<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.16337.1</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>Apoptosis inducing effects of chlorhexidine and essential oil mouthwashes on BHK-21 fibroblast cell line: An 
                    <italic>in vitro</italic> study</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 1; peer review: 1 approved, 1 not approved]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Ali El Basuony</surname>
                        <given-names>Shaimaa Ali Hamouda</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0003-0557-5607</uri>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>El Hossary</surname>
                        <given-names>Naglaa</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Raouf Amin</surname>
                        <given-names>Nermine</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Department of Oral and Maxillofacial Pathology, Faculty of Dentistry, Cairo University, Cairo, Egypt</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:Shaimaa.hamouda@dentistry.cu.edu.eg">Shaimaa.hamouda@dentistry.cu.edu.eg</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>26</day>
                <month>10</month>
                <year>2018</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2018</year>
            </pub-date>
            <volume>7</volume>
            <elocation-id>1703</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>4</day>
                    <month>10</month>
                    <year>2018</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2018 Ali El Basuony SAH et al.</copyright-statement>
                <copyright-year>2018</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/7-1703/pdf"/>
            <abstract>
                <p>

                    <bold>Background:</bold> The maintenance of oral health can be performed by mechanical and chemical means. Chemically, mouthwashes are used for personal oral health because they can inhibit dental plaque. The antibacterial effects of essential oils (EOs) and chlorhexidine (CHX) are well documented; however, the reaction of host tissue to these substances has a poor documentation. Until now studies have not examined the effect of EOs with sodium fluoride (EOF) on fibroblast cell lines. The aim of this study was to examine the effect of mouth rinse EOs, EOF and CHX on the apoptosis of fibroblast cell line.</p>
                <p>

                    <bold>Methods:</bold> BHK-21 fibroblast cell line was cultured and incubated in Eagle's Minimum Essential Medium containing EOs, EOF and CHX mouthwashes with different doses (15% or 25%) and various exposure times. Cell apoptosis was assayed using RT-PCR.</p>
                <p>

                    <bold>Results:</bold> EOs, EOF and CHX induce apoptotic effects on fibroblasts in a dose and time dependent manner.</p>
                <p>

