<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.15127.1</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>The effect of aerobic exercise on relative leukocyte telomere length in male Sprague-Dawley rats given a high fat-diet</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 1; peer review: 2 approved with reservations]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Santoso</surname>
                        <given-names>Dewi Irawati Soeria</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Paramita</surname>
                        <given-names>Nurul</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-1362-8572</uri>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Prijanti</surname>
                        <given-names>Ani Retno</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0003-0663-2714</uri>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Hendrawan</surname>
                        <given-names>Thressia</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Software</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <uri content-type="orcid">https://orcid.org/0000-0001-8622-0124</uri>
                    <xref ref-type="aff" rid="a3">3</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Wicaksono</surname>
                        <given-names>Swandito</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Software</role>
                    <xref ref-type="aff" rid="a3">3</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Department of Medical Physiology, Faculty of Medicine, Universitas Indonesia, Jakarta Pusat, 10430, Indonesia</aff>
                <aff id="a2">
                    <label>2</label>Department of Medical Biochemistry and Molecular Biology, Faculty of Medicine, Universitas Indonesia, Jakarta Pusat, 10430, Indonesia</aff>
                <aff id="a3">
                    <label>3</label>Master Program in Biomedical Sciences, Faculty of Medicine, Universitas Indonesia, Jakarta Pusat, 10430, Indonesia</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:nurul.paramita61@ui.ac.id">nurul.paramita61@ui.ac.id</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>27</day>
                <month>7</month>
                <year>2018</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2018</year>
            </pub-date>
            <volume>7</volume>
            <elocation-id>1143</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>20</day>
                    <month>7</month>
                    <year>2018</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2018 Santoso DIS et al.</copyright-statement>
                <copyright-year>2018</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/7-1143/pdf"/>
            <abstract>
                <p>

                    <bold>Background</bold>: There is an increasing number of studies showing that physical activity and aerobic exercise have a positive effect on telomere length. Some studies also show that dynamics of telomere length is influenced by various environmental factors such as lifestyle and diet. However, the association between exercise and diet with telomere length is still questionable. The aim of this study was to examine the effects of aerobic physical exercise on relative telomere length changes in high fat-diet condition in rat animal models.</p>
                <p>

                    <bold>Methods</bold>: This study was an 
                    <italic toggle="yes">in vivo</italic> experimental study using twelve Sprague-Dawley male white rats (12-month-old). Subjects were evenly and randomly divided into two groups (n=6): (1) high fat-diet fed control group; (2) high fat-diet fed and aerobic exercise treatment group. Aerobic exercise was conducted using animal treadmill with intensity of 20 m/min, 5 days/week. At weeks 4 and 8, relative telomere length was compared with week 0 control group, using q-RT-PCR.</p>
                <p>

                    <bold>Results</bold>: Lengthening of relative telomere length was observed in both control and treatment groups at weeks 4 and 8, when compared to week 0 control group. The lengthening in the control group was much greater than the treatment group.</p>
                <p>

