<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.10138.2</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                    <subj-group>
                        <subject>Bioinformatics</subject>
                    </subj-group>
                    <subj-group>
                        <subject>Genitourinary Cancers</subject>
                    </subj-group>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>Mapping of microRNAs related to cervical cancer in Latin American human genomic variants</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 2; peer review: 2 approved]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Guerrero Fl&#x00f3;rez</surname>
                        <given-names>Milena</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-5094-6350</uri>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Guerrero G&#x00f3;mez</surname>
                        <given-names>Olivia Alexandra</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Mena Huertas</surname>
                        <given-names>Jaqueline</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Y&#x00e9;pez Chamorro</surname>
                        <given-names>Mar&#x00ed;a Clara</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-3482-5786</uri>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Department of Biology, Center for Health Studies at the University of Nari&#x00f1;o (CESUN), University of Nari&#x00f1;o, Pasto, Nari&#x00f1;o, Colombia</aff>
                <aff id="a2">
                    <label>2</label>Department of Biology, University of Nari&#x00f1;o, Pasto, Nari&#x00f1;o, Colombia</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:milenague@udenar.edu.co">milenague@udenar.edu.co</email>
                </corresp>
                <fn fn-type="con">
                    <p>MGF directed all the research and bioinformatics analysis, wrote the article and made the final edits. OAGG developed the methodology and bioinformatics analysis and edited the article. JMH co-advised the research, wrote the article and made the final edits, and MCYC wrote the article.</p>
                </fn>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>5</day>
                <month>12</month>
                <year>2018</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2017</year>
            </pub-date>
            <volume>6</volume>
            <elocation-id>946</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>5</day>
                    <month>9</month>
                    <year>2018</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2018 Guerrero Fl&#x00f3;rez M et al.</copyright-statement>
                <copyright-year>2018</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/6-946/pdf"/>
            <abstract>
                <p>
                    <bold>Background</bold>: MicroRNAs are related to human cancers, including cervical cancer (CC) caused by HPV. In 2018, approximately 56.075 cases and 28.252 deaths from this cancer were registered in Latin America and the Caribbean according to GLOBOCAN reports. The main molecular mechanism of HPV in CC is related to integration of viral DNA into the hosts&#x2019; genome. However, the different variants in the human genome can result in different integration mechanisms, specifically involving microRNAs (miRNAs).</p>
                <p>
                    <bold>Methods</bold>: The miRNAs associated with CC were obtained from literature, the miRNA sequences and four human genome variants (HGV) from Latin American populations were obtained from miRBase and 1000 Genomes Browser, respectively. HPV integration sites near cell cycle regulatory genes were identified. miRNAs were mapped on HGV. miRSNPs were identified in the miRNA sequences located at HPV integration sites on the Latin American HGV.</p>
                <p>
                    <bold>Results</bold>: Two hundred seventy-two miRNAs associated with CC were identified in 139 reports from different geographic locations. By mapping with Blast-Like Alignment Tool (BLAT), 2028 binding sites were identified from these miRNAs on the human genome (version GRCh38/hg38); 42 miRNAs were located on unique integration sites; and miR-5095, miR-548c-5p and miR-548d-5p were involved with multiple genes related to the cell cycle. Thirty-seven miRNAs were mapped on the Latin American HGV (PUR, MXL, CLM and PEL), but only miR-11-3p, miR-31-3p, miR-107, miR-133a-3p, miR-133a-5p, miR-133b, miR-215-5p, miR-491-3p, miR-548d-5p and miR-944 were conserved.</p>
                <p>
                    <bold>Conclusions</bold>: Ten miRNAs were conserved in the four HGV. In the remaining 27 miRNAs, substitutions, deletions or insertions were observed. These of variation patterns can imply differentiated mechanisms towards each genomic variant in human populations because of specific genomic patterns and geographic features. These findings may help in determining susceptibility for CC development. Further identification of cellular genes and signalling pathways involved in CC progression could lead new therapeutic strategies based on miRNAs.</p>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>cervical cancer</kwd>
                <kwd>HPV</kwd>
                <kwd>HPV integration sites</kwd>
                <kwd>microRNAs</kwd>
                <kwd>miRNAs</kwd>
                <kwd>secondary structure</kwd>
                <kwd>human genome variants</kwd>
                <kwd>bioinformatics tools</kwd>
            </kwd-group>
            <funding-group>
                <funding-statement>The author(s) declared that no grants were involved in supporting this work.</funding-statement>
            </funding-group>
        </article-meta>
        <notes>
            <sec sec-type="version-changes">
                <label>Revised</label>
                <title>Amendments from Version 1</title>
                <p>The version includes the following modifications: 
                    <list list-type="bullet">
                        <list-item>
                            <p>
                                <bold>Abstract</bold>: adjusted to 300 words. &#x00a0;</p>
                        </list-item>
                        <list-item>
                            <p>
                                <bold>Introduction</bold>: re-write some words.</p>
                        </list-item>
                        <list-item>
                            <p>
                                <bold>Methodology</bold>: More details and description about mapping.</p>
                        </list-item>
                        <list-item>
                            <p>
                                <bold>Results</bold>: Figure 7D, is represented in percentage. We include the statistical support about the random distribution of number of binding sites for miRNAs along to the human genome. The analysis for each chromosome was done.</p>
                        </list-item>
                        <list-item>
                            <p>And some minor revision on dataset, supplementary files, tables and figures as describe below: 
                                <list list-type="bullet">
                                    <list-item>
                                        <p>
                                            <bold>Dataset 2</bold>: checked the English as request by reviewer. Data sheet &#x201c;HPV integration sites&#x201d;- Column H1:569, Data sheet &#x201c;BLAT results&#x201d;, column A1. Data sheet &#x201c;Matrix&#x201d;- column B1. C1, D1. Datasheet &#x201c;Human Genomic Variants&#x201d;, column B1 and C1, C6. Datasheet &#x201c;miRNA_CCU, adjusted the title of row 1 and B2. All changes are highlighted in red. 
                                            <bold>&#x201c;Mapping with BLAT&#x201d; has replaced the previous &#x201c;BLAT result sheet</bold>. Checked the English in Column C2. All changes are highlighted in red.</p>
                                    </list-item>
                                    <list-item>
                                        <p>
                                            <bold>Supplementary file 1</bold>: adjusted the name in column D1.</p>
                                    </list-item>
                                    <list-item>
                                        <p>
                                            <bold>Table 1.</bold> Modified the title.</p>
                                    </list-item>
                                    <list-item>
                                        <p>
                                            <bold>Table 4.</bold> Adjusted the title</p>
                                    </list-item>
                                    <list-item>
                                        <p>
                                            <bold>Figure 6.</bold> Adjusted the title</p>
                                    </list-item>
                                    <list-item>
                                        <p>
                                            <bold>Figure 7.</bold> Modified the title, and 
                                            <bold>Figure 7D:</bold> Changed to "percentage" in X axis</p>
                                    </list-item>
                                </list> </p>
                        </list-item>
                    </list>
                </p>
            </sec>
        </notes>
    </front>
    <body>
        <sec sec-type="intro">
            <title>Introduction</title>
            <p>Cervical cancer (CC) is the second most common malignancy in women worldwide. According to GLOBOCAN reports, approximately 569.847 women are diagnosed with CC and 311.365 die from it each year
                <sup>
                    <xref ref-type="bibr" rid="ref-1">1</xref>
                </sup>. Infection by human papillomavirus (HPV) has been recognized as the major risk factor in this pathology
                <sup>
                    <xref ref-type="bibr" rid="ref-2">2</xref>,
                    <xref ref-type="bibr" rid="ref-3">3</xref>
                </sup>, but the virus presence is not the main cause for the development of this cancer
                <sup>
                    <xref ref-type="bibr" rid="ref-4">4</xref>,
                    <xref ref-type="bibr" rid="ref-5">5</xref>
                </sup>. Viral DNA integration into the host cell genome is considered a conducive factor for cervical intraepithelial neoplasia (CIN) to develop into CC
                <sup>
                    <xref ref-type="bibr" rid="ref-5">5</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-7">7</xref>
                </sup>.</p>
            <p>Numerous microRNAs (miRNAs) have been identified in proximity to HPV integration sites
                <sup>
                    <xref ref-type="bibr" rid="ref-8">8</xref>,
                    <xref ref-type="bibr" rid="ref-9">9</xref>
                </sup>. miRNAs are a class of small (18 to 26 nucleotides length), noncoding, evolutionarily conserved RNAs that are processed from longer transcripts known as pre-miRNAs (60 to 100 nucleotides in length)
                <sup>
                    <xref ref-type="bibr" rid="ref-10">10</xref>
                </sup>. They are located on regions known as fragile sites and distributed in intergenic, intronic and exonic segments of the human genome involved in cancer
                <sup>
                    <xref ref-type="bibr" rid="ref-11">11</xref>,
                    <xref ref-type="bibr" rid="ref-12">12</xref>
                </sup>. Functionally, miRNAs has been recognized to participate in multiple cellular processes, including development, morphogenesis and carcinogenesis due to they regulate post-transcriptional expression levels of up to 60% of total protein-encoding genes by binding their seed sequences (2&#x2013;8 nucleotides length). The 5'-UTR end of the miRNA seed sequence is complementary to the 3'-UTR end of the target mRNAs
                <sup>
                    <xref ref-type="bibr" rid="ref-13">13</xref>
                </sup>. This recognition event according to its length can affect the expression of important regulatory genes. Deregulation of genes such as tumour suppressor genes and oncogenes can lead to cancer development, including CC
                <sup>
                    <xref ref-type="bibr" rid="ref-14">14</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-16">16</xref>
                </sup>.</p>
            <p>Human genome variants generate different patterns of miRNA deregulation
                <sup>
                    <xref ref-type="bibr" rid="ref-17">17</xref>
                </sup>, which can contribute to cancer development susceptibility, treatment efficacy and patient prognosis
                <sup>
                    <xref ref-type="bibr" rid="ref-18">18</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-20">20</xref>
                </sup>. 99% of the human genome is genetically identical, and the remaining 1% is responsible for all human diversity. miRNAs represent a major part of this genetic variation
                <sup>
                    <xref ref-type="bibr" rid="ref-21">21</xref>
                </sup>. miRSNPs (single nucleotide polymorphisms in miRNAs) are human polymorphisms at or near predicted miRNA target sites
                <sup>
                    <xref ref-type="bibr" rid="ref-22">22</xref>
                </sup>. The occurrence of miRSNPs can influence miRNA functionality on all levels, including transcription, maturation, and mRNA target binding.</p>
            <p>Knowledge on miRNAs related to CC development in human genome variants from Latin American populations is scarce. Thus, in this study, we mapped miRNAs associated with CC in human genome variants obtained from Colombia, Mexico, Peru and Puerto Rico. Complete genomes were included in this study. Additionally, the relationships between HPV integration sites, genes close to these sites, mapping profiles and mutation patterns for each of the miRNAs were estimated for each of the genome sequences. The objective of this research was to analyse how genetic variation of CC-associated miRNAs identified in previously reported HPV integration sites affects cell cycle regulatory genes in human genomic variants from Latin America.</p>
        </sec>
        <sec sec-type="methods">
            <title>Methods</title>
            <sec>
                <title>miRNA sequences associated with cervical cancer</title>
                <p>Two hundred and seventy-two miRNAs associated with CC were selected as described in the systematic review published by Guerrero &amp; Guerrero
                    <sup>
                        <xref ref-type="bibr" rid="ref-23">23</xref>
                    </sup>. With the information contained in 
                    <ext-link ext-link-type="uri" xlink:href="http://www.mirbase.org/">miRBase</ext-link>
                    <sup>
                        <xref ref-type="bibr" rid="ref-24">24</xref>&#x2013;
                        <xref ref-type="bibr" rid="ref-26">26</xref>
                    </sup>, 
                    <ext-link ext-link-type="uri" xlink:href="http://mirnamap.mbc.nctu.edu.tw/">miRNAMap</ext-link>
                    <sup>
                        <xref ref-type="bibr" rid="ref-27">27</xref>
                    </sup> and 
                    <ext-link ext-link-type="uri" xlink:href="http://mirstart.mbc.nctu.edu.tw/about.php">miRNAstart</ext-link>, features such as length, chromosomal and genomic location of pre-miRNAs and mature miRNAs were analysed. The mature miRNA reference sequences were obtained in FASTA format from the miRBase database (
                    <xref ref-type="other" rid="DS0">Dataset 1</xref>
                    <sup>
                        <xref ref-type="bibr" rid="ref-28">28</xref>
                    </sup>).</p>
            </sec>
            <sec>
                <title>Latin American human genomic variants</title>
                <p>Four human genome sequences were obtained from randomly selected female participants in the 1000 Genomes Project from Latin American populations
                    <sup>
                        <xref ref-type="bibr" rid="ref-22">22</xref>,
                        <xref ref-type="bibr" rid="ref-29">29</xref>
                    </sup>. Their codes were CLM (from Medellin in Colombia), MXL (from Los Angeles and of Mexican ancestry in the USA), PEL (from Lima in Peru) and PUR (from Puerto Rico). The control sequence was a variant that is phylogenetically distant to Latin American variants and identified with the code BEB (from Bangladesh and of Bengali ancestry). Access codes were obtained from the 
                    <ext-link ext-link-type="uri" xlink:href="http://www.internationalgenome.org/">1000 Genomes Project resources</ext-link>
                    <sup>
                        <xref ref-type="bibr" rid="ref-21">21</xref>,
                        <xref ref-type="bibr" rid="ref-30">30</xref>
                    </sup>. This information is summarized in 
                    <xref ref-type="table" rid="T1">Table 1</xref>.</p>
                <table-wrap id="T1" orientation="portrait" position="anchor">
                    <label>Table 1. </label>
                    <caption>
                        <title>Accession numbers of the four Latin American human genome variants obtained from the NCBI 1000 genomes project.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="center" colspan="1" rowspan="1">TYPE
                                    <break/>SEQUENCE</th>
                                <th align="center" colspan="1" rowspan="1">NAME
                                    <break/>SEQUENCE</th>
                                <th align="center" colspan="1" rowspan="1">DATABASE</th>
                                <th align="center" colspan="1" rowspan="1">ACCESSION
                                    <break/>NUMBER</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="center" colspan="1" rowspan="5">Genomic
                                    <break/>sequence</td>
                                <td align="center" colspan="1" rowspan="1">CLM</td>
                                <td align="center" colspan="1" rowspan="5">NCBI 1000
                                    <break/>Genomes
                                    <break/>Project</td>
                                <td align="center" colspan="1" rowspan="1">HG01432</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">MXL</td>
                                <td align="center" colspan="1" rowspan="1">NA19749</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">PEL</td>
                                <td align="center" colspan="1" rowspan="1">HG01566</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">PUR</td>
                                <td align="center" colspan="1" rowspan="1">HG00554</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">BEB (Control)</td>
                                <td align="center" colspan="1" rowspan="1">HG03589</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
            </sec>
            <sec>
                <title>Selection, identification and analysis of HPV integration sites near cell cycle regulatory genes</title>
                <p>Viral insertion sites and nearby genes on the human genome were identified with the 
                    <ext-link ext-link-type="uri" xlink:href="https://genome.ucsc.edu/cgi-bin/hgTracks?db=hg38&amp;lastVirtModeType=default&amp;lastVirtModeExtraState=&amp;virtModeType=default&amp;virtMode=0&amp;nonVirtPosition=&amp;position=chr9%3A133252000-133280861&amp;hgsid=589057083_Tl5sBznDpiFetaAdeXlECtT5cAWx">UCSC Genome Bioinformatics</ext-link> search engine
                    <sup>
                        <xref ref-type="bibr" rid="ref-31">31</xref>,
                        <xref ref-type="bibr" rid="ref-32">32</xref>
                    </sup>. To select HPV integration sites, a literature search was conducted in three databases (
                    <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/pubmed/">PubMed</ext-link>, 
                    <ext-link ext-link-type="uri" xlink:href="http://www.sciencedirect.com/">Science Direct</ext-link> and 
                    <ext-link ext-link-type="uri" xlink:href="https://link.springer.com/">Springer link</ext-link>) using the terms: "HPV Integration sites AND Cervical Cancer". Positions of viral insertion sites and cellular genes close to these sites in the human genome were identified using the search engine tools available at 
                    <ext-link ext-link-type="uri" xlink:href="https://genome.ucsc.edu/cgi-bin/hgTracks?db=hg38&amp;lastVirtModeType=default&amp;lastVirtModeExtraState=&amp;virtModeType=default&amp;virtMode=0&amp;nonVirtPosition=&amp;position=chr1%3A11102837-11267747&amp;hgsid=627069371_kaTDR2Og2NpKgm73B7F5q8NOAIO7">UCSC Genome Browser on Human Dec. 2013 (GRCh38/hg38) Assembly</ext-link>: (a) search bar; (b) zoom in; (c) zoom out; (d) Mapping and Sequencing, chromosome band (
                    <italic toggle="yes">full</italic>); and (e) Genes and Gene Predictions, GENCODE v24 (
                    <italic toggle="yes">full</italic>) and NCBI RefSeq (
                    <italic toggle="yes">full</italic>)
                    <sup>
                        <xref ref-type="bibr" rid="ref-31">31</xref>
                    </sup>. To establish possible functional relationships with the development of CC, it was done by genes functional annotation described by 
                    <ext-link ext-link-type="uri" xlink:href="http://www.uniprot.org/">UniProt</ext-link>
                    <sup>
                        <xref ref-type="bibr" rid="ref-33">33</xref>,
                        <xref ref-type="bibr" rid="ref-34">34</xref>
                    </sup>.</p>
            </sec>
            <sec>
                <title>Mapping miRNAs and chromosomal locations on the human genome</title>
                <p>According to Xia 
                    <italic toggle="yes">et al.</italic>
                    <sup>
                        <xref ref-type="bibr" rid="ref-35">35</xref>
                    </sup>, the mature miRNA sequences are located in regions with pre-miRNA secondary structure complementarity (3' and 5'). In total, 445 miRNA sequences were analysed. The 
                    <ext-link ext-link-type="uri" xlink:href="https://genome.ucsc.edu/cgi-bin/hgBlat?command=start">Blast-Like Alignment Tool (BLAT)</ext-link> available on the UCSC Genome Bioinformatics website was used for mapping the miRNAs associated with the full human genome with the following default parameters: (a) genome, human; (b) assembly, Dec. 2013 (
                    <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/assembly/GCA_000001405.15/">GRCh38/hg38</ext-link>); (c) query type, DNA; (d) sort output, query; and (e) score and output, hyperlinks. A matrix of chromosomal location data was built with Microsoft Excel 2013 (&#x2018;Matrix of data&#x2019; in 
                    <xref ref-type="other" rid="DS1">Dataset 2</xref>
                    <sup>
                        <xref ref-type="bibr" rid="ref-36">36</xref>
                    </sup>). From this matrix, the miRNAs over HPV integration sites were manually identified.</p>
            </sec>
            <sec>
                <title>Identification of miRNAs in Latin American human genomic variants</title>
                <p>To identify miRNA mutations in the four Latin American human genome variants, the available tools, including ideogram view, subjects and exon navigator, in the 
                    <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/variation/tools/1000genomes/">NCBI 1000 Genomes Browser</ext-link> (Phase 3, version 3.7) were used. The code for each female genetic variant selection (Colombia, Mexico, Peru, Puerto Rico and Bangladesh) was inserted and the sequence of each miRNA identified in viral integration sites was introduced and the mapped nucleotide positions were selected. Using 
                    <ext-link ext-link-type="uri" xlink:href="http://weblogo.threeplusone.com/create.cgi">WebLogo 3</ext-link>
                    <sup>
                        <xref ref-type="bibr" rid="ref-37">37</xref>
                    </sup>, logos were created to view the nucleotide differences. The bioinformatics workflow is summarized in 
                    <xref ref-type="fig" rid="f1">Figure 1</xref>.</p>
                <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                    <label>Figure 1. </label>
                    <caption>
                        <title>Bioinformatic workflow for mapping of miRNAs related to CC on Latin American human genomic variants.</title>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/17592/5eca6d24-e2e1-45f3-8dcf-566ce79c47e3_figure1.gif"/>
                </fig>
                <supplementary-material id="DS0" orientation="portrait" position="float" xlink:href="https://f1000researchdata.s3.amazonaws.com/datasets/10138/53108f4c-1629-4a30-9d83-b20090996156_Dataset_1.csv">
                    <label>Dataset 1. The mature miRNA reference sequences were obtained in FASTA format from the miRBase database</label>
                    <caption>
                        <p>
                            <ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.5256/f1000research.10138.d164732">http://dx.doi.org/10.5256/f1000research.10138.d164732</ext-link>
                        </p>
                    </caption>
                </supplementary-material>
                <supplementary-material id="DS1" orientation="portrait" position="float" xlink:href="https://f1000researchdata.s3.amazonaws.com/datasets/10138/6c0d20bb-7923-4801-8b05-69a0ef114a6c_Dataset_2_new.xls">
                    <label>Dataset 2. Matrix of data containing all the necessary components for the validation of data on CC-associated miRNAs in HPV integration sites in Latin American human genomic variants</label>
                    <caption>
                        <p>
                            <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.5256/f1000research.10138.d217286">https://doi.org/10.5256/f1000research.10138.d217286</ext-link>
                        </p>
                    </caption>
                </supplementary-material>
            </sec>
        </sec>
        <sec sec-type="results">
            <title>Results</title>
            <sec>
                <title>HPV integration sites and chromosomal distribution</title>
                <p>A total of 44 publications were identified between 1987 and 2015 related to HPV integration sites in the human genome. The most frequent types of HPV associated with CC were HPV-16 and HPV-18. Details of these articles are outlined in 
                    <xref ref-type="other" rid="SF1">Supplementary File 1</xref>. Five hundred and sixty-eight integration sites for 8 types of HPV associated with different histological cervical conditions were identified, of which 63.84% were HPV-16 (
                    <xref ref-type="fig" rid="f2">Figure 2</xref> and &#x2018;HPV integration sites&#x2019; in 
                    <xref ref-type="other" rid="DS1">Dataset 2</xref>
                    <sup>
                        <xref ref-type="bibr" rid="ref-36">36</xref>
                    </sup>).</p>
                <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                    <label>Figure 2. </label>
                    <caption>
                        <title>Chromosomal distribution of integration sites of HPV types (HPV 16, 18, 31, 33, 45, 58, 67 and 68) most frequently reported in the literature.</title>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/17592/5eca6d24-e2e1-45f3-8dcf-566ce79c47e3_figure2.gif"/>
                </fig>
                <p>HPV-16 and HPV-18 have integration sites on all human chromosomes. HPV-16 has more integration sites on chromosomes 2, 1, 3, 6, 9, 5, 8 and 4, while HPV-18 has more on chromosomes 2, 1, 8, 12, 5, 10, 4, 6 and 9. Some less frequently oncogenic HPV types have integration sites on specific chromosomes, such as HPV-45 on 2, 1, 3, 9, 4, 7 and 13; HPV-33 on 9, 13, 5, 6, 8, 11, 16, 18 and X; HPV-58 on 4, 12 and 18; HPV-31 on 2 and 17; HPV-67 on 4 and 13; and HPV-68 on chromosome 18. Chromosomes 1 and 2 displayed a higher number of viral insertion sites (41 and 45, respectively), while chromosomes 13 and 18 displayed insertion sites for 5 different HPV genotypes. The chromosomal loci with the highest numbers of HPV integration sites are presented in 
                    <xref ref-type="table" rid="T2">Table 2</xref>.</p>
                <table-wrap id="T2" orientation="portrait" position="anchor">
                    <label>Table 2. </label>
                    <caption>
                        <title>Chromosomal loci with the highest numbers of HPV integration sites
                            <sup>
                                <xref ref-type="other" rid="tfn1">1</xref>
                            </sup>.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="center" colspan="1" rowspan="1">CHROMOSOMAL LOCUS</th>
                                <th align="center" colspan="1" rowspan="1">HPV INTEGRATION SITES</th>
                                <th align="center" colspan="1" rowspan="1">HPV TYPES</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">8q24.21</td>
                                <td align="center" colspan="1" rowspan="1">23</td>
                                <td align="center" colspan="1" rowspan="1">16,18,45</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">3q28 y 13q22.1</td>
                                <td align="center" colspan="1" rowspan="1">9</td>
                                <td align="center" colspan="1" rowspan="1">16,18,45</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">4q13.3</td>
                                <td align="center" colspan="1" rowspan="1">7</td>
                                <td align="center" colspan="1" rowspan="1">16,45</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">2q34</td>
                                <td align="center" colspan="1" rowspan="1">6</td>
                                <td align="center" colspan="1" rowspan="1">16,18</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">2q22.3 y 20p12.1</td>
                                <td align="center" colspan="1" rowspan="1">5</td>
                                <td align="center" colspan="1" rowspan="1">16,18</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">13q21 y 17q12</td>
                                <td align="center" colspan="1" rowspan="1">5</td>
                                <td align="center" colspan="1" rowspan="1">16</td>
                            </tr>
                        </tbody>
                    </table>
                    <table-wrap-foot>
                        <fn>
                            <p id="tfn1">
                                <sup>1</sup>Chromosomal bands that have more than 5 HPV integration sites.</p>
                        </fn>
                    </table-wrap-foot>
                </table-wrap>
            </sec>
            <sec>
                <title>Analysis of HPV integration sites near cell cycle regulatory genes</title>
                <p>Information on the associated functions of genes located near HPV integration sites obtained from UniProt showed that 86.1% of the genes located in close proximity were involved in apoptosis, cell adhesion, cell differentiation, ion transport and metabolic processes. Fifty-four genes were involved in direct regulation of the cell cycle. Twenty-six of these were tumour suppressor genes, 8 were oncogenes, 8 were proto-oncogenes and 13 did not have a determined functionality in the development of this neoplasia (
                    <xref ref-type="fig" rid="f3">Figure 3</xref>).</p>
                <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                    <label>Figure 3. </label>
                    <caption>
                        <title>Functional classification of cellular genes in HPV integration sites (GRCC: cell cycle regulatory genes).</title>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/17592/5eca6d24-e2e1-45f3-8dcf-566ce79c47e3_figure3.gif"/>
                </fig>
            </sec>
            <sec>
                <title>Mapping miRNAs associated with cervical cancer</title>
                <p>The 2028 miRNA binding sites associated with CC in the human genome were identified from BLAT mapping using previously identified miRNAs
                    <sup>
                        <xref ref-type="bibr" rid="ref-23">23</xref>
                    </sup>, including 432 sites previously reported in miRBase (&#x2018;Results of mapping with BLAT&#x2019; in 
                    <xref ref-type="other" rid="DS1">Dataset 2</xref>
                    <sup>
                        <xref ref-type="bibr" rid="ref-36">36</xref>
                    </sup>). These sites were located on both DNA strands (52.97% on the positive strand and 47.03% on the negative strand). 1881 binding sites were fully complementary (100% sequence identity) to miRNA sequences, while 1, 24, and 122 binding sites had 96.2%, 95.7% and 95.5% sequence identity, respectively.</p>
                <p>miR-5095 was mapped onto 853 binding sites on 23 chromosomes. Four hundred and twenty-four mature miRNAs sequences (98.15%) mapped to one, two, three and even ten different binding sites. miR-522-5p and miR-523-5p binding sites mapped only a single chromosome (Chr. 19). 
                    <xref ref-type="table" rid="T3">Table 3</xref> shows the chromosomal location and number of binding sites for each specific miRNA associated with CC.</p>
                <table-wrap id="T3" orientation="portrait" position="anchor">
                    <label>Table 3. </label>
                    <caption>
                        <title>Chromosomal location and frequency of miRNA binding sites associated with CC
                            <sup>
                                <xref ref-type="other" rid="tfn2">1</xref>
                            </sup>.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="center" colspan="1" rowspan="1">miRNA ASSOCIATED WITH CC</th>
                                <th align="center" colspan="1" rowspan="1">miRNAs BINDING SITES</th>
                                <th align="center" colspan="1" rowspan="1">CHROMOSOMAL
                                    <break/>LOCATION</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">hsa-miR-5095</td>
                                <td align="center" colspan="1" rowspan="1">853</td>
                                <td align="center" colspan="1" rowspan="1">All chromosome </td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">hsa-miR-548c-5p</td>
                                <td align="center" colspan="1" rowspan="1">194</td>
                                <td align="center" colspan="1" rowspan="1">All, except 9</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">hsa-miR-548d-5p</td>
                                <td align="center" colspan="1" rowspan="1">188</td>
                                <td align="center" colspan="1" rowspan="1">All, except X, Y</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">hsa-miR-548b-5p</td>
                                <td align="center" colspan="1" rowspan="1">87</td>
                                <td align="center" colspan="1" rowspan="1">All, except 3, 4, 5, 6, X, Y </td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">hsa-miR-574-5p</td>
                                <td align="center" colspan="1" rowspan="1">62</td>
                                <td align="center" colspan="1" rowspan="1">All, except 16, 21, Y</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">hsa-miR-576-3p</td>
                                <td align="center" colspan="1" rowspan="1">15</td>
                                <td align="center" colspan="1" rowspan="1">4, 5, 8, 9, 12, 13, 15, 18, 22, X</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">hsa-miR-548c-3p</td>
                                <td align="center" colspan="1" rowspan="1">13</td>
                                <td align="center" colspan="1" rowspan="1">2, 4, 5, 7, 8, 13, 14, X, Y</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">hsa-miR-1273g-5p</td>
                                <td align="center" colspan="1" rowspan="1">11</td>
                                <td align="center" colspan="1" rowspan="1">1, 3, 7, 9, 10, 11, 13, 14, 15</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">hsa-miR-95-5p</td>
                                <td align="center" colspan="1" rowspan="1">10</td>
                                <td align="center" colspan="1" rowspan="1">1, 2, 4, 6, 7, 13, X</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">hsa-miR-1244</td>
                                <td align="center" colspan="1" rowspan="1">9</td>