                    <bold>Conclusion:</bold> CHX is the most cytotoxic mouthwash to fibroblasts as compared to mouthwashes containing EOs and EOF.</p>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>fibroblast</kwd>
                <kwd>chlorhexidine</kwd>
                <kwd>essential oils</kwd>
                <kwd>essential oils with sodium fluoride</kwd>
                <kwd>mouthwash.</kwd>
            </kwd-group>
            <funding-group>
                <funding-statement>The author(s) declared that no grants were involved in supporting this work.</funding-statement>
            </funding-group>
        </article-meta>
    </front>
    <body>
        <sec sec-type="intro">
            <title>Introduction</title>
            <p>Fibroblasts are the common cell type in connective tissue and plays a major role in normal function and in pathologic changes of oral tissues
                <sup>
                    <xref ref-type="bibr" rid="ref-1">1</xref>,
                    <xref ref-type="bibr" rid="ref-2">2</xref>
                </sup>. Various antiseptic agents are available in the form of mouthwashes, among them are essential oils (EOs), EOs with sodium fluoride (EOF) and chlorhexidine (CHX). The antibacterial action of these agents had been widely examined
                <sup>
                    <xref ref-type="bibr" rid="ref-1">1</xref>,
                    <xref ref-type="bibr" rid="ref-3">3</xref>,
                    <xref ref-type="bibr" rid="ref-4">4</xref>
                </sup>.</p>
            <p>In fibroblasts, EOs can induce depolarization of the mitochondrial membranes by decreasing the membrane potential, affecting ionic Ca++ cycling
                <sup>
                    <xref ref-type="bibr" rid="ref-5">5</xref>,
                    <xref ref-type="bibr" rid="ref-6">6</xref>
                </sup>. They change the permeability of membranes resulting in liberation of cytochrome, leading to apoptosis
                <sup>
                    <xref ref-type="bibr" rid="ref-7">7</xref>
                </sup>. Fluoride inhibits protein synthesis and thus it influences certain signalling pathways included in apoptosis such as the P53 pathway
                <sup>
                    <xref ref-type="bibr" rid="ref-8">8</xref>,
                    <xref ref-type="bibr" rid="ref-9">9</xref>
                </sup>.</p>
            <p>CHX inhibits protein and DNA synthesis, resulting in cell apoptosis
                <sup>
                    <xref ref-type="bibr" rid="ref-3">3</xref>,
                    <xref ref-type="bibr" rid="ref-10">10</xref>
                </sup>. Moreover, CHX can damage mitochondrial membranes resulting in leakage of apoptosis-inducing proteins
                <sup>
                    <xref ref-type="bibr" rid="ref-11">11</xref>,
                    <xref ref-type="bibr" rid="ref-12">12</xref>
                </sup>.</p>
            <p>Many previous studies have compared the effect of both CHX and EOs mouthwashes on cultured fibroblasts
                <sup>
                    <xref ref-type="bibr" rid="ref-3">3</xref>,
                    <xref ref-type="bibr" rid="ref-5">5</xref>
                </sup>. However, to the best of our knowledge, the combined effect of EOs and EOF hasn&#x2019;t been studied yet. In this study, we investigated the effect of different doses and different exposure periods of mouthwashes containing EOs, EOF and CHX on a fibroblast cell line.</p>
        </sec>
        <sec sec-type="methods">
            <title>Methods</title>
            <sec>
                <title>Laboratory procedures</title>
                <p>This study was performed on BHK-21 cell line in (Vacsera Co., Egypt). It was cultured according to a previous protocol
                    <sup>
                        <xref ref-type="bibr" rid="ref-3">3</xref>
                    </sup>. Briefly, BHK-21 cells were cultured in Eagle's Minimum Essential Medium (ATCC, Manassas, VA, USA). They were sub-cultured into 96-well plates (ATCC, USA).</p>
                <p>Commercial mouthwashes (3 total) were diluted to 15% and 25% using distilled water. Mouthwashes used were composed as followed:</p>
                <list list-type="bullet">
                    <list-item>
                        <label>- </label>
                        <p>EO mouthwash: containing thymol (0.0060%), eucalyptol (0.09%), mentol (0.042%) and methyl-salicylate (0.064%) in a 26.9% hydroalcoholic vehicle;</p>
                    </list-item>
                    <list-item>
                        <label>- </label>
                        <p>EOF mouthwash: containing EOs as before and 0.2% sodium fluoride;</p>
                    </list-item>
                    <list-item>
                        <label>- </label>
                        <p>CHX mouthwash: containing 0.12% chlorhexidine hydrochloric acid.</p>
                    </list-item>
                </list>
                <p>Cells were incubated with mouthwashes for 0, 1, 2, 3, 5, 10 minutes in the 96-well plates at 37
                    <sup>
                        <underline>o</underline>
                    </sup>C.</p>
            </sec>
            <sec>
                <title>Assessment of apoptosis</title>
                <p>After cell culturing, RNA extraction and quantitative real time polymerase chain reaction (PCR) was performed as follows
                    <sup>
                        <xref ref-type="bibr" rid="ref-1">1</xref>
                    </sup>:</p>
                <list list-type="bullet">
                    <list-item>
                        <label>1. </label>
                        <p>Total RNA was isolated using the RNeasy Micro Kit (Qiagen, Germany) and RNA concentration was measured spectrophotometrically using Nanodrop ND-1000.</p>
                    </list-item>
                    <list-item>
                        <label>2. </label>
                        <p>Reverse transcription was performed on 600 ng of total RNA using oligo dT primers and MMLV Reverse Transcriptase in a final volume of 20 mL (Invitrogen, CA, USA) for 5 minutes at 65
                            <sup>
                                <underline>o</underline>
                            </sup>C, followed by one hour at 37
                            <sup>
                                <underline>o</underline>
                            </sup>C.</p>
                    </list-item>
                    <list-item>
                        <label>3. </label>
                        <p>Samples were subsequently heated for 15 minutes at 70
                            <sup>
                                <underline>o</underline>
                            </sup>C to terminate the reverse transcription reaction.</p>
                    </list-item>
                    <list-item>
                        <label>4. </label>
                        <p>Real-time quantitative PCR was performed on the cDNA samples using an Applied Biosystem Real-Time Detection System. Annexin V was the target gene for apoptosis. Primer sequences for Annexin V: sense primer, 5' CAGTCTAGGTGCAGCTGCCG 3' and antisense primer, 5' GGTGAAGCAGGACCAGTGT3'. The following primer sequences were used for GAPDH (housekeeping gene): sense primer, 5' ATG GCC TTC CGT GTT CCT AC 3' and antisense primer, 5' GCC TGC TTC ACC ACC TTC TT 3'</p>
                    </list-item>
                    <list-item>
                        <label>5. </label>
                        <p>Real-time PCR was conducted by amplifying the cDNA with iQ SYBR Green Universal Master Mix (Applied Biosystems, CA, USA).</p>
                    </list-item>
                    <list-item>
                        <label>6. </label>
                        <p>Melting curve analysis of amplification products was performed at the end of the PCR reaction to confirm that a single PCR product was detected. For every PCR reaction, GAPDH was used as the internal control.</p>
                    </list-item>
                    <list-item>
                        <label>7. </label>
                        <p>A relative quantification method 2&#x2212;&#x0394;&#x0394;CT method was used
                            <sup>
                                <xref ref-type="bibr" rid="ref-13">13</xref>
                            </sup>. The relative quantitation value of target was normalized to the internal control (GAPDH).</p>
                    </list-item>
                </list>
            </sec>
            <sec>
                <title>Statistical methods</title>
                <p>Data was analysed using IBM Statistical Package for Social Sciences (SPSS), version 21 (SPSS Inc., IL, USA). Numerical data was described as mean and standard deviation and comparisons between these were performed using ANOVA and a post-hoc Tukey test.</p>
            </sec>
        </sec>
        <sec sec-type="results">
            <title>Results</title>
            <sec>
                <title>Microscopic examination</title>
                <p>Microscopic examination of fibroblast cell line after application of different mouthwashes at different concentrations and for different time durations is shown in 
                    <xref ref-type="fig" rid="f1">Figure 1</xref>.</p>
                <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                    <label>Figure 1. </label>
                    <caption>
                        <title>Microscopic examination of fibroblast BHK-21 cells treated with various mouthwashes at different concentrations and for different durations.</title>
