibr" rid="ref-52">52</xref>
                </sup>, GSE9750
                <sup>
                    <xref ref-type="bibr" rid="ref-53">53</xref>
                </sup>, GSE26342
                <sup>
                    <xref ref-type="bibr" rid="ref-29">29</xref>
                </sup> (
                <xref ref-type="other" rid="SM1">Table S21</xref>).</p>
            <p>
                <italic toggle="yes">F1000Research</italic>: Dataset 1. Differentially expressed genes from BcKO study, 
                <ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.5256/f1000research.9708.d142100">10.5256/f1000research.9708.d142100</ext-link>
                <sup>
                    <xref ref-type="bibr" rid="ref-57">57</xref>
                </sup>
            </p>
            <p>
                <italic toggle="yes">F1000Research</italic>: Dataset 2. Differentially correlated pairs from BcKO study, 
                <ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.5256/f1000research.9708.d142099">10.5256/f1000research.9708.d142099</ext-link>
                <sup>
                    <xref ref-type="bibr" rid="ref-58">58</xref>
                </sup>
            </p>
            <p>
                <italic toggle="yes">F1000Research</italic>: Dataset 3. Causal genes from BcKO study, 
                <ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.5256/f1000research.9708.d142097">10.5256/f1000research.9708.d142097</ext-link>
                <sup>
                    <xref ref-type="bibr" rid="ref-59">59</xref>
                </sup>
            </p>
            <p>
                <italic toggle="yes">F1000Research</italic>: Dataset 4. Causal genes from cervical cancer study, 
                <ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.5256/f1000research.9708.d142098">10.5256/f1000research.9708.d142098</ext-link>
                <sup>
                    <xref ref-type="bibr" rid="ref-60">60</xref>
                </sup>
            </p>
            <p>
                <italic toggle="yes">F1000Research</italic>: Dataset 5. Cytoscape Edges and Nodes tables from network in 
                <xref ref-type="fig" rid="f1">Figure 1</xref>, 
                <ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.5256/f1000research.9708.d142101">10.5256/f1000research.9708.d142101</ext-link>
                <sup>
                    <xref ref-type="bibr" rid="ref-61">61</xref>
                </sup>
            </p>
            <p>
                <italic toggle="yes">F1000Research</italic>: Dataset 6. Cytoscape Edges and Nodes tables from network in 
                <xref ref-type="fig" rid="f3">Figure 3</xref>, 
                <ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.5256/f1000research.9708.d142102">10.5256/f1000research.9708.d142102</ext-link>
                <sup>
                    <xref ref-type="bibr" rid="ref-62">62</xref>
                </sup>
            </p>
            <p>
                <italic toggle="yes">F1000Research</italic>: Dataset 7. Raw data for 
                <xref ref-type="fig" rid="f5">Figure 5A,C</xref>, 
                <ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.5256/f1000research.9708.d142103">10.5256/f1000research.9708.d142103</ext-link>
                <sup>
                    <xref ref-type="bibr" rid="ref-63">63</xref>
                </sup>
            </p>
        </sec>
    </body>
    <back>
        <ack>
            <title>Acknowledgements</title>
            <p>We thank Mark Ganon and Andre Belejo for the English review and editing, CGRB at OSU for the computational support. AY and LT thank AM's lab at College of Pharmacy - OSU for their hospitality.</p>
        </ack>
        <sec id="SM1" sec-type="supplementary-material">
            <title>Supplementary material</title>
            <p>Extra details, figures and tables</p>
            <p>
                <ext-link ext-link-type="uri" xlink:href="https://f1000researchdata.s3.amazonaws.com/supplementary/9708/99b4e4c8-4a30-45ce-b7f7-748edac05142.docx">Click here to access the data.</ext-link>.</p>
        </sec>
        <ref-list>
            <ref id="ref-1">
                <label>1</label>
                <mixed-citation publication-type="book">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kaufman</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rousseeuw</surname>
                            <given-names>PJ</given-names>
                        </name>
</person-group>:
                    <article-title>Finding Groups in Data: An Introduction to Cluster Analysis</article-title>. (1 ed.). New York: John Wiley. ISBN 0-471-87876-6,<year>1990</year>.
                    <ext-link ext-link-type="uri" xlink:href="https://leseprobe.buch.de/images-adb/5c/cc/5ccc031f-49c1-452f-a0ac-22babc5e252e.pdf">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-2">
                <label>2</label>
                <mixed-citation publication-type="book">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Press</surname>
                            <given-names>WH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Teukolsky</surname>
                            <given-names>SA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Vetterling</surname>
                            <given-names>WT</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Section 16.4. Hierarchical Clustering by Phylogenetic Trees</article-title>.
                    <italic toggle="yes">Numerical Recipes: The Art of Scientific Computing (3rd ed.).</italic>New York: Cambridge University Press, ISBN 978-0-521-88068-8,<year>2007</year>.
                    <ext-link ext-link-type="uri" xlink:href="https://books.google.co.in/books?id=1aAOdzK3FegC&amp;printsec=frontcover&amp;source=gbs_ge_summary_r&amp;cad=0#v=onepage&amp;q&amp;f=false">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-3">
                <label>3</label>
                <mixed-citation publication-type="book">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hastie</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tibshirani</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Friedman</surname>
                            <given-names>J</given-names>
                        </name>
</person-group>:
                    <article-title>14.3.12 Hierarchical clustering</article-title>.
                    <italic toggle="yes">The Elements of Statistical Learning</italic>(PDF) (2nd ed.). New York: Springer. 520&#x2013;528, ISBN 0-387-84857-6,<year>2009</year>.</mixed-citation>
            </ref>
            <ref id="ref-4">
                <label>4</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Dudoit</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yang</surname>
                            <given-names>YH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Callow</surname>
                            <given-names>MJ</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Statistical methods for identifying differentially expressed genes in replicated cDNA microarray experiments.</article-title>
                    <source>

                        <italic toggle="yes">Stat Sin.</italic>
</source>
                    <year>2002</year>;<volume>12</volume>(<issue>1</issue>):<fpage>111</fpage>&#x2013;<lpage>139</lpage>.
                    <ext-link ext-link-type="uri" xlink:href="http://citeseerx.ist.psu.edu/viewdoc/download;jsessionid=B3672C2561AB28FA575BCEEE52FB2219?doi=10.1.1.117.9702&amp;rep=rep1&amp;type=pdf">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-5">
                <label>5</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Reiner</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yekutieli</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Benjamini</surname>
                            <given-names>Y</given-names>
                        </name>
</person-group>:
                    <article-title>Identifying differentially expressed genes using false discovery rate controlling procedures.</article-title>
                    <source>