                    <bold>Conclusions</bold>: Excessive increase of relative telomere length was seen in high fat-diet conditions. Aerobic exercise for 8 weeks suppresses excessive increase of relative telomere length in high fat-diet conditions.</p>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>aerobic exercise</kwd>
                <kwd>telomere length</kwd>
                <kwd>high fat-diet</kwd>
            </kwd-group>
            <funding-group>
                <award-group id="fund-1">
                    <funding-source>Hibah Publikasi Internasional Terindeks untuk Tugas Akhir</funding-source>
                    <award-id>2017</award-id>
                </award-group>
                <funding-statement>This research was funded by Hibah Publikasi Internasional Terindeks untuk Tugas Akhir (PITTA) 2017.</funding-statement>
                <funding-statement>
                    <italic>The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.</italic>
                </funding-statement>
            </funding-group>
        </article-meta>
    </front>
    <body>
        <sec sec-type="intro">
            <title>Introduction</title>
            <p>Obesity is a global problem that is associated with high mortality and morbidity. Several studies has shown that obesity increases the risk of cardiovascular disease, renal impairment, diabetes, and even certain cancers
                <sup>
                    <xref ref-type="bibr" rid="ref-1">1</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-3">3</xref>
                </sup>. Meanwhile, the World Health Organization (WHO) showed that in the last 4 decades obesity rates have increased 10 times worldwide
                <sup>
                    <xref ref-type="bibr" rid="ref-3">3</xref>
                </sup>. This phenomenon is worrisome because there is an increasing number of people who have a high risk of developing various diseases associated with obesity.</p>
            <p>Some studies show that there is a strong association between the incidence of obesity with the level of physical activity and high fat diet intake. Individuals with low physical activity levels are known to have a higher risk of developing obesity
                <sup>
                    <xref ref-type="bibr" rid="ref-4">4</xref>,
                    <xref ref-type="bibr" rid="ref-5">5</xref>
                </sup>. Physical activity is also known to have a role on lowering blood glucose levels, improving homeostasis in people with diabetes mellitus, decreasing production of oxidative stress, lowering triglyceride levels in the body, increasing endogenous antioxidants, and can also maintain telomere length, thus reducing cardiovascular metabolic disease risk
                <sup>
                    <xref ref-type="bibr" rid="ref-6">6</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-8">8</xref>
                </sup>.</p>
            <p>The role of physical activity in decreasing the risk of cardiovascular metabolic mortality and morbidity is thought to be mediated by maintaining the length of telomeres
                <sup>
                    <xref ref-type="bibr" rid="ref-9">9</xref>
                </sup>. A study performed by Goglin 
                <italic toggle="yes">et al.</italic> demonstrates the association between telomere shortening and increased 5-year mortality in patients with acute coronary syndromes. This study also showed that a decrease in telomere shortening rate would be followed by a decrease in mortality rate
                <sup>
                    <xref ref-type="bibr" rid="ref-10">10</xref>
                </sup>.</p>
            <p>The rate of shortening of the telomere can be suppressed through a healthy lifestyle such as healthy diet and physical activity
                <sup>
                    <xref ref-type="bibr" rid="ref-9">9</xref>,
                    <xref ref-type="bibr" rid="ref-11">11</xref>
                </sup>. Certain types of food have been shown to have a correlation with telomere length. A Mediterranean-rich diet of olive oil (38% of total energy as fat) has been observed to maintain telomere length
                <sup>
                    <xref ref-type="bibr" rid="ref-12">12</xref>
                </sup>. In contrast, a high western type diet of sugar and red meat is associated with shortening of the telomere
                <sup>
                    <xref ref-type="bibr" rid="ref-12">12</xref>
                </sup>.</p>
            <p>The aim of this study was to explore the effect of aerobic physical exercise on telomere length under high fat-diet conditions to provide information for further research.</p>
        </sec>
        <sec sec-type="methods">
            <title>Methods</title>
            <sec>
                <title>Experimental animals</title>
                <p>Twelve male Sprague-Dawley rats (Rattus norvegicus), weighing 250&#x2013;450g, aged 12&#x2013;13 months, were obtained from Central Animal Facility (Bogor Agricultural University) and divided into two groups: control and trained high fat diet. They were acclimatized for 1 week in a controlled room temperature of 24+1&#x00b0;C, with a 12-hour light/dark cycle, and access to food pellets and filtered water 
                    <italic toggle="yes">ad libitum</italic> to adapt to the new environment. They were housed in plastic cages (50&#x00d7;34&#x00d7;25 cm), two animals in each cage. All protocols used in this experiment received approval from the Ethical Animal Care and Use Committee of Faculty of Medicine Universitas Indonesia with approval number 164/UN2.F1/ETIK/2017.</p>
            </sec>
            <sec>
                <title>Study design</title>
                <p>Before the beginning of the study all rats were acclimatized with high fat-diet for 10 weeks, consisting of 19% fat, 24% protein, and 47.77% carbohydrate. After 10 weeks of acclimatization, the rats were evenly and randomly assigned using a random number into two groups (n=6 per group): (1) the control group (without aerobic exercise) and (2) the treatment group (with aerobic physical exercise). The treatment group received aerobic exercise for 8 weeks. During 8 weeks of intervention, both treatment and control groups were still given a high-fat diet.</p>
                <p>Aerobic exercise was conducted using an animal treadmill, with a speed of 20 m/min for 20 minutes, 5 days/week, every morning around 6 am until 8 am. The intervention was carried out at the Biochemistry and Molecular Laboratory, Faculty of Medicine, Universitas Indonesia. All aerobic exercise protocols were supervised by experienced researchers.</p>
            </sec>
            <sec>
                <title>Data collection</title>
                <p>Blood was collected from both groups after an overnight fasting. All animals were anesthetized intraperitoneally with a ketamine-xylazine (KX) solution before blood was taken. Approximately 1 ml of whole blood was taken from the sinus orbitalis on week 0, week 4 and week 8. Genomic DNA in leukocytes was extracted from peripheral blood. DNA isolation were then performed using DNA isolation kit (
                    <italic toggle="yes">GeneAll&#x00ae; ExgeneTM Clinic SV mini</italic>). Relative telomere length from isolated DNA were measured on a real-time PCR detection system using a Quantitative PCR method. Kit used for qPCR were pipettes (and tips), optical PCR plates and caps, and master mix. The type of taq used was AmpliTaq Gold DNA polymerase. The model number/name of the PCR machine was Applied Biosystems 7300. The cycling conditions used were 10 min at 95&#x00b0;C, followed by 40 cycles of 95&#x00b0;C for 15 sec, 60&#x00b0;C for 1 min, followed by a dissociation (or melt) curve. The primer sequences were as follows:</p>
                <list list-type="bullet">
                    <list-item>
                        <p>Telo F: CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGG TTTGGGTT</p>
                    </list-item>
                    <list-item>
                        <p>Telo R: GGCTTGCCTTACCCTTACCCTTACCC TTACCCTTACCCT</p>
                    </list-item>
                    <list-item>
                        <p>36B4 F: ACTGGTCTAGGACCCGAGAAG</p>
                    </list-item>
                    <list-item>
                        <p>36B4 R: TCAATGGTGCCTCTGGAGATT</p>
                    </list-item>
                </list>
                <p>The primers were obtained from rodent (GenScript
                    <italic toggle="yes">&#x00ae;</italic>). Relative telomere length was calculated using the formula of 2
                    <sup>-</sup>&#x0394;&#x0394;
                    <sup>Ct
                        <xref ref-type="bibr" rid="ref-13">13</xref>
                    </sup>.</p>
            </sec>
            <sec>
                <title>Statistical analysis</title>
                <p>All statistical analysis was performed using SPSS 20 for Windows. Because the distribution of data is not normal, the data was assessed using a nonparametric Kruskal-Wallis test.</p>
            </sec>
        </sec>
        <sec sec-type="results">
            <title>Results</title>
            <p>The characteristics of the animals are shown in 
                <xref ref-type="table" rid="T1">Table 1</xref>. All the animals were in good condition throughout the length of study. There was no significant difference in age, body weight, Lee index and telomere length between control and treatment groups.</p>
            <table-wrap id="T1" orientation="portrait" position="anchor">
                <label>Table 1. </label>
                <caption>
                    <title>Characteristics of the animals.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th colspan="1" rowspan="1"/>
                            <th align="center" colspan="1" rowspan="1" valign="top">Control Group</th>
                            <th align="center" colspan="1" rowspan="1" valign="top">Treatment Group</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td colspan="1" rowspan="1">
                                <bold>Age (months)</bold>
                            </td>
                            <td align="center" colspan="1" rowspan="1">12-13</td>
                            <td align="center" colspan="1" rowspan="1">12-13</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">
                                <bold>Body weight (g)</bold>
                            </td>
                            <td align="center" colspan="1" rowspan="1">370.5 &#x00b1; 51.32</td>
                            <td align="center" colspan="1" rowspan="1">352.5 &#x00b1; 30.95</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">
                                <bold>Body Mass Index (Lee Index)</bold>
                            </td>
                            <td align="center" colspan="1" rowspan="1">307.34 &#x00b1; 8.66</td>
                            <td align="center" colspan="1" rowspan="1">318.71 &#x00b1; 10.34</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">
                                <bold>Telomere length at baseline (week 0)</bold>
                            </td>
                            <td align="center" colspan="1" rowspan="1">0.993 (0.302 &#x2013; 3.026)</td>
                            <td align="center" colspan="1" rowspan="1">0.971 (0.493 &#x2013; 5.059)</td>
                        </tr>
                    </tbody>
                </table>
            </table-wrap>
            <p>There was an increase in relative telomere length at weeks 4 and 8 compared to week 0 in both groups. At week 4, the relative telomere length of the control group (2.231) did not differ much with the treatment group (1.802) when compared to week 0 of control group. At week 8, there was a progressive increase of relative telomere length in both groups compared to week 0 and week 4. Relative telomere length increase in week 8 of the control group was much higher (178.62) compared to week 8 treatment group (74.86) (
                <xref ref-type="fig" rid="f1">Figure 1</xref>; 
                <xref ref-type="table" rid="T2">Table 2</xref>).</p>
            <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                <label>Figure 1. </label>
                <caption>
                    <title>Comparison of relative telomere length in leukocytes of rats fed a high fat-diet at weeks 0, 4 and 8 between control group (no aerobic exercise) and treatment group (aerobic exercise).</title>
                </caption>
                <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/16480/d2354cfb-4221-405b-b5e8-1ab6444cb76c_figure1.gif"/>
            </fig>
            <table-wrap id="T2" orientation="portrait" position="anchor">
                <label>Table 2. </label>
                <caption>
                    <title>Comparison of relative telomere length in leukocytes of rats fed with high-fet diet at week 0, 4 and 8 between control group (no aerobic exercise) and treatment group (aerobic exercise).</title>
                    <p>Median (minimum-maximum).</p>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th colspan="1" rowspan="1"/>
                            <th align="left" colspan="1" rowspan="1" valign="top">Control Group</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Treatment Group</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Kruskal-Wallis test (p-value)</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td colspan="1" rowspan="1">Week 0</td>
                            <td colspan="1" rowspan="1">0.993 (0.302-3.026)</td>
                            <td colspan="1" rowspan="1">0.971 (0.493-5.059)</td>
                            <td colspan="1" rowspan="1">0.749</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">Week 4</td>
                            <td colspan="1" rowspan="1">2.321 (0.633-9.344)</td>
                            <td colspan="1" rowspan="1">1.802 (0.912-9.721)</td>
                            <td colspan="1" rowspan="1">0.873</td>
                        </tr>
                        <tr>
                            <td colspan="1" rowspan="1">Week 8</td>
                            <td colspan="1" rowspan="1">178.621 (95.158-812.49)</td>
                            <td colspan="1" rowspan="1">74.864 (36.218-295.895)</td>
                            <td colspan="1" rowspan="1">0.055</td>
                        </tr>
                    </tbody>
                </table>
            </table-wrap>
            <supplementary-material id="DS0" orientation="portrait" position="float" xlink:href="https://f1000researchdata.s3.amazonaws.com/datasets/15127/fd2b958f-9712-4fc4-ac6f-2aacdf6c58dd_raw_data_telomere_rev.xlsx">
                <label>Raw data including the relative telomere length for control and treatment groups at week 0, 4 and 8, and 2
                    <sup>-&#x0394;&#x0394;Ct</sup> calculations</label>
                <caption>
                    <p>