                        <p>From L-R (
                            <bold>A</bold>) Untreated  fibroblast cell line demonstrated confluent growth of elongated cells. Some cells appeared bipolar and some were multipolar. (
                            <bold>B</bold>&#x2013;
                            <bold>E</bold>) Essential oil mouthwash: (
                            <bold>B</bold>) 15% for 1 minute showed many viable spindle shaped fibroblasts; (
                            <bold>C</bold>) 15% for 10 minutes showed decreased spindle shaped fibroblasts; (
                            <bold>D</bold>) 25% for 1 minute showed few viable spindle shaped fibroblasts; (
                            <bold>E</bold>) 25% for 10 minutes showed obvious cell free areas. (
                            <bold>F</bold>&#x2013;
                            <bold>I</bold>) Sodium fluoride mouthwash: (
                            <bold>F</bold>) 15% for 1 minute showed many viable spindle shaped fibroblasts and few apoptotic cells; (
                            <bold>G</bold>) 15% for 10 minutes showed destroyed fibroblasts; (
                            <bold>H</bold>) 25% for 1 minute showed large cell free areas; (
                            <bold>I</bold>) 25% for 10 minutes showed more obvious large cell free areas. (
                            <bold>J</bold>-
                            <bold>M</bold>) Chlorhexidine mouthwash: (
                            <bold>J</bold>) 15% for 1 and (
                            <bold>K</bold>) 10 minutes many viable fibroblasts were detected; (
                            <bold>L</bold>) 25% for 1 minute showed massive reduction in cell viability, many dead or destroyed fibroblasts surrounded by large cell free areas; (
                            <bold>M</bold>) 25% for 10 minutes, only few remnants of dead fibroblasts were obvious.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/17846/0e080273-900e-4c29-8e9a-37c4109e45ff_figure1.gif"/>
                </fig>
            </sec>
            <sec>
                <title>Effect of concentration of EOs, EOF and CHX mouthwashes on apoptosis induction in fibroblast cell line</title>
                <p>In all mouthwashes 25% concentration showed a statistically significant increase in apoptosis compared with 15% and the untreated control (
                    <xref ref-type="table" rid="T1">Table 1</xref> and 
                    <xref ref-type="fig" rid="f2">Figure 2</xref>).</p>
                <table-wrap id="T1" orientation="portrait" position="anchor">
                    <label>Table 1. </label>
                    <caption>
                        <title>Apoptosis induction in BHK-21 fibroblast cell line by EO, EOF and CHX mouthwashes compared to an untreated group (n=3).</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1">Mouthwash</th>
                                <th align="left" colspan="1" rowspan="1">Untreated</th>
                                <th align="left" colspan="1" rowspan="1">15% mouthwash dilution</th>
                                <th align="left" colspan="1" rowspan="1">25% mouthwash dilution</th>
                                <th align="left" colspan="1" rowspan="1">P-value
                                    <xref ref-type="other" rid="fn1">**</xref>
                                </th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td colspan="1" rowspan="1">EO</td>
                                <td colspan="1" rowspan="1">1.01&#x00b1;-0.2
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">1.34&#x00b1;0.470
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">5.97&#x00b1;1.90
                                    <sup>
                                        <bold>b</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">0.0000</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">EOF</td>
                                <td colspan="1" rowspan="1">1.01&#x00b1;-0.2
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">1.77&#x00b1;0.710
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">5.30&#x00b1;1.93
                                    <sup>
                                        <bold>b</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">0.0000</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">CHX</td>
                                <td colspan="1" rowspan="1">1.01&#x00b1;-0.2
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">1.97&#x00b1;0.52
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">10.3&#x00b1;2.61
                                    <sup>
                                        <bold>c</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">0.0000</td>
                            </tr>
                        </tbody>
                    </table>
                    <table-wrap-foot>
                        <fn>
                            <p id="fn1">*Groups with different letters are statistically significantly different. **ANOVA. EO, essential oil; EOF, sodium fluoride; CHX, chlorhexidine.</p>
                        </fn>
                    </table-wrap-foot>
                </table-wrap>
                <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                    <label>Figure 2. </label>
                    <caption>
                        <title>Apoptosis induction in fibroblast BHK-21 cells after incubation with various mouthwashes at different concentrations.</title>
                        <p>EO, essential oil; EOF, sodium fluoride; CHX, chlorhexidine (n=3).</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/17846/0e080273-900e-4c29-8e9a-37c4109e45ff_figure2.gif"/>
                </fig>
            </sec>
            <sec>
                <title>Effect of duration of application of EOs, EOF and CHX mouthwashes on apoptosis induction in fibroblast cell line</title>
                <p>In the EO mouthwash, values for apoptosis continued to significantly increase after 2, 3, 5 and 10 minutes for the 25% concentration (
                    <xref ref-type="table" rid="T2">Table 2</xref> and 
                    <xref ref-type="fig" rid="f3">Figure 3</xref>).</p>
                <table-wrap id="T2" orientation="portrait" position="anchor">
                    <label>Table 2. </label>
                    <caption>
                        <title>Effect of duration of application and percentage of an essential oil mouthwash on apoptosis induction in BHK-21 fibroblast cell line.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th colspan="1" rowspan="1"/>
                                <th align="center" colspan="6" rowspan="1">Time</th>
                                <th colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <th align="left" colspan="1" rowspan="1">Mouthwash</th>
                                <th align="left" colspan="1" rowspan="1">0</th>
                                <th align="left" colspan="1" rowspan="1">1</th>
                                <th align="left" colspan="1" rowspan="1">2</th>
                                <th align="left" colspan="1" rowspan="1">3</th>
                                <th align="left" colspan="1" rowspan="1">5</th>
                                <th align="left" colspan="1" rowspan="1">10</th>
                                <th align="left" colspan="1" rowspan="1">P-value
                                    <xref ref-type="other" rid="fn2">**</xref>
                                </th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td colspan="1" rowspan="1">
                                    <bold>15%</bold>
                                </td>
                                <td colspan="1" rowspan="1">1.01&#x00b1;1.5
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">1.15&#x00b1;0.18
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">1.17&#x00b1;0.21
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">1.22&#x00b1;0.46
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">1.5&#x00b1;0.502
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">1.74&#x00b1;0.65
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">0.6448</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">
                                    <bold>20%</bold>
                                </td>
                                <td colspan="1" rowspan="1">1.01&#x00b1;1.5
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">4.66&#x00b1;1.28
                                    <sup>
                                        <bold>b</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">5.26&#x00b1;1.58
                                    <sup>
                                        <bold>b</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">5.99&#x00b1;1.64
                                    <sup>
                                        <bold>b</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">6.57&#x00b1;1.65
                                    <sup>
                                        <bold>c</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">6.78&#x00b1;2.3
                                    <sup>
                                        <bold>c</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">0.0001</td>
                            </tr>
                        </tbody>
                    </table>
                    <table-wrap-foot>
                        <fn>
                            <p id="fn2">*Groups with different letters are statistically significantly different. **ANOVA</p>
                        </fn>