                        <italic toggle="yes">Bioinformatics.</italic>
</source>
                    <year>2003</year>;<volume>19</volume>(<issue>3</issue>):<fpage>368</fpage>&#x2013;<lpage>375</lpage>.
                    <pub-id pub-id-type="pmid">12584122</pub-id>
                    <pub-id pub-id-type="doi">10.1093/bioinformatics/btf877</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-6">
                <label>6</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Dong</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yambartsev</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ramsey</surname>
                            <given-names>SA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Reverse enGENEering of Regulatory Networks from Big Data: A Roadmap for Biologists.</article-title>
                    <source>

                        <italic toggle="yes">Bioinform Biol Insights.</italic>
</source>
                    <year>2015</year>;<volume>9</volume>:<fpage>61</fpage>&#x2013;<lpage>74</lpage>.
                    <pub-id pub-id-type="pmid">25983554</pub-id>
                    <pub-id pub-id-type="doi">10.4137/BBI.S12467</pub-id>
                    <pub-id pub-id-type="pmcid">4415676</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-7">
                <label>7</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Morgun</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Dzutsev</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Dong</surname>
                            <given-names>X</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Uncovering effects of antibiotics on the host and microbiota using transkingdom gene networks.</article-title>
                    <source>

                        <italic toggle="yes">Gut.</italic>
</source>
                    <year>2015</year>;<volume>64</volume>(<issue>11</issue>):<fpage>1732</fpage>&#x2013;<lpage>43</lpage>.
                    <pub-id pub-id-type="pmid">25614621</pub-id>
                    <pub-id pub-id-type="doi">10.1136/gutjnl-2014-308820</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-8">
                <label>8</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kostka</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Spang</surname>
                            <given-names>R</given-names>
                        </name>
</person-group>:
                    <article-title>Finding disease specific alterations in the co-expression of genes.</article-title>
                    <source>

                        <italic toggle="yes">Bioinformatics.</italic>
</source>
                    <year>2004</year>;<volume>20</volume>(<issue>Suppl 1</issue>):<fpage>i194</fpage>&#x2013;<lpage>9</lpage>.
                    <pub-id pub-id-type="pmid">15262799</pub-id>
                    <pub-id pub-id-type="doi">10.1093/bioinformatics/bth909</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-9">
                <label>9</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Xiao</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Frisina</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Gordon</surname>
                            <given-names>A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Multivariate search for differentially expressed gene combinations.</article-title>
                    <source>

                        <italic toggle="yes">BMC bioinformatics.</italic>
</source>
                    <year>2004</year>;<volume>5</volume>(<issue>1</issue>):<fpage>164</fpage>.
                    <pub-id pub-id-type="pmid">15507138</pub-id>
                    <pub-id pub-id-type="doi">10.1186/1471-2105-5-164</pub-id>
                    <pub-id pub-id-type="pmcid">529250</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-10">
                <label>10</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Shin</surname>
                            <given-names>E</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yoon</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ahn</surname>
                            <given-names>J</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>TC-VGC: a tumor classification system using variations in genes&#x2019; correlation.</article-title>
                    <source>

                        <italic toggle="yes">Comput Methods Programs Biomed.</italic>
</source>
                    <year>2011</year>;<volume>104</volume>(<issue>3</issue>):<fpage>e87</fpage>&#x2013;<lpage>e101</lpage>.
                    <pub-id pub-id-type="pmid">21531474</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.cmpb.2011.03.002</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-11">
                <label>11</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Needham</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hu</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Dwarkadas</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Hierarchical parallelization of gene differential association analysis.</article-title>
                    <source>

                        <italic toggle="yes">BMC Bioinformatics.</italic>
</source>
                    <year>2011</year>;<volume>12</volume>:<fpage>374</fpage>.
                    <pub-id pub-id-type="pmid">21936916</pub-id>
                    <pub-id pub-id-type="doi">10.1186/1471-2105-12-374</pub-id>
                    <pub-id pub-id-type="pmcid">3248234</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-12">
                <label>12</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Amar</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Safer</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Shamir</surname>
                            <given-names>R</given-names>
                        </name>
</person-group>:
                    <article-title>Dissection of regulatory networks that are altered in disease via differential co-expression.</article-title>
                    <source>

                        <italic toggle="yes">PLoS Comput Biol.</italic>
</source>
                    <year>2013</year>;<volume>9</volume>(<issue>3</issue>):<fpage>e1002955</fpage>.
                    <pub-id pub-id-type="pmid">23505361</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pcbi.1002955</pub-id>
                    <pub-id pub-id-type="pmcid">3591264</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-13">
                <label>13</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>de la Fuente</surname>
                            <given-names>A</given-names>
                        </name>
</person-group>:
                    <article-title>From &#x2018;differential expression&#x2019; to &#x2018;differential networking&#x2019;- identification of dysfunctional regulatory networks in diseases.</article-title>
                    <source>

                        <italic toggle="yes">Trends Genet.</italic>
</source>
                    <year>2010</year>;<volume>26</volume>(<issue>7</issue>):<fpage>326</fpage>&#x2013;<lpage>333</lpage>.
                    <pub-id pub-id-type="pmid">20570387</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.tig.2010.05.001</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-14">
                <label>14</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Lai</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wu</surname>
                            <given-names>B</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Chen</surname>
                            <given-names>L</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>A statistical method for identifying differential gene-gene co-expression patterns.</article-title>
                    <source>

                        <italic toggle="yes">Bioinformatics.</italic>
</source>
                    <year>2004</year>;<volume>20</volume>(<issue>17</issue>):<fpage>3146</fpage>&#x2013;<lpage>3155</lpage>.
                    <pub-id pub-id-type="pmid">15231528</pub-id>
                    <pub-id pub-id-type="doi">10.1093/bioinformatics/bth379</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-15">
                <label>15</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>KC</given-names>
                        </name>
</person-group>:
                    <article-title>Genome-wide coexpression dynamics: theory and application.</article-title>
                    <source>

