There are 114 species of freshwater and brackish water fish distributed around 17 sampling locations across Aceh waters ¹ . Several of these have the potential for aquaculture, e.g. the Anguilla spp. of tropical eels, locally known as sidat or illeah in Acehnese language ^{2– 3} . Based on morphological characteristics, only two species of eels have been recorded in Aceh waters, Anguilla bicolor and Anguilla marmorata ¹ , but it is believed that the true number of species is greater because some parts of the inland waters in Aceh province have not been explored yet. According to Miller and Tsukamoto ⁴ , there are 19 species of eels that have been identified worldwide, 7 of which are found in Indonesian waters ⁵ . It is therefore very likely that new species will be found in Aceh waters.

For fisheries management it is crucial to identify these species in order to plan a better conservation strategy, since each one has unique behavioral patterns, and should be independently managed. Eels are very similar morphologically, so it is very difficult to distinguish one species from the other based on morphological characteristics only. Analysing genetic data through DNA barcoding can solve this problem ⁶ , so that the true number of eel species living in the waters of Aceh can be evaluated. The objective of the present study was to verify the taxonomic status of eels in Aceh waters by amplifying the cox1 gene and analysing the genetic data.

The study was conducted on the western coast of Aceh Province, Indonesia, from July to November 2016. The samples were processed and analyzed in the School of Biological Sciences, Universiti Sains Malaysia. Sampling was done at night from 18.00 to 06.00 hours. Adult eels were caught using line fishing, while traps were used to catch glass eels. Eel larvae are called glass eels; they have translucent white bodies and measure about 5–10 cm. The length of adult eels is species dependent but most measure between 40–120 cm.

Approximately 1 cm ² of caudal fin tissue was taken from each specimen using a sterile procedure to avoid contamination of specimens. The tissue was placed into 2.0 ml tubes containing 96% alcohol. Genomic DNA was isolated using Aqua Genomic DNA solution following the manufacturer’s protocol ^{7– 8} . DNA electrophoresis was carried out on a 0.8% agarose gel at 100V. The quality and quantity of extracted DNA was assessed using a spectrophotometer. A genomic region approximately 655 bp in size was amplified from the 5’ region of the Mitochondrial Cytochrome Oxidase Subunit I ( cox1) gene following the protocol from Ward et al. ⁹ with these primer pairs:

FishF1: 5’TCAACCAACCACAAAGACATTGGCAC3’

FishR1: 5’TAGACTTCTGGGTGGCCAAAGAATCA3’

After amplification, PCR products were run on 1.2% agarose gels at 100V. The clearest band was selected and purified using purification kits (PCR Clean-Up System, Promega), following the manufacturer's protocol. The purified products were run on 1.2% agarose gels at 100V to check for bands and only clear products were sent for sequencing to First BASE Laboratory Sdn Bhd in Kuala Lumpur, Malaysia. All obtained sequences were edited and aligned using MEGA 6.0 program ¹⁰ . Multiple sequence alignments were performed on the edited sequences with Cluster W, which is integrated into the MEGA 6.0 program. The sequences were then blasted into the NCBI database to compare and identify species. Nucleotide divergence among sequences was estimated for their genetic distance by Neighbour-Joining (NJ) based on Kimura 2 parameter. NJ was also used to construct phylogenetic trees to determine genetic relationships among haplotypes.

All procedures involving animals were conducted in compliance with The Syiah Kuala University Research and Ethics Guidelines, Section of Animal Care and Use in Research (Ethic Code No: 958/2015). Please refer to Supplementary File 1 for the completed ARRIVE guidelines checklist.

Genomic DNA from the 5’ region of the cox1 gene from a total of 13 glass eel samples and 31 adult eel samples were successfully amplified ( Table 1). The results from NCBI BLAST identified two species of eel from adult eel samples, shortfin eel A. bicolor bicolor and giant mottled eel A. marmorata. In addition, there were three species of eels that were recognized among the glass eel samples, namely A. bicolor bicolor, A. marmorata and Indian mottled eel A. bengalensis bengalensis. A total of 20 haplotypes, consisting of 3 haplotypes of the A. bengalensis bengalensis, 1 haplotype of the A. marmorata, 15 haplotypes of the A. bicolor bicolor and 1 haplotype of the Uroconger lepturus (out-group) were produced from 44 samples ( Table 2), out of 132 variable sites. and a haplotype diversity (Hd) of 0.8742. The haplotype number four belongs to A. marmorata and was shared by 9 samples from 4 different locations. The haplotype number 5 belongs to A. bicolor bicolor and was shared by 13 samples from 6 locations. All of the haplotype sequences have been deposited in the NCBI GenBank with accession numbers KY618767 to KY618795.

Therefore, the study revealed that there are three valid species of tropical eels found in Aceh waters: A. bicolor, A. marmorata, and A. bengalensis; the last species being a newly recorded species in Aceh waters. The study indicates that multiple species of glass eels migrate from the sea into freshwater. One interesting finding was that one sample of conger eels ( Uroconger lepturus) was detected among the Tropical glass eel samples. This is indicatory of DNA barcoding being successful in identifying species of eels in Aceh waters which cannot be identified by biometric data. Genetic data has become an important tool in assessing gene flow between marine populations ¹¹ , species identification ¹² and monitoring the resources of marine fisheries ¹³ .

The genetic divergence between A. bicolor and A. marmorata was 5.0%, between A. bicolor and A. bengalensis it was 6.7% and between A. marmorata and A. bengalensis genetic divergence was 4.0% ( Table 3). The phylogenetic tree showed a close relationship between A. marmorata and A. bengalensis ( Figure 1). Based on IUCN ¹⁴ data, A. bengalensis bengalensis and A. bicolor bicolor are categorized as near threatened, while the status of A. marmorata is on least concern. However, based on direct sampling in Aceh waters the shortfin eels are still abundant and most frequently caught, and are distributed over a wide range of areas including small streams, marshes, peat swamp, estuaries and irrigation channel in paddy fields ^{1, 15} . Indian mottled and giant mottled eels on the other hand have been very rarely caught and are generally only found in large rivers directly connected to the sea.

It is concluded that three species of tropical eels are found in Aceh waters, namely, A. marmorata, A. bicolor bicolor, and A. bengalensis bengalensis where A. bengalensis bengalensis is the newly recorded species.

The data referenced by this article are under copyright with the following copyright statement: Copyright: � 2017 Muchlisin ZA et al.

Data associated with the article are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication).

Sequenced DNA of Tropical eels from Aceh waters can be found in the NCBI GenBank repository ( https://www.ncbi.nlm.nih.gov/genbank/) with accession numbers KY618767 to KY618795.