                        <ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.5256/f1000research.15127.d211681">http://dx.doi.org/10.5256/f1000research.15127.d211681</ext-link>
</p>
                </caption>
            </supplementary-material>
        </sec>
        <sec sec-type="discussion">
            <title>Discussion</title>
            <p>One important structures located at the ends of the linear chromosomes is the telomere. In human cells, they are composed of TTAGGG repeats and a number of proteins. Their function is to protect the integrity and stability of the DNA
                <sup>
                    <xref ref-type="bibr" rid="ref-14">14</xref>
                </sup>.</p>
            <p>Many studies showed that telomere length is influenced by a number of factors
                <sup>
                    <xref ref-type="bibr" rid="ref-9">9</xref>,
                    <xref ref-type="bibr" rid="ref-12">12</xref>,
                    <xref ref-type="bibr" rid="ref-15">15</xref>
                </sup>. Sedentary lifestyle, high blood glucose levels, and increased percentage of body fat have a negative influence on telomere length. The underlying mechanism have been suggested as being mediated through oxidative stress and inflammation
                <sup>
                    <xref ref-type="bibr" rid="ref-16">16</xref>
                </sup>.</p>
            <p>Exercise as a lifestyle intervention has been associated with longer leukocytes telomere length
                <sup>
                    <xref ref-type="bibr" rid="ref-15">15</xref>
                </sup>. A study by Cherkas on 2401 subject showed that telomere length has a direct relation with increased level of physical activity
                <sup>
                    <xref ref-type="bibr" rid="ref-17">17</xref>
                </sup>. An observation of physical activity and telomere length by Du 
                <italic toggle="yes">et al.</italic> on 7813 adult women concluded that moderate and vigorous intensity activity increased telomere length compared with least active women
                <sup>
                    <xref ref-type="bibr" rid="ref-18">18</xref>
                </sup>. Ludlow 
                <italic toggle="yes">et al.</italic> studied the effect of physical activity on telomere length in three different groups: sedentary, moderate and overtraining. The result showed a positive effect on telomere length in the moderate group
                <sup>
                    <xref ref-type="bibr" rid="ref-19">19</xref>
                </sup>.</p>
            <p>To date, to our knowledge, very few studies have investigated the relative effect of a specific diet on telomere length. Cassidy 
                <italic toggle="yes">et al.</italic> found that total fat intake was only inversely associated with leukocytes telomere length and higher polyunsaturated fatty acids (PUFA) intake, specifically linoleic acid intake, was inversely associated with leukocytes telomere length
                <sup>
                    <xref ref-type="bibr" rid="ref-11">11</xref>
                </sup>. Li 
                <italic toggle="yes">et al.</italic> found that there was no difference in telomere length between consumption of fish oil-rich diet and soy oil-rich diet
                <sup>
                    <xref ref-type="bibr" rid="ref-20">20</xref>
                </sup>. Kiecolt-Glaser 
                <italic toggle="yes">et al.</italic> compared telomere length between subjects with n-6 PUFA and n-3 PUFA supplementation. They found that telomere length is longer in subject with omega 3 or n-3 PUFA supplementation (high in fish oil) compared to n-6 PUFA supplementation
                <sup>
                    <xref ref-type="bibr" rid="ref-21">21</xref>
                </sup>.</p>
            <p>Results from our current study showed a lengthening of relative telomere length in both groups in week 4 and week 8. This was in contrast with studies showing telomeres usually shortened with age
                <sup>
                    <xref ref-type="bibr" rid="ref-9">9</xref>
                </sup>., but there are also studies which indicate that 
                <italic toggle="yes">in vivo</italic>, telomere may shorten or elongate, and leukocyte telomere length may fluctuates within months
                <sup>
                    <xref ref-type="bibr" rid="ref-22">22</xref>,
                    <xref ref-type="bibr" rid="ref-23">23</xref>
                </sup>.</p>
            <p>In general, preserved telomere length and lengthening of telomere are considered as something good because it is thought to play an important role in extending the biological age of cells
                <sup>
                    <xref ref-type="bibr" rid="ref-12">12</xref>,
                    <xref ref-type="bibr" rid="ref-21">21</xref>,
                    <xref ref-type="bibr" rid="ref-24">24</xref>
                </sup>.</p>
            <p>Nevertheless, studies have also shown that telomere lengthening can be an initial response that arises after exposure to low doses of various carcinogenic chemicals 
                <italic toggle="yes">in vitro</italic> and in experimental animals
                <sup>
                    <xref ref-type="bibr" rid="ref-23">23</xref>
                </sup>. Zhang 
                <italic toggle="yes">et al.</italic> concluded from their study that subject with longer telomere length had a higher risk of getting lung cancer, and this was especially true for men
                <sup>
                    <xref ref-type="bibr" rid="ref-25">25</xref>
                </sup>.</p>
            <p>The positive associations between high fat-diet conditions and telomere length is difficult to explain because a high fat-diet is associated with increased risk of various diseases. Telomeres generally shorten with age, thus, the discovery of telomer elongation in the provision of high-fat diet can be regarded as something that deviates from normal condition. Therefore, the positive associations between high fat-diet conditions and telomere length observed in this study are notable.</p>
            <p>Telomere will shorten at each cell division. Telomeres that elongate excessively in both groups in this study may indicate a prolonged period before apoptosis, and this could indicates a change from normal cell function. Currently, the implications of excessive telomere lengthening are still unknown. Our result shows that aerobic exercise can act as a barrier to progressive changes that occur in the relative telomere length caused by a high-fat diet condition. Modulation of oxidative stress in the body is one possible mechanism that may explain how aerobic exercise resist relative telomere changes. Aerobic exercise upregulate genes that encode various antioxidant enzymes. Several studies shows that regular physical exercise increase the body's endogenous antioxidant activity and thus increase body&#x2019;s resistance to oxidation events
                <sup>
                    <xref ref-type="bibr" rid="ref-15">15</xref>,
                    <xref ref-type="bibr" rid="ref-26">26</xref>
                </sup>.</p>
        </sec>
        <sec sec-type="conclusions">
            <title>Conclusions</title>
            <p>Our study showed that exposure to a high fat-diet plays an important role to the emergence of altered telomere length, and aerobic exercise could reduce the progression of the alteration in length. Our results support the hypothesis that leukocyte telomere length is associated with daily dietary intake and physical activities. Further investigation is still needed to explore the mechanism and implications of telomere length changes found in this study.</p>
        </sec>
        <sec>
            <title>Data availability</title>
            <p>The data referenced by this article are under copyright with the following copyright statement: Copyright: &#x00ef;&#x00bf;&#x00bd; 2018 Santoso DIS et al.</p>
            <p>Data associated with the article are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication).
                <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/publicdomain/zero/1.0/"/>
            </p>
            <p>Dataset 1: Raw data including the relative telomere length for control and treatment groups at week 0, 4 and 8, and 2
                <sup>-</sup>&#x0394;&#x0394;
                <sup>Ct </sup> calculations. DOI, 
                <ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.5256/f1000research.15127.d211681">10.5256/f1000research.15127.d211681</ext-link>
                <sup>
                    <xref ref-type="bibr" rid="ref-27">27</xref>
                </sup>.</p>
        </sec>
    </body>
    <back>
        <ref-list>
            <ref id="ref-1">
                <label>1</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Arroyo-Johnson</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Mincey</surname>
                            <given-names>KD</given-names>
                        </name>
					</person-group>:
                    <article-title>Obesity Epidemiology Worldwide.</article-title>
                    <source>
						