                                <td align="center" colspan="1" rowspan="1">2, 3, 5, 7, 12, 13, 14, 20</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">hsa-miR-545-3p</td>
                                <td align="center" colspan="1" rowspan="1">8</td>
                                <td align="center" colspan="1" rowspan="1">3, 5, 7, 10, 12, X</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">hsa-miR-378a-3p</td>
                                <td align="center" colspan="1" rowspan="1">7</td>
                                <td align="center" colspan="1" rowspan="1">3, 5, 10, 11, 14, 17, 18</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">hsa-miR-522-5p, -523-5p</td>
                                <td align="center" colspan="1" rowspan="1">7</td>
                                <td align="center" colspan="1" rowspan="1">19</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">hsa-miR-518f-5p</td>
                                <td align="center" colspan="1" rowspan="1">6</td>
                                <td align="center" colspan="1" rowspan="1">5, 19</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">hsa-miR-545-5p</td>
                                <td align="center" colspan="1" rowspan="1">6</td>
                                <td align="center" colspan="1" rowspan="1">2, 3, 5, 14, 17, X</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">hsa-miR-151a-5p</td>
                                <td align="center" colspan="1" rowspan="1">5</td>
                                <td align="center" colspan="1" rowspan="1">1, 4, 8, 19, X</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">hsa-miR-339-5p</td>
                                <td align="center" colspan="1" rowspan="1">5</td>
                                <td align="center" colspan="1" rowspan="1">5, 7, 20, 22</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">hsa-miR-603</td>
                                <td align="center" colspan="1" rowspan="1">4</td>
                                <td align="center" colspan="1" rowspan="1">10, 13, 14, 16</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">hsa-miR-7-5p</td>
                                <td align="center" colspan="1" rowspan="1">4</td>
                                <td align="center" colspan="1" rowspan="1">9, 10, 15, 19</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">hsa-miR-584-5p</td>
                                <td align="center" colspan="1" rowspan="1">4</td>
                                <td align="center" colspan="1" rowspan="1">4, 5, 9, 19</td>
                            </tr>
                        </tbody>
                    </table>
                    <table-wrap-foot>
                        <fn>
                            <p id="tfn2">
                                <sup>1</sup>miRNAs associated with CC mapped more than 4 positions.</p>
                        </fn>
                    </table-wrap-foot>
                </table-wrap>
                <p>The distribution of the 2028 binding sites was not homogeneous along the human genome. 41% of the total binding sites were identified on chromosomes 1, 19, 5, 2, 3, 14, 7 and X. Although the number of miRNA binding sites correlated with the size of each chromosome, some short chromosomes, such as 19 and X, had more miRNA binding sites when compared to other larger chromosomes (
                    <xref ref-type="table" rid="T4">Table 4</xref>).</p>
                <table-wrap id="T4" orientation="portrait" position="anchor">
                    <label>Table 4. </label>
                    <caption>
                        <title>Chromosomal distribution of binding sites identified in miRNAs associated with CC.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="center" colspan="1" rowspan="1">CHR.
                                    <sup>
                                        <xref ref-type="other" rid="tfn3">1</xref>
                                    </sup>
                                </th>
                                <th align="center" colspan="1" rowspan="1">NUMBER OF miRNAs
                                    <break/>BINDING SITES</th>
                                <th align="center" colspan="1" rowspan="1">(%)</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">
                                    <bold>1</bold>
                                </td>
                                <td align="center" colspan="1" rowspan="1">175</td>
                                <td align="center" colspan="1" rowspan="1">8,63</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">
                                    <bold>2</bold>
                                </td>
                                <td align="center" colspan="1" rowspan="1">108</td>
                                <td align="center" colspan="1" rowspan="1">5,33</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">
                                    <bold>3</bold>
                                </td>
                                <td align="center" colspan="1" rowspan="1">106</td>
                                <td align="center" colspan="1" rowspan="1">5,23</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">
                                    <bold>4</bold>
                                </td>
                                <td align="center" colspan="1" rowspan="1">89</td>
                                <td align="center" colspan="1" rowspan="1">4,39</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">
                                    <bold>5</bold>
                                </td>
                                <td align="center" colspan="1" rowspan="1">111</td>
                                <td align="center" colspan="1" rowspan="1">5,47</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">
                                    <bold>6</bold>
                                </td>
                                <td align="center" colspan="1" rowspan="1">87</td>
                                <td align="center" colspan="1" rowspan="1">4,29</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">
                                    <bold>7</bold>
                                </td>
                                <td align="center" colspan="1" rowspan="1">103</td>
                                <td align="center" colspan="1" rowspan="1">5,08</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">
                                    <bold>8</bold>
                                </td>
                                <td align="center" colspan="1" rowspan="1">81</td>
                                <td align="center" colspan="1" rowspan="1">3,99</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">
                                    <bold>9</bold>
                                </td>
                                <td align="center" colspan="1" rowspan="1">79</td>
                                <td align="center" colspan="1" rowspan="1">3,90</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">
                                    <bold>10</bold>
                                </td>
                                <td align="center" colspan="1" rowspan="1">92</td>
                                <td align="center" colspan="1" rowspan="1">4,54</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">
                                    <bold>11</bold>
                                </td>
                                <td align="center" colspan="1" rowspan="1">93</td>
                                <td align="center" colspan="1" rowspan="1">4,59</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">
                                    <bold>12</bold>
                                </td>
                                <td align="center" colspan="1" rowspan="1">93</td>
                                <td align="center" colspan="1" rowspan="1">4,59</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">13</td>
                                <td align="center" colspan="1" rowspan="1">71</td>
                                <td align="center" colspan="1" rowspan="1">3,50</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">14</td>
                                <td align="center" colspan="1" rowspan="1">106</td>
                                <td align="center" colspan="1" rowspan="1">5,23</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">15</td>
                                <td align="center" colspan="1" rowspan="1">66</td>
                                <td align="center" colspan="1" rowspan="1">3,25</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">81</td>
                                <td align="center" colspan="1" rowspan="1">3,99</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">17</td>
                                <td align="center" colspan="1" rowspan="1">94</td>
                                <td align="center" colspan="1" rowspan="1">4,64</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">18</td>
                                <td align="center" colspan="1" rowspan="1">57</td>
                                <td align="center" colspan="1" rowspan="1">2,81</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">19</td>
                                <td align="center" colspan="1" rowspan="1">131</td>
                                <td align="center" colspan="1" rowspan="1">6,46</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">20</td>
                                <td align="center" colspan="1" rowspan="1">42</td>
                                <td align="center" colspan="1" rowspan="1">2,07</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">21</td>
                                <td align="center" colspan="1" rowspan="1">27</td>
                                <td align="center" colspan="1" rowspan="1">1,33</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">22</td>
                                <td align="center" colspan="1" rowspan="1">29</td>
                                <td align="center" colspan="1" rowspan="1">1,43</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">X</td>
                                <td align="center" colspan="1" rowspan="1">100</td>
                                <td align="center" colspan="1" rowspan="1">4,93</td>
                            </tr>
                        </tbody>
                    </table>
                    <table-wrap-foot>
                        <fn>
                            <p id="tfn3">
                                <sup>1</sup>
                                <bold>CHR</bold>= Chromosome.</p>
                        </fn>
                    </table-wrap-foot>
                </table-wrap>
                <p>14.89% (302) of binding sites grouped into the following 19 specific chromosomal locations: (1) 19q13.42 (51 sites/14 miRNAs), (2) 14q32.31 (34 sites/16 miRNAs), (3) 13q31.3 (16 sites/11 miRNAs), (4) 14q32.2 (16 sites/9 miRNAs), (5) 4q25 (16 sites/7 miRNAs), (6) 20q13.33 (15 sites/7 miRNAs), (7) 16p13.3 (15 sites/4 miRNAs), (8) Xq26.2 (14 sites/8 miRNAs), (9) 7q22.1 (14 sites/6 miRNAs) and (10) 1p31.3 (14 sites/6 miRNAs). The remaining 9 chromosomal locations contained between 10 and 13 binding sites (
                    <xref ref-type="other" rid="SF2">Supplementary File 2</xref>). 92% (1865/2028) of the binding sites were distributed into 250 groups along the human genome; the remaining 8% (163/2028) of binding sites for various miRNAs including miR-5095 were distributed along the human genome without being distributed into any groups.</p>
                <p>Each group contains between 2 and 7 miRNA binding sites, although some groups contain between 8 and 16 (
                    <xref ref-type="fig" rid="f4">Figure 4</xref>). The majority of the groups are located on chromosomes 1, 2, 3, 5, 10 and 11. The biggest groups are located on chromosome 19, with 51 binding sites for 25 miRNAs involved in CC development.</p>
                <fig fig-type="figure" id="f4" orientation="portrait" position="float">
                    <label>Figure 4. </label>
                    <caption>
                        <title>Chromosomic distribution of groups identified binding sites of miRNAs.</title>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/17592/5eca6d24-e2e1-45f3-8dcf-566ce79c47e3_figure4.gif"/>
                </fig>
                <p>58.8% of miRNA binding sites associated with CC (1194 binding sites) are located in intergenic regions, 39.65% (804 binding sites) in intronic regions, 1.28% (26 binding sites) in exonic regions and 0.19% (4 binding sites) between intronic and exonic regions (mixed miRNAs). 
                    <xref ref-type="fig" rid="f5">Figure 5</xref> shows the variation in the number of intergenic, exonic and intronic miRNAs associated with CC.</p>
                <fig fig-type="figure" id="f5" orientation="portrait" position="float">
                    <label>Figure 5. </label>
                    <caption>
                        <title>Numeric variation of miRNAs associated with the development of CC in different genomic locations (intergenic, intronic and exonic) per chromosome.</title>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/17592/5eca6d24-e2e1-45f3-8dcf-566ce79c47e3_figure5.gif"/>
                </fig>
            </sec>
            <sec>
                <title>miRNA identification in selected HPV integration sites</title>
                <p>Thirty-eight integration sites were found for six types of oncogenic HPV (HPV-16, -18, -33, -45, -58 and -68) in miRNA binding sites and cell cycle regulatory genes associated with CC (
                    <xref ref-type="table" rid="T5">Table 5</xref>). The largest number of HPV integration sites was found for miR-5095 (33 sites), followed by miR-548c-5p (11 sites) and miR-548d-5p (11 sites) (
                    <xref ref-type="table" rid="T5">Table 5</xref>). In 14 integration sites, no miRNA binding sites were detected. The highest number of miRNA binding sites was found in chromosome regions 18q11.2 and 19p13.12 (
                    <xref ref-type="other" rid="SF2">Supplementary File 2</xref>).</p>
                <table-wrap id="T5" orientation="portrait" position="anchor">
                    <label>Table 5. </label>
                    <caption>
                        <title>miRNAs in HPV integration sites and their correlation with cell cycle regulatory genes.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="center" colspan="1" rowspan="1">HPV
                                    <break/>TYPES</th>
                                <th align="center" colspan="1" rowspan="1">HPV INTEGRATION
                                    <break/>SITES</th>
                                <th align="center" colspan="1" rowspan="1">miRNAs PRESENT AT HPV
                                    <break/>INTEGRATION SITES
                                    <sup>
                                        <xref ref-type="other" rid="tfn4">1</xref>
                                    </sup>
                                </th>
                                <th align="center" colspan="1" rowspan="1">CELLULAR
                                    <break/>GENES
                                    <sup>
                                        <xref ref-type="other" rid="tfn5">2</xref>
                                    </sup>
                                </th>
                                <th align="center" colspan="1" rowspan="1">CL.
                                    <sup>
                                        <xref ref-type="other" rid="tfn6">3</xref>
                                    </sup>
                                </th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">18</td>
                                <td align="center" colspan="1" rowspan="1">1p22.2</td>
                                <td align="center" colspan="1" rowspan="1">miR-548c-5p (-)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">CDC7</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">--</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">18</td>
                                <td align="center" colspan="1" rowspan="1">1p31.2</td>
                                <td align="center" colspan="1" rowspan="1">-</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">GADD45A</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">ST</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">1p34.1</td>
                                <td align="center" colspan="1" rowspan="1">-</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">PLK3</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">--</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">1p34.3</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (3; -,-,+), -548b-5p (-),
                                    <break/>-548c-5p (2, -,-), -548d-5p (-)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">CDCA8</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">OG</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">1q25</td>
                                <td align="center" colspan="1" rowspan="1">-</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">TPR</italic> (-)</td>
                                <td align="center" colspan="1" rowspan="1">--</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">1q36.32</td>
                                <td align="center" colspan="1" rowspan="1">-</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">TP73</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">ST</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16,18</td>
                                <td align="center" colspan="1" rowspan="1">1q41</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (2,+,+), -194-5p (-), -215-3p (-),
                                    <break/>-215-5p (-), -548b-5p (-)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">PROX1</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">ST</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">18</td>
                                <td align="center" colspan="1" rowspan="1">2p15</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (-)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">XPO1</italic> (-)</td>
                                <td align="center" colspan="1" rowspan="1">ST</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="2">16</td>
                                <td align="center" colspan="1" rowspan="2">2q33.1</td>
                                <td align="center" colspan="1" rowspan="2">miR-152-5p(-), -548d-5p(-)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">ORC2</italic> (-)</td>
                                <td align="center" colspan="1" rowspan="1">--</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">BZW1</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">--</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">2q33.3</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (+)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">PARD3B</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">ST</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">2q34</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (-)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">BARD1</italic> (-)</td>
                                <td align="center" colspan="1" rowspan="1">ST</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">3p21.31</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (3;-,+,+), -191-3p (-), -191-5p (-),
                                    <break/>-425-3p (-),  -425-5p (-)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">MAP4</italic> (-)</td>
                                <td align="center" colspan="1" rowspan="1">--</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">3q26.33</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (2; -,+)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">SOX2</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">OG</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="2">16</td>
                                <td align="center" colspan="1" rowspan="2">3q28</td>
                                <td align="center" colspan="1" rowspan="2">miR-5095 (-), -944 (+), -28-3p (+),
                                    <break/> -28-5p (+)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">P3H2</italic> (-)</td>
                                <td align="center" colspan="1" rowspan="1">ST</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">TP63</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">ST</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16, 45</td>
                                <td align="center" colspan="1" rowspan="1">4q13.3</td>
                                <td align="center" colspan="1" rowspan="1">-</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">CXCL8</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">PO</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">4q23</td>
                                <td align="center" colspan="1" rowspan="1">-</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">EIF4E</italic> (-)</td>
                                <td align="center" colspan="1" rowspan="1">OG</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">4q31.21</td>
                                <td align="center" colspan="1" rowspan="1">miR-548c-5p (+)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">FBXW7</italic> (-)</td>
                                <td align="center" colspan="1" rowspan="1">ST</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">5q11.2</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (3; -,-,+), -449a (-), -449b-3p (-),
                                    <break/>-449b-5p (-), -548c-3p (+), -548d-5p (+),
                                    <break/>-581 (-)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">MAP3K1</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">ST</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">5q31.1</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (-)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">PPP2CA</italic> (-)</td>
                                <td align="center" colspan="1" rowspan="1">ST</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">6p21.31</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (+)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">BAK1</italic> (-)</td>
                                <td align="center" colspan="1" rowspan="1">ST</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">6p22.3</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (4; -,-,+,+), -548c-5p (+),
                                    <break/>-548d-5p (2; +,+)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">ID4</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">ST</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">6q22.32</td>
                                <td align="center" colspan="1" rowspan="1">-</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">CENPW</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">--</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">6q23.3</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (3; -,+,+)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">CITED2</italic> (-)</td>
                                <td align="center" colspan="1" rowspan="1">ST</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">7p21.1</td>
                                <td align="center" colspan="1" rowspan="1">-</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">AHR</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">ST</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">18</td>
                                <td align="center" colspan="1" rowspan="1">7q36.2</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (-)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">RHEB</italic> (-)</td>
                                <td align="center" colspan="1" rowspan="1">PO</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">18</td>
                                <td align="center" colspan="1" rowspan="1">8q21.2</td>
                                <td align="center" colspan="1" rowspan="1">-</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">E2F5</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">--</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16, 18</td>
                                <td align="center" colspan="1" rowspan="1">8q21.3</td>
                                <td align="center" colspan="1" rowspan="1">-</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">NBN</italic> (-)</td>
                                <td align="center" colspan="1" rowspan="1">ST</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16, 18, 45</td>
                                <td align="center" colspan="1" rowspan="1">8q24.21</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (-), -548d-5p (-)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">MYC</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">PO</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">8q24.21</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (-), -548d-5p (-)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">PVT1</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">OG</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">18</td>
                                <td align="center" colspan="1" rowspan="1">9p21.3</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (+), -31-3p (-), -31-5p (-),
                                    <break/>-491-3p (+), -491-5p (+)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">CDKN2A</italic> (-)</td>
                                <td align="center" colspan="1" rowspan="1">ST</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">9q22.2</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (+), -576-3p (2; +,+)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">CKS2</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">OG</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16, 18</td>
                                <td align="center" colspan="1" rowspan="1">10q23.31</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (-), -107 (-), -103a-3p (-),
                                    <break/>-548b-5p (2; -,-),  -548d-5p (2; -,-)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">PTEN</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">ST</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">10q24.2</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (-), -1287-5p (-)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">MARVELD1</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">ST</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="2">16</td>
                                <td align="center" colspan="1" rowspan="2">12q14.3</td>
                                <td align="center" colspan="1" rowspan="2">miR-574-5p (-)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">CDK4</italic> (-)</td>
                                <td align="center" colspan="1" rowspan="1">OG</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">MDM2</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">OG</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">18</td>
                                <td align="center" colspan="1" rowspan="1">12q15</td>
                                <td align="center" colspan="1" rowspan="1">-</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">HMGA2</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">PO</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">58</td>
                                <td align="center" colspan="1" rowspan="1">12q24.33</td>
                                <td align="center" colspan="1" rowspan="1">-</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">ZNF268</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">ST</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">18</td>
                                <td align="center" colspan="1" rowspan="1">14q11.2</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (+), -548c-3p (+), -574-5p (+)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">HAUS4</italic> (-)</td>
                                <td align="center" colspan="1" rowspan="1">--</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">18, 45</td>
                                <td align="center" colspan="1" rowspan="1">14q24.1</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (2, -,+), -548c-5p (+)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">RAD51B</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">ST</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">18</td>
                                <td align="center" colspan="1" rowspan="1">15q21.3</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (2; -,+), -574-5p (-)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">CCNB2</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">PO</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">16p13.3</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (12; (7 -, 5+,)), -548c-5p (+),
                                    <break/>-572 (-), -940 (+)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">TSC2</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">ST</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">17q21.31</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (3; -,+,+)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">BRCA1</italic> (-)</td>
                                <td align="center" colspan="1" rowspan="1">ST</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">33</td>
                                <td align="center" colspan="1" rowspan="1">18q11.2</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (-), -1-3p (-), -133a-3p,
                                    <break/>-133a-5p (-), -133b, -378a-3p (+),
                                    <break/>-548b-5p (-), -548d-5p (-)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">TTC39C</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">--</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">68</td>
                                <td align="center" colspan="1" rowspan="1">18q21.1</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (3; -,+,+), -548c-5p (+),
                                    <break/>-548d-5p (+), -574-5p(+)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">ZBTB7C</italic> (-)</td>
                                <td align="center" colspan="1" rowspan="1">ST</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">18</td>
                                <td align="center" colspan="1" rowspan="1">18q21.33</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (-), -548b-5p (+),
                                    <break/>-548c-5p (-), -548d-5p (+)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">BCL2</italic> (-)</td>
                                <td align="center" colspan="1" rowspan="1">PO</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">19p13.12</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (-), -23a-3p (-), -23a-5p (-),
                                    <break/>-27a-3p (-), -27a-5p (-), -181c-3p (+),
                                    <break/>-181c-5p (+), -584-5p (+)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">NANOS3</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">--</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">20q11.21</td>
                                <td align="center" colspan="1" rowspan="1">-</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">TPX2</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">ST</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">20q13.2</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (-)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">SRC</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">PO</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">21q22.13</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095(+), -548d-5p (-)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">DYRK1A</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">--</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">22q12.1</td>
                                <td align="center" colspan="1" rowspan="1">miR-548c-5p (+)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">CHEK2</italic> (-)</td>
                                <td align="center" colspan="1" rowspan="1">ST</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16, 18, 45</td>
                                <td align="center" colspan="1" rowspan="1">22q13.1</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (2, -,-)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">MCM5</italic> (+)</td>
                                <td align="center" colspan="1" rowspan="1">PO</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">16</td>
                                <td align="center" colspan="1" rowspan="1">Xq25</td>
                                <td align="center" colspan="1" rowspan="1">miR-5095 (-), -574-5p (-)</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <italic toggle="yes">DCAF12L2</italic> (-)</td>
                                <td align="center" colspan="1" rowspan="1">OG</td>
                            </tr>
                        </tbody>
                    </table>
                    <table-wrap-foot>
                        <fn>
                            <p id="tfn4">
                                <sup>1</sup>In parentheses, the number of binding sites of miRNAs and DNA chain where miRNAs are located.</p>
                            <p id="tfn5">
                                <sup>2</sup>In parentheses DNA chain where the cell cycle regulatory genes are located.</p>
                            <p id="tfn6">
                                <sup>3</sup>Cl: Classification of cellular genes; ST: tumor suppressors; OG: Oncogenes; PO: Proto-oncogenes.</p>
                        </fn>
                    </table-wrap-foot>
                </table-wrap>
                <p>Ninety-six possible interactions were identified between 37 mature miRNAs associated with CC and 42 cell cycle regulatory genes located in proximity to the viral insertion sites. The network of interactions is presented in 
                    <xref ref-type="fig" rid="f6">Figure 6</xref>. 35.42% of the interactions involved miR-5095, 12.5% involved miR-548c-5p and 12.5% miR-548d-5p.</p>
                <fig fig-type="figure" id="f6" orientation="portrait" position="float">
                    <label>Figure 6. </label>
                    <caption>
                        <title>Possible network of interactions between miRNAs associated with development of CC and cell cycle regulatory genes present at HPV integration sites.</title>
                        <p>The cell cycle regulatory genes in rectangles of various colors are presented, depends on their classification (ST - 
                            <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/17592/5eca6d24-e2e1-45f3-8dcf-566ce79c47e3_f6.gif"/>, OG - 
                            <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/17592/5eca6d24-e2e1-45f3-8dcf-566ce79c47e3_f7.gif"/>, POG - 
                            <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/17592/5eca6d24-e2e1-45f3-8dcf-566ce79c47e3_f8.gif"/> e IND - 
                            <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/17592/5eca6d24-e2e1-45f3-8dcf-566ce79c47e3_f9.gif"/>). The arrows represent the interactions between miRNAs and genes involved in cell cycle regulation, dates color depends on the DNA chain where miRNAs and cell cycle regulatory genes are located.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/17592/5eca6d24-e2e1-45f3-8dcf-566ce79c47e3_figure6.gif"/>
                </fig>
                <p>38.1% of genes identified in HPV integration sites have binding sites for a single miRNA, and 61.9% have binding sites for more than two miRNAs. 
                    <xref ref-type="table" rid="T6">Table 6</xref> displays genes with more than five miRNA binding sites.</p>
                <table-wrap id="T6" orientation="portrait" position="anchor">
                    <label>Table 6. </label>
                    <caption>
                        <title>Gene associated a more five binding sites of miRNAs.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="center" colspan="1" rowspan="1">NUMBER OF miRNA
                                    <break/>BINDING SITES</th>
                                <th align="center" colspan="1" rowspan="1">miRNAs</th>
                                <th align="center" colspan="1" rowspan="1">GENE</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="center" colspan="1" rowspan="2">5 sites</td>
                                <td align="center" colspan="1" rowspan="1">miR-103a-3p, -107, -548b-5p, -548d-5p and -5095</td>
                                <td align="center" colspan="1" rowspan="1">