                        <italic toggle="yes">Proc Natl Acad Sci U S A.</italic>
</source>
                    <year>2002</year>;<volume>99</volume>(<issue>26</issue>):<fpage>16875</fpage>&#x2013;<lpage>16880</lpage>.
                    <pub-id pub-id-type="pmid">12486219</pub-id>
                    <pub-id pub-id-type="doi">10.1073/pnas.252466999</pub-id>
                    <pub-id pub-id-type="pmcid">139237</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-16">
                <label>16</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Dettling</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Gabrielson</surname>
                            <given-names>E</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Parmigiani</surname>
                            <given-names>G</given-names>
                        </name>
</person-group>:
                    <article-title>Searching for differentially expressed gene combinations.</article-title>
                    <source>

                        <italic toggle="yes">Genome Biol.</italic>
</source>
                    <year>2005</year>;<volume>6</volume>(<issue>10</issue>):<fpage>R88</fpage>.
                    <pub-id pub-id-type="pmid">16207359</pub-id>
                    <pub-id pub-id-type="doi">10.1186/gb-2005-6-10-r88</pub-id>
                    <pub-id pub-id-type="pmcid">1257471</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-17">
                <label>17</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Watson</surname>
                            <given-names>M</given-names>
                        </name>
</person-group>:
                    <article-title>CoXpress: differential co-expression in gene expression data.</article-title>
                    <source>

                        <italic toggle="yes">BMC Bioinformatics.</italic>
</source>
                    <year>2006</year>;<volume>7</volume>:<fpage>509</fpage>.
                    <pub-id pub-id-type="pmid">17116249</pub-id>
                    <pub-id pub-id-type="doi">10.1186/1471-2105-7-509</pub-id>
                    <pub-id pub-id-type="pmcid">1660556</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-18">
                <label>18</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Mani</surname>
                            <given-names>KM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lefebvre</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>K</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>A systems biology approach to prediction of oncogenes and molecular perturbation targets in B-cell lymphomas.</article-title>
                    <source>

                        <italic toggle="yes">Mol Syst Biol.</italic>
</source>
                    <year>2008</year>;<volume>4</volume>:<fpage>169</fpage>.
                    <pub-id pub-id-type="pmid">18277385</pub-id>
                    <pub-id pub-id-type="doi">10.1038/msb.2008.2</pub-id>
                    <pub-id pub-id-type="pmcid">2267731</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-19">
                <label>19</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hu</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Qiu</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Glazko</surname>
                            <given-names>G</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Detecting intergene correlation changes in microarray analysis: a new approach to gene selection.</article-title>
                    <source>

                        <italic toggle="yes">BMC Bioinformatics.</italic>
</source>
                    <year>2009</year>;<volume>10</volume>:<fpage>20</fpage>.
                    <pub-id pub-id-type="pmid">19146700</pub-id>
                    <pub-id pub-id-type="doi">10.1186/1471-2105-10-20</pub-id>
                    <pub-id pub-id-type="pmcid">2657217</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-20">
                <label>20</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Cho</surname>
                            <given-names>SB</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kim</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kim</surname>
                            <given-names>JH</given-names>
                        </name>
</person-group>:
                    <article-title>Identifying set-wise differential co-expression in gene expression microarray data.</article-title>
                    <source>

                        <italic toggle="yes">BMC Bioinformatics.</italic>
</source>
                    <year>2009</year>;<volume>10</volume>:<fpage>109</fpage>.
                    <pub-id pub-id-type="pmid">19371436</pub-id>
                    <pub-id pub-id-type="doi">10.1186/1471-2105-10-109</pub-id>
                    <pub-id pub-id-type="pmcid">2679020</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-21">
                <label>21</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Skinner</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kotliarov</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Varma</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Construct and Compare Gene Coexpression Networks with DAPfinder and DAPview.</article-title>
                    <source>

                        <italic toggle="yes">BMC Bioinformatics.</italic>
</source>
                    <year>2011</year>;<volume>12</volume>:<fpage>286</fpage>.
                    <pub-id pub-id-type="pmid">21756334</pub-id>
                    <pub-id pub-id-type="doi">10.1186/1471-2105-12-286</pub-id>
                    <pub-id pub-id-type="pmcid">3149583</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-22">
                <label>22</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Dawson</surname>
                            <given-names>JA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ye</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kendziorski</surname>
                            <given-names>C</given-names>
                        </name>
</person-group>:
                    <article-title>R/EBcoexpress: an empirical Bayesian framework for discovering differential co-expression.</article-title>
                    <source>

                        <italic toggle="yes">Bioinformatics.</italic>
</source>
                    <year>2012</year>;<volume>28</volume>(<issue>14</issue>):<fpage>1939</fpage>&#x2013;<lpage>40</lpage>.
                    <pub-id pub-id-type="pmid">22595207</pub-id>
                    <pub-id pub-id-type="doi">10.1093/bioinformatics/bts268</pub-id>
                    <pub-id pub-id-type="pmcid">3492001</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-23">
                <label>23</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Fukushima</surname>
                            <given-names>A</given-names>
                        </name>
</person-group>:
                    <article-title>DiffCorr: an R package to analyze and visualize differential correlations in biological networks.</article-title>
                    <source>

                        <italic toggle="yes">Gene.</italic>
</source>
                    <year>2013</year>;<volume>518</volume>(<issue>1</issue>):<fpage>209</fpage>&#x2013;<lpage>214</lpage>.
                    <pub-id pub-id-type="pmid">23246976</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.gene.2012.11.028</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-24">
                <label>24</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Jacob</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Neuvial</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Dudoit</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Package &#x2018;DEGraph&#x2019;</article-title>.<year>2012</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.477.6530&amp;rep=rep1&amp;type=pdf">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-25">
                <label>25</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Choi</surname>
                            <given-names>JK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yu</surname>
                            <given-names>U</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yoo</surname>
                            <given-names>OJ</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Differential coexpression analysis using microarray data and its application to human cancer.</article-title>
                    <source>

                        <italic toggle="yes">Bioinformatics.</italic>
</source>
                    <year>2005</year>;<volume>21</volume>(<issue>24</issue>):<fpage>4348</fpage>&#x2013;<lpage>4355</lpage>.
                    <pub-id pub-id-type="pmid">16234317</pub-id>
                    <pub-id pub-id-type="doi">10.1093/bioinformatics/bti722</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-26">
                <label>26</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Pronk</surname>
                            <given-names>TE</given-names>
                        </name>

                        <name name-style="western">
                            <surname>van Someren</surname>
                            <given-names>EP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Stierum</surname>
                            <given-names>RH</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Unraveling toxicological mechanisms and predicting toxicity classes with gene dysregulation networks.</article-title>
                    <source>