                        <italic toggle="yes">Gastroenterol Clin North Am.</italic>
					</source>
                    <year>2016</year>;<volume>45</volume>(<issue>4</issue>):<fpage>571</fpage>&#x2013;<lpage>9</lpage>.
                    <pub-id pub-id-type="pmid">27837773</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.gtc.2016.07.012</pub-id>
                    <pub-id pub-id-type="pmcid">5599163</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-2">
                <label>2</label>
                <mixed-citation publication-type="journal">
                    <collab>Prospective Studies Collaboration, </collab>
                    <person-group person-group-type="author">
					
                        <name name-style="western">
                            <surname>Whitlock</surname>
                            <given-names>G</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Lewington</surname>
                            <given-names>S</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Body-mass index and cause-specific mortality in 900 000 adults: collaborative analyses of 57 prospective studies.</article-title>
                    <source>
						
                        <italic toggle="yes">Lancet.</italic>
					</source>
                    <year>2009</year>;<volume>373</volume>(<issue>9669</issue>):<fpage>1083</fpage>&#x2013;<lpage>96</lpage>.
                    <pub-id pub-id-type="pmid">19299006</pub-id>
                    <pub-id pub-id-type="doi">10.1016/S0140-6736(09)60318-4</pub-id>
                    <pub-id pub-id-type="pmcid">2662372</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-3">
                <label>3</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Berrington de Gonzalez</surname>
                            <given-names>A</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Hartge</surname>
                            <given-names>P</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Cerhan</surname>
                            <given-names>JR</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Body-mass index and mortality among 1.46 million white adults.</article-title>
                    <source>
						
                        <italic toggle="yes">N Engl J Med.</italic>
					</source>
                    <year>2010</year>;<volume>363</volume>(<issue>23</issue>):<fpage>2211</fpage>&#x2013;<lpage>9</lpage>.
                    <pub-id pub-id-type="pmid">21121834</pub-id>
                    <pub-id pub-id-type="doi">10.1056/NEJMoa1000367</pub-id>
                    <pub-id pub-id-type="pmcid">3066051</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-4">
                <label>4</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Rachmi</surname>
                            <given-names>CN</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Baur</surname>
                            <given-names>LA</given-names>
                        </name>
					</person-group>:
                    <article-title>Overweight and obesity in Indonesia: prevalence and risk factors-a literature review.</article-title>
                    <source>
						
                        <italic toggle="yes">Public Health.</italic>
					</source>
                    <year>2017</year>;<volume>147</volume>:<fpage>20</fpage>&#x2013;<lpage>9</lpage>.
                    <pub-id pub-id-type="pmid">28404492</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.puhe.2017.02.002</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-5">
                <label>5</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Rauner</surname>
                            <given-names>A</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Mess</surname>
                            <given-names>F</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Woll</surname>
                            <given-names>A</given-names>
                        </name>
					</person-group>:
                    <article-title>The relationship between physical activity, physical fitness and overweight in adolescents: a systematic review of studies published in or after 2000.</article-title>
                    <source>
						
                        <italic toggle="yes">BMC Pediatr.</italic>
					</source>
                    <year>2013</year>;<volume>13</volume>:<fpage>19</fpage>.
                    <pub-id pub-id-type="pmid">23375072</pub-id>
                    <pub-id pub-id-type="doi">10.1186/1471-2431-13-19</pub-id>
                    <pub-id pub-id-type="pmcid">3571910</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-6">
                <label>6</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Colberg</surname>
                            <given-names>SR</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Sigal</surname>
                            <given-names>RJ</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Fernhall</surname>
                            <given-names>B</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Exercise and type 2 diabetes: the American College of Sports Medicine and the American Diabetes Association: joint position statement.</article-title>
                    <source>
						
                        <italic toggle="yes">Diabetes Care.</italic>
					</source>
                    <year>2010</year>;<volume>33</volume>(<issue>12</issue>):<fpage>e147</fpage>&#x2013;<lpage>67</lpage>.
                    <pub-id pub-id-type="pmid">21115758</pub-id>
                    <pub-id pub-id-type="doi">10.2337/dc10-9990</pub-id>
                    <pub-id pub-id-type="pmcid">2992225</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-7">
                <label>7</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Sa&#x00df;enroth</surname>
                            <given-names>D</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Meyer</surname>
                            <given-names>A</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Salewsky</surname>
                            <given-names>B</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Sports and Exercise at Different Ages and Leukocyte Telomere Length in Later Life--Data from the Berlin Aging Study II (BASE-II)</article-title>. Saretzki G, editor.
                    <source>
					