                                    <italic toggle="yes">PTEN</italic>
</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">miR-194-5p, -215-3p, -215-5p, -548b-5p and -5095</td>
                                <td align="center" colspan="1" rowspan="1">

                                    <italic toggle="yes">PROX1</italic>
</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">7 sites</td>
                                <td align="center" colspan="1" rowspan="1">miR-449a, -449b-3p, -449b-5p, -548c-3p, -548d-5p, -581 and -5095</td>
                                <td align="center" colspan="1" rowspan="1">MAP3K1</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="2">8 sites</td>
                                <td align="center" colspan="1" rowspan="1">miR-1-3p, -133a-3p, -133a-5p, -133b, -378a-3p, -548b-5p, -548d-5p and -5095</td>
                                <td align="center" colspan="1" rowspan="1">

                                    <italic toggle="yes">TTC39C</italic>
</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">miR-23a-3p, -23a-5p, -27a-3p, -27a-5p, -181c-3p, -181c-5p, -584-5p and -5095</td>
                                <td align="center" colspan="1" rowspan="1">

                                    <italic toggle="yes">NANOS3</italic>
</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <p>A gene may have binding sites for both regions of complementarity (3' and 5') of a miRNA
                    <sup>
                        <xref ref-type="bibr" rid="ref-38">38</xref>
                    </sup>. In this study, we found that the TTC39C gene has binding sites for miR-133a-3p and miR-133a-5p and MAP3K1 has binding sites for miR-449b-3p and miR-449b-5p, though some mature sequences from one miRNA also showed binding sites to different genes (
                    <xref ref-type="fig" rid="f6">Figure 6</xref>). As an example, the miR-548c-3p mature chain has binding sites in the HAUS4 gene as well as in the MAP3K1, CDCA8, BCL2, ID4, cMYC, RAD51B, TSC2, ZBTB7C, FBXW7, CHEK2 and CDC7 genes (
                    <xref ref-type="fig" rid="f6">Figure 6</xref>).</p>
            </sec>
            <sec>
                <title>Identification of miRNAs on Latin American human genomic variants</title>
                <p>26.31% (10/42) of the miRNAs analysed (miR-11-3p, miR-31-3p, miR-107, miR-133a-3p, miR-133a-5p, miR-133b, miR-215-5p, miR-491-3p, miR-548d-5p and miR-944) were identical across the Latin American human genome variants, and 73.69% showed a genetic mutation (substitution or deletion of nucleotides) (
                    <xref ref-type="fig" rid="f7">Figure 7</xref>, Panels A and B).</p>
                <fig fig-type="figure" id="f7" orientation="portrait" position="float">
                    <label>Figure 7. </label>
                    <caption>
                        <p>
                            <bold>A</bold>) Number of miRNAs and nucleotide substitutions found in each human genomic variant; 
                            <bold>B</bold>) Number of miRNAs with between 1 and 7 nucleotide substitutions; 
                            <bold>C</bold>) Number of miRNAs with nucleotide substitutions in one, two or three genomic variants in the Latin American human genome, and 
                            <bold>D</bold>) Percentage of types of nucleotide substitutions in the miRNA sequences associated with CC in the selected human genome variants.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/17592/5eca6d24-e2e1-45f3-8dcf-566ce79c47e3_figure7.gif"/>
                </fig>
                <p>When mapping the sequences of these miRNAs to the selected Latin American human genome variants (
                    <xref ref-type="other" rid="SF3">Supplementary File 3</xref>), 88 miRSNPs related to miRNAs or miRNA binding sites were identified on the Latin American variants compared with 33 on the reference variant. Twenty-one miRSNPs were located in the miRNA seed sequences of Latin American variants compared with 3 located in the reference variant. The most representative mapping results are shown in 
                    <xref ref-type="table" rid="T6">Table 6</xref>.</p>
                <p>Types of nucleotide substitutions in the miRNA sequences associated with CC in the selected human genome variants showed that there were more frequent transversions than transitions and that the most frequent nucleotide substitutions were G&#x2192;U (16.9%), followed by A&#x2192;C (15.7%), C&#x2192;A (15.7%) and G&#x2192;A (10.8%) (
                    <xref ref-type="fig" rid="f7">Figure 7</xref>).</p>
                <p>Between one and 18 nucleotide deletions were detected in miR-27a-3p, miR-31-5p, miR-103a-3p, miR-191-3p, miR-215-3p and miR-574. The sequences of miR-28, miR-152, miR-548c-5p, miR-572 and miR-5095 only mapped to reference sequences (version GRCh38/hg38), but not to any of the Latin American human genomic variants. miR-152 did not map to the PUR variant (
                    <xref ref-type="table" rid="T6">Table 6</xref>).</p>
                <p>
                    <xref ref-type="table" rid="T7">Table 7</xref> displays the nucleotide variations from human genome variants obtained from Colombia, Mexico, Peru and Puerto Rico and Bangladesh, which was the control variant.</p>
                <table-wrap id="T7" orientation="portrait" position="anchor">
                    <label>Table 7. </label>
                    <caption>
                        <title>miRNAs identified in HPV integration sites, displaying the nucleotide variations in the selected Latin American human genome variants and the control variant.</title>
                        <p>More data is available in 
                            <xref ref-type="other" rid="SF3">Supplementary File 3</xref>.</p>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <tbody>
                            <tr>
                                <th align="center" colspan="1" rowspan="1">HG
                                    <sup>
                                        <xref ref-type="other" rid="tfn7">1</xref>
                                    </sup>
</th>
                                <th align="center" colspan="2" rowspan="1">miRNAs IDENTIFIED IN HPV INTEGRATION SITES (Cromosomal location
                                    <break/>(Chain))
                                    <sup>
                                        <xref ref-type="other" rid="tfn8">2</xref>
                                    </sup>
</th>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1"/>
                                <td align="center" colspan="1" rowspan="1">hsa-mir-1-3p (18q11.2 (-))</td>
                                <td align="center" colspan="1" rowspan="1">hsa-mir-23a-3p (19p13.12 (-))</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">

                                    <bold>CLM</bold>

                                    <break/>

                                    <bold>MXL</bold>

                                    <break/>

                                    <bold>PEL</bold>

                                    <break/>

                                    <bold>PUR</bold>

                                    <break/>

                                    <bold>BEB</bold>
</td>
                                <td align="center" colspan="1" rowspan="1">

                                    <styled-content style="#F7CAAC" style-type="background-color">UGGAAUGUAAAGAAGUAUGUAU</styled-content>
                                    <break/>

                                    <styled-content style="#F7CAAC" style-type="background-color">UGGAAUGUAAAGAAGUAUGUAU</styled-content>
                                    <break/>

                                    <styled-content style="#F7CAAC" style-type="background-color">UGGAAUGUAAAGAAGUAUGUAU</styled-content>
                                    <break/>

                                    <styled-content style="#F7CAAC" style-type="background-color">UGGAAUGUAAAGAAGUAUGUAU</styled-content>
                                    <break/>

                                    <styled-content style="#F7CAAC" style-type="background-color">UGGAAUGUAAAGAAGUAUGUAU</styled-content>
                                </td>
                                <td align="center" colspan="1" rowspan="1">
                                    <styled-content style="#DEEAF6" style-type="background-color">AU</styled-content>C
                                    <styled-content style="#DEEAF6" style-type="background-color">ACAU</styled-content>U
                                    <styled-content style="#DEEAF6" style-type="background-color">GCC</styled-content>A
                                    <styled-content style="#DEEAF6" style-type="background-color">GGGAUUUCC</styled-content>
                                    <break/>
                                    <styled-content style="#DEEAF6" style-type="background-color">AU</styled-content>C
                                    <styled-content style="#DEEAF6" style-type="background-color">ACAU</styled-content>U
                                    <styled-content style="#DEEAF6" style-type="background-color">GCC</styled-content>A
                                    <styled-content style="#DEEAF6" style-type="background-color">GGGAUUUCC</styled-content>
                                    <break/>
                                    <styled-content style="#DEEAF6" style-type="background-color">AU</styled-content>
                                    <styled-content style="#FF0000" style-type="color">A</styled-content>
                                    <styled-content style="#DEEAF6" style-type="background-color">ACAU</styled-content>U
                                    <styled-content style="#DEEAF6" style-type="background-color">GCA</styled-content>
                                    <styled-content style="#FF0000" style-type="color">A</styled-content>
                                    <styled-content style="#DEEAF6" style-type="background-color">GGGAUUUCC</styled-content>
                                    <break/>
                                    <styled-content style="#DEEAF6" style-type="background-color">AU</styled-content>C
                                    <styled-content style="#DEEAF6" style-type="background-color">ACAU</styled-content>U
                                    <styled-content style="#DEEAF6" style-type="background-color">GCC</styled-content>A
                                    <styled-content style="#DEEAF6" style-type="background-color">GGGAUUUCC</styled-content>
                                    <break/>
                                    <styled-content style="#DEEAF6" style-type="background-color">AU</styled-content>C
                                    <styled-content style="#DEEAF6" style-type="background-color">ACAU</styled-content>
                                    <styled-content style="#FF0000" style-type="color">C</styled-content>
                                    <styled-content style="#DEEAF6" style-type="background-color">GCC</styled-content>A
                                    <styled-content style="#DEEAF6" style-type="background-color">GGGAUUUCC</styled-content>
                                </td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1"/>
                                <td align="center" colspan="1" rowspan="1">