                    </table-wrap-foot>
                </table-wrap>
                <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                    <label>Figure 3. </label>
                    <caption>
                        <title>Apoptosis induction in BHK-21 fibroblast cell line after application of different concentrations of essential oil containing mouthwash for different time durations (n=3).</title>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/17846/0e080273-900e-4c29-8e9a-37c4109e45ff_figure3.gif"/>
                </fig>
                <p>In the EOF mouthwash, at 25% concentration, a significant increase in apoptosis values was detected after 5 and 10 minutes (
                    <xref ref-type="table" rid="T3">Table 3</xref> and 
                    <xref ref-type="fig" rid="f4">Figure 4</xref>).</p>
                <table-wrap id="T3" orientation="portrait" position="anchor">
                    <label>Table 3. </label>
                    <caption>
                        <title>Effect of duration of application and percentage of a sodium fluoride mouthwash on apoptosis induction in BHK-21 fibroblast cell line.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th colspan="1" rowspan="1"/>
                                <th align="center" colspan="6" rowspan="1">Time</th>
                                <th colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <th align="left" colspan="1" rowspan="1">Mouthwash</th>
                                <th align="left" colspan="1" rowspan="1">0</th>
                                <th align="left" colspan="1" rowspan="1">1</th>
                                <th align="left" colspan="1" rowspan="1">2</th>
                                <th align="left" colspan="1" rowspan="1">3</th>
                                <th align="left" colspan="1" rowspan="1">5</th>
                                <th align="left" colspan="1" rowspan="1">10</th>
                                <th align="left" colspan="1" rowspan="1">P-value
                                    <xref ref-type="other" rid="fn3">**</xref>
                                </th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td colspan="1" rowspan="1">
                                    <bold>15%</bold>
                                </td>
                                <td colspan="1" rowspan="1">1.01&#x00b1;1.5
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">1.19&#x00b1;0.15
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">1.24&#x00b1;0.18
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">1.42&#x00b1;0.34
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">2.13&#x00b1;0.31
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">2.74&#x00b1;0.25
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">0.0019</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">
                                    <bold>20%</bold>
                                </td>
                                <td colspan="1" rowspan="1">1.01&#x00b1;1.5
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">4.82&#x00b1;2.06
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">4.99&#x00b1;0.95
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">5.38&#x00b1;1.36
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">6.02&#x00b1;2.7
                                    <sup>
                                        <bold>b</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">7&#x00b1;1.96
                                    <sup>
                                        <bold>b</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">0.0008</td>
                            </tr>
                        </tbody>
                    </table>
                    <table-wrap-foot>
                        <fn>
                            <p id="fn3">*Groups with different letters are statistically significantly different. **ANOVA</p>
                        </fn>
                    </table-wrap-foot>
                </table-wrap>
                <fig fig-type="figure" id="f4" orientation="portrait" position="float">
                    <label>Figure 4. </label>
                    <caption>
                        <title>Apoptosis induction in BHK-21 fibroblast cell line after application of different concentrations of sodium fluoride containing mouthwash for different time durations (n=3).</title>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/17846/0e080273-900e-4c29-8e9a-37c4109e45ff_figure4.gif"/>
                </fig>
                <p>In the CHX mouthwash, at 25% concentration, a significant increase in apoptosis values started after 1 minute and continued to increase by time (
                    <xref ref-type="table" rid="T4">Table 4</xref> and 
                    <xref ref-type="fig" rid="f5">Figure 5</xref>).</p>
                <table-wrap id="T4" orientation="portrait" position="anchor">
                    <label>Table 4. </label>
                    <caption>
                        <title>Effect of duration of application and percentage of a chlorhexidine mouthwash on apoptosis induction in BHK-21 fibroblast cell line.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th colspan="1" rowspan="1"/>
                                <th align="center" colspan="6" rowspan="1">Time</th>
                                <th colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <th align="center" colspan="1" rowspan="1">Mouthwash</th>
                                <th align="left" colspan="1" rowspan="1">0</th>
                                <th align="left" colspan="1" rowspan="1">1</th>
                                <th align="left" colspan="1" rowspan="1">2</th>
                                <th align="left" colspan="1" rowspan="1">3</th>
                                <th align="left" colspan="1" rowspan="1">5</th>
                                <th align="left" colspan="1" rowspan="1">10</th>
                                <th align="center" colspan="1" rowspan="1">P-value
                                    <xref ref-type="other" rid="fn4">**</xref>
                                </th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td colspan="1" rowspan="1">
                                    <bold>15%</bold>
                                </td>
                                <td colspan="1" rowspan="1">1.01&#x00b1;1.5
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">1.86&#x00b1;0.71
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">1.87&#x00b1;0.36
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">1.94&#x00b1;0.69
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">2.06&#x00b1;0.25
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">2.38&#x00b1;0.45
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">0.1606</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1">
                                    <bold>20%</bold>
                                </td>
                                <td colspan="1" rowspan="1">1.01&#x00b1;1.5
                                    <sup>
                                        <bold>a</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">8.34&#x00b1;1.9
                                    <sup>
                                        <bold>c</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">10.6&#x00b1;3.4
                                    <sup>
                                        <bold>b</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">11.1&#x00b1;1.96
                                    <sup>
                                        <bold>d</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">11.3&#x00b1;0.83
                                    <sup>
                                        <bold>b</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">11.4&#x00b1;1.5
                                    <sup>
                                        <bold>b</bold>
                                    </sup>
                                </td>
                                <td colspan="1" rowspan="1">0.0000</td>
                            </tr>
                        </tbody>
                    </table>
                    <table-wrap-foot>
                        <fn>
                            <p id="fn4">*Groups with different letters are statistically significantly different. **ANOVA</p>
                        </fn>
                    </table-wrap-foot>
                </table-wrap>
                <fig fig-type="figure" id="f5" orientation="portrait" position="float">
                    <label>Figure 5. </label>
                    <caption>
                        <title>Apoptosis induction in BHK-21 fibroblast cell line after application of different concentrations of chlorhexidine containing mouthwash for different time durations (n=3).</title>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/17846/0e080273-900e-4c29-8e9a-37c4109e45ff_figure5.gif"/>
                </fig>
                <supplementary-material id="DS0" orientation="portrait" position="float" xlink:href="https://f1000researchdata.s3.amazonaws.com/datasets/16337/2ac9e0a2-8ed5-45f6-a5ec-d24151bd84fa_Dataset_1.zip">
                    <label>Dataset 1. File containing: Part A, Raw numerical data of RNA concentration at each concentration and duration of application of the mouthwashes; part B, raw phase contrast photomicrograph of fibroblast cell line after application of mouthwashes at different concentrations and durations</label>
                    <caption>
                        <p>