                        <italic toggle="yes">PLoS One.</italic>
					</source>
                    <year>2015</year>;<volume>10</volume>(<issue>12</issue>):<fpage>e0142131</fpage>.
                    <pub-id pub-id-type="pmid">26630493</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0142131</pub-id>
                    <pub-id pub-id-type="pmcid">4668005</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-8">
                <label>8</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Botha</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Grace</surname>
                            <given-names>L</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Bugarith</surname>
                            <given-names>K</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>The impact of voluntary exercise on relative telomere length in a rat model of developmental stress.</article-title>
                    <source>
						
                        <italic toggle="yes">BMC Res Notes.</italic>
					</source>
                    <year>2012</year>;<volume>5</volume>(<issue>1</issue>):<fpage>697</fpage>.
                    <pub-id pub-id-type="pmid">23270390</pub-id>
                    <pub-id pub-id-type="doi">10.1186/1756-0500-5-697</pub-id>
                    <pub-id pub-id-type="pmcid">3543200</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-9">
                <label>9</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Denham</surname>
                            <given-names>J</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>O&#x2019;Brien</surname>
                            <given-names>BJ</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Charchar</surname>
                            <given-names>FJ</given-names>
                        </name>
					</person-group>:
                    <article-title>Telomere Length Maintenance and Cardio-Metabolic Disease Prevention Through Exercise Training.</article-title>
                    <source>
						
                        <italic toggle="yes">Sports Med.</italic>
					</source>
                    <year>2016</year>;<volume>46</volume>(<issue>9</issue>):<fpage>1213</fpage>&#x2013;<lpage>37</lpage>.
                    <pub-id pub-id-type="pmid">26914269</pub-id>
                    <pub-id pub-id-type="doi">10.1007/s40279-016-0482-4</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-10">
                <label>10</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Goglin</surname>
                            <given-names>SE</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Farzaneh-Far</surname>
                            <given-names>R</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Epel</surname>
                            <given-names>ES</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Change in Leukocyte Telomere Length Predicts Mortality in Patients with Stable Coronary Heart Disease from the Heart and Soul Study</article-title>. Wellinger RJ, editor.
                    <source>
					
                        <italic toggle="yes">PLoS One.</italic>
					</source>
                    <year>2016</year>;<volume>11</volume>(<issue>10</issue>):<fpage>e0160748</fpage>.
                    <pub-id pub-id-type="pmid">27783614</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0160748</pub-id>
                    <pub-id pub-id-type="pmcid">5081189</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-11">
                <label>11</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Cassidy</surname>
                            <given-names>A</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>De Vivo</surname>
                            <given-names>I</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Liu</surname>
                            <given-names>Y</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Associations between diet, lifestyle factors, and telomere length in women.</article-title>
                    <source>
						
                        <italic toggle="yes">Am J Clin Nutr.</italic>
					</source>
                    <year>2010</year>;<volume>91</volume>(<issue>5</issue>):<fpage>1273</fpage>&#x2013;<lpage>80</lpage>.
                    <pub-id pub-id-type="pmid">20219960</pub-id>
                    <pub-id pub-id-type="doi">10.3945/ajcn.2009.28947</pub-id>
                    <pub-id pub-id-type="pmcid">2854902</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-12">
                <label>12</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Freitas-Simoes</surname>
                            <given-names>TM</given-names>
                        </name>
							
                        <name name-style="western">
                            <surname>Ros</surname>
                            <given-names>E</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Sala-Vila</surname>
                            <given-names>A</given-names>
                        </name>
					</person-group>:
                    <article-title>Nutrients, foods, dietary patterns and telomere length: Update of epidemiological studies and randomized trials.</article-title>
                    <source>
						
                        <italic toggle="yes">Metabolism.</italic>
					</source>
                    <year>2016</year>;<volume>65</volume>(<issue>4</issue>):<fpage>406</fpage>&#x2013;<lpage>15</lpage>.
                    <pub-id pub-id-type="pmid">26975532</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.metabol.2015.11.004</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-13">
                <label>13</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Cawthon</surname>
                            <given-names>RM</given-names>
                        </name>
					</person-group>:
                    <article-title>Telomere measurement by quantitative PCR.</article-title>
                    <source>
						
                        <italic toggle="yes">Nucleic Acids Res.</italic>
					</source>
                    <year>2002</year>;<volume>30</volume>(<issue>10</issue>):<fpage>e47</fpage>.
                    <pub-id pub-id-type="pmid">12000852</pub-id>
                    <pub-id pub-id-type="doi">10.1093/nar/30.10.e47</pub-id>
                    <pub-id pub-id-type="pmcid">115301</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-14">
                <label>14</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>O&#x2019;Sullivan</surname>
                            <given-names>RJ</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Karlseder</surname>
                            <given-names>J</given-names>
                        </name>
					</person-group>:
                    <article-title>Telomeres: protecting chromosomes against genome instability.</article-title>
                    <source>
						
                        <italic toggle="yes">Nat Rev Mol Cell Biol.</italic>
					</source>
                    <year>2010</year>;<volume>11</volume>(<issue>3</issue>):<fpage>171</fpage>&#x2013;<lpage>81</lpage>.
                    <pub-id pub-id-type="pmid">20125188</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nrm2848</pub-id>
                    <pub-id pub-id-type="pmcid">2842081</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-15">
                <label>15</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Arsenis</surname>
                            <given-names>NC</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>You</surname>
                            <given-names>T</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Ogawa</surname>
                            <given-names>EF</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Physical activity and telomere length: Impact of aging and potential mechanisms of action.</article-title>
                    <source>
						
                        <italic toggle="yes">Oncotarget.</italic>
					</source>
                    <year>2017</year>;<volume>8</volume>(<issue>27</issue>):<fpage>45008</fpage>&#x2013;<lpage>19</lpage>.
                    <pub-id pub-id-type="pmid">28410238</pub-id>
                    <pub-id pub-id-type="doi">10.18632/oncotarget.16726</pub-id>
                    <pub-id pub-id-type="pmcid">5546536</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-16">
                <label>16</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Kim</surname>
                            <given-names>S</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Parks</surname>
                            <given-names>CG</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>DeRoo</surname>
                            <given-names>LA</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Obesity and weight gain in adulthood and telomere length.</article-title>
                    <source>
						
                        <italic toggle="yes">Cancer Epidemiol Biomarkers Prev.</italic>
					</source>
                    <year>2009</year>;<volume>18</volume>(<issue>3</issue>):<fpage>816</fpage>&#x2013;<lpage>20</lpage>.
                    <pub-id pub-id-type="pmid">19273484</pub-id>
                    <pub-id pub-id-type="doi">10.1158/1055-9965.EPI-08-0935</pub-id>
                    <pub-id pub-id-type="pmcid">2805851</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-17">
                <label>17</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Cherkas</surname>
                            <given-names>LF</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Hunkin</surname>
                            <given-names>JL</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Kato</surname>
                            <given-names>BS</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>The association between physical activity in leisure time and leukocyte telomere length.</article-title>
                    <source>
						