                                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/17592/5eca6d24-e2e1-45f3-8dcf-566ce79c47e3_t1.gif"/>
</td>
                                <td align="center" colspan="1" rowspan="1">

                                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/17592/5eca6d24-e2e1-45f3-8dcf-566ce79c47e3_t2.gif"/>
</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1"/>
                                <td align="center" colspan="1" rowspan="1">

                                    <bold>Conserved</bold>
</td>
                                <td align="center" colspan="1" rowspan="1">

                                    <bold>Nucleotide substitution</bold>
</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1"/>
                                <td align="center" colspan="1" rowspan="1">hsa-mir-31-5p (9p21.3 (-))</td>
                                <td align="center" colspan="1" rowspan="1">hsa-mir-152 (17q21.32 (-))</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">

                                    <bold>CLM</bold>

                                    <break/>

                                    <bold>MXL</bold>

                                    <break/>

                                    <bold>PEL</bold>

                                    <break/>

                                    <bold>PUR</bold>

                                    <break/>

                                    <bold>BEB</bold>
</td>
                                <td align="center" colspan="1" rowspan="1">
                                    <styled-content style="#DEEAF6" style-type="background-color">AGGCAAGAUGCUGGCAU</styled-content>
                                    <styled-content style="#E2EFD9" style-type="background-color">AGCU</styled-content>
                                    <break/>
                                    <styled-content style="#DEEAF6" style-type="background-color">AGGCAAGAUGCUGGCAU</styled-content>
                                    <styled-content style="#E2EFD9" style-type="background-color">AGCU</styled-content>
                                    <break/>
                                    <styled-content style="#DEEAF6" style-type="background-color">AGGCAAGAUGCUGGCAU</styled-content>
                                    <styled-content style="#E2EFD9" style-type="background-color">&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;</styled-content>
                                    <break/>
                                    <styled-content style="#DEEAF6" style-type="background-color">AGGCAAGAUGCUGGCAU</styled-content>
                                    <styled-content style="#E2EFD9" style-type="background-color">AGCU</styled-content>
                                    <break/>
                                    <styled-content style="#DEEAF6" style-type="background-color">AGGCAAGAUGCUGGCAU</styled-content>
                                    <styled-content style="#E2EFD9" style-type="background-color">AGCU</styled-content>
                                </td>
                                <td align="center" colspan="1" rowspan="1">
                                    <styled-content style="#FF0000" style-type="color">C</styled-content>
                                    <styled-content style="#FCF59E" style-type="background-color">GG</styled-content>
                                    <styled-content style="#FF0000" style-type="color">G</styled-content>
                                    <styled-content style="#FCF59E" style-type="background-color">UCUGU</styled-content>G
                                    <styled-content style="#FF0000" style-type="color">C</styled-content>
                                    <styled-content style="#FCF59E" style-type="background-color">U</styled-content>A
                                    <styled-content style="#FCF59E" style-type="background-color">CACU</styled-content>CC
                                    <styled-content style="#E2EFD9" style-type="background-color">GACU</styled-content>
                                    <break/>&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;&#x00a0;C
                                    <styled-content style="#E2EFD9" style-type="background-color">GACU</styled-content>
                                    <break/>A
                                    <styled-content style="#FCF59E" style-type="background-color">GG</styled-content>U
                                    <styled-content style="#FCF59E" style-type="background-color">UCUGU</styled-content>GA
                                    <styled-content style="#FCF59E" style-type="background-color">U</styled-content>A
                                    <styled-content style="#FCF59E" style-type="background-color">CACU</styled-content>
                                    <styled-content style="#FF0000" style-type="color">A</styled-content>C
                                    <styled-content style="#E2EFD9" style-type="background-color">GACU</styled-content>
                                    <break/>

                                    <break/>A
                                    <styled-content style="#FCF59E" style-type="background-color">GG</styled-content>U
                                    <styled-content style="#FCF59E" style-type="background-color">UCUGU</styled-content>
                                    <styled-content style="#FF0000" style-type="color">UG</styled-content>
                                    <styled-content style="#FCF59E" style-type="background-color">U</styled-content>
                                    <styled-content style="#FF0000" style-type="color">G</styled-content>
                                    <styled-content style="#FCF59E" style-type="background-color">CACU</styled-content>C
                                    <styled-content style="#FF0000" style-type="color">U</styled-content>
                                    <styled-content style="#E2EFD9" style-type="background-color">GACU</styled-content>
                                </td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1"/>
                                <td align="center" colspan="1" rowspan="1">

                                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/17592/5eca6d24-e2e1-45f3-8dcf-566ce79c47e3_t3.gif"/>
</td>
                                <td align="center" colspan="1" rowspan="1">

                                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/17592/5eca6d24-e2e1-45f3-8dcf-566ce79c47e3_t4.gif"/>
</td>
                            </tr>
                            <tr>
                                <td align="center" colspan="1" rowspan="1">

                                    <bold>|</bold>
</td>
                                <td align="center" colspan="1" rowspan="1">

                                    <bold>Nucleotide deletion</bold>
</td>
                                <td align="center" colspan="1" rowspan="1">

                                    <bold>Absence of the miRNA sequence</bold>
</td>
                            </tr>
                        </tbody>
                    </table>
                    <table-wrap-foot>
                        <fn>
                            <p id="tfn7">
                                <sup>1</sup>HG: Human genome; CLM: variant of Medellin, Colombia; MXL: Los Angeles with Mexican ancestry; PEL: Lima, Peru; PUR: of Puerto Rico; BEB: Bengali, Bangladesh.</p>
                            <p id="tfn8">
                                <sup>2</sup>The size of each letter indicates the enrichment of each nucleotide in Latin American variants of the human genome, WebLogo displayed through the program..</p>
                        </fn>
                    </table-wrap-foot>
                </table-wrap>
            </sec>
        </sec>
        <sec sec-type="discussion">
            <title>Discussion</title>
            <sec>
                <title>HPV integration sites</title>
                <p>According to the literature, approximately 570 integration sites have been identified for eight oncogenic HPV types associated with CC (
                    <xref ref-type="fig" rid="f2">Figure 2</xref>). HPV integration into cellular DNA and consequent deregulation of genes is considered a crucial step in cancer progression. Genotype HPV-16 is the most studied for its relationship with CC, as it is responsible for 70% of cases worldwide
                    <sup>
                        <xref ref-type="bibr" rid="ref-39">39</xref>
                    </sup>. This could be a consequence of the greater proportion of integration sites reported for this genotype. In contrast, low risk genotypes, such as HPV-45, -66 and -93 reported in Colombia, are frequent in CC
                    <sup>
                        <xref ref-type="bibr" rid="ref-40">40</xref>&#x2013;
                        <xref ref-type="bibr" rid="ref-44">44</xref>
                    </sup>.</p>
                <p>HPV integration into the host genome occurs in regions well-known as fragile sites, breakpoints or transcriptionally active regions
                    <sup>
                        <xref ref-type="bibr" rid="ref-45">45</xref>
                    </sup>. This integration induces functional alterations of cellular genes in close proximity
                    <sup>
                        <xref ref-type="bibr" rid="ref-12">12</xref>,
                        <xref ref-type="bibr" rid="ref-46">46</xref>&#x2013;
                        <xref ref-type="bibr" rid="ref-48">48</xref>
                    </sup>. According to our results, the 8q24.21 chromosome region is the most affected by HPV integration. If we take into account that proto-oncogenes such as the MYC gene are located here 
                    <sup>
                        <xref ref-type="bibr" rid="ref-49">49</xref>
                    </sup>(as displayed in 
                    <xref ref-type="fig" rid="f3">Figure 3</xref>) and that MYC represents a family of genes overexpressed in several tumours including CC
                    <sup>
                        <xref ref-type="bibr" rid="ref-49">49</xref>&#x2013;
                        <xref ref-type="bibr" rid="ref-51">51</xref>
                    </sup>, inhibition of MYC expression can induce cancer cell destruction
                    <sup>
                        <xref ref-type="bibr" rid="ref-50">50</xref>
                    </sup>. In this context, the MYC gene could be both a tumour biomarker and potential treatment target for several tumours
                    <sup>
                        <xref ref-type="bibr" rid="ref-51">51</xref>
                    </sup> (
                    <xref ref-type="table" rid="T2">Table 2</xref>).</p>
                <p>Chromosomes 1, 14, 19 and X contain significantly more mature miRNAs than others, and chromosome 18 contains fewer miRNAs. The 19q13.4 chromosome region contains the largest group of human miRNAs (known as the group of miRNAs on chromosome 19 "C19 MC"), with alterations in several that have been previously reported in cancer
                    <sup>
                        <xref ref-type="bibr" rid="ref-52">52</xref>
                    </sup>. Studies have reported associations between chromosome 1 and malignant transformation in cancers, including CC
                    <sup>
                        <xref ref-type="bibr" rid="ref-53">53</xref>
                    </sup>.</p>
                <p>The 578 integration sites identified in eight HPV types associated with CC were located in cell cycle regulatory genes, including the tumour suppressor genes TP73, P3H2, TP63, NBN, PTEN, BRCA1, and TPX2; the oncogenes EIF4E, CDCA8, MDM2, and PVT1; and the proto-oncogenes SRC, MYC, MCM5, CXCL8, and BCL2. Their deregulation could explain the progression of CC (
                    <xref ref-type="fig" rid="f3">Figure 3</xref>).</p>
            </sec>
            <sec>
                <title>miRNA binding sites associated with cervical cancer</title>
                <p>In 2011, Reshmi 
                    <italic toggle="yes">et al.</italic> used BLAT to determine the exact location of four miRNA binding sites associated with CC using bioinformatics programmes and computational tools
                    <sup>
                        <xref ref-type="bibr" rid="ref-54">54</xref>
                    </sup>. To the best of our knowledge, this study is the first to use BLAT to identify miRNA binding sites in proximity to HPV integration sites involved in CC progression. In this study, 2028 binding sites from 272 CC-associated miRNAs were identified.</p>
                <p>Identification of the target mRNAs of these miRNAs is considered a key step in their structural and functional analysis to establish possible interactions and consequently, cellular processes that may be altered in CC progression
                    <sup>
                        <xref ref-type="bibr" rid="ref-55">55</xref>&#x2013;
                        <xref ref-type="bibr" rid="ref-57">57</xref>
                    </sup>. miRNAs located in the two strands of cellular DNA (5&#x2019; and 3&#x2019; strands) demonstrate their ability to interact in both orientations with the two strands of DNA and form triple helix structures to enhance RNA stability
                    <sup>
                        <xref ref-type="bibr" rid="ref-58">58</xref>,
                        <xref ref-type="bibr" rid="ref-59">59</xref>
                    </sup>.</p>
                <p>Each CC-associated miRNA showed a different number of binding sites in the human genome (
                    <xref ref-type="table" rid="T3">Table 3</xref>, 
                    <xref ref-type="other" rid="SF2">Supplementary File 2</xref>), and in the human genomic variants
                    <sup>
                        <xref ref-type="bibr" rid="ref-17">17</xref>,
                        <xref ref-type="bibr" rid="ref-21">21</xref>,
                        <xref ref-type="bibr" rid="ref-60">60</xref>,
                        <xref ref-type="bibr" rid="ref-61">61</xref>
                    </sup>; miRNAs were distributed throughout the genomes in both intronic or exonic regions
                    <sup>
                        <xref ref-type="bibr" rid="ref-13">13</xref>
                    </sup>. In this study, CC-associated miRNAs were distributed in the karyosome, with chromosomes 1, 19, 5, 2, 3, 14, 7 and X having the largest number of miRNA binding sites (
                    <xref ref-type="table" rid="T4">Table 4</xref>). In order to confirm the distribution of miRNA binding sites, the analysis for each chromosomal following all chromosomes was done. The statistic W Shapiro-Wilk test, show a p-value 0.02; and the mean comparison analysis by ANOVA with a p-value 0.0046 allowed us to confirm the non-random distribution of miRNA binding sites along the genome. These results are consistent with those reported by Calin 
                    <italic toggle="yes">et al.</italic>
                    <sup>
                        <xref ref-type="bibr" rid="ref-12">12</xref>
                    </sup>. Because some chromosomes have a greater number of miRNA binding sites, it provides evidence of a non-random distribution of miRNAs within the chromosomes.</p>
                <p>Our results showed a low number of exonic miRNAs. These exonic miRNAs are considered rare miRNAs
                    <sup>
                        <xref ref-type="bibr" rid="ref-62">62</xref>
                    </sup>, which are important candidates for gaining a better comprehension of interaction networks between miRNAs and their CC-associated targets.</p>
                <p>The miRNA binding sites are within a short distance of each other in the chromosome, indicating that they tend to cluster
                    <sup>
                        <xref ref-type="bibr" rid="ref-63">63</xref>&#x2013;
                        <xref ref-type="bibr" rid="ref-66">66</xref>
                    </sup>. Altuvia 
                    <italic toggle="yes">et al.</italic> reported miRNAs in groups of two or three
                    <sup>
                        <xref ref-type="bibr" rid="ref-64">64</xref>
                    </sup>. This coincides with our results on CC-associated miRNA binding sites, as we found that miRNAs are capable of forming groups of more than 6 miRNAs on both strands of human DNA (
                    <xref ref-type="fig" rid="f4">Figure 4</xref>). We identified an important group of 16 miRNAs that can form these clusters and are located on chromosome 14 region 14q32.31. They include hsa-miR-134, miR-299, miR-323a, miR-329, miR-376a, miR-376c, miR-379, miR-411, miR-485, miR-487a, miR-487b, miR-494, miR-495, miR-539, miR-654 and miR-5095 (
                    <xref ref-type="other" rid="SF2">Supplementary File 2</xref>). Understanding their individual and collective roles is important when studying the development of this neoplasia.</p>
                <p>miR-5095 had the highest number of binding sites distributed throughout the human genome (
                    <xref ref-type="table" rid="T3">Table 3</xref>), which is in accordance with previously reported data
                    <sup>
                        <xref ref-type="bibr" rid="ref-66">66</xref>&#x2013;
                        <xref ref-type="bibr" rid="ref-68">68</xref>
                    </sup> where approximately 900 binding sites were identified; they are probably related to the expression of many target mRNAs and biological processes. Based on its extensive genomic distribution and low specificity in CC, miR-5095 is a good candidate to be used as an indicator of genetic variability within the human population.</p>
            </sec>
            <sec>
                <title>miRNAs located in HPV integration sites</title>
                <p>To identify the role of miRNAs, HPV integration sites located in cell cycle-controlling genes were analysed. Thirty-seven miRNAs were identified in HPV integration sites close to cell cycle-controlling genes (
                    <xref ref-type="table" rid="T5">Table 5</xref>). Nambaru 
                    <italic toggle="yes">et al.</italic> and Schmitz 
                    <italic toggle="yes">et al.</italic> identified numerous miRNAs in the proximity of HPV integration sites and reported that approximately 65% of these were involved in cervical carcinogenesis
                    <sup>
                        <xref ref-type="bibr" rid="ref-8">8</xref>,
                        <xref ref-type="bibr" rid="ref-9">9</xref>
                    </sup>. Inactivation of tumour suppressor genes by viral integration increases genomic instability and leads to cervical malignant neoplasm progression
                    <sup>
                        <xref ref-type="bibr" rid="ref-69">69</xref>
                    </sup>.</p>
                <p>The multiple miRNA binding sites on a target may decrease the levels of mRNA translation and improve the specificity of gene regulation. For example, one miRNA can have multiple target genes and each individual mRNA can be regulated by numerous miRNAs
                    <sup>
                        <xref ref-type="bibr" rid="ref-13">13</xref>,
                        <xref ref-type="bibr" rid="ref-70">70</xref>,
                        <xref ref-type="bibr" rid="ref-71">71</xref>
                    </sup>. Ninety-seven interactions were identified between miRNAs and cell cycle regulatory genes (
                    <xref ref-type="table" rid="T4">Table 4</xref>&#x2013;
                    <xref ref-type="table" rid="T5">Table 5</xref>, 
                    <xref ref-type="fig" rid="f4">Figure 4</xref>&#x2013;
                    <xref ref-type="fig" rid="f6">Figure 6</xref>); miR-5095, -548c-5p and -548d-5p showed the highest number of interactions with these kinds of genes.</p>
                <p>Ivashchenko 
                    <italic toggle="yes">et al.</italic> identified miR-5095 binding sites in the BRCA1 gene
                    <sup>
                        <xref ref-type="bibr" rid="ref-67">67</xref>
                    </sup>. In this study, miR-5095 was also found to have binding sites in the BAK1, BARD1, CITED2, MDM5, SRC, PARD3B, PPP2CA, RHEB, SOX2 and XPO1 genes (
                    <xref ref-type="table" rid="T5">Table 5</xref> and 
                    <xref ref-type="fig" rid="f6">Figure 6</xref>). Our findings provide a basis for searching for other interactions, gene targets, and CC-associated miRNAs.</p>
                <p>During miRNA biogenesis, some pre-miRNA produces two mature miRNAs, such as miRNA-5p and miRNA-3p
                    <sup>
                        <xref ref-type="bibr" rid="ref-72">72</xref>
                    </sup>. Mature miRNA deregulation can have an important role in tumour development, suggesting the need to analyse each mature sequence (miRNA-5p and -3p). In this study, binding sites were analysed for both mature miRNA sequences (-5p and -3p) in several interactions (
                    <xref ref-type="fig" rid="f6">Figure 6</xref>). A mature miRNA sequence, such as miR-548c, demonstrated binding sites in different cellular genes. Thus, this miRNA could serve as candidate biomarker for CC prognosis and diagnosis.</p>
                <p>Han 
                    <italic toggle="yes">et al.</italic> characterized the two mature chains of miR-21 and their oncogenic roles in cervical cancer
                    <sup>
                        <xref ref-type="bibr" rid="ref-73">73</xref>
                    </sup>. The regulation of the mature 5p and 3p chains from several miRNAs has been investigated in other cancers, including colorectal, gastric, breast, lung, kidney, and bladder
                    <sup>
                        <xref ref-type="bibr" rid="ref-36">36</xref>,
                        <xref ref-type="bibr" rid="ref-72">72</xref>,
                        <xref ref-type="bibr" rid="ref-74">74</xref>&#x2013;
                        <xref ref-type="bibr" rid="ref-77">77</xref>
                    </sup>, suggesting the need to focus further studies on the two mature chains from the 272 miRNAs reported in this study.</p>
                <p>
                    <xref ref-type="fig" rid="f6">Figure 6</xref> shows the complexity of the interactions between miRNAs and tumour suppressor genes, proto-oncogenes and oncogenes. The study of interaction networks between cell cycle genes and miRNAs involved in cancer is one of the most recent challenges in systems biology and is important for elucidating the control mechanisms for cancer biological process
                    <sup>
                        <xref ref-type="bibr" rid="ref-78">78</xref>&#x2013;
                        <xref ref-type="bibr" rid="ref-81">81</xref>
                    </sup>.</p>
            </sec>
            <sec>
                <title>miRNAs in HPV integration sites and Latin American human genome variants</title>
                <p>The differences in miRNA expression profiles between normal and cancerous tissues have led to the identification of clinical biomarkers for the early detection of many diseases, including various cancers and their precursor stages
                    <sup>
                        <xref ref-type="bibr" rid="ref-79">79</xref>,
                        <xref ref-type="bibr" rid="ref-82">82</xref>,
                        <xref ref-type="bibr" rid="ref-83">83</xref>
                    </sup>. Research on miRNAs associated with cancer has not taken into account the genetic variability in human populations, which influences the structure, expression and function of miRNAs in populations from different ethnic backgrounds. Studies on genetic variability are relevant to designing strategies for the diagnosis and prognosis of various diseases.</p>
                <p>miR-11-3p, miR-31-3p, miR-107, miR-133a-3p, miR-133a-5p, miR-133b, miR-215-5p, miR-491-3p, miR-548d-5p and miR-944 were conserved in the four human genome variants. In the remaining 27 miRNAs, substitutions, deletions or insertions were observed in the nucleotide sequences, indicating that this variability can be decisive when determining susceptibility to the development of CC (
                    <xref ref-type="table" rid="T7">Table 7</xref> and 
                    <xref ref-type="other" rid="SF3">Supplementary File 3</xref>).</p>
                <p>There are numerous studies that analyse miRSNPs in different malignancies
                    <sup>
                        <xref ref-type="bibr" rid="ref-84">84</xref>&#x2013;
                        <xref ref-type="bibr" rid="ref-86">86</xref>
                    </sup>, but there is no available data on the correlation of SNPs in CC-associated miRNAs located in HPV integration sites in Latin American human genomic variants.</p>
                <p>According to our results, the genomes from Latin America showed a lower miRSNP frequency compared to the control genome (BEB), although the Colombian (CLM) genome frequency was more similar to the BEB genome. Latin American populations have experienced migrations from European, Asian and African individuals
                    <sup>
                        <xref ref-type="bibr" rid="ref-87">87</xref>
                    </sup>. Thus, our results could be a result of the specific interracial mixing of Colombian populations but also due to migration patterns during human settlement in Latin America.</p>
                <p>miRSNPs can affect the structure and function of miRNAs by impacting interactions between miRNAs and their mRNA targets or interfering with the expression levels of individual miRNAs
                    <sup>
                        <xref ref-type="bibr" rid="ref-20">20</xref>&#x2013;
                        <xref ref-type="bibr" rid="ref-22">22</xref>,
                        <xref ref-type="bibr" rid="ref-88">88</xref>,
                        <xref ref-type="bibr" rid="ref-89">89</xref>
                    </sup>. miRSNPs could cause the loss or gain of binding sites for the co-evolution of miRNAs and their target mRNA and even influence cell processes related to tumour progression, disease phenotypes or susceptibility to developing a specific disease.</p>
                <p>More studies are needed to clarify the role, targets and transcriptional regulatory mechanisms of cellular events in which miRNA are involved, including differentiation, apoptosis, metabolism and carcinogenesis. The expression and deregulation of miRNAs in cancer as well as their role as biological markers in diagnosis and treatment of CC should be explored. Further identification of cellular genes and signalling pathways involved in CC progression could lead to the development of new therapeutic strategies based on miRNAs
                    <sup>
                        <xref ref-type="bibr" rid="ref-90">90</xref>,
                        <xref ref-type="bibr" rid="ref-91">91</xref>
                    </sup>. Additional biomarkers associated with apoptosis, necrosis and possible interactions with CRISPR complex sequences from healthy-tumour cervical can be explored in order to develop therapeutic strategies in the future.</p>
            </sec>
        </sec>
        <sec>
            <title>Data availability</title>
            <p>The data referenced by this article are under copyright with the following copyright statement: Copyright: &#x00ef;&#x00bf;&#x00bd; 2018 Guerrero Fl&#x00f3;rez M et al.</p>
            <p>Data associated with the article are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication).
                <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/publicdomain/zero/1.0/"/>
            </p>
            <p>Dataset 1. The mature miRNA reference sequences were obtained in FASTA format from the miRBase database. DOI, 
                <ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.5256/f1000research.10138.d164732">10.5256/f1000research.10138.d164732</ext-link>
                <sup>
                    <xref ref-type="bibr" rid="ref-28">28</xref>
                </sup>
</p>
            <p>Dataset 2. Matrix of data containing all the necessary components for the validation of data on CC-associated miRNAs in HPV integration sites in Latin American human genomic variants. DOI, 
                <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.5256/f1000research.10138.d217286">10.5256/f1000research.10138.d217286</ext-link>
                <sup>
                    <xref ref-type="bibr" rid="ref-36">36</xref>
                </sup>
</p>
        </sec>
    </body>
    <back>
        <ack>
            <title>Acknowledgments</title>
            <p>The authors thank the recommendations and suggestions of. Guillermo Torres from Kiel University (Germany) to improve the bioinformatics approach in this research.</p>
        </ack>
        <sec sec-type="supplementary-material">
            <title>Supplementary material</title>
            <p id="SF1">Supplementary File 1 Articles that mention HPV integration sites, detailing the most frequent types of HPV associated with CC.
</p>
            <p>
                <ext-link ext-link-type="uri" xlink:href="https://f1000researchdata.s3.amazonaws.com/supplementary/10138/ec37e22f-dfb7-4660-97b3-a494b7d8c8ba_Supplementary_file_1_new.csv">Click here to access the data</ext-link>
            </p>
            <p id="SF2">Supplementary File 2. Diagram indicating the regions on all chromosomes with miRNA binding sites that are associated with cervical cancer.</p>
            <p>
                <ext-link ext-link-type="uri" xlink:href="https://f1000researchdata.s3.amazonaws.com/supplementary/10138/c406ad9b-7558-465d-bb56-6f99fcf8fd7e.pdf">Click here to access the data</ext-link>
            </p>
            <p id="SF3">Supplementary File 3. miRNAs identified in HPV integration sites, displaying the nucleotide variations in the selected Latin American human genome variants and in the control variant.</p>
            <p>
                <ext-link ext-link-type="uri" xlink:href="https://f1000researchdata.s3.amazonaws.com/supplementary/10138/9e84a3e7-58dd-4136-8230-9af454521b86.pdf">Click here to access the data</ext-link>
            </p>
        </sec>
        <ref-list>
            <ref id="ref-1">
                <label>1</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Bray</surname>
                            <given-names>F</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Ferlay</surname>
                            <given-names>J</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Soerjomataram</surname>
                            <given-names>I</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Global Cancer Statistics 2018: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries.</article-title>
                    <source>
						