                            <ext-link ext-link-type="uri" xlink:href="https://dx.doi.org/10.5256/f1000research.16337.d220684">https://doi.org/10.5256/f1000research.16337.d220684</ext-link>
</p>
                    </caption>
                </supplementary-material>
            </sec>
        </sec>
        <sec sec-type="discussion">
            <title>Discussion</title>
            <p>The effectiveness of CHX and EOs mouthwashes in controlling the formation of plaque and gingivitis has been demonstrated
                <sup>
                    <xref ref-type="bibr" rid="ref-14">14</xref>
                </sup>. However, there are concerns that these products are harmful to oral cells
                <sup>
                    <xref ref-type="bibr" rid="ref-15">15</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-17">17</xref>
                </sup>.</p>
            <p>CHX is toxic, even in low concentrations, for different cell types including fibroblasts in culture
                <sup>
                    <xref ref-type="bibr" rid="ref-18">18</xref>,
                    <xref ref-type="bibr" rid="ref-19">19</xref>
                </sup>. Topical application of CHX can result in its penetration through the epithelial barrier leading to tissue damage
                <sup>
                    <xref ref-type="bibr" rid="ref-20">20</xref>
                </sup>. In our study, and increase in concentration for EOs, EOF and CHX mouthwashes resulted in an increase in apoptosis. This was also observed by Faria 
                <italic toggle="yes">et al</italic>.
                <sup>
                    <xref ref-type="bibr" rid="ref-1">1</xref>
                </sup> who reported that CHX induced apoptosis of cultured fibroblasts in a concentration dependent manner. Values for apoptosis at 15% and 25% concentrations of EOF were slightly higher than EOs alone in our study, demonstrating the ability of fluoride to enhance apoptosis induction, as previously described
                <sup>
                    <xref ref-type="bibr" rid="ref-9">9</xref>
                </sup>.</p>
            <p>A significant increase in apoptosis induction was seen at 15% concentration CHX and at 25% concentration EOs and EOF. This suggests that CHX is more effective than EOs and EOF in apoptosis induction. This result was in agreement with Tsourounakis 
                <italic toggle="yes">et al</italic>.
                <sup>
                    <xref ref-type="bibr" rid="ref-5">5</xref>
                </sup> who reported that there was a significant reduction in cell survival that occurred at concentrations of 15% CHX and 25% EOs
                <sup>
                    <xref ref-type="bibr" rid="ref-21">21</xref>
                </sup>.</p>
            <p>The increase in duration of application of EOs, EOF and CHX didn&#x2019;t significantly increase apoptosis at the low concentration of 15% in the present study. However, at 25% CHX, increase in the duration of treatment significantly enhanced apoptosis, which was significant obvious after 1 minute. This means that CHX is more efficient than EOs and EOF in apoptosis induction at lower concentrations. This was in accordance with Flemingson 
                <italic toggle="yes">et al</italic>.
                <sup>
                    <xref ref-type="bibr" rid="ref-3">3</xref>
                </sup> who stated that the apoptotic effect of CHX on fibroblasts occurs early, after 1 minute exposure, and added that CHX had the maximum cytotoxicity followed by EOs.</p>
        </sec>
        <sec sec-type="conclusions">
            <title>Conclusion</title>
            <p>CHX mouthwash is the most cytotoxic to fibroblasts compared to EOs and EOF containing mouthwashes. Adding fluoride to EOs in low concentrations didn&#x2019;t worsen the adverse effects of Eos as shown by the combination mouthwash containing EOs and fluoride.</p>
        </sec>
        <sec>
            <title>Data availability</title>
            <p>The data referenced by this article are under copyright with the following copyright statement: Copyright: &#x00ef;&#x00bf;&#x00bd; 2018 Ali El Basuony SAH et al.</p>
            <p>Data associated with the article are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication).
                <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/publicdomain/zero/1.0/"/>
            </p>
            <p>F1000Research: Dataset 1. File containing: Part A, Raw numerical data of RNA concentration at each concentration and duration of application of the mouthwashes; part B, raw phase contrast photomicrograph of fibroblast cell line after application of mouthwashes at different concentrations and durations., 
                <ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.5256/f1000research.16337.d220684">10.5256/f1000research.16337.d220684</ext-link>
                <sup>
                    <xref ref-type="bibr" rid="ref-22">22</xref>
                </sup>.</p>
        </sec>
    </body>
    <back>
        <ref-list>
            <ref id="ref-1">
                <label>1</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
				