                        <italic toggle="yes">Arch Intern Med.</italic>
					</source>
                    <year>2008</year>;<volume>168</volume>(<issue>2</issue>):<fpage>154</fpage>&#x2013;<lpage>8</lpage>.
                    <pub-id pub-id-type="pmid">18227361</pub-id>
                    <pub-id pub-id-type="doi">10.1001/archinternmed.2007.39</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-18">
                <label>18</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Du</surname>
                            <given-names>M</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Prescott</surname>
                            <given-names>J</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Kraft</surname>
                            <given-names>P</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Physical activity, sedentary behavior, and leukocyte telomere length in women.</article-title>
                    <source>
						
                        <italic toggle="yes">Am J Epidemiol.</italic>
					</source>
                    <year>2012</year>;<volume>175</volume>(<issue>5</issue>):<fpage>414</fpage>&#x2013;<lpage>22</lpage>.
                    <pub-id pub-id-type="pmid">22302075</pub-id>
                    <pub-id pub-id-type="doi">10.1093/aje/kwr330</pub-id>
                    <pub-id pub-id-type="pmcid">3282876</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-19">
                <label>19</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Ludlow</surname>
                            <given-names>AT</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Zimmerman</surname>
                            <given-names>JB</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Witkowski</surname>
                            <given-names>S</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Relationship between physical activity level, telomere length, and telomerase activity.</article-title>
                    <source>
					
                        <italic toggle="yes">Med Sci Sports Exerc.</italic>
					</source>
                    <year>2008</year>;<volume>40</volume>(<issue>10</issue>):<fpage>1764</fpage>&#x2013;<lpage>71</lpage>, [cited 2018 May 10].
                    <pub-id pub-id-type="pmid">18799986</pub-id>
                    <pub-id pub-id-type="doi">10.1249/MSS.0b013e31817c92aa</pub-id>
                    <pub-id pub-id-type="pmcid">2581416</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-20">
                <label>20</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>Y</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Zhao</surname>
                            <given-names>F</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Wu</surname>
                            <given-names>Q</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Fish oil diet may reduce inflammatory levels in the liver of middle-aged rats.</article-title>
                    <source>
						
                        <italic toggle="yes">Sci Rep.</italic>
					</source>
                    <year>2017</year>;<volume>7</volume>(<issue>1</issue>): 6241, [cited 2018 May 14].
                    <pub-id pub-id-type="pmid">28740245</pub-id>
                    <pub-id pub-id-type="doi">10.1038/s41598-017-06506-3</pub-id>
                    <pub-id pub-id-type="pmcid">5524965</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-21">
                <label>21</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Kiecolt-Glaser</surname>
                            <given-names>JK</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Epel</surname>
                            <given-names>ES</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Belury</surname>
                            <given-names>MA</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Omega-3 fatty acids, oxidative stress, and leukocyte telomere length: A randomized controlled trial.</article-title>
                    <source>
						
                        <italic toggle="yes">Brain Behav Immun.</italic>
					</source>
                    <year>2013</year>;<volume>28</volume>:<fpage>16</fpage>&#x2013;<lpage>24</lpage>.
                    <pub-id pub-id-type="pmid">23010452</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.bbi.2012.09.004</pub-id>
                    <pub-id pub-id-type="pmcid">3545053</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-22">
                <label>22</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Shin</surname>
                            <given-names>JY</given-names>
                        </name>
							
                        <name name-style="western">
                            <surname>Choi</surname>
                            <given-names>YY</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Jeon</surname>
                            <given-names>HS</given-names>
                        </name>
							
                        <etal/>
					</person-group>:
                    <article-title>Low-dose persistent organic pollutants increased telomere length in peripheral leukocytes of healthy Koreans.</article-title>
                    <source>
						
                        <italic toggle="yes">Mutagenesis.</italic>
					</source>
                    <year>2010</year>;<volume>25</volume>(<issue>5</issue>):<fpage>511</fpage>&#x2013;<lpage>6</lpage>.
                    <pub-id pub-id-type="pmid">20616147</pub-id>
                    <pub-id pub-id-type="doi">10.1093/mutage/geq035</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-23">
                <label>23</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Duan</surname>
                            <given-names>X</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Yang</surname>
                            <given-names>Y</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>S</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Changes in the expression of genes involved in cell cycle regulation and the relative telomere length in the process of canceration induced by omethoate.</article-title>
                    <source>
						
                        <italic toggle="yes">Tumour Biol.</italic>
					</source>
                    <year>2017</year>;<volume>39</volume>(<issue>7</issue>):<fpage>1010428317719782</fpage>.
                    <pub-id pub-id-type="pmid">28718371</pub-id>
                    <pub-id pub-id-type="doi">10.1177/1010428317719782</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-24">
                <label>24</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Roake</surname>
                            <given-names>CM</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Artandi</surname>
                            <given-names>SE</given-names>
                        </name>
					</person-group>:
                    <article-title>DNA repair: Telomere-lengthening mechanism revealed.</article-title>
                    <source>
						
                        <italic toggle="yes">Nature.</italic>
					</source>
                    <year>2016</year>;<volume>539</volume>(<issue>7627</issue>):<fpage>35</fpage>&#x2013;<lpage>6</lpage>.
                    <pub-id pub-id-type="pmid">27760112</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nature19483</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-25">
                <label>25</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Zhang</surname>
                            <given-names>C</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Doherty</surname>
                            <given-names>JA</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Burgess</surname>
                            <given-names>S</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Genetic determinants of telomere length and risk of common cancers: a Mendelian randomization study.</article-title>
                    <source>
						
                        <italic toggle="yes">Hum Mol Genet.</italic>
					</source>
                    <year>2015</year>;<volume>24</volume>(<issue>18</issue>):<fpage>5356</fpage>&#x2013;<lpage>66</lpage>.
                    <pub-id pub-id-type="pmid">26138067</pub-id>
                    <pub-id pub-id-type="doi">10.1093/hmg/ddv252</pub-id>
                    <pub-id pub-id-type="pmcid">4550826</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-26">
                <label>26</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Powers</surname>
                            <given-names>SK</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Radak</surname>
                            <given-names>Z</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Ji</surname>
                            <given-names>LL</given-names>
                        </name>
					</person-group>:
                    <article-title>Exercise-induced oxidative stress: past, present and future.</article-title>
                    <source>
						
                        <italic toggle="yes">J Physiol.</italic>
					</source>
                    <year>2016</year>;<volume>594</volume>(<issue>18</issue>):<fpage>5081</fpage>&#x2013;<lpage>92</lpage>.
                    <pub-id pub-id-type="pmid">26893258</pub-id>
                    <pub-id pub-id-type="doi">10.1113/JP270646</pub-id>
                    <pub-id pub-id-type="pmcid">5023699</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-27">
                <label>27</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
						
                        <name name-style="western">
                            <surname>Santoso</surname>
                            <given-names>DIS</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Paramita</surname>
                            <given-names>N</given-names>
                        </name>
						