                        <italic toggle="yes">J Appl Toxicol.</italic>
</source>
                    <year>2013</year>;<volume>33</volume>(<issue>12</issue>):<fpage>1407</fpage>&#x2013;<lpage>1415</lpage>.
                    <pub-id pub-id-type="pmid">22886929</pub-id>
                    <pub-id pub-id-type="doi">10.1002/jat.2800</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-27">
                <label>27</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Cho</surname>
                            <given-names>DY</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kim</surname>
                            <given-names>YA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Przytycka</surname>
                            <given-names>TM</given-names>
                        </name>
</person-group>:
                    <article-title>Chapter 5: Network biology approach to complex diseases.</article-title>
                    <source>

                        <italic toggle="yes">PLoS Comput Biol.</italic>
</source>
                    <year>2012</year>;<volume>8</volume>(<issue>12</issue>):<fpage>e1002820</fpage>.
                    <pub-id pub-id-type="pmid">23300411</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pcbi.1002820</pub-id>
                    <pub-id pub-id-type="pmcid">3531284</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-28">
                <label>28</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Shulzhenko</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Morgun</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hsiao</surname>
                            <given-names>W</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Crosstalk between B lymphocytes, microbiota and the intestinal epithelium governs immunity versus metabolism in the gut.</article-title>
                    <source>

                        <italic toggle="yes">Nat Med.</italic>
</source>
                    <year>2011</year>;<volume>17</volume>(<issue>12</issue>):<fpage>1585</fpage>&#x2013;<lpage>1593</lpage>.
                    <pub-id pub-id-type="pmid">22101768</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nm.2505</pub-id>
                    <pub-id pub-id-type="pmcid">3902046</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-29">
                <label>29</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Mine</surname>
                            <given-names>KL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Shulzhenko</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yambartsev</surname>
                            <given-names>A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Gene network reconstruction reveals cell cycle and antiviral genes as major drivers of cervical cancer.</article-title>
                    <source>

                        <italic toggle="yes">Nat Commun.</italic>
</source>
                    <year>2013</year>;<volume>4</volume>: 1806.
                    <pub-id pub-id-type="pmid">23651994</pub-id>
                    <pub-id pub-id-type="doi">10.1038/ncomms2693</pub-id>
                    <pub-id pub-id-type="pmcid">4237593</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-30">
                <label>30</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Thomas</surname>
                            <given-names>LD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Fossaluza</surname>
                            <given-names>V</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yambartsev</surname>
                            <given-names>A</given-names>
                        </name>
</person-group>:
                    <article-title>Building complex networks through classical and bayesian statistics - a comparison</article-title>. In
                    <italic toggle="yes">XI Brazilian Meeting on Bayesian Statistics</italic>. AIP Conf. Proc.<year>2012</year>;<volume>1490</volume>:<fpage>323</fpage>&#x2013;<lpage>331</lpage>.
                    <pub-id pub-id-type="doi">10.1063/1.4759617</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-31">
                <label>31</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ghosh</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>Z</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tan</surname>
                            <given-names>XF</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>iTRAQ Based Quantitative Proteomics Approach Validated the Role of Calcyclin Binding Protein (CacyBP) in Promoting Colorectal Cancer Metastasis.</article-title>
                    <source>

                        <italic toggle="yes">Mol Cell Proteomics.</italic>
</source>
                    <year>2013</year>;<volume>12</volume>(<issue>7</issue>):<fpage>1865</fpage>&#x2013;<lpage>1880</lpage>.
                    <pub-id pub-id-type="pmid">23543800</pub-id>
                    <pub-id pub-id-type="doi">10.1074/mcp.M112.023085</pub-id>
                    <pub-id pub-id-type="pmcid">3708172</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-32">
                <label>32</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Cost</surname>
                            <given-names>NG</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Czyzyk-Krzeska</surname>
                            <given-names>MF</given-names>
                        </name>
</person-group>:
                    <article-title>Regulation of autophagy by two products of one gene: TRPM3 and miR-204.</article-title>
                    <source>

                        <italic toggle="yes">Mol Cell Oncol.</italic>
</source>
                    <year>2015</year>;<volume>2</volume>(<issue>4</issue>):<fpage>e1002712</fpage>, in press.
                    <pub-id pub-id-type="pmid">27308495</pub-id>
                    <pub-id pub-id-type="doi">10.1080/23723556.2014.1002712</pub-id>
                    <pub-id pub-id-type="pmcid">4905337</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-33">
                <label>33</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hall</surname>
                            <given-names>DP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Cost</surname>
                            <given-names>NG</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hegde</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>TRPM3 and miR-204 establish a regulatory circuit that controls oncogenic autophagy in clear cell renal cell carcinoma.</article-title>
                    <source>

                        <italic toggle="yes">Cancer cell.</italic>
</source>
                    <year>2014</year>;<volume>26</volume>(<issue>5</issue>):<fpage>738</fpage>&#x2013;<lpage>753</lpage>.
                    <pub-id pub-id-type="pmid">25517751</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.ccell.2014.09.015</pub-id>
                    <pub-id pub-id-type="pmcid">4269832</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-34">
                <label>34</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Lee</surname>
                            <given-names>HJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Pyo</surname>
                            <given-names>JO</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Oh</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>AK2 activates a novel apoptotic pathway through formation of a complex with FADD and caspase-10.</article-title>
                    <source>

                        <italic toggle="yes">Nat Cell Biol.</italic>
</source>
                    <year>2007</year>;<volume>9</volume>(<issue>11</issue>):<fpage>1303</fpage>&#x2013;<lpage>1310</lpage>.
                    <pub-id pub-id-type="pmid">17952061</pub-id>
                    <pub-id pub-id-type="doi">10.1038/ncb1650</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-35">
                <label>35</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Walker</surname>
                            <given-names>BA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Leone</surname>
                            <given-names>PE</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Chiecchio</surname>
                            <given-names>L</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>A compendium of myeloma-associated chromosomal copy number abnormalities and their prognostic value.</article-title>
                    <source>

                        <italic toggle="yes">Blood.</italic>
</source>
                    <year>2010</year>;<volume>116</volume>(<issue>15</issue>):<fpage>e56</fpage>&#x2013;<lpage>e65</lpage>.
                    <pub-id pub-id-type="pmid">20616218</pub-id>
                    <pub-id pub-id-type="doi">10.1182/blood-2010-04-279596</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-36">
                <label>36</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Bj&#x00f6;rck</surname>
                            <given-names>E</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ek</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Landgren</surname>
                            <given-names>O</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>High expression of cyclin B1 predicts a favorable outcome in patients with follicular lymphoma.</article-title>
                    <source>