                        <name name-style="western">
                            <surname>Faria</surname>
                            <given-names>G</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Celes</surname>
                            <given-names>MR</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>De Rossi</surname>
                            <given-names>A</given-names>
                        </name>
				
                        <etal/>
			</person-group>:
                    <article-title>Evaluation of chlorhexidine toxicity injected in the paw of mice and added to cultured l929 fibroblasts.</article-title>
                    <source>
				
                        <italic toggle="yes">J Endod.</italic>
			</source>
                    <year>2007</year>;<volume>33</volume>(<issue>6</issue>):<fpage>715</fpage>&#x2013;<lpage>722</lpage>.
                    <pub-id pub-id-type="pmid">17509413</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.joen.2006.12.023</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-2">
                <label>2</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
				
                        <name name-style="western">
                            <surname>Barnhart</surname>
                            <given-names>BD</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Chuang</surname>
                            <given-names>A</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Lucca</surname>
                            <given-names>JJ</given-names>
                        </name>
				
                        <etal/>
			</person-group>:
                    <article-title>An 
                        <italic toggle="yes">in vitro</italic> evaluation of the cytotoxicity of various endodontic irrigants on human gingival fibroblasts.</article-title>
                    <source>
				
                        <italic toggle="yes">J Endod.</italic>
			</source>
                    <year>2005</year>;<volume>31</volume>(<issue>8</issue>):<fpage>613</fpage>&#x2013;<lpage>615</lpage>.
                    <pub-id pub-id-type="pmid">16044047</pub-id>
                    <pub-id pub-id-type="doi">10.1097/01.don.0000153840.94227.87</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-3">
                <label>3</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
				
                        <name name-style="western">
                            <surname>Flemingson</surname>
                        </name>
					
                        <name name-style="western">
                            <surname>Emmadi</surname>
                            <given-names>P</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Ambalavanan</surname>
                            <given-names>N</given-names>
                        </name>				
				
                        <etal/>
			</person-group>:
                    <article-title>Effect of three commercial mouth rinses on cultured human gingival fibroblast: an 
                        <italic toggle="yes">in vitro</italic> study.</article-title>
                    <source>
				
                        <italic toggle="yes">Indian J Dent Res.</italic>
			</source>
                    <year>2008</year>;<volume>19</volume>(<issue>1</issue>):<fpage>29</fpage>&#x2013;<lpage>35</lpage>.
                    <pub-id pub-id-type="pmid">18245921</pub-id>
                    <pub-id pub-id-type="doi">10.4103/0970-9290.38929</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-4">
                <label>4</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
				
                        <name name-style="western">
                            <surname>Rajabalian</surname>
                            <given-names>S</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Mohammadi</surname>
                            <given-names>M</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Mozaffari</surname>
                            <given-names>B</given-names>
                        </name>
			</person-group>:
                    <article-title>Cytotoxicity evaluation of Persica mouthwash on cultured human and mouse cell lines in the presence and absence of fetal calf serum.</article-title>
                    <source>
				
                        <italic toggle="yes">Indian J Dent Res.</italic>
			</source>
                    <year>2009</year>;<volume>20</volume>(<issue>2</issue>):<fpage>169</fpage>&#x2013;<lpage>73</lpage>.
                    <pub-id pub-id-type="pmid">19553717</pub-id>
                    <pub-id pub-id-type="doi">10.4103/0970-9290.52894</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-5">
                <label>5</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
				
                        <name name-style="western">
                            <surname>Tsourounakis</surname>
                            <given-names>I</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Palaiologou-Gallis</surname>
                            <given-names>AA</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Stoute</surname>
                            <given-names>D</given-names>
                        </name>
				
                        <etal/>
			</person-group>:
                    <article-title>Effect of essential oil and chlorhexidine mouthwashes on gingival fibroblast survival and migration.</article-title>
                    <source>
				
                        <italic toggle="yes">J Periodontol.</italic>
			</source>
                    <year>2013</year>;<volume>84</volume>(<issue>8</issue>):<fpage>1211</fpage>&#x2013;<lpage>1220</lpage>.
                    <pub-id pub-id-type="pmid">23106509</pub-id>
                    <pub-id pub-id-type="doi">10.1902/jop.2012.120312</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-6">
                <label>6</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
				