                        <name name-style="western">
                            <surname>Prijanti</surname>
                            <given-names>AR</given-names>
                        </name>
						
                        <etal/>
					</person-group>:
                    <article-title>Dataset 1 in: The effect of aerobic exercise on relative leukocyte telomere length in male Sprague-Dawley rats given a high fat-diet.</article-title>
                    <source>
						
                        <italic toggle="yes">F1000Research.</italic>
					</source>
                    <year>2018</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.5256/f1000research.15127.d211681">http://www.doi.org/10.5256/f1000research.15127.d211681</ext-link>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report40574">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.16480.r40574</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Ludlow</surname>
                        <given-names>Andrew T.</given-names>
                    </name>
                    <xref ref-type="aff" rid="r40574a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0003-0423-4800</uri>
                </contrib>
                <aff id="r40574a1">
                    <label>1</label>University of Michigan, Ann Arbor, MI, USA</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>27</day>
                <month>11</month>
                <year>2018</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2018 Ludlow AT</copyright-statement>
                <copyright-year>2018</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport40574" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.15127.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>Santoso et al. explore the relationship between a high fat diet, aerobic exercise and telomere length. In this small-scale animal research study, the authors make the unexpected observation that after 8 weeks of high fat diet, telomeres are elongated in circulating blood cells (leukocytes). They observed in aerobically trained animals that the apparent telomere elongation was significantly attenuated compared to a sedentary control. These interesting findings observations call into question the strict dogmatic view that telomere shortening is the rule in pathology. Human epidemiological studies have reported similar discrepancies, where telomere shortening is not always observed in pathological scenarios but rather telomere elongation can also be apparent in disease situations. While these observations are provocative, I have several concerns with the sample size, the model organism, the method used to measure telomere length, and the interpretation of the data.</p>
            <p> This study is very positive in terms that it points out the need to perform longitudinal analysis of telomere biology in both human and model organism studies. Repeat sampling will be critical to moving the field of telomere biology and environmental/lifestyle impacts forward. For instance, what happens to telomere biology or cell biology after 12 weeks on a high fat diet following the apparent rapid and massive telomere elongation event at 8 weeks?</p>
            <p> The negatives of this study are the model organism of choice, the measurement biochemistry, the data analysis, and the lack of mechanistic insights provided by the authors.</p>
            <p> 1. Sample size, model organism, and statistical treatment of the data.</p>
            <p> </p>
            <p> While the effect observed in this study is large, the sample size is small. Further the authors utilize a repeated-measures design and do not analyze the data as such. Each rat&#x2019;s telomere length was measured three times. Thus, change in telomere length per individual rat should be reported between each time point and analyzed via a repeated measures analysis. Further, with the assay of choice, 6 animals would be borderline powered enough to detect a meaningful change. What were the authors expectations in terms of a priori predictions on the magnitude of change in telomere length?</p>
            <p> Are the rats inbred or outbred? This needs to be reported in the document.</p>
            <p> Translatability of findings to humans. Rats use a different life history/ life course strategy to promote survival of the species. These animals grow quickly, have a small body size, do not suppress telomerase, reproduce young, and are cancer susceptible while humans grow slowly, have a large body size, suppress telomerase, reproduce late in life, and are cancer resistant. Thus, could this extreme lengthening be due to evolutionary differences between humans and the chosen model organism? That is, humans might not have a similar response compared to rodents.</p>
            <p> 2. Assay choice.</p>
            <p> </p>
            <p> The Cawthon method or T/S ratio to determine relative telomere length is a valid assay when performed by certain labs, but it can have issues. A critical validation step in the assay that I did not see in the online data is the reference DNA sample. Did the authors have a reference sample of known telomere length that was run on each plate to ensure their assay was performing as expected? This should have been done on each plate and the inter and intra plate coefficient of variation should be reported for the assay in general. This is critical to be sure the findings are not erroneous.&#x00a0;The authors could purchase a cell line with a known telomere length, isolate DNA and repeat the T/S ratio on all samples (both known and unknowns/experimental) to ensure the measurement is correct.</p>
            <p> I would have expected higher T values across the board. Rats have 25-40 kb telomeres and a single copy of 36B4. Thus, the ratio of telomere copy to 36B4 copy should have been more like 2 or 3, not 1.</p>
            <p> 3. Interpretation concerns.</p>
            <p> </p>
            <p> What is known about rapid telomere elongation to my knowledge is as follows:</p>
            <p> E. Blackburn&#x2019;s group showed that yeast mutants for telomerase RNA result in ultra-elongated telomeres rapidly and impair cellular survival. Further, some mutants acted as a &#x2018;time-bomb&#x2019; and killed cells later in life (slow on set of telomere elongation 
                <sup>
                    <xref ref-type="bibr" rid="rep-ref-40574-1">1</xref>
                </sup>). In human cancer cells telomere elongation induces cell differentiation and less aggressive tumors 
                <sup>
                    <xref ref-type="bibr" rid="rep-ref-40574-2">2</xref>
                </sup>. Another line of evidence from the L. Harrington lab is that telomere elongation reduced cell survival after radiation treatment 
                <sup>
                    <xref ref-type="bibr" rid="rep-ref-40574-3">3</xref>
                </sup>. From epidemiological evidence, telomere trajectory in CVD can be maintained, shorten or elongated in follow up 
                <sup>
                    <xref ref-type="bibr" rid="rep-ref-40574-4">4</xref>
                </sup>. Whether or not these changes correlate to health outcomes or are correlated with secondary CVD events is unknown.</p>
            <p> Thus, it appears that ultra-long telomere lengths (greater than 15 kb in human) could be equally as &#x2018;bad&#x2019; as short telomeres for cell fate decisions. The major cellular and molecular issues of long telomeres are stalled replication forks at telomeres and double strand breaks in the telomeres that a refractory to repair. Do the authors suspect that the immune cells with ultra-long telomeres will die soon after the 8-week period? Is there a major shift in immune cell distribution after 8 weeks on a high fat diet that would indicate a lasting impact of this observation? Are the cells with long telomeres dying?</p>
            <p> The concept that telomere length must be maintained at the correct telomere length and that telomere structure and sensing by the cell may be more important that absolute length is an emerging concept in the field. The results from the current study lend to the hypothesis that absolute length is not critical but rather tight regulation and sensing of telomere length is critical to cellular health and in turn gene expression regulation and cellular physiology. This idea needs and deserves more investigation as much of our evidence to date comes from cells grown in culture which may be very different than cells 
                <italic>in vivo</italic> when it comes to telomere biology.</p>
            <p> 4. Short duration and extreme impact.</p>
            <p> </p>
            <p> My hypothesis would have been no or very subtle changes in telomere length for this duration of intervention. What are the speculative mechanisms the authors see occurring? Are the leukocytes entering a stress mode whereby they activate telomerase and elongate telomeres dramatically to try to survive? Could this be the beginning of alternative lengthening of telomeres in these cells? Can the author speculate a bit about what they think might be happening in terms of mechanisms?</p>