                        <italic toggle="yes">Blood.</italic>
</source>
                    <year>2005</year>;<volume>105</volume>(<issue>7</issue>):<fpage>2908</fpage>&#x2013;<lpage>2915</lpage>.
                    <pub-id pub-id-type="pmid">15576476</pub-id>
                    <pub-id pub-id-type="doi">10.1182/blood-2004-07-2721</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-37">
                <label>37</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Landemaine</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jackson</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bellahc&#x00e8;ne</surname>
                            <given-names>A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>A six-gene signature predicting breast cancer lung metastasis.</article-title>
                    <source>

                        <italic toggle="yes">Cancer Res.</italic>
</source>
                    <year>2008</year>;<volume>68</volume>(<issue>15</issue>):<fpage>6092</fpage>&#x2013;<lpage>6099</lpage>.
                    <pub-id pub-id-type="pmid">18676831</pub-id>
                    <pub-id pub-id-type="doi">10.1158/0008-5472.CAN-08-0436</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-38">
                <label>38</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Nie</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yu</surname>
                            <given-names>XL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>XG</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Down-regulation of CacyBP is associated with poor prognosis and the effects on COX-2 expression in breast cancer.</article-title>
                    <source>

                        <italic toggle="yes">Int J Oncol.</italic>
</source>
                    <year>2010</year>;<volume>37</volume>(<issue>5</issue>):<fpage>1261</fpage>&#x2013;<lpage>1269</lpage>.
                    <pub-id pub-id-type="pmid">20878073</pub-id>
                    <pub-id pub-id-type="doi">10.3892/ijo_00000777</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-39">
                <label>39</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Horlings</surname>
                            <given-names>HM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lai</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Nuyten</surname>
                            <given-names>DS</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Integration of DNA copy number alterations and prognostic gene expression signatures in breast cancer patients.</article-title>
                    <source>

                        <italic toggle="yes">Clin Cancer Res.</italic>
</source>
                    <year>2010</year>;<volume>16</volume>(<issue>2</issue>):<fpage>651</fpage>&#x2013;<lpage>663</lpage>.
                    <pub-id pub-id-type="pmid">20068109</pub-id>
                    <pub-id pub-id-type="doi">10.1158/1078-0432.CCR-09-0709</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-40">
                <label>40</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hunter</surname>
                            <given-names>DJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kraft</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jacobs</surname>
                            <given-names>KB</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>A genome-wide association study identifies alleles in 
                        <italic toggle="yes">FGFR2</italic> associated with risk of sporadic postmenopausal breast cancer.</article-title>
                    <source>

                        <italic toggle="yes">Nat Genet.</italic>
</source>
                    <year>2007</year>;<volume>39</volume>(<issue>7</issue>):<fpage>870</fpage>&#x2013;<lpage>874</lpage>.
                    <pub-id pub-id-type="pmid">17529973</pub-id>
                    <pub-id pub-id-type="doi">10.1038/ng2075</pub-id>
                    <pub-id pub-id-type="pmcid">3493132</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-41">
                <label>41</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Katoh</surname>
                            <given-names>M</given-names>
                        </name>
</person-group>:
                    <article-title>Cancer genomics and genetics of FGFR2 (Review).</article-title>
                    <source>

                        <italic toggle="yes">Int J Oncol.</italic>
</source>
                    <year>2008</year>;<volume>33</volume>(<issue>2</issue>):<fpage>233</fpage>&#x2013;<lpage>237</lpage>.
                    <pub-id pub-id-type="pmid">18636142</pub-id>
                    <pub-id pub-id-type="doi">10.3892/ijo_00000001</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-42">
                <label>42</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Jang</surname>
                            <given-names>JH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Shin</surname>
                            <given-names>KH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Park</surname>
                            <given-names>JG</given-names>
                        </name>
</person-group>:
                    <article-title>Mutations in 
                        <italic toggle="yes">fibroblast growth factor receptor 2</italic> and 
                        <italic toggle="yes">fibroblast growth factor receptor 3</italic> genes associated with human gastric and colorectal cancers.</article-title>
                    <source>

                        <italic toggle="yes">Cancer Res.</italic>
</source>
                    <year>2001</year>;<volume>61</volume>(<issue>9</issue>):<fpage>3541</fpage>&#x2013;<lpage>3543</lpage>.
                    <pub-id pub-id-type="pmid">11325814</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-43">
                <label>43</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Vedeld</surname>
                            <given-names>HM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Andresen</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Eilertsen</surname>
                            <given-names>IA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The novel colorectal cancer biomarkers 
                        <italic toggle="yes">CDO1, ZSCAN18</italic> and 
                        <italic toggle="yes">ZNF331</italic> are frequently methylated across gastrointestinal cancers.</article-title>
                    <source>

                        <italic toggle="yes">Int J Cancer.</italic>
</source>
                    <year>2015</year>;<volume>136</volume>(<issue>4</issue>):<fpage>844</fpage>&#x2013;<lpage>853</lpage>.
                    <pub-id pub-id-type="pmid">24948044</pub-id>
                    <pub-id pub-id-type="doi">10.1002/ijc.29039</pub-id>
                    <pub-id pub-id-type="pmcid">4277335</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-44">
                <label>44</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Berman</surname>
                            <given-names>EM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Werbel</surname>
                            <given-names>LM</given-names>
                        </name>
</person-group>:
                    <article-title>The renewed potential for folate antagonists in contemporary cancer chemotherapy.</article-title>
                    <source>

                        <italic toggle="yes">J Med Chem.</italic>
</source>
                    <year>1991</year>;<volume>34</volume>(<issue>2</issue>):<fpage>479</fpage>&#x2013;<lpage>485</lpage>.
                    <pub-id pub-id-type="pmid">1995868</pub-id>
                    <pub-id pub-id-type="doi">10.1021/jm00106a001</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-45">
                <label>45</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kwak</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Cho</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hur</surname>
                            <given-names>W</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Antitumor effects and mechanisms of AZD4547 on FGFR2-deregulated endometrial cancer cells.</article-title>
                    <source>