                        <italic toggle="yes">CA Cancer J Clin.</italic>
					</source>
                    <year>2018</year>.
                    <pub-id pub-id-type="doi">10.3322/caac.21492</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-2">
                <label>2</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Bernard</surname>
                            <given-names>HU</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Calleja-Macias</surname>
                            <given-names>IE</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Dunn</surname>
                            <given-names>ST</given-names>
                        </name>
					</person-group>:
                    <article-title>Genome variation of human papillomavirus types: phylogenetic and medical implications.</article-title>
                    <source>
						
                        <italic toggle="yes">Int J Cancer.</italic>
					</source>
                    <year>2006</year>;<volume>118</volume>(<issue>5</issue>):<fpage>1071</fpage>&#x2013;<lpage>6</lpage>.
                    <pub-id pub-id-type="pmid">16331617</pub-id>
                    <pub-id pub-id-type="doi">10.1002/ijc.21655</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-3">
                <label>3</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Burd</surname>
                            <given-names>EM</given-names>
                        </name>
					</person-group>:
                    <article-title>Human papillomavirus and cervical cancer.</article-title>
                    <source>
						
                        <italic toggle="yes">Clin Microbiol Rev.</italic>
					</source>
                    <year>2003</year>;<volume>16</volume>(<issue>1</issue>):<fpage>1</fpage>&#x2013;<lpage>17</lpage>.
                    <pub-id pub-id-type="pmid">12525422</pub-id>
                    <pub-id pub-id-type="doi">10.1128/CMR.16.1.1-17.2003</pub-id>
                    <pub-id pub-id-type="pmcid">145302</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-4">
                <label>4</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Richardson</surname>
                            <given-names>H</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Kelsall</surname>
                            <given-names>G</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Tellier</surname>
                            <given-names>P</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>The natural history of type-specific human papillomavirus infections in female university students.</article-title>
                    <source>
						
                        <italic toggle="yes">Cancer Epidemiol Biomarkers Prev.</italic>
					</source>
                    <year>2003</year>;<volume>12</volume>(<issue>6</issue>):<fpage>485</fpage>&#x2013;<lpage>90</lpage>.
                    <pub-id pub-id-type="pmid">12814991</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-5">
                <label>5</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Woodman</surname>
                            <given-names>CB</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Collins</surname>
                            <given-names>SI</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Young</surname>
                            <given-names>LS</given-names>
                        </name>
					</person-group>:
                    <article-title>The natural history of cervical HPV infection: unresolved issues.</article-title>
                    <source>
						
                        <italic toggle="yes">Nat Rev Cancer.</italic>
					</source>
                    <year>2007</year>;<volume>7</volume>(<issue>1</issue>):<fpage>11</fpage>&#x2013;<lpage>22</lpage>.
                    <pub-id pub-id-type="pmid">17186016</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nrc2050</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-6">
                <label>6</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Wentzensen</surname>
                            <given-names>N</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Vinokurova</surname>
                            <given-names>S</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>von Knebel Doeberitz</surname>
                            <given-names>M</given-names>
                        </name>
					</person-group>:
                    <article-title>Systematic review of genomic integration sites of human papillomavirus genomes in epithelial dysplasia and invasive cancer of the female lower genital tract.</article-title>
                    <source>
						
                        <italic toggle="yes">Cancer Res.</italic>
					</source>
                    <year>2004</year>;<volume>64</volume>(<issue>11</issue>):<fpage>3878</fpage>&#x2013;<lpage>84</lpage>.
                    <pub-id pub-id-type="pmid">15172997</pub-id>
                    <pub-id pub-id-type="doi">10.1158/0008-5472.CAN-04-0009</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-7">
                <label>7</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Pett</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Coleman</surname>
                            <given-names>N</given-names>
                        </name>
					</person-group>:
                    <article-title>Integration of high-risk human papillomavirus: a key event in cervical carcinogenesis?</article-title>
                    <source>
						
                        <italic toggle="yes">J Pathol.</italic>
					</source>
                    <year>2007</year>;<volume>212</volume>(<issue>4</issue>):<fpage>356</fpage>&#x2013;<lpage>67</lpage>.
                    <pub-id pub-id-type="pmid">17573670</pub-id>
                    <pub-id pub-id-type="doi">10.1002/path.2192</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-8">
                <label>8</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Nambaru</surname>
                            <given-names>L</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Meenakumari</surname>
                            <given-names>B</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Swaminathan</surname>
                            <given-names>R</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Prognostic significance of HPV physical status and integration sites in cervical cancer.</article-title>
                    <source>
						
                        <italic toggle="yes">Asian Pac J Cancer Prev.</italic>
					</source>
                    <year>2009</year>;<volume>10</volume>(<issue>3</issue>):<fpage>355</fpage>&#x2013;<lpage>60</lpage>.
                    <pub-id pub-id-type="pmid">19640172</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-9">
                <label>9</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Schmitz</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Driesch</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Jansen</surname>
                            <given-names>L</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Non-random integration of the HPV genome in cervical cancer.</article-title>
                    <source>
						
                        <italic toggle="yes">PLoS One.</italic>
					</source>
                    <year>2012</year>;<volume>7</volume>(<issue>6</issue>):<fpage>e39632</fpage>.
                    <pub-id pub-id-type="pmid">22761851</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0039632</pub-id>
                    <pub-id pub-id-type="pmcid">3384597</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-10">
                <label>10</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Bartel</surname>
                            <given-names>DP</given-names>
                        </name>
					</person-group>:
                    <article-title>MicroRNAs: genomics, biogenesis, mechanism, and function.</article-title>
                    <source>
						
                        <italic toggle="yes">Cell.</italic>
					</source>
                    <year>2004</year>;<volume>116</volume>(<issue>2</issue>):<fpage>281</fpage>&#x2013;<lpage>97</lpage>.
                    <pub-id pub-id-type="pmid">14744438</pub-id>
                    <pub-id pub-id-type="doi">10.1016/S0092-8674(04)00045-5</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-11">
                <label>11</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Rodriguez</surname>
                            <given-names>A</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Griffiths-Jones</surname>
                            <given-names>S</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Ashurst</surname>
                            <given-names>JL</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Identification of mammalian microRNA host genes and transcription units.</article-title>
                    <source>
						
                        <italic toggle="yes">Genome Res.</italic>
					</source>
                    <year>2004</year>;<volume>14</volume>(<issue>10A</issue>):<fpage>1902</fpage>&#x2013;<lpage>10</lpage>.
                    <pub-id pub-id-type="pmid">15364901</pub-id>
                    <pub-id pub-id-type="doi">10.1101/gr.2722704</pub-id>
                    <pub-id pub-id-type="pmcid">524413</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-12">
                <label>12</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Calin</surname>
                            <given-names>GA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Sevignani</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Dumitru</surname>
                            <given-names>CD</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers.</article-title>
                    <source>
						
                        <italic toggle="yes">Proc Natl Acad Sci U S A.</italic>
					</source>
                    <year>2004</year>;<volume>101</volume>(<issue>9</issue>):<fpage>2999</fpage>&#x2013;<lpage>3004</lpage>.
                    <pub-id pub-id-type="pmid">14973191</pub-id>
                    <pub-id pub-id-type="doi">10.1073/pnas.0307323101</pub-id>
                    <pub-id pub-id-type="pmcid">365734</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-13">
                <label>13</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Bartel</surname>
                            <given-names>DP</given-names>
                        </name>
					</person-group>:
                    <article-title>MicroRNAs: target recognition and regulatory functions.</article-title>
                    <source>
						
                        <italic toggle="yes">Cell.</italic>
					</source>
                    <year>2009</year>;<volume>136</volume>(<issue>2</issue>):<fpage>215</fpage>&#x2013;<lpage>33</lpage>.
                    <pub-id pub-id-type="pmid">19167326</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.cell.2009.01.002</pub-id>
                    <pub-id pub-id-type="pmcid">3794896</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-14">
                <label>14</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Sharma</surname>
                            <given-names>G</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Dua</surname>
                            <given-names>P</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Agarwal</surname>
                            <given-names>SM</given-names>
                        </name>
					</person-group>:
                    <article-title>A Comprehensive Review of Dysregulated miRNAs Involved in Cervical Cancer.</article-title>
                    <source>
						
                        <italic toggle="yes">Curr Genomics.</italic>
					</source>
                    <year>2014</year>;<volume>15</volume>(<issue>4</issue>):<fpage>310</fpage>&#x2013;<lpage>23</lpage>.
                    <pub-id pub-id-type="pmid">25132800</pub-id>
                    <pub-id pub-id-type="doi">10.2174/1389202915666140528003249</pub-id>
                    <pub-id pub-id-type="pmcid">4133953</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-15">
                <label>15</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Mullany</surname>
                            <given-names>LE</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Herrick</surname>
                            <given-names>JS</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Wolff</surname>
                            <given-names>RK</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>MicroRNA Seed Region Length Impact on Target Messenger RNA Expression and Survival in Colorectal Cancer.</article-title>
                    <source>
						
                        <italic toggle="yes">PLoS One.</italic>
					</source>
                    <year>2016</year>;<volume>11</volume>(<issue>4</issue>):<fpage>e0154177</fpage>.
                    <pub-id pub-id-type="pmid">27123865</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0154177</pub-id>
                    <pub-id pub-id-type="pmcid">4849741</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-16">
                <label>16</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Melo</surname>
                            <given-names>SA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Esteller</surname>
                            <given-names>M</given-names>
                        </name>						
					</person-group>:
                    <article-title>Dysregulation of microRNAs in cancer: playing with fire.</article-title>
                    <source>
						
                        <italic toggle="yes">FEBS Lett.</italic>
					</source>
                    <year>2011</year>;<volume>585</volume>(<issue>13</issue>):<fpage>2087</fpage>&#x2013;<lpage>99</lpage>.
                    <pub-id pub-id-type="pmid">20708002</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.febslet.2010.08.009</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-17">
                <label>17</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Cammaerts</surname>
                            <given-names>S</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Strazisar</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>De Rijk</surname>
                            <given-names>P</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Genetic variants in microRNA genes: impact on microRNA expression, function, and disease.</article-title>
                    <source>
					
                        <italic toggle="yes">Front Genet.</italic>
					</source>Frontiers Media SA;<year>2015</year>;<volume>6</volume>:<fpage>186</fpage>.
                    <pub-id pub-id-type="pmid">26052338</pub-id>
                    <pub-id pub-id-type="doi">10.3389/fgene.2015.00186</pub-id>
                    <pub-id pub-id-type="pmcid">4439572</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-18">
                <label>18</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Sudmant</surname>
                            <given-names>PH</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Rausch</surname>
                            <given-names>T</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Gardner</surname>
                            <given-names>EJ</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>An integrated map of structural variation in 2,504 human genomes.</article-title>
                    <source>
						
                        <italic toggle="yes">Nature.</italic>
					</source>
                    <year>2015</year>;<volume>526</volume>(<issue>7571</issue>):<fpage>75</fpage>&#x2013;<lpage>81</lpage>.
                    <pub-id pub-id-type="pmid">26432246</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nature15394</pub-id>
                    <pub-id pub-id-type="pmcid">4617611</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-19">
                <label>19</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <collab>1000 Genomes Project Consortium, </collab>
						
                        <name name-style="western">
                            <surname>Abecasis</surname>
                            <given-names>GR</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Altshuler</surname>
                            <given-names>D</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>A map of human genome variation from population-scale sequencing.</article-title>
                    <source>
						
                        <italic toggle="yes">Nature.</italic>
					</source>
                    <year>2010</year>;<volume>467</volume>(<issue>7319</issue>):<fpage>1061</fpage>&#x2013;<lpage>73</lpage>.
                    <pub-id pub-id-type="pmid">20981092</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nature09534</pub-id>
                    <pub-id pub-id-type="pmcid">3042601</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-20">
                <label>20</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Liu</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Rennie</surname>
                            <given-names>WA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Carmack</surname>
                            <given-names>CS</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Effects of genetic variations on microRNA: target interactions.</article-title>
                    <source>
						
                        <italic toggle="yes">Nucleic Acids Res.</italic>
					</source>
                    <year>2014</year>;<volume>42</volume>(<issue>15</issue>):<fpage>9543</fpage>&#x2013;<lpage>52</lpage>.
                    <pub-id pub-id-type="pmid">25081214</pub-id>
                    <pub-id pub-id-type="doi">10.1093/nar/gku675</pub-id>
                    <pub-id pub-id-type="pmcid">4150780</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-21">
                <label>21</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Torruella-Loran</surname>
                            <given-names>I</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Laayouni</surname>
                            <given-names>H</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Dobon</surname>
                            <given-names>B</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>MicroRNA Genetic Variation: From Population Analysis to Functional Implications of Three Allele Variants Associated with Cancer.</article-title>
                    <source>
						
                        <italic toggle="yes">Hum Mutat.</italic>
					</source>
                    <year>2016</year>;<volume>37</volume>(<issue>10</issue>):<fpage>1060</fpage>&#x2013;<lpage>73</lpage>.
                    <pub-id pub-id-type="pmid">27397105</pub-id>
                    <pub-id pub-id-type="doi">10.1002/humu.23045</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-22">
                <label>22</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Wu</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Jolicoeur</surname>
                            <given-names>N</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>Z</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Genetic variations of microRNAs in human cancer and their effects on the expression of miRNAs.</article-title>
                    <source>
						
                        <italic toggle="yes">Carcinogenesis.</italic>
					</source>
                    <year>2008</year>;<volume>29</volume>(<issue>9</issue>):<fpage>1710</fpage>&#x2013;<lpage>6</lpage>.
                    <pub-id pub-id-type="pmid">18356149</pub-id>
                    <pub-id pub-id-type="doi">10.1093/carcin/bgn073</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-23">
                <label>23</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Guerrero</surname>
                            <given-names>A</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Guerrero</surname>
                            <given-names>M</given-names>
                        </name>
					</person-group>:
                    <article-title>MicroRNAs asociados al C&#x00e1;ncer de Cuello Uterino y sus lesiones precursoras: Una revisi&#x00f3;n sistem&#x00e1;tica MicroRNAs associated with Cervical Cancer and its precursor lesions: A systematic Review.</article-title>
                    <source>
						
                        <italic toggle="yes">Rev Univ y Salud.</italic>
					</source>
                    <year>2016</year>;<volume>28</volume>(<issue>2</issue>):<fpage>1</fpage>&#x2013;<lpage>26</lpage>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.scielo.org.co/scielo.php?script=sci_arttext&amp;pid=S0124-71072016000200015">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-24">
                <label>24</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Kozomara</surname>
                            <given-names>A</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Griffiths-Jones</surname>
                            <given-names>S</given-names>
                        </name>
					</person-group>:
                    <article-title>miRBase: annotating high confidence microRNAs using deep sequencing data.</article-title>
                    <source>
						