                        <name name-style="western">
                            <surname>Carson</surname>
                            <given-names>CF</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Mee</surname>
                            <given-names>BJ</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Riley</surname>
                            <given-names>TV</given-names>
                        </name>
			</person-group>:
                    <article-title>Mechanism of action of 
                        <italic toggle="yes">Melaleuca alternifolia</italic> (tea tree) oil on 
                        <italic toggle="yes">Staphylococcus aureus</italic> determined by time-kill, lysis, leakage, and salt tolerance assays and electron microscopy.</article-title>
                    <source>
				
                        <italic toggle="yes">Antimicrob Agents Chemother.</italic>
			</source>
                    <year>2002</year>;<volume>46</volume>(<issue>6</issue>):<fpage>1914</fpage>&#x2013;<lpage>1920</lpage>.
                    <pub-id pub-id-type="pmid">12019108</pub-id>
                    <pub-id pub-id-type="doi">10.1128/AAC.46.6.1914-1920.2002</pub-id>
                    <pub-id pub-id-type="pmcid">127210</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-7">
                <label>7</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
				
                        <name name-style="western">
                            <surname>Armstrong</surname>
                            <given-names>JS</given-names>
                        </name>
			</person-group>:
                    <article-title>Mitochondrial membrane permeabilization: the sine qua non for cell death.</article-title>
                    <source>
				
                        <italic toggle="yes">BioEssays.</italic>
			</source>
                    <year>2006</year>;<volume>28</volume>(<issue>3</issue>):<fpage>253</fpage>&#x2013;<lpage>260</lpage>.
                    <pub-id pub-id-type="pmid">16479581</pub-id>
                    <pub-id pub-id-type="doi">10.1002/bies.20370</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-8">
                <label>8</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
				
                        <name name-style="western">
                            <surname>Jeng</surname>
                            <given-names>JH</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Hsieh</surname>
                            <given-names>CC</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Lan</surname>
                            <given-names>WH</given-names>
                        </name>
				
                        <etal/>
			</person-group>:
                    <article-title>Cytotoxicity of sodium fluoride on human oral mucosal fibroblasts and its mechanisms.</article-title>
                    <source>
				
                        <italic toggle="yes">Cell Biol Toxicol.</italic>
			</source>
                    <year>1998</year>;<volume>14</volume>(<issue>6</issue>):<fpage>383</fpage>&#x2013;<lpage>389</lpage>.
                    <pub-id pub-id-type="pmid">9879930</pub-id>
                    <pub-id pub-id-type="doi">10.1023/A:1007591426267</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-9">
                <label>9</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
				
                        <name name-style="western">
                            <surname>Karube</surname>
                            <given-names>H</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Nishitai</surname>
                            <given-names>G</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Inageda</surname>
                            <given-names>K</given-names>
                        </name>
				
                        <etal/>
			</person-group>:
                    <article-title>NaF activates MAPKs and induces apoptosis in odontoblast-like cells.</article-title>
                    <source>
				
                        <italic toggle="yes">J Dent Res.</italic>
			</source>
                    <year>2009</year>;<volume>88</volume>(<issue>5</issue>):<fpage>461</fpage>&#x2013;<lpage>465</lpage>.
                    <pub-id pub-id-type="pmid">19493891</pub-id>
                    <pub-id pub-id-type="doi">10.1177/0022034509334771</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-10">
                <label>10</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
				
                        <name name-style="western">
                            <surname>Chang</surname>
                            <given-names>YC</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Huang</surname>
                            <given-names>FM</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Tai</surname>
                            <given-names>KW</given-names>
                        </name>
				
                        <etal/>
			</person-group>:
                    <article-title>The effect of sodium hypochlorite and chlorhexidine on cultured human periodontal ligament cells.</article-title>
                    <source>
				
                        <italic toggle="yes">Oral Surg Oral Med Oral Pathol Oral Radiol Endod.</italic>
			</source>
                    <year>2001</year>;<volume>92</volume>(<issue>4</issue>):<fpage>446</fpage>&#x2013;<lpage>450</lpage>.
                    <pub-id pub-id-type="pmid">11598582</pub-id>
                    <pub-id pub-id-type="doi">10.1067/moe.2001.116812</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-11">
                <label>11</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
				
                        <name name-style="western">
                            <surname>Negrelo Newton</surname>
                            <given-names>AP</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Cadena</surname>
                            <given-names>SM</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Merlin Rocha</surname>
                            <given-names>ME</given-names>
                        </name>
				
                        <etal/>
			</person-group>:
                    <article-title>New data on biological effects of chlorhexidine: Fe
                        <sup>2+</sup> induced lipid peroxidation and mitochondrial permeability transition.</article-title>
                    <source>
				
                        <italic toggle="yes">Toxicol Lett.</italic>
			</source>
                    <year>2004</year>;<volume>151</volume>(<issue>3</issue>):<fpage>407</fpage>&#x2013;<lpage>416</lpage>.
                    <pub-id pub-id-type="pmid">15261985</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.toxlet.2004.02.013</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-12">
                <label>12</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
				
                        <name name-style="western">
                            <surname>Cribb</surname>
                            <given-names>AE</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Peyrou</surname>
                            <given-names>M</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Muruganandan</surname>
                            <given-names>S</given-names>
                        </name>
				
                        <etal/>
			</person-group>:
                    <article-title>The endoplasmic reticulum in xenobiotic toxicity.</article-title>
                    <source>
				
                        <italic toggle="yes">Drug Metab Rev.</italic>
			</source>
                    <year>2005</year>;<volume>37</volume>(<issue>3</issue>):<fpage>405</fpage>&#x2013;<lpage>42</lpage>.
                    <pub-id pub-id-type="pmid">16257829</pub-id>
                    <pub-id pub-id-type="doi">10.1080/03602530500205135</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-13">
                <label>13</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
				