                        <italic toggle="yes">Mol Cancer Ther.</italic>
</source>
                    <year>2015</year>;<volume>14</volume>(<issue>10</issue>):<fpage>2292</fpage>&#x2013;<lpage>2302</lpage>.
                    <pub-id pub-id-type="pmid">26294741</pub-id>
                    <pub-id pub-id-type="doi">10.1158/1535-7163.MCT-15-0032</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-46">
                <label>46</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ning</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sun</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hong</surname>
                            <given-names>L</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Calcyclin-binding protein inhibits proliferation, tumorigenicity, and invasion of gastric cancer.</article-title>
                    <source>

                        <italic toggle="yes">Mol Cancer Res.</italic>
</source>
                    <year>2007</year>;<volume>5</volume>(<issue>12</issue>):<fpage>1254</fpage>&#x2013;<lpage>1262</lpage>.
                    <pub-id pub-id-type="pmid">18171983</pub-id>
                    <pub-id pub-id-type="doi">10.1158/1541-7786.MCR-06-0426</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-47">
                <label>47</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sun</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ning</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Liu</surname>
                            <given-names>J</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Overexpressed CacyBP/SIP leads to the suppression of growth in renal cell carcinoma.</article-title>
                    <source>

                        <italic toggle="yes">Biochem Biophys Res Commun.</italic>
</source>
                    <year>2007</year>;<volume>356</volume>(<issue>4</issue>):<fpage>864</fpage>&#x2013;<lpage>871</lpage>.
                    <pub-id pub-id-type="pmid">17400182</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.bbrc.2007.03.080</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-48">
                <label>48</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Morris</surname>
                            <given-names>MR</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ricketts</surname>
                            <given-names>CJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Gentle</surname>
                            <given-names>D</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Genome-wide methylation analysis identifies epigenetically inactivated candidate tumour suppressor genes in renal cell carcinoma.</article-title>
                    <source>

                        <italic toggle="yes">Oncogene.</italic>
</source>
                    <year>2011</year>;<volume>30</volume>(<issue>12</issue>):<fpage>1390</fpage>&#x2013;<lpage>1401</lpage>.
                    <pub-id pub-id-type="pmid">21132003</pub-id>
                    <pub-id pub-id-type="doi">10.1038/onc.2010.525</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-49">
                <label>49</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Weng</surname>
                            <given-names>G</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bhalla</surname>
                            <given-names>US</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Iyengar</surname>
                            <given-names>R</given-names>
                        </name>
</person-group>:
                    <article-title>Complexity in biological signaling systems.</article-title>
                    <source>

                        <italic toggle="yes">Science.</italic>
</source>
                    <year>1999</year>;<volume>284</volume>(<issue>5411</issue>):<fpage>92</fpage>&#x2013;<lpage>96</lpage>.
                    <pub-id pub-id-type="pmid">10102825</pub-id>
                    <pub-id pub-id-type="doi">10.1126/science.284.5411.92</pub-id>
                    <pub-id pub-id-type="pmcid">3773983</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-50">
                <label>50</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Biewenga</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Buist</surname>
                            <given-names>MR</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Moerland</surname>
                            <given-names>PD</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Gene expression in early stage cervical cancer.</article-title>
                    <source>

                        <italic toggle="yes">Gynecol Oncol.</italic>
</source>
                    <year>2008</year>;<volume>108</volume>(<issue>3</issue>):<fpage>520</fpage>&#x2013;<lpage>526</lpage>.
                    <pub-id pub-id-type="pmid">18191186</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.ygyno.2007.11.024</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-51">
                <label>51</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Pyeon</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Newton</surname>
                            <given-names>MA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lambert</surname>
                            <given-names>PF</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Fundamental differences in cell cycle deregulation in human papillomavirus-positive and human papillomavirus-negative head/neck and cervical cancers.</article-title>
                    <source>

                        <italic toggle="yes">Cancer Res.</italic>
</source>
                    <year>2007</year>;<volume>67</volume>(<issue>10</issue>):<fpage>4605</fpage>&#x2013;<lpage>4619</lpage>.
                    <pub-id pub-id-type="pmid">17510386</pub-id>
                    <pub-id pub-id-type="doi">10.1158/0008-5472.CAN-06-3619</pub-id>
                    <pub-id pub-id-type="pmcid">2858285</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-52">
                <label>52</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Zhai</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kuick</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Nan</surname>
                            <given-names>B</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Gene expression analysis of preinvasive and invasive cervical squamous cell carcinomas identifies 
                        <italic toggle="yes">HOXC10</italic> as a key mediator of invasion.</article-title>
                    <source>

                        <italic toggle="yes">Cancer Res.</italic>
</source>
                    <year>2007</year>;<volume>67</volume>(<issue>21</issue>):<fpage>10163</fpage>&#x2013;<lpage>10172</lpage>.
                    <pub-id pub-id-type="pmid">17974957</pub-id>
                    <pub-id pub-id-type="doi">10.1158/0008-5472.CAN-07-2056</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-53">
                <label>53</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Scotto</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Narayan</surname>
                            <given-names>G</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Nandula</surname>
                            <given-names>SV</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Identification of copy number gain and overexpressed genes on chromosome arm 20q by an integrative genomic approach in cervical cancer: potential role in progression.</article-title>
                    <source>

                        <italic toggle="yes">Genes Chromosomes Cancer.</italic>
</source>
                    <year>2008</year>;<volume>47</volume>(<issue>9</issue>):<fpage>755</fpage>&#x2013;<lpage>765</lpage>.
                    <pub-id pub-id-type="pmid">18506748</pub-id>
                    <pub-id pub-id-type="doi">10.1002/gcc.20577</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-54">
                <label>54</label>
                <mixed-citation publication-type="book">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Fisher</surname>
                            <given-names>RA</given-names>
                        </name>
</person-group>:
                    <article-title>Statistical Methods for Research Workers</article-title>. Oliver and Boyd (Edinburgh);<year>1925</year>.
                    <ext-link ext-link-type="uri" xlink:href="https://www.scribd.com/document/58873576/Fisher-R-a-1925-Statistical-Methods-for-Research-Workers">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-55">
                <label>55</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Benjamini</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hochberg</surname>
                            <given-names>Y</given-names>
                        </name>
</person-group>:
                    <article-title>Controlling the false discovery rate: a practical and powerful approach to multiple testing.</article-title>
                    <source>