                        <italic toggle="yes">Nucleic Acids Res.</italic>
					</source>
                    <year>2014</year>;<volume>42</volume>(<issue>Database issue</issue>):<fpage>D68</fpage>&#x2013;<lpage>73</lpage>.
                    <pub-id pub-id-type="pmid">24275495</pub-id>
                    <pub-id pub-id-type="doi">10.1093/nar/gkt1181</pub-id>
                    <pub-id pub-id-type="pmcid">3965103</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-25">
                <label>25</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Van Peer</surname>
                            <given-names>G</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Lefever</surname>
                            <given-names>S</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Anckaert</surname>
                            <given-names>J</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>miRBase Tracker: keeping track of microRNA annotation changes.</article-title>
                    <source>
						
                        <italic toggle="yes">Database (Oxford).</italic>
					</source>
                    <year>2014</year>;<volume>2014</volume>: pii: bau080.
                    <pub-id pub-id-type="pmid">25157074</pub-id>
                    <pub-id pub-id-type="doi">10.1093/database/bau080</pub-id>
                    <pub-id pub-id-type="pmcid">4142392</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-26">
                <label>26</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Kozomara</surname>
                            <given-names>A</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Griffiths-Jones</surname>
                            <given-names>S</given-names>
                        </name>
					</person-group>:
                    <article-title>miRBase: integrating microRNA annotation and deep-sequencing data.</article-title>
                    <source>
						
                        <italic toggle="yes">Nucleic Acids Res.</italic>
					</source>
                    <year>2011</year>;<volume>39</volume>(<issue>Database issue</issue>):<fpage>D152</fpage>&#x2013;<lpage>7</lpage>.
                    <pub-id pub-id-type="pmid">21037258</pub-id>
                    <pub-id pub-id-type="doi">10.1093/nar/gkq1027</pub-id>
                    <pub-id pub-id-type="pmcid">3013655</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-27">
                <label>27</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Hsu</surname>
                            <given-names>PW</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Huang</surname>
                            <given-names>HD</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Hsu</surname>
                            <given-names>SD</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>miRNAMap: genomic maps of microRNA genes and their target genes in mammalian genomes.</article-title>
                    <source>
						
                        <italic toggle="yes">Nucleic Acids Res.</italic>
					</source>
                    <year>2006</year>;<volume>34</volume>(<issue>Database issue</issue>):<fpage>D135</fpage>&#x2013;<lpage>9</lpage>.
                    <pub-id pub-id-type="pmid">16381831</pub-id>
                    <pub-id pub-id-type="doi">10.1093/nar/gkj135</pub-id>
                    <pub-id pub-id-type="pmcid">1347497</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-28">
                <label>28</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Guerrero Fl&#x00f3;rez</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Guerrero G&#x00f3;mez</surname>
                            <given-names>OA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Mena Huertas</surname>
                            <given-names>J</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Dataset 1 in: Mapping of microRNAs related to cervical cancer in Latin American human genomic variants.</article-title>
                    <source>
						
                        <italic toggle="yes">F1000Research.</italic>
					</source>
                    <year>2017</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.5256/f1000research.10138.d164732">http://www.doi.org/10.5256/f1000research.10138.d164732</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-29">
                <label>29</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <collab>1000 Genomes Project Consortium, </collab>
						
                        <name name-style="western">
                            <surname>Abecasis</surname>
                            <given-names>GR</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Auton</surname>
                            <given-names>A</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>An integrated map of genetic variation from 1,092 human genomes.</article-title>
                    <source>
						
                        <italic toggle="yes">Nature.</italic>
						</source>
                    <year>2012</year>;<volume>491</volume>(<issue>7422</issue>):<fpage>56</fpage>&#x2013;<lpage>65</lpage>.
                    <pub-id pub-id-type="pmid">23128226</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nature11632</pub-id>
                    <pub-id pub-id-type="pmcid">3498066</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-30">
                <label>30</label>
                <mixed-citation publication-type="journal">
                    <collab>International HapMap Consortium</collab>:
                    <article-title>The International HapMap Project.</article-title>
                    <source>
						
                        <italic toggle="yes">Nature.</italic>
					</source>
                    <year>2003</year>;<volume>426</volume>(<issue>6968</issue>):<fpage>789</fpage>&#x2013;<lpage>96</lpage>.
                    <pub-id pub-id-type="pmid">14685227</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nature02168</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-31">
                <label>31</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Karolchik</surname>
                            <given-names>D</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Hinrichs</surname>
                            <given-names>AS</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Kent</surname>
                            <given-names>WJ</given-names>
                        </name>
					</person-group>:
                    <article-title>The UCSC Genome Browser.</article-title>
                    <source>
						
                        <italic toggle="yes">Curr Protoc Bioinformatics.</italic>
					</source>
                    <year>2009</year>; Chapter 1: Unit1.4.
                    <pub-id pub-id-type="pmid">19957273</pub-id>
                    <pub-id pub-id-type="doi">10.1002/0471250953.bi0104s28</pub-id>
                    <pub-id pub-id-type="pmcid">2834533</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-32">
                <label>32</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Karolchik</surname>
                            <given-names>D</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Baertsch</surname>
                            <given-names>R</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Diekhans</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>The UCSC Genome Browser Database.</article-title>
                    <source>
					
                        <italic toggle="yes">Nucleic Acids Res.</italic>
					</source>
                    <year>2003</year>;<volume>31</volume>(<issue>1</issue>):<fpage>51</fpage>&#x2013;<lpage>4</lpage>.
                    <pub-id pub-id-type="pmid">12519945</pub-id>
                    <pub-id pub-id-type="doi">10.1093/nar/gkg129</pub-id>
                    <pub-id pub-id-type="pmcid">165576</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-33">
                <label>33</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Apweiler</surname>
                            <given-names>R</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Bairoch</surname>
                            <given-names>A</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Wu</surname>
                            <given-names>CH</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>UniProt: the Universal Protein knowledgebase.</article-title>
                    <source>
						
                        <italic toggle="yes">Nucleic Acids Res.</italic>
					</source>
                    <year>2004</year>;<volume>32</volume>(<issue>Database issue</issue>):<fpage>D115</fpage>&#x2013;<lpage>9</lpage>.
                    <pub-id pub-id-type="pmid">14681372</pub-id>
                    <pub-id pub-id-type="doi">10.1093/nar/gkh131</pub-id>
                    <pub-id pub-id-type="pmcid">308865</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-34">
                <label>34</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Magrane</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <collab>UniProt Consortium</collab>
					</person-group>:
                    <article-title>UniProt Knowledgebase: a hub of integrated protein data.</article-title>
                    <source>
						
                        <italic toggle="yes">Database (Oxford).</italic>
					</source>
                    <year>2011</year>;<volume>2011</volume>:<fpage>bar009</fpage>.
                    <pub-id pub-id-type="pmid">21447597</pub-id>
                    <pub-id pub-id-type="doi">10.1093/database/bar009</pub-id>
                    <pub-id pub-id-type="pmcid">3070428</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-35">
                <label>35</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Xia</surname>
                            <given-names>H</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>F</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>He</surname>
                            <given-names>T</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Distribution of Mature MicroRNA on Its Precursor: A New Character for MicroRNA Prediction.</article-title>
                    <source>
						
                        <italic toggle="yes">Int J Inf Technol.</italic>
					</source>
                    <year>2005</year>;<volume>11</volume>(<issue>8</issue>).
                    <ext-link ext-link-type="uri" xlink:href="http://intjit.org/cms/journal/volume/11/8/118_1.pdf">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-36">
                <label>36</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Guerrero Fl&#x00f3;rez</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Guerrero G&#x00f3;mez</surname>
                            <given-names>OA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Mena Huertas</surname>
                            <given-names>J</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Dataset 2 in: Mapping of microRNAs related to cervical cancer in Latin American human genomic variants.</article-title>
                    <source>
						
                        <italic toggle="yes">F1000Research.</italic>
					</source>
                    <year>2018</year>;<volume>6</volume>:<fpage>946</fpage>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.5256/f1000research.10138.d217286">http://www.doi.org/10.5256/f1000research.10138.d217286</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-37">
                <label>37</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Crooks</surname>
                            <given-names>GE</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Hon</surname>
                            <given-names>G</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Chandonia</surname>
                            <given-names>JM</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>WebLogo: a sequence logo generator.</article-title>
                    <source>
						
                        <italic toggle="yes">Genome Res.</italic>
					</source>
                    <year>2004</year>;<volume>14</volume>(<issue>6</issue>):<fpage>1188</fpage>&#x2013;<lpage>90</lpage>.
                    <pub-id pub-id-type="pmid">15173120</pub-id>
                    <pub-id pub-id-type="doi">10.1101/gr.849004</pub-id>
                    <pub-id pub-id-type="pmcid">419797</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-38">
                <label>38</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Kuo</surname>
                            <given-names>WT</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Su</surname>
                            <given-names>MW</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Lee</surname>
                            <given-names>YL</given-names>
                        </name>												
						
                        <etal/>
					</person-group>:
                    <article-title>Bioinformatic Interrogation of 5p-arm and 3p-arm Specific miRNA Expression Using TCGA Datasets.</article-title>
                    <source>
						
                        <italic toggle="yes">J Clin Med.</italic>
					</source>
                    <year>2015</year>;<volume>4</volume>(<issue>9</issue>):<fpage>1798</fpage>&#x2013;<lpage>814</lpage>.
                    <pub-id pub-id-type="pmid">26389959</pub-id>
                    <pub-id pub-id-type="doi">10.3390/jcm4091798</pub-id>
                    <pub-id pub-id-type="pmcid">4600160</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-39">
                <label>39</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Mu&#x00f1;oz</surname>
                            <given-names>N</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Bravo</surname>
                            <given-names>LE</given-names>
                        </name>
					</person-group>:
                    <article-title>Epidemiology of cervical cancer in Colombia.</article-title>
                    <source>
						
                        <italic toggle="yes">Salud Publica Mex.</italic>
					</source>
                    <year>2014</year>;<volume>56</volume>(<issue>5</issue>):<fpage>431</fpage>&#x2013;<lpage>9</lpage>.
                    <pub-id pub-id-type="pmid">25604289</pub-id>
                    <pub-id pub-id-type="doi">10.21149/spm.v56i5.7368</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-40">
                <label>40</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Angulo</surname>
                            <given-names>A</given-names>
                        </name>
					</person-group>:
                    <article-title>Analisis bioinformatico de secuencias L1, E6, E7 de VPH de alto y bajo riesgo m&#x00e1;s frecuentes Latinoamerica</article-title>. Universidad de Nari&#x00f1;o;<year>2014</year>.</mixed-citation>
            </ref>
            <ref id="ref-41">
                <label>41</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Sanchez</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Suarez</surname>
                            <given-names>K</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Yepez</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Infecci&#x00f3;n por VPH en mujeres del municipio de Pasto, Colombia con resultados de citolog&#x00ed;a normal.</article-title>
                    <source>
						
                        <italic toggle="yes">Rev Univ y Salud.</italic>
					</source>
                    <year>2013</year>;<volume>15</volume>(<issue>1</issue>):<fpage>7</fpage>&#x2013;<lpage>21</lpage>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.scielo.org.co/pdf/reus/v15n1/v15n1a02.pdf">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-42">
                <label>42</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Nicola</surname>
                            <given-names>SN</given-names>
                        </name>
					</person-group>:
                    <article-title>Tipificaci&#x00f3;n del Virus del Papiloma Humano-VPH y su relaci&#x00f3;n con caracter&#x00ed;sticas poblacionales y lesiones en C&#x00e1;ncer de Cuello Uterino en mujeres del Municipio de Pasto</article-title>. Universidad de Nari&#x00f1;o;<year>2014</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://sired.udenar.edu.co/3239/">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-43">
                <label>43</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Bodelon</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Untereiner</surname>
                            <given-names>ME</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Machiela</surname>
                            <given-names>MJ</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Genomic characterization of viral integration sites in HPV-related cancers.</article-title>
                    <source>
						
                        <italic toggle="yes">Int J Cancer.</italic>
					</source>
                    <year>2016</year>;<volume>139</volume>(<issue>9</issue>):<fpage>2001</fpage>&#x2013;<lpage>11</lpage>.
                    <pub-id pub-id-type="pmid">27343048</pub-id>
                    <pub-id pub-id-type="doi">10.1002/ijc.30243</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-44">
                <label>44</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Soto-De Leon</surname>
                            <given-names>SC</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Camargo</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Sanchez</surname>
                            <given-names>R</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Prevalence of infection with high-risk human papillomavirus in women in Colombia.</article-title>
                    <source>
						
                        <italic toggle="yes">Clin Microbiol Infect.</italic>
					</source>
                    <year>2009</year>;<volume>15</volume>(<issue>1</issue>):<fpage>100</fpage>&#x2013;<lpage>2</lpage>.
                    <pub-id pub-id-type="pmid">19154481</pub-id>
                    <pub-id pub-id-type="doi">10.1111/j.1469-0691.2008.02120.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-45">
                <label>45</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Kraus</surname>
                            <given-names>I</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Driesch</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Vinokurova</surname>
                            <given-names>S</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>The majority of viral-cellular fusion transcripts in cervical carcinomas cotranscribe cellular sequences of known or predicted genes.</article-title>
                    <source>
						
                        <italic toggle="yes">Cancer Res.</italic>
					</source>
                    <year>2008</year>;<volume>68</volume>(<issue>7</issue>):<fpage>2514</fpage>&#x2013;<lpage>22</lpage>.
                    <pub-id pub-id-type="pmid">18381461</pub-id>
                    <pub-id pub-id-type="doi">10.1158/0008-5472.CAN-07-2776</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-46">
                <label>46</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Thorland</surname>
                            <given-names>EC</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Myers</surname>
                            <given-names>SL</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Gostout</surname>
                            <given-names>BS</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Common fragile sites are preferential targets for HPV16 integrations in cervical tumors.</article-title>
                    <source>
						
                        <italic toggle="yes">Oncogene.</italic>
					</source>
                    <year>2003</year>;<volume>22</volume>(<issue>8</issue>):<fpage>1225</fpage>&#x2013;<lpage>37</lpage>.
                    <pub-id pub-id-type="pmid">12606949</pub-id>
                    <pub-id pub-id-type="doi">10.1038/sj.onc.1206170</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-47">
                <label>47</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Dall</surname>
                            <given-names>KL</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Scarpini</surname>
                            <given-names>CG</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Roberts</surname>
                            <given-names>I</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Characterization of naturally occurring HPV16 integration sites isolated from cervical keratinocytes under noncompetitive conditions.</article-title>
                    <source>
						
                        <italic toggle="yes">Cancer Res.</italic>
					</source>
                    <year>2008</year>;<volume>68</volume>(<issue>20</issue>):<fpage>8249</fpage>&#x2013;<lpage>59</lpage>.
                    <pub-id pub-id-type="pmid">18922896</pub-id>
                    <pub-id pub-id-type="doi">10.1158/0008-5472.CAN-08-1741</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-48">
                <label>48</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Ferber</surname>
                            <given-names>MJ</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Thorland</surname>
                            <given-names>EC</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Brink</surname>
                            <given-names>AA</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Preferential integration of human papillomavirus type 18 near the 
                        <italic toggle="yes">c-myc</italic> locus in cervical carcinoma.</article-title>
                    <source>
						
                        <italic toggle="yes">Oncogene.</italic>
					</source>
                    <year>2003</year>;<volume>22</volume>(<issue>46</issue>):<fpage>7233</fpage>&#x2013;<lpage>42</lpage>.
                    <pub-id pub-id-type="pmid">14562053</pub-id>
                    <pub-id pub-id-type="doi">10.1038/sj.onc.1207006</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-49">
                <label>49</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Haws</surname>
                            <given-names>BT</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Cui</surname>
                            <given-names>W</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Persons</surname>
                            <given-names>DL</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Clinical and Pathologic Correlation of Increased 
                        <italic toggle="yes">MYC</italic> Gene Copy Number in Diffuse Large B-Cell Lymphoma.</article-title>
                    <source>
						
                        <italic toggle="yes">Clin Lymphoma Myeloma Leuk.</italic>
					</source>
                    <year>2016</year>;<volume>16</volume>(<issue>12</issue>):<fpage>679</fpage>&#x2013;<lpage>683</lpage>.
                    <pub-id pub-id-type="pmid">27633159</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.clml.2016.08.017</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-50">
                <label>50</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Lee</surname>
                            <given-names>KS</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Kwak</surname>
                            <given-names>Y</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Nam</surname>
                            <given-names>KH</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Favorable prognosis in colorectal cancer patients with co-expression of c-MYC and &#x00df;-catenin.</article-title>
                    <source>
						
                        <italic toggle="yes">BMC Cancer.</italic>
					</source>
                    <year>2016</year>;<volume>16</volume>(<issue>1</issue>):<fpage>730</fpage>.
                    <pub-id pub-id-type="pmid">27619912</pub-id>
                    <pub-id pub-id-type="doi">10.1186/s12885-016-2770-7</pub-id>
                    <pub-id pub-id-type="pmcid">5020485</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-51">
                <label>51</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Wolfer</surname>
                            <given-names>A</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Wittner</surname>
                            <given-names>BS</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Irimia</surname>
                            <given-names>D</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>MYC regulation of a &#x201c;poor-prognosis&#x201d; metastatic cancer cell state.</article-title>
                    <source>
						
                        <italic toggle="yes">Proc Natl Acad Sci U S A.</italic>
					</source>
                    <year>2010</year>;<volume>107</volume>(<issue>8</issue>):<fpage>3698</fpage>&#x2013;<lpage>703</lpage>.
                    <pub-id pub-id-type="pmid">20133671</pub-id>
                    <pub-id pub-id-type="doi">10.1073/pnas.0914203107</pub-id>
                    <pub-id pub-id-type="pmcid">2840447</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-52">
                <label>52</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Rao</surname>
                            <given-names>PH</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Arias-Pulido</surname>
                            <given-names>H</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Lu</surname>
                            <given-names>XY</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Chromosomal amplifications, 3q gain and deletions of 2q33-q37 are the frequent genetic changes in cervical carcinoma.</article-title>
                    <source>
						
                        <italic toggle="yes">BMC Cancer.</italic>
					</source>
                    <year>2004</year>;<volume>4</volume>(<issue>1</issue>):<fpage>5</fpage>.
                    <pub-id pub-id-type="pmid">15018632</pub-id>
                    <pub-id pub-id-type="doi">10.1186/1471-2407-4-5</pub-id>
                    <pub-id pub-id-type="pmcid">356916</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-53">
                <label>53</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Wilting</surname>
                            <given-names>SM</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Snijders</surname>
                            <given-names>PJ</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Verlaat</surname>
                            <given-names>W</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Altered microRNA expression associated with chromosomal changes contributes to cervical carcinogenesis.</article-title>
                    <source>
						
                        <italic toggle="yes">Oncogene.</italic>
					</source>
                    <year>2013</year>;<volume>32</volume>(<issue>1</issue>):<fpage>106</fpage>&#x2013;<lpage>16</lpage>.
                    <pub-id pub-id-type="pmid">22330141</pub-id>
                    <pub-id pub-id-type="doi">10.1038/onc.2012.20</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-54">
                <label>54</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Reshmi</surname>
                            <given-names>G</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Chandra</surname>
                            <given-names>SS</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Babu</surname>
                            <given-names>VJ</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Identification and analysis of novel microRNAs from fragile sites of human cervical cancer: computational and experimental approach.</article-title>
                    <source>
						
                        <italic toggle="yes">Genomics.</italic>
					</source>
                    <year>2011</year>;<volume>97</volume>(<issue>6</issue>):<fpage>333</fpage>&#x2013;<lpage>40</lpage>.
                    <pub-id pub-id-type="pmid">21377523</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.ygeno.2011.02.010</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-55">
                <label>55</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Peter</surname>
                            <given-names>ME</given-names>
                        </name>
					</person-group>:
                    <article-title>Targeting of mRNAs by multiple miRNAs: the next step.</article-title>
                    <source>
						
                        <italic toggle="yes">Oncogene.</italic>
					</source>
                    <year>2010</year>;<volume>29</volume>(<issue>15</issue>):<fpage>2161</fpage>&#x2013;<lpage>4</lpage>.
                    <pub-id pub-id-type="pmid">20190803</pub-id>
                    <pub-id pub-id-type="doi">10.1038/onc.2010.59</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-56">
                <label>56</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Carleton</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Cleary</surname>
                            <given-names>MA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Linsley</surname>
                            <given-names>PS</given-names>
                        </name>
					</person-group>:
                    <article-title>MicroRNAs and cell cycle regulation.</article-title>
                    <source>
						