            <p> Issue of timing &#x2013; in terms of physiology &#x2013; after 8 weeks on a high fat diet what else is changed in the immune system of these animals? Can the authors provide about how long 8 weeks in a rats&#x2019; life would be equivalent to how long on a high fat &#x2018;western&#x2019; diet for humans would be?</p>
            <p> What other physiological changes occur? Fatty liver? Higher cholesterol? Higher fasting blood glucose? Hormone levels (epi, nor-epi, insulin, IGF-1, glucagon, cortisol, growth hormone, TNF alpha, IL-6, IL-10, etc.). All of these measures could identify correlates to the change in telomere length.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Partly</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>No</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Partly</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Partly</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Partly</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Partly</p>
            <p>Reviewer Expertise:</p>
            <p>NA</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
        <back>
            <ref-list>
                <title>References</title>
                <ref id="rep-ref-40574-1">
                    <label>1</label>
                    <mixed-citation publication-type="journal">
                        <person-group person-group-type="author"/>:
                        <article-title>Runaway telomere elongation caused by telomerase RNA gene mutations.</article-title>
                        <source>
                            <italic>Nature</italic>
                        </source>.<year>1995</year>;<volume>376</volume>(<issue>6539</issue>) :
                        <elocation-id>10.1038/376403a0</elocation-id>
                        <fpage>403</fpage>-<lpage>9</lpage>
                        <pub-id pub-id-type="pmid">7630414</pub-id>
                        <pub-id pub-id-type="doi">10.1038/376403a0</pub-id>
                    </mixed-citation>
                </ref>
                <ref id="rep-ref-40574-2">
                    <label>2</label>
                    <mixed-citation publication-type="journal">
                        <person-group person-group-type="author"/>:
                        <article-title>Telomere length influences cancer cell differentiation in vivo.</article-title>
                        <source>
                            <italic>Mol Cell Biol</italic>
                        </source>.<year>2013</year>;<volume>33</volume>(<issue>15</issue>) :
                        <elocation-id>10.1128/MCB.00136-13</elocation-id>
                        <fpage>2988</fpage>-<lpage>95</lpage>
                        <pub-id pub-id-type="pmid">23716593</pub-id>
                        <pub-id pub-id-type="doi">10.1128/MCB.00136-13</pub-id>
                    </mixed-citation>
                </ref>
                <ref id="rep-ref-40574-3">
                    <label>3</label>
                    <mixed-citation publication-type="journal">
                        <person-group person-group-type="author"/>:
                        <article-title>Enforced telomere elongation increases the sensitivity of human tumour cells to ionizing radiation.</article-title>
                        <source>
                            <italic>DNA Repair (Amst)</italic>
                        </source>.<year>2015</year>;<volume>25</volume>:
                        <elocation-id>10.1016/j.dnarep.2014.11.005</elocation-id>
                        <fpage>54</fpage>-<lpage>9</lpage>
                        <pub-id pub-id-type="pmid">25484304</pub-id>
                        <pub-id pub-id-type="doi">10.1016/j.dnarep.2014.11.005</pub-id>
                    </mixed-citation>
                </ref>
                <ref id="rep-ref-40574-4">
                    <label>4</label>
                    <mixed-citation publication-type="journal">
                        <person-group person-group-type="author"/>:
                        <article-title>Telomere length trajectory and its determinants in persons with coronary artery disease: longitudinal findings from the heart and soul study.</article-title>
                        <source>
                            <italic>PLoS One</italic>
                        </source>.<year>2010</year>;<volume>5</volume>(<issue>1</issue>) :
                        <elocation-id>10.1371/journal.pone.0008612</elocation-id>
                        <fpage>e8612</fpage>
                        <pub-id pub-id-type="pmid">20072607</pub-id>
                        <pub-id pub-id-type="doi">10.1371/journal.pone.0008612</pub-id>
                    </mixed-citation>
                </ref>
            </ref-list>
        </back>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report36736">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.16480.r36736</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Lesmana</surname>
                        <given-names>Ronny</given-names>
                    </name>
                    <xref ref-type="aff" rid="r36736a1">1</xref>
                    <xref ref-type="aff" rid="r36736a2">2</xref>
                    <role>Referee</role>
                </contrib>
                <contrib contrib-type="author">
                    <name>
                        <surname>Goenawan</surname>
                        <given-names>Hanna</given-names>
                    </name>
                    <xref ref-type="aff" rid="r36736a3">3</xref>
                    <role>Co-referee</role>
                </contrib>
                <aff id="r36736a1">
                    <label>1</label>Central Laboratory, Universitas Padjadjaran, Bandung, Indonesia</aff>
                <aff id="r36736a2">
                    <label>2</label>Department of Physiology, Padjadjaran University (UNPAD), Bandung, Indonesia</aff>
                <aff id="r36736a3">
                    <label>3</label>Universitas Padjadjaran, Bandung, Indonesia</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>13</day>
                <month>8</month>
                <year>2018</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2018 Lesmana R and Goenawan H</copyright-statement>
                <copyright-year>2018</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport36736" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.15127.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>Study is interesting, however there are some points need to be added: 
                <list list-type="order">
                    <list-item>
                        <p>Training protocol should followed and compared with the protocol of the aerobic exercise in previous report, please cross check and add reference (lesmana et al, 2017
                            <sup>
                                <xref ref-type="bibr" rid="rep-ref-36736-1">1</xref>
                            </sup>).</p>
                    </list-item>
                    <list-item>
                        <p>Please present the change in level of profil lipid</p>
                    </list-item>
                    <list-item>
                        <p>Discuss more about factor change and induce telomere characteristic</p>
                    </list-item>
                    <list-item>
                        <p>Reasons the using high fat diet connected to the change telomere.</p>
                    </list-item>
                </list>
            </p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Partly</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Yes</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Partly</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Partly</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>NA</p>
            <p>We confirm that we have read this submission and believe that we have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however we have significant reservations, as outlined above.</p>
        </body>
        <back>
            <ref-list>
                <title>References</title>
                <ref id="rep-ref-36736-1">
                    <label>1</label>
                    <mixed-citation publication-type="journal">
                        <person-group person-group-type="author"/>:
                        <article-title>The change in thyroid hormone signaling by altered training intensity in male rat skeletal muscle.</article-title>
                        <source>
                            <italic>Endocr J</italic>
                        </source>.<year>2016</year>;<volume>63</volume>(<issue>8</issue>) :
                        <elocation-id>10.1507/endocrj.EJ16-0126</elocation-id>
                        <fpage>727</fpage>-<lpage>38</lpage>
                        <pub-id pub-id-type="pmid">27350720</pub-id>
                        <pub-id pub-id-type="doi">10.1507/endocrj.EJ16-0126</pub-id>
                    </mixed-citation>
                </ref>
            </ref-list>
        </back>
    </sub-article>
</article>