                        <italic toggle="yes">J R Stat Soc B.</italic>
</source>
                    <year>1995</year>;<volume>57</volume>(<issue>1</issue>):<fpage>289</fpage>&#x2013;<lpage>300</lpage>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.stat.purdue.edu/~doerge/BIOINFORM.D/FALL06/Benjamini%20and%20Y%20FDR.pdf">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-56">
                <label>56</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Yambartsev</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Perlin</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kovchegov</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Unexpected links reflect the noise in networks.</article-title>
                    <source>

                        <italic toggle="yes">Biol Direct.</italic>
</source>
                    <year>2016</year>;<volume>11</volume>(<issue>1</issue>):<fpage>52</fpage>.
                    <pub-id pub-id-type="pmid">27737689</pub-id>
                    <pub-id pub-id-type="doi">10.1186/s13062-016-0155-0</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-57">
                <label>57</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Thomas</surname>
                            <given-names>LD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Vyshenska</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Shulzhenko</surname>
                            <given-names>N</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Dataset 1 in: Differentially correlated genes in co-expression networks control phenotype transitions.</article-title>
                    <source>

                        <italic toggle="yes">F1000Research.</italic>
</source>
                    <year>2016</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.5256/f1000research.9708.d142100">Data Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-58">
                <label>58</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Thomas</surname>
                            <given-names>LD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Vyshenska</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Shulzhenko</surname>
                            <given-names>N</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Dataset 2 in: Differentially correlated genes in co-expression networks control phenotype transitions.</article-title>
                    <source>

                        <italic toggle="yes">F1000Research.</italic>
</source>
                    <year>2016</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.5256/f1000research.9708.d142099">Data Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-59">
                <label>59</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Thomas</surname>
                            <given-names>LD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Vyshenska</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Shulzhenko</surname>
                            <given-names>N</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Dataset 3 in: Differentially correlated genes in co-expression networks control phenotype transitions.</article-title>
                    <source>

                        <italic toggle="yes">F1000Research.</italic>
</source>
                    <year>2016</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.5256/f1000research.9708.d142097">Data Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-60">
                <label>60</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Thomas</surname>
                            <given-names>LD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Vyshenska</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Shulzhenko</surname>
                            <given-names>N</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Dataset 4 in: Differentially correlated genes in co-expression networks control phenotype transitions.</article-title>
                    <source>

                        <italic toggle="yes">F1000Research.</italic>
</source>
                    <year>2016</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.5256/f1000research.9708.d142098">Data Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-61">
                <label>61</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Thomas</surname>
                            <given-names>LD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Vyshenska</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Shulzhenko</surname>
                            <given-names>N</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Dataset 5 in: Differentially correlated genes in co-expression networks control phenotype transitions.</article-title>
                    <source>

                        <italic toggle="yes">F1000Research.</italic>
</source>
                    <year>2016</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.5256/f1000research.9708.d142101">Data Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-62">
                <label>62</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Thomas</surname>
                            <given-names>LD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Vyshenska</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Shulzhenko</surname>
                            <given-names>N</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Dataset 6 in: Differentially correlated genes in co-expression networks control phenotype transitions.</article-title>
                    <source>

                        <italic toggle="yes">F1000Research.</italic>
</source>
                    <year>2016</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.5256/f1000research.9708.d142102">Data Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-63">
                <label>63</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Thomas</surname>
                            <given-names>LD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Vyshenska</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Shulzhenko</surname>
                            <given-names>N</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Dataset 7 in: Differentially correlated genes in co-expression networks control phenotype transitions.</article-title>
                    <source>