                        <italic toggle="yes">Cell Cycle.</italic>
					</source>
                    <year>2007</year>;<volume>6</volume>(<issue>17</issue>):<fpage>2127</fpage>&#x2013;<lpage>32</lpage>.
                    <pub-id pub-id-type="pmid">17786041</pub-id>
                    <pub-id pub-id-type="doi">10.4161/cc.6.17.4641</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-57">
                <label>57</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Devi</surname>
                            <given-names>KJ</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Chakraborty</surname>
                            <given-names>S</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Deb</surname>
                            <given-names>B</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Computational identification and functional annotation of microRNAs and their targets from expressed sequence tags (ESTs) and genome survey sequences (GSSs) of coffee (
                        <italic toggle="yes">Coffea arabica</italic> L.).</article-title>
                    <source>
						
                        <italic toggle="yes">Plant Gene.</italic>
					</source>
                    <year>2016</year>;<volume>6</volume>:<fpage>30</fpage>&#x2013;<lpage>42</lpage>.
                    <pub-id pub-id-type="doi">10.1016/j.plgene.2016.03.001</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-58">
                <label>58</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Trafton</surname>
                            <given-names>A</given-names>
                        </name>
					</person-group>:
                    <article-title>Shrinking tumors with an RNA triple-helix hydrogel glue</article-title>.<year>2015</year>;<fpage>1</fpage>&#x2013;<lpage>3</lpage>.
                    <ext-link ext-link-type="uri" xlink:href="https://medicalxpress.com/pdf368706744.pdf">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-59">
                <label>59</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Conde</surname>
                            <given-names>J</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Oliva</surname>
                            <given-names>N</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Atilano</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Self-assembled RNA-triple-helix hydrogel scaffold for microRNA modulation in the tumour microenvironment.</article-title>
                    <source>
						
                        <italic toggle="yes">Nat Mater.</italic>
					</source>
                    <year>2016</year>;<volume>15</volume>(<issue>3</issue>):<fpage>353</fpage>&#x2013;<lpage>63</lpage>.
                    <pub-id pub-id-type="pmid">26641016</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nmat4497</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-60">
                <label>60</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Kertesz</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Iovino</surname>
                            <given-names>N</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Unnerstall</surname>
                            <given-names>U</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>The role of site accessibility in microRNA target recognition.</article-title>
                    <source>
						
                        <italic toggle="yes">Nat Genet.</italic>
					</source>
                    <year>2007</year>;<volume>39</volume>(<issue>10</issue>):<fpage>1278</fpage>&#x2013;<lpage>84</lpage>.
                    <pub-id pub-id-type="pmid">17893677</pub-id>
                    <pub-id pub-id-type="doi">10.1038/ng2135</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-61">
                <label>61</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Bulik-Sullivan</surname>
                            <given-names>B</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Selitsky</surname>
                            <given-names>S</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Sethupathy</surname>
                            <given-names>P</given-names>
                        </name>
					</person-group>:
                    <article-title>Prioritization of genetic variants in the microRNA regulome as functional candidates in genome-wide association studies.</article-title>
                    <source>
						
                        <italic toggle="yes">Hum Mutat.</italic>
					</source>
                    <year>2013</year>;<volume>34</volume>(<issue>8</issue>):<fpage>1049</fpage>&#x2013;<lpage>56</lpage>.
                    <pub-id pub-id-type="pmid">23595788</pub-id>
                    <pub-id pub-id-type="doi">10.1002/humu.22337</pub-id>
                    <pub-id pub-id-type="pmcid">3807557</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-62">
                <label>62</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Slezak-Prochazka</surname>
                            <given-names>I</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Kluiver</surname>
                            <given-names>J</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>de Jong</surname>
                            <given-names>D</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Cellular localization and processing of primary transcripts of exonic microRNAs</article-title>. Wilusz CJ, editor.
                    <source>
					
                        <italic toggle="yes">PLoS One.</italic>
	</source>
                    <year>2013</year>;<volume>8</volume>(<issue>9</issue>):<fpage>e76647</fpage>.
                    <pub-id pub-id-type="pmid">24073292</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0076647</pub-id>
                    <pub-id pub-id-type="pmcid">3779153</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-63">
                <label>63</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Concepcion</surname>
                            <given-names>CP</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Bonetti</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Ventura</surname>
                            <given-names>A</given-names>
                        </name>
					</person-group>:
                    <article-title>The microRNA-17-92 family of microRNA clusters in development and disease.</article-title>
                    <source>
						
                        <italic toggle="yes">Cancer J.</italic>
					</source>
                    <year>2012</year>;<volume>18</volume>(<issue>3</issue>):<fpage>262</fpage>&#x2013;<lpage>7</lpage>.
                    <pub-id pub-id-type="pmid">22647363</pub-id>
                    <pub-id pub-id-type="doi">10.1097/PPO.0b013e318258b60a</pub-id>
                    <pub-id pub-id-type="pmcid">3592780</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-64">
                <label>64</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Altuvia</surname>
                            <given-names>Y</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Landgraf</surname>
                            <given-names>P</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Lithwick</surname>
                            <given-names>G</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Clustering and conservation patterns of human microRNAs.</article-title>
                    <source>
						
                        <italic toggle="yes">Nucleic Acids Res.</italic>
					</source>
                    <year>2005</year>;<volume>33</volume>(<issue>8</issue>):<fpage>2697</fpage>&#x2013;<lpage>706</lpage>.
                    <pub-id pub-id-type="pmid">15891114</pub-id>
                    <pub-id pub-id-type="doi">10.1093/nar/gki567</pub-id>
                    <pub-id pub-id-type="pmcid">1110742</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-65">
                <label>65</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Cai</surname>
                            <given-names>N</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>YD</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Zheng</surname>
                            <given-names>PS</given-names>
                        </name>
					</person-group>:
                    <article-title>The microRNA-302-367 cluster suppresses the proliferation of cervical carcinoma cells through the novel target AKT1.</article-title>
                    <source>
						
                        <italic toggle="yes">RNA.</italic>
					</source>
                    <year>2013</year>;<volume>19</volume>(<issue>1</issue>):<fpage>85</fpage>&#x2013;<lpage>95</lpage>.
                    <pub-id pub-id-type="pmid">23185040</pub-id>
                    <pub-id pub-id-type="doi">10.1261/rna.035295.112</pub-id>
                    <pub-id pub-id-type="pmcid">3527729</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-66">
                <label>66</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Ivashchenko</surname>
                            <given-names>A</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Berillo</surname>
                            <given-names>O</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Pyrkova</surname>
                            <given-names>A</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>The properties of binding sites of miR-619-5p, miR-5095, miR-5096, and miR-5585-3p in the mRNAs of human genes.</article-title>
                    <source>
						
                        <italic toggle="yes">Biomed Res Int.</italic>
					</source>
                    <year>2014</year>;<volume>2014</volume>: 720715.
                    <pub-id pub-id-type="pmid">25162022</pub-id>
                    <pub-id pub-id-type="doi">10.1155/2014/720715</pub-id>
                    <pub-id pub-id-type="pmcid">4137733</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-67">
                <label>67</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Ivashchenko</surname>
                            <given-names>A</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Berillo</surname>
                            <given-names>O</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Pyrkova</surname>
                            <given-names>A</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>The arrangements of the locations of miR-619, miR-5095, miR-5096 and miR-5585 binding sites in the human mRNAs.</article-title>
                    <source>
						
                        <italic toggle="yes">Recent Adv Biomed Chem Eng Mater Sci.</italic>
					</source>
                    <year>2014</year>;<fpage>144</fpage>&#x2013;<lpage>9</lpage>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.inase.org/library/2014/venice/bypaper/BICHE/BICHE-26.pdf">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-68">
                <label>68</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Ivashchenko</surname>
                            <given-names>A</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Berillo</surname>
                            <given-names>O</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Pyrkova</surname>
                            <given-names>A</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>The Binding Sites of miR-619-5p, miR-5095, miR-5096 and miR-5585-3p in the Human mRNAs.</article-title>In
                    <italic toggle="yes">Proceedings IWBBIO</italic>.<year>2014</year>;<fpage>1674</fpage>&#x2013;<lpage>1684</lpage>.
                    <ext-link ext-link-type="uri" xlink:href="https://pdfs.semanticscholar.org/ea53/e208594b28647a9f57e28344034d8195779a.pdf">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-69">
                <label>69</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Schmitz</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Driesch</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Beer-Grondke</surname>
                            <given-names>K</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Loss of gene function as a consequence of human papillomavirus DNA integration.</article-title>
                    <source>
						
                        <italic toggle="yes">Int J Cancer.</italic>
					</source>
                    <year>2012</year>;<volume>131</volume>(<issue>5</issue>):<fpage>E593</fpage>&#x2013;<lpage>602</lpage>.
                    <pub-id pub-id-type="pmid">22262398</pub-id>
                    <pub-id pub-id-type="doi">10.1002/ijc.27433</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-70">
                <label>70</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Dweep</surname>
                            <given-names>H</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Sticht</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Gretz</surname>
                            <given-names>N</given-names>
                        </name>
					</person-group>:
                    <article-title>
                        <italic toggle="yes">In-Silico</italic> Algorithms for the Screening of Possible microRNA Binding Sites and Their Interactions.</article-title>
                    <source>
						
                        <italic toggle="yes">Curr Genomics.</italic>
					</source>
                    <year>2013</year>;<volume>14</volume>(<issue>2</issue>):<fpage>127</fpage>&#x2013;<lpage>36</lpage>.
                    <pub-id pub-id-type="pmid">24082822</pub-id>
                    <pub-id pub-id-type="doi">10.2174/1389202911314020005</pub-id>
                    <pub-id pub-id-type="pmcid">3637677</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-71">
                <label>71</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Palmero</surname>
                            <given-names>EI</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>de Campos</surname>
                            <given-names>SG</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Campos</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Mechanisms and role of microRNA deregulation in cancer onset and progression.</article-title>
                    <source>
						
                        <italic toggle="yes">Genet Mol Biol.</italic>
					</source>
                    <year>2011</year>;<volume>34</volume>(<issue>3</issue>):<fpage>363</fpage>&#x2013;<lpage>70</lpage>.
                    <pub-id pub-id-type="pmid">21931505</pub-id>
                    <pub-id pub-id-type="doi">10.1590/S1415-47572011000300001</pub-id>
                    <pub-id pub-id-type="pmcid">3168173</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-72">
                <label>72</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Choo</surname>
                            <given-names>KB</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Soon</surname>
                            <given-names>YL</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Nguyen</surname>
                            <given-names>PN</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>MicroRNA-5p and -3p co-expression and cross-targeting in colon cancer cells.</article-title>
                    <source>
						
                        <italic toggle="yes">J Biomed Sci.</italic>
					</source>
                    <year>2014</year>;<volume>21</volume>(<issue>1</issue>):<fpage>95</fpage>.
                    <pub-id pub-id-type="pmid">25287248</pub-id>
                    <pub-id pub-id-type="doi">10.1186/s12929-014-0095-x</pub-id>
                    <pub-id pub-id-type="pmcid">4195866</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-73">
                <label>73</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Han</surname>
                            <given-names>Y</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Xu</surname>
                            <given-names>GX</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Lu</surname>
                            <given-names>H</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Dysregulation of miRNA-21 and their potential as biomarkers for the diagnosis of cervical cancer.</article-title>
                    <source>
						
                        <italic toggle="yes">Int J Clin Exp Pathol.</italic>
					</source>
                    <year>2015</year>;<volume>8</volume>(<issue>6</issue>):<fpage>7131</fpage>&#x2013;<lpage>9</lpage>.
                    <pub-id pub-id-type="pmid">26261606</pub-id>
                    <pub-id pub-id-type="pmcid">4525940</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-74">
                <label>74</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Uchino</surname>
                            <given-names>K</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Takeshita</surname>
                            <given-names>F</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Takahashi</surname>
                            <given-names>RU</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Therapeutic effects of microRNA-582-5p and -3p on the inhibition of bladder cancer progression.</article-title>
                    <source>
						
                        <italic toggle="yes">Mol Ther.</italic>
					</source>
                    <year>2013</year>;<volume>21</volume>(<issue>3</issue>):<fpage>610</fpage>&#x2013;<lpage>9</lpage>.
                    <pub-id pub-id-type="pmid">23295946</pub-id>
                    <pub-id pub-id-type="doi">10.1038/mt.2012.269</pub-id>
                    <pub-id pub-id-type="pmcid">3589153</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-75">
                <label>75</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Mlcochova</surname>
                            <given-names>J</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Faltejskova-Vychytilova</surname>
                            <given-names>P</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Ferracin</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>MicroRNA expression profiling identifies miR-31-5p/3p as associated with time to progression in wild-type RAS metastatic colorectal cancer treated with cetuximab.</article-title>
                    <source>
						
                        <italic toggle="yes">Oncotarget.</italic>
					</source>
                    <year>2015</year>;<volume>6</volume>(<issue>36</issue>):<fpage>38695</fpage>&#x2013;<lpage>704</lpage>.
                    <pub-id pub-id-type="pmid">26497852</pub-id>
                    <pub-id pub-id-type="doi">10.18632/oncotarget.5735</pub-id>
                    <pub-id pub-id-type="pmcid">4770730</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-76">
                <label>76</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Muti</surname>
                            <given-names>P</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Sacconi</surname>
                            <given-names>A</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Hossain</surname>
                            <given-names>A</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Downregulation of microRNAs 145-3p and 145-5p is a long-term predictor of postmenopausal breast cancer risk: The ORDET prospective study.</article-title>
                    <source>
						
                        <italic toggle="yes">Cancer Epidemiol Biomarkers Prev.</italic>
					</source>
                    <year>2014</year>;<volume>23</volume>(<issue>11</issue>):<fpage>2471</fpage>&#x2013;<lpage>81</lpage>.
                    <pub-id pub-id-type="pmid">25073626</pub-id>
                    <pub-id pub-id-type="doi">10.1158/1055-9965.EPI-14-0398</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-77">
                <label>77</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Lou</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Xiao</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Cheng</surname>
                            <given-names>S</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>MiR-485-3p and miR-485-5p suppress breast cancer cell metastasis by inhibiting PGC-1&#x03b1; expression.</article-title>
                    <source>
						
                        <italic toggle="yes">Cell Death Dis.</italic>
					</source>
                    <year>2016</year>;<volume>7</volume>(<issue>3</issue>):<fpage>e2159</fpage>.
                    <pub-id pub-id-type="pmid">27010860</pub-id>
                    <pub-id pub-id-type="doi">10.1038/cddis.2016.27</pub-id>
                    <pub-id pub-id-type="pmcid">4823935</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-78">
                <label>78</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Watanabe</surname>
                            <given-names>Y</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Tomita</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Kanai</surname>
                            <given-names>A</given-names>
                        </name>
					</person-group>:
                    <article-title>Computational methods for microRNA target prediction.</article-title>
                    <source>
						
                        <italic toggle="yes">Methods Enzymol.</italic>
					</source>
                    <year>2007</year>;<volume>427</volume>:<fpage>65</fpage>&#x2013;<lpage>86</lpage>.
                    <pub-id pub-id-type="pmid">17720479</pub-id>
                    <pub-id pub-id-type="doi">10.1016/S0076-6879(07)27004-1</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-79">
                <label>79</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Pritchard</surname>
                            <given-names>CC</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Cheng</surname>
                            <given-names>HH</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Tewari</surname>
                            <given-names>M</given-names>
                        </name>
					</person-group>:
                    <article-title>MicroRNA profiling: approaches and considerations.</article-title>
                    <source>
						
                        <italic toggle="yes">Nat Rev Genet.</italic>
					</source>
                    <year>2012</year>;<volume>13</volume>(<issue>5</issue>):<fpage>358</fpage>&#x2013;<lpage>69</lpage>.
                    <pub-id pub-id-type="pmid">22510765</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nrg3198</pub-id>
                    <pub-id pub-id-type="pmcid">4517822</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-80">
                <label>80</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>N</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Xu</surname>
                            <given-names>Z</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>K</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Construction and analysis of regulatory genetic networks in cervical cancer based on involved microRNAs, target genes, transcription factors and host genes.</article-title>
                    <source>
						
                        <italic toggle="yes">Oncol Lett.</italic>
					</source>
                    <year>2014</year>;<volume>7</volume>(<issue>4</issue>):<fpage>1279</fpage>&#x2013;<lpage>83</lpage>.
                    <pub-id pub-id-type="pmid">24944708</pub-id>
                    <pub-id pub-id-type="doi">10.3892/ol.2014.1814</pub-id>
                    <pub-id pub-id-type="pmcid">3961274 </pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-81">
                <label>81</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Yin</surname>
                            <given-names>Y</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Song</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Gu</surname>
                            <given-names>B</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Systematic analysis of key miRNAs and related signaling pathways in colorectal tumorigenesis.</article-title>
                    <source>
						
                        <italic toggle="yes">Gene.</italic>
					</source>
                    <year>2016</year>;<volume>578</volume>(<issue>2</issue>):<fpage>177</fpage>&#x2013;<lpage>84</lpage>.
                    <pub-id pub-id-type="pmid">26692142</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.gene.2015.12.015</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-82">
                <label>82</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Hayes</surname>
                            <given-names>J</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Peruzzi</surname>
                            <given-names>PP</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Lawler</surname>
                            <given-names>S</given-names>
                        </name>
					</person-group>:
                    <article-title>MicroRNAs in cancer: biomarkers, functions and therapy.</article-title>
                    <source>
						
                        <italic toggle="yes">Trends Mol Med.</italic>
					</source>
                    <year>2014</year>;<volume>20</volume>(<issue>8</issue>):<fpage>460</fpage>&#x2013;<lpage>9</lpage>.
                    <pub-id pub-id-type="pmid">25027972</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.molmed.2014.06.005</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-83">
                <label>83</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Ma</surname>
                            <given-names>Q</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Wan</surname>
                            <given-names>G</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>S</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Serum microRNA-205 as a novel biomarker for cervical cancer patients.</article-title>
                    <source>
						
                        <italic toggle="yes">Cancer Cell Int.</italic>
					</source>
                    <year>2014</year>;<volume>14</volume>:<fpage>81</fpage>.
                    <pub-id pub-id-type="pmid">25788864</pub-id>
                    <pub-id pub-id-type="doi">10.1186/s12935-014-0081-0</pub-id>
                    <pub-id pub-id-type="pmcid">4364049</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-84">
                <label>84</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Mu</surname>
                            <given-names>W</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Zhang</surname>
                            <given-names>W</given-names>
                        </name>
					</person-group>:
                    <article-title>Bioinformatic Resources of microRNA Sequences, Gene Targets, and Genetic Variation.</article-title>
                    <source>
						
                        <italic toggle="yes">Front Genet.</italic>
					</source>
                    <year>2012</year>;<volume>3</volume>: 31.
                    <pub-id pub-id-type="pmid">22403585</pub-id>
                    <pub-id pub-id-type="doi">10.3389/fgene.2012.00031</pub-id>
                    <pub-id pub-id-type="pmcid">3293225</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-85">
                <label>85</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Mi</surname>
                            <given-names>Y</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>L</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Zong</surname>
                            <given-names>L</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Genetic variants in microRNA target sites of 37 selected cancer-related genes and the risk of cervical cancer.</article-title>
                    <source>
						
                        <italic toggle="yes">PLoS One.</italic>
					</source>
                    <year>2014</year>;<volume>9</volume>(<issue>1</issue>):<fpage>e86061</fpage>.
                    <pub-id pub-id-type="pmid">24465869</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0086061</pub-id>
                    <pub-id pub-id-type="pmcid">3899132</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-86">
                <label>86</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Hu</surname>
                            <given-names>Y</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Yu</surname>
                            <given-names>CY</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>JL</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>MicroRNA sequence polymorphisms and the risk of different types of cancer.</article-title>
                    <source>
						
                        <italic toggle="yes">Sci Rep.</italic>
					</source>
                    <year>2014</year>;<volume>4</volume>: 3648.
                    <pub-id pub-id-type="pmid">24413317</pub-id>
                    <pub-id pub-id-type="doi">10.1038/srep03648</pub-id>
                    <pub-id pub-id-type="pmcid">5379157</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-87">
                <label>87</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Homburger</surname>
                            <given-names>JR</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Moreno-Estrada</surname>
                            <given-names>A</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Gignoux</surname>
                            <given-names>CR</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Genomic Insights into the Ancestry and Demographic History of South America.</article-title>
                    <source>
						