                        <italic toggle="yes">F1000Research.</italic>
</source>
                    <year>2016</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.5256/f1000research.9708.d142103">Data Source</ext-link>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report17875">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.10464.r17875</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Martins Lopes</surname>
                        <given-names>Fabr&#x00ed;cio</given-names>
                    </name>
                    <xref ref-type="aff" rid="r17875a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-8786-3313</uri>
                </contrib>
                <aff id="r17875a1">
                    <label>1</label>Federal University of Technology &#x2013; Paran&#x00e1;, Corn&#x00e9;lio Proc&#x00f3;pio, Brazil</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>16</day>
                <month>1</month>
                <year>2017</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2017 Martins Lopes F</copyright-statement>
                <copyright-year>2017</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport17875" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.9708.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>The manuscript &#x201c;Differentially correlated genes in co-expression networks control phenotype transitions&#x201d; investigates the differentially co-expressed genes in two biological processes, a homogeneous one-causal-factor process (B cell deficiency) and a heterogeneous multi-causal system (cervical cancer). The authors have adopted the Pearson correlation and partial correlation for the inference of networks.</p>
            <p> </p>
            <p> 
                <bold>Major revision:</bold> 
                <list list-type="bullet">
                    <list-item>
                        <p>The networks were inferred from local partial correlation method, which is able to identify a linear relationship between two variables X and Y (genes), and this relationship may or may not be mediate by another gene Z. It is not clear why the authors have adopted the Pearson correlation for B cell deficiency analysis and the partial correlation for cervical cancer analysis. Moreover, it would be interesting to highlight the gain obtained by adopting the partial correlation. For instance, what were the relationships inferred with the partial correlation that would not be inferred using Pearson correlation?</p>
                    </list-item>
                    <list-item>
                        <p>Another important issue is that even with partial correlation, only pairwise of relationships are identified. In the study presented at http://dx.doi.org/10.1109/JSTSP.2008.923841, it presents the Intrinsically Multivariate Predictive (IMP) Genes, which are genes that depend on a subset of predictors. How did the authors deal with these IMP genes?</p>
                    </list-item>
                    <list-item>
                        <p>It is not clear how and why the microarray data was filtered. The authors could better describe how the data was filtered and how the parameters were adopted.</p>
                    </list-item>
                    <list-item>
                        <p>The title &#x201c;Differentially correlated genes in co-expression networks control phenotype transitions&#x201d; is too rigid leading to the understanding that all correlated genes control the phenotype transitions. I believe that is not true. Authors could provide a more appropriate title.</p>
                    </list-item>
                </list> </p>
            <p> 
                <bold>Minor revisions:</bold> 
                <list list-type="bullet">
                    <list-item>
                        <p>Page 3: &#x201c;homogenous&#x201d; &#x2192; homogeneous</p>
                    </list-item>
                    <list-item>
                        <p>Page 4: "correlation lost" &#x2192; correlation loss;</p>
                    </list-item>
                </list>
            </p>
            <p>Reviewer Expertise:</p>
            <p>NA</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
        <back>
            <ref-list>
                <title>References</title>
                <ref id="rep-ref-17875-1">
                    <label>1</label>
                    <mixed-citation publication-type="journal">
                        <person-group person-group-type="author"/>:
                        <article-title>Intrinsically Multivariate Predictive Genes</article-title>.
                        <source>
                            <italic>IEEE Journal of Selected Topics in Signal Processing</italic>
                        </source>.<year>2008</year>;<volume>2</volume>(<issue>3</issue>) :
                        <elocation-id>10.1109/JSTSP.2008.923841</elocation-id>
                        <fpage>424</fpage>-<lpage>439</lpage>
                        <pub-id pub-id-type="doi">10.1109/JSTSP.2008.923841</pub-id>
                    </mixed-citation>
                </ref>
            </ref-list>
        </back>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report17872">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.10464.r17872</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Zinovyev</surname>
                        <given-names>Andrei</given-names>
                    </name>
                    <xref ref-type="aff" rid="r17872a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r17872a1">
                    <label>1</label>Institut Curie, Paris, France</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>23</day>
                <month>12</month>
                <year>2016</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2016 Zinovyev A</copyright-statement>
                <copyright-year>2016</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport17872" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.9708.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>The manuscript "Differentially correlated genes in co-expression networks control phenotype transitions" by Lina Thomas
                <italic> et al</italic>, is devoted to describing a case study of two transcriptomic datasets with the focus on characterizing pairs of differentially correlated genes, with a limited experimental validation of the conclusions of the statistical analysis.</p>
            <p> </p>
            <p> The manuscript is clear, technically sound and exploits an interesting approach for the analysis of expression data. The conclusions of the statistical analysis are sufficiently justified. I like the detailed and illustrated description of the novel methods exploited the paper. Experimental validation of several findings is a big plus. Therefore, I think the article deserves to be indexed.</p>
            <p> </p>
            <p> I have several remarks for the manuscript which I think should be addressed before approval: 
                <list list-type="order">
                    <list-item>
                        <p>I am not completely comfortable with the title of the manuscript, which is quite conceptual, while the content of the paper remains descriptive and does not provide mechanistic insight on how DCG pairs can control the phenotype. I suggest to the authors to have some reflexion on how to make it more adequate.</p>
                    </list-item>
                    <list-item>
                        <p>Related to 1), in Introduction the desciption of the mechanisms by which DCG pairs can "contribute to propagation of perturbation" remain very illusive. I suggest to the authors to formulate more clearly at least several hypotheses or scenario by which DCG pairs might appear and play an important role. A figure illustrating such hypotheses would clarify what the authors mean.</p>
                    </list-item>
                    <list-item>
                        <p>Figures 1 and 3 are not very informative. Can authors make an effort to improve this aspect (at least, visualize some DC gene names?)</p>
                    </list-item>
                    <list-item>
                        <p>The authors do not discuss a possibility that appearance of DC pairs can be a result of differential sample tissue composition from several cell types (i.e., immune cells in jejunum or in a tumor tissue). Discussing this point would be an advantage.</p>
                    </list-item>
                    <list-item>
                        <p>In several places, the authors apply terms "upstream", "downstream" with respect to the network which is undirected by its nature. I suggest to underline that the nature of correlation networks does not allow distinguishing causality direction and considering genes "downstream" of the key drivers is only a hypothesis which can not be assessed from the data.</p>
                    </list-item>
                    <list-item>
                        <p>Description of the transcriptomic datasets in Materials and Methods is too brief, especially for the cervix dataset which seems to be quite composite. It would be appropriate to specify more clearly the dataset's composition (not simply referring to the original publications) directly in the paper text.</p>
                    </list-item>
                    <list-item>
                        <p>One thing which is confusing to me is that the correlation networks are constructed differently for two case studies (direct vs partial). I understood the reason why partial correlation was prefered for the cervical cancer study, however, the question is: can the conclusion about that DC pairs do not contain key drivers in the case of cervical cancer be affected by the difference in the methodology of correlation graph computation? It would be usefull to clarify this aspect.</p>
                    </list-item>
                    <list-item>
                        <p>The section "Filtering and meta-analysis of microarray data" was not clear to me. I suggest to re-write it.</p>
                    </list-item>
                </list> </p>
            <p> Minor remarks:</p>
            <p> </p>
            <p> Page 4: "correlation lost" -&gt; "correlation loss"</p>
            <p> </p>
            <p> Description of the partial correlation method refers to a paper (30) which can not be easily accessed. Direct reference to the arXiv preprint would be more appropriate in this case</p>
            <p>Reviewer Expertise:</p>
            <p>NA</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report17874">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.10464.r17874</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Venancio</surname>
                        <given-names>Thiago M.</given-names>
                    </name>
                    <xref ref-type="aff" rid="r17874a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r17874a1">
                    <label>1</label>Center for Bioscience and Biotechnology, State University of Norte Fluminense Darcy Ribeiro, Campos dos Goytacazes, RJ, 28035-200, Brazil</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>20</day>
                <month>12</month>
                <year>2016</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2016 Venancio TM</copyright-statement>
                <copyright-year>2016</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport17874" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.9708.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>In the present work Thomas 
                <italic>et al.&#x00a0;</italic>employed method to find differentially co-expressed genes in co-expression networks of a B lymphocyte deficiency (largely mono-causal) and a complex cervical cancer (multi-causal) dataset. They used different graph-theoretical approaches to find relevant genes in this context.</p>
            <p> </p>
            <p> Interestingly, the authors found that 72% (39/54) of the correlation gains involve at least one Ig gene, which is in agreement with the previously shown association between intestinal gene expression and B cells ability to produce antibodies. Is it possible that this "correlation gains" are merely a consequence of the general enrichment of Ig genes in the DC list?</p>
            <p> </p>
            <p> In the cervical cancer analysis, the authors used shortest-path and betweenness centrality to argue for the regulatory relevance of DC genes. I think it would be great to supplement this finding with more biochemical information. For example, how many of these genes are transcription factors or protein kinases?</p>
            <p> </p>
            <p> Overall, I think this study is technically sound and properly executed.</p>
            <p> </p>
            <p> </p>
            <p> == Minor corrections</p>
            <p> In the abstract, "mus musculus" should read "Mus musculus".</p>
            <p> </p>
            <p> In Figure 2, Ig is underlined as if marked by a spellchecker.</p>
            <p>Reviewer Expertise:</p>
            <p>NA</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
</article>