                        <italic toggle="yes">PLoS Genet.</italic>
					</source>
                    <year>2015</year>;<volume>11</volume>(<issue>12</issue>):<fpage>e1005602</fpage>.
                    <pub-id pub-id-type="pmid">26636962</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pgen.1005602</pub-id>
                    <pub-id pub-id-type="pmcid">4670080</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-88">
                <label>88</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Bhartiya</surname>
                            <given-names>D</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Scaria</surname>
                            <given-names>V</given-names>
                        </name>
					</person-group>:
                    <article-title>Genomic variations in non-coding RNAs: Structure, function and regulation.</article-title>
                    <source>
						
                        <italic toggle="yes">Genomics.</italic>
					</source>
                    <year>2016</year>;<volume>107</volume>(<issue>2&#x2013;3</issue>):<fpage>59</fpage>&#x2013;<lpage>68</lpage>.
                    <pub-id pub-id-type="pmid">26790601</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.ygeno.2016.01.005</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-89">
                <label>89</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Rawlings-Goss</surname>
                            <given-names>RA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Campbell</surname>
                            <given-names>MC</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Tishkoff</surname>
                            <given-names>SA</given-names>
                        </name>
						</person-group>:
                    <article-title>Global population-specific variation in miRNA associated with cancer risk and clinical biomarkers.</article-title>
                    <source>
						
                        <italic toggle="yes">BMC Med Genomics.</italic>
					</source>
                    <year>2014</year>;<volume>7</volume>(<issue>1</issue>):<fpage>53</fpage>.
                    <pub-id pub-id-type="pmid">25169894</pub-id>
                    <pub-id pub-id-type="doi">10.1186/1755-8794-7-53</pub-id>
                    <pub-id pub-id-type="pmcid">4159108</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-90">
                <label>90</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Ahmad</surname>
                            <given-names>J</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Hasnain</surname>
                            <given-names>SE</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Siddiqui</surname>
                            <given-names>MA</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>MicroRNA in carcinogenesis &amp; cancer diagnostics: a new paradigm.</article-title>
                    <source>
						
                        <italic toggle="yes">Indian J Med Res.</italic>
					</source>
                    <year>2013</year>;<volume>137</volume>(<issue>4</issue>):<fpage>680</fpage>&#x2013;<lpage>94</lpage>.
                    <pub-id pub-id-type="pmid">23703335</pub-id>
                    <pub-id pub-id-type="pmcid">3724248</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-91">
                <label>91</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Liu</surname>
                            <given-names>Z</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Sall</surname>
                            <given-names>A</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Yang</surname>
                            <given-names>D</given-names>
                        </name>
					</person-group>:
                    <article-title>MicroRNA: An emerging therapeutic target and intervention tool.</article-title>
                    <source>
						
                        <italic toggle="yes">Int J Mol Sci.</italic>
					</source>
                    <year>2008</year>;<volume>9</volume>(<issue>6</issue>):<fpage>978</fpage>&#x2013;<lpage>99</lpage>.
                    <pub-id pub-id-type="pmid">19325841</pub-id>
                    <pub-id pub-id-type="doi">10.3390/ijms9060978</pub-id>
                    <pub-id pub-id-type="pmcid">2658779</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report47634">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.17592.r47634</article-id>
            <title-group>
                <article-title>Reviewer response for version 2</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Agarwal</surname>
                        <given-names>Subhash Mohan</given-names>
                    </name>
                    <xref ref-type="aff" rid="r47634a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r47634a1">
                    <label>1</label>Bioinformatics Division, ICMR-National Institute of Cancer Prevention and Research, Noida, Uttar Pradesh&#x00a0;, India</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>24</day>
                <month>4</month>
                <year>2019</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2019 Agarwal SM</copyright-statement>
                <copyright-year>2019</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport47634" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.10138.2"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Yes</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>No</p>
            <p>Reviewer Expertise:</p>
            <p>NA</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report41551">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.17592.r41551</article-id>
            <title-group>
                <article-title>Reviewer response for version 2</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Anzola</surname>
                        <given-names>Juan Manuel</given-names>
                    </name>
                    <xref ref-type="aff" rid="r41551a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0003-2677-6731</uri>
                </contrib>
                <aff id="r41551a1">
                    <label>1</label>Bioinformatics &amp; Computational Biology, Corporaci&#x00f3;n CorpoGen, Bogot&#x00e1;, Colombia</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>3</day>
                <month>1</month>
                <year>2019</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2019 Anzola JM</copyright-statement>
                <copyright-year>2019</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport41551" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.10138.2"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>Most of the comments in my previous review have been addressed. I still find the methodology could have been modified to make more sensitive and more similar to the rules of base pairing of microRNAs. Despite this the conclusions are within reach of the methodology. To me the paper is ready for indexing.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Yes</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>No</p>
            <p>Reviewer Expertise:</p>
            <p>NA</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report24293">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.10920.r24293</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Agarwal</surname>
                        <given-names>Subhash Mohan</given-names>
                    </name>
                    <xref ref-type="aff" rid="r24293a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r24293a1">
                    <label>1</label>Bioinformatics Division, ICMR-National Institute of Cancer Prevention and Research, Noida, Uttar Pradesh&#x00a0;, India</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>28</day>
                <month>9</month>
                <year>2017</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2017 Agarwal SM</copyright-statement>
                <copyright-year>2017</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport24293" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.10138.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>In the present study the authors have mapped the miRNA involved in cervical cancer on to Latin American genome using in silico predictions. As cervical cancer has the highest mortality rates in low and middle income countries we do need to advance our understanding on mechanism of its progression. It is an interesting study however, there are few shortcomings in the current MS which need to be addressed. 
                <list list-type="order">
                    <list-item>
                        <p>It is not clear how human genes near to viral insertion sites have been identified. It was observer that near integration sites mostly only one or two genes are present. The method and parameters used for finding the genes should be detailed so that the results are reproducible. For example have the genes been identified within a particular distance of the insertion sites.</p>
                    </list-item>
                    <list-item>
                        <p>Why the authors have mapped the integration sites for 8 types of HPVs collectively and not HPV-16 and 18 alone which are the high risk HPV. Is there any basis for it?</p>
                    </list-item>
                    <list-item>
                        <p>The authors have stated that a total of 2028 miRNA binding sites of which 432 were detected in miRBase. In my opinion the analysis should have been restricted to only these sites as they are experimentally identified sites for miRNA binding.</p>
                    </list-item>
                    <list-item>
                        <p>As I understand the authors have mapped 42 miRNAs on Latin American genome. It is not clear how 42 miRNAs were selected for this subsequent step.</p>
                    </list-item>
                </list> Minor comments: 
                <list list-type="order">
                    <list-item>
                        <p>In the supplementary data the headings of the tables should be in English.</p>
                    </list-item>
                    <list-item>
                        <p>Are there 578 or 568 integration sites. It appears from Dataset 2 that there are 568 integration sites. Sheet named "VPH integration sites"</p>
                    </list-item>
                    <list-item>
                        <p>Page 4 (last 2 lines) instead of 12 it should be 13. As per the data in figure 3 there are 13 genes in the intermediate category.</p>
                    </list-item>
                    <list-item>
                        <p>Methods in Abstract: miRNA sequences associated with CC &#x2026;&#x2026;were obtained from miRBase. Shouldn&#x2019;t it be literature?</p>
                    </list-item>
                </list>
            </p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Yes</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>No</p>
            <p>Reviewer Expertise:</p>
            <p>NA</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
        <sub-article article-type="response" id="comment3924-24293">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Guerrero</surname>
                            <given-names>Milena</given-names>
                        </name>
                        <aff>University of Nari&#x00f1;o, Colombia</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>24</day>
                    <month>8</month>
                    <year>2018</year>
                </pub-date>
            </front-stub>
            <body>
                <p>Dear Reviewer SMA.</p>
                <p> We resubmitted the second version of the paper after addressing the various concerns raised.</p>
                <p> We would like to thank for their time and for their constructive comments to help assist us in improving the manuscript.</p>
                <p> We made the necessary changes in order to address all the specified concerns. The direct responses to the reviewer&#x2019;s comments are listed below</p>
                <p> </p>
                <p> 
                    <bold>
                        <underline>Reviewer. SMA</underline>
                    </bold>
                </p>
                <p> 
                    <bold>Q8</bold>. It is not clear how human genes near to viral insertion sites have been identified. It was observer that near integration sites mostly only one or two genes are present. The method and parameters used for finding the genes should be detailed so that the results are reproducible. For example have the genes been identified within a particular distance of the insertion sites.</p>
                <p> 
                    <bold>R8</bold>: Thanks for your valuable suggestion. In a previous work (published in Spanish) it was described Guerrero &amp; Guerrero, 2016. We analyze 42 scientific reports including chromosomal bands, HPV genotype, molecular technique for experimental results, and expression profile of miRNA according to lesions in CC.</p>
                <p> Here, we use the description and annotation of genes described in Data Bases, identified positions, regions, chromosomes, sequences and other characteristics to limit the regions of IS. All was manually curated for each chromosome along genome.</p>
                <p> 
                    <bold>Q9</bold>: Why the authors have mapped the integration sites for 8 types of HPVs collectively and not HPV-16 and 18 alone which are the high risk HPV. Is there any basis for it?</p>
                <p> 
                    <bold>R9:</bold> Thanks for your valuable comment. In fact, our reason were the results of two of our previous studies about genotyping of HPV in our region, which showed remarkable frequency, in addition to HPV16 and HPV 18, to other as HPV 45, 31, 33, 58, 67, 68. That was the main reason to include these genotypes in our analysis of mapping.</p>
                <p> But also by scientific purposes, because, in the literature is highly frequent to find and to study HPV 16 and 18, but not other genotypes. This information is relevant for us, to understand more depth the natural history of HPV and its mechanisms.</p>
                <p> S&#x00e1;nchez et al., 2013. Published in Spanish</p>
                <p> Nicola N, 2014. Bachelor thesis published in Spanish</p>
                <p> 
                    <bold>Q10</bold>: The authors have stated that a total of 2028 miRNA binding sites of which 432 were detected in miRBase. In my opinion the analysis should have been restricted to only these sites as they are experimentally identified sites for miRNA binding.</p>
                <p> 
                    <bold>R10</bold>: Thanks for your valuable comment. To our knowledge, the 2028 binding sites to miRNA and its key role in cervical cancer were identified by the first time in this study, using BLAT mapping. Is an important finding to highlight, compared to 432 binding sites previously reported, and a valuable contribution of bioinformatic tools for this kind research.</p>
                <p> 
                    <bold>Q11</bold>: As I understand the authors have mapped 42 miRNAs on Latin American genome. It is not clear how 42 miRNAs were selected for this subsequent step.</p>
                <p> 
                    <bold>R11</bold>: Thanks for your valuable comment. Briefly the pipeline was:</p>
                <p> -BLAT mapping of miRNAs on reference genome</p>
                <p> -Identification of integration sites (IS) of HPV</p>
                <p> -From IS HPV, looking for positions of genes of cell cycle, near to these IS.</p>
                <p> -Functional analysis of IS HPV according to annotations described by Uniprot.</p>
                <p> -With positions of near genes (regulators of cell cycle) and the positions of binding sites of miRNAs, manual mapping for each chromosome was done.</p>
                <p> -Finally, miRNAs in proximity to cell cycle genes control, were identified.</p>
                <p> 
                    <bold>Minor comments:</bold>
                </p>
                <p> 
                    <bold>Q12</bold>. In the supplementary data the headings of the tables should be in English.</p>
                <p> 
                    <bold>R12</bold>: Thanks for your detailed comment. It was corrected.</p>
                <p> 
                    <bold>Q13</bold>. Are there 578 or 568 integration sites. It appears from Dataset 2 that there are 568 integration sites. Sheet named "VPH integration sites"</p>
                <p> 
                    <bold>R13</bold>: Correct. There are 568 HPV integration sites. It was corrected.</p>
                <p> 
                    <bold>Q14</bold>. Page 4 (last 2 lines) instead of 12 it should be 13. As per the data in figure 3 there are 13 genes in the intermediate category.</p>
                <p> 
                    <bold>R14</bold>: Correct. Are 13 genes. It is corrected.</p>
                <p> 
                    <bold>Q15</bold>. Methods in Abstract: miRNA sequences associated with CC &#x2026;&#x2026;were obtained from miRBase. Shouldn&#x2019;t it be literature?</p>
                <p> 
                    <bold>R15:</bold> Correct. The abstract is re written to include and express data in a clear way.</p>
            </body>
        </sub-article>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report23646">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.10920.r23646</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Anzola</surname>
                        <given-names>Juan Manuel</given-names>
                    </name>
                    <xref ref-type="aff" rid="r23646a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0003-2677-6731</uri>
                </contrib>
                <aff id="r23646a1">
                    <label>1</label>Bioinformatics &amp; Computational Biology, Corporaci&#x00f3;n CorpoGen, Bogot&#x00e1;, Colombia</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>11</day>
                <month>7</month>
                <year>2017</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2017 Anzola JM</copyright-statement>
                <copyright-year>2017</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport23646" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.10138.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>In this work, Guerrero et al. use mature microRNA in order to detect possible targets of these microRNAs in the human genome, and its population variants, including from Latin American, in order to determine possible associations with cervical cancer.&#x00a0;</p>
            <p> </p>
            <p> I found the paper sound and its results, analysis and conclusions within the reach of the methodology, however I find the methods lacking, in particular when it comes to the parameters used in the BLAT search. BLAT uses a default seed of 11 to do nucleotide searches (they call it tileSize). So it would be good if the authors state clearly what were the BLAT parameters used, in particular "tileSize" and "stepSize". If a 11-word was used for this analysis the authors are running the risk of not being sensistive enough in their searches. High Specificity, Low Sensitivity. It would be interesting to determine how many of the genes reported as being targets for microRNAs are not detected in your search.&#x00a0;</p>
            <p> </p>
            <p> microRNA have a particular set of rules when it comes to binding to their respective targets, with seeds between 6, 8 or 9 nucleotides. Nothing is stated in the paper to give an idea of how the rules for target detection were used in this paper. See Mullany et al paper.</p>
            <p> </p>
            <p> It is assumed throughout the paper that all the hits are true positives. There is no measure as to how good is BLAT to detect true vs false positives.</p>
            <p> </p>
            <p> The paper:</p>
            <p> In your introduction you mention that microRNAs are involved in cancer. The paragraph suggest this is the only role of microRNAs, however they are involved in processes such as development and morphogenesis, so please rephrase this paragraph because cancer is not the only role of microRNAs.</p>
            <p> </p>
            <p> Figure 7D is better represented as percentage, as in the body of the paper.</p>
            <p> </p>
            <p> Your&#x00a0;phrase: "Because some chromosomes have a greater number of miRNA binding sites, it provides evidence of a non-random distribution of miRNAs within the chromosomes." could be the result of chromosome length. Please provide statistical&#x00a0;support for your statement.</p>
            <p> </p>
            <p> Page 14: Not all Pre microRNAs produce mature ones from both strands, in fact in the great majority of cases is only one strand that produces the mature one.</p>
            <p> </p>
            <p> The paper will be ready for indexing once these observations are addressed.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Yes</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>No</p>
            <p>Reviewer Expertise:</p>
            <p>NA</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
        <back>
            <ref-list>
                <title>References</title>
                <ref id="rep-ref-23646-1">
                    <label>1</label>
                    <mixed-citation publication-type="journal">
                        <person-group person-group-type="author"/>:
                        <article-title>MicroRNA Seed Region Length Impact on Target Messenger RNA Expression and Survival in Colorectal Cancer.</article-title>
                        <source>
                            <italic>PLoS One</italic>
                        </source>.<year>2016</year>;<volume>11</volume>(<issue>4</issue>) :
                        <elocation-id>10.1371/journal.pone.0154177</elocation-id>
                        <fpage>e0154177</fpage>
                        <pub-id pub-id-type="pmid">27123865</pub-id>
                        <pub-id pub-id-type="doi">10.1371/journal.pone.0154177</pub-id>
                    </mixed-citation>
                </ref>
            </ref-list>
        </back>
        <sub-article article-type="response" id="comment3925-23646">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Guerrero</surname>
                            <given-names>Milena</given-names>
                        </name>
                        <aff>University of Nari&#x00f1;o, Colombia</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>24</day>
                    <month>8</month>
                    <year>2018</year>
                </pub-date>
            </front-stub>
            <body>
                <p>We resubmitted the second version of paper after addressing the various concerns raised.</p>
                <p> We would like to thank you for their time and for their constructive comments to help assist us in improving the manuscript.</p>
                <p> We made the necessary changes in order to address all the specified concerns. The direct responses to the reviewer&#x2019;s comments are listed below:</p>
                <p> 
                    <bold>
                        <underline>Reviewer. JMA</underline>
                    </bold>
                </p>
                <p> 
                    <bold>Q1.</bold> I found the paper sound and its results, analysis and conclusions within the reach of the methodology, however I find the methods lacking, in particular when it comes to the parameters used in the BLAT search. BLAT uses a default seed of 11 to do nucleotide searches (they call it tileSize). So it would be good if the authors state clearly what were the BLAT parameters used, in particular "tileSize" and "stepSize". If a 11-word was used for this analysis the authors are running the risk of not being sensitive enough in their searches. High Specificity, Low Sensitivity. It would be interesting to determine how many of the genes reported as being targets for microRNAs are not detected in your search.</p>
                <p> 
                    <bold>R1</bold>: Thanks for your valuable suggestion. The methodology is re writer. In fact, BLAT only works with tile size 11. This mean that the average total length of mature miRNAs around 16 to 22, and consequently the seed sequence surely is represented at least 50% in mapping with this number of nucleotides.</p>
                <p> About suggestion &#x201c;to determine how many of genes reports as being for miRNAs are not detected in your search&#x201d;, we did the search, using programming R. And similar results of reported here we obtained. We not include this new focus on this paper, but If is need, we can send one of R mapping obtained for one chromosome.</p>
                <p> 
                    <bold>Q2:</bold> microRNA have a particular set of rules when it comes to binding to their respective targets, with seeds between 6, 8 or 9 nucleotides. Nothing is stated in the paper to give an idea of how the rules for target detection were used in this paper. See Mullany et al paper.</p>
                <p> 
                    <bold>R2</bold>: Thanks for the valuable comment. According to Mullany one of the most important &#x201c;rules&#x201d; for binding to mRNA and the role for cancer are length of seed sequence of miRNA. This condition is mentioned in second paragraph of introduction. Despite of this, the analysis no mentioned, but the authors analyzed seed sequences of miRNAs in terms of folding miRNAs (loop, folk, stem), length, 5&#x00b4;UTR extreme, the results was not included for this publication, because is part to another analysis.</p>
                <p> 
                    <bold>Q3</bold>: It is assumed throughout the paper that all the hits are true positives. There is no measure as to how good is BLAT to detect true vs false positives.</p>
                <p> 
                    <bold>R3</bold>: Thanks for your valuable annotation. Considering this probability, after that, we use R and bioconductor tools in order to be sure about the mapping results, we found a match between BLAT and R mapping. This data are under analysis ongoing.</p>
                <p> 
                    <bold>The paper:</bold>
                </p>
                <p> 
                    <bold>Q4.</bold> In your introduction you mention that microRNAs are involved in cancer. The paragraph suggest this is the only role of microRNAs, however they are involved in processes such as development and morphogenesis, so please rephrase this paragraph because cancer is not the only role of microRNAs.</p>
                <p> 
                    <bold>R4</bold>. Correct. The text is re write.</p>
                <p> 
                    <bold>Q5. </bold>Figure 7D is better represented as percentage, as in the body of the paper.</p>
                <p> 
                    <bold>R5</bold>. Thanks for the valuable suggestion. The figure was modified, highlighting percentages instead numeric values. File of figures.</p>
                <p> 
                    <bold>Q6.</bold> Your phrase: "Because some chromosomes have a greater number of miRNA binding sites, it provides evidence of a non-random distribution of miRNAs within the chromosomes." could be the result of chromosome length. Please provide statistical support for your statement.</p>
                <p> 
                    <bold>R6</bold>: Thanks for the valuable suggestion. The authors included the statistical analysis and confirmed the results, for more clarity the paragraph is re-writing as follow:</p>
                <p> &#x201c;In order to confirm the distribution of miRNA binding sites, the analysis for each chromosomal following all chromosomes was done. The statistic W Shapiro-Wilk test, show a p-value 0.02; and the mean comparison analysis by ANOVA with a p-value 0.0046 allowed us to confirm the non-random distribution of miRNA binding sites along the genome&#x201d;.</p>
                <p> 
                    <bold>Q7.</bold> Page 14: Not all Pre microRNAs produce mature ones from both strands, in fact in the great majority of cases is only one strand that produces the mature one.</p>
                <p> 
                    <bold>R7</bold>: Thanks for the suggestion. It was adjusted.</p>
            </body>
        </sub-article>
    </sub-article>
</article>