                        <name name-style="western">
                            <surname>Boulter</surname>
                            <given-names>N</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Suarez</surname>
                            <given-names>FG</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Schibeci</surname>
                            <given-names>S</given-names>
                        </name>
				
                        <etal/>
			</person-group>:
                    <article-title>A simple, accurate and universal method for quantification of PCR.</article-title>
                    <source>
				
                        <italic toggle="yes">BMC Biotechnol.</italic>
			</source>
                    <year>2016</year>;<volume>16</volume>:<fpage>27</fpage>.
                    <pub-id pub-id-type="pmid">26956612</pub-id>
                    <pub-id pub-id-type="doi">10.1186/s12896-016-0256-y</pub-id>
                    <pub-id pub-id-type="pmcid">4784296</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-14">
                <label>14</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
				
                        <name name-style="western">
                            <surname>Haffajee</surname>
                            <given-names>AD</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Roberts</surname>
                            <given-names>C</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Murray</surname>
                            <given-names>L</given-names>
                        </name>
				
                        <etal/>
			</person-group>:
                    <article-title>Effect of herbal, essential oil, and chlorhexidine mouthrinses on the composition of the subgingival microbiota and clinical periodontal parameters.</article-title>
                    <source>
				
                        <italic toggle="yes">J Clin Dent.</italic>
			</source>
                    <year>2009</year>;<volume>20</volume>(<issue>7</issue>):<fpage>211</fpage>&#x2013;<lpage>217</lpage>.
                    <pub-id pub-id-type="pmid">20128317</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-15">
                <label>15</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
				
                        <name name-style="western">
                            <surname>Wyganowska-Swiatkowska</surname>
                            <given-names>M</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Urbaniak</surname>
                            <given-names>P</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Szkaradkiewicz</surname>
                            <given-names>A</given-names>
                        </name>
				
                        <etal/>
			</person-group>:
                    <article-title>Effects of chlorhexidine, essential oils and herbal medicines (Salvia, Chamomile, Calendula) on human fibroblast  
                        <italic toggle="yes">in vitro</italic>.</article-title>
                    <source>
				
                        <italic toggle="yes">Cent Eur J Immunol.</italic>
			</source>
                    <year>2016</year>;<volume>41</volume>(<issue>2</issue>):<fpage>125</fpage>&#x2013;<lpage>131</lpage>.
                    <pub-id pub-id-type="pmid">27536196</pub-id>
                    <pub-id pub-id-type="doi">10.5114/ceji.2016.59739</pub-id>
                    <pub-id pub-id-type="pmcid">4967643</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-16">
                <label>16</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
				
                        <name name-style="western">
                            <surname>Selwitz</surname>
                            <given-names>RH</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Ismail</surname>
                            <given-names>AI</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Pitts</surname>
                            <given-names>NB</given-names>
                        </name>
			</person-group>:
                    <article-title>Dental caries.</article-title>
                    <source>
				
                        <italic toggle="yes">Lancet.</italic>
			</source>
                    <year>2007</year>;<volume>369</volume>(<issue>9555</issue>):<fpage>51</fpage>&#x2013;<lpage>59</lpage>.
                    <pub-id pub-id-type="pmid">17208642</pub-id>
                    <pub-id pub-id-type="doi">10.1016/S0140-6736(07)60031-2</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-17">
                <label>17</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
				
                        <name name-style="western">
                            <surname>Giannelli</surname>
                            <given-names>M</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Chellini</surname>
                            <given-names>F</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Margheri</surname>
                            <given-names>M</given-names>
                        </name>
				
                        <etal/>
			</person-group>:
                    <article-title>Effect of chlorhexidine digluconate on different cell types: a molecular and ultrastructural investigation.</article-title>
                    <source>
				
                        <italic toggle="yes">Toxicol In Vitro.</italic>
			</source>
                    <year>2008</year>;<volume>22</volume>(<issue>2</issue>):<fpage>308</fpage>&#x2013;<lpage>317</lpage>.
                    <pub-id pub-id-type="pmid">17981006</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.tiv.2007.09.012</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-18">
                <label>18</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
				
                        <name name-style="western">
                            <surname>Ghabanchi</surname>
                            <given-names>J</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Moattari</surname>
                            <given-names>A</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Darafshi</surname>
                            <given-names>R</given-names>
                        </name>
				
                        <etal/>
			</person-group>:
                    <article-title>Effects of three Commercial Mouth Rinses on the Cultured Fibroblasts: An 
                        <italic toggle="yes">in Vitro</italic> Study.</article-title>
                    <source>
				
                        <italic toggle="yes">J Dent (Shiraz).</italic>
			</source>
                    <year>2013</year>;<volume>14</volume>(<issue>2</issue>):<fpage>64</fpage>&#x2013;<lpage>7</lpage>.
                    <pub-id pub-id-type="pmid">24724121</pub-id>
                    <pub-id pub-id-type="pmcid">3977549</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-19">
                <label>19</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
				
                        <name name-style="western">
                            <surname>Eren</surname>
                            <given-names>K</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Ozmeri&#x00e7;</surname>
                            <given-names>N</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Sarda&#x015f;</surname>
                            <given-names>S</given-names>
                        </name>
			</person-group>:
                    <article-title>Monitoring of buccal epithelial cells by alkaline comet assay (single cell gel electrophoresis technique) in cytogenetic evaluation of chlorhexidine.</article-title>
                    <source>
				
                        <italic toggle="yes">Clin Oral Investig.</italic>
			</source>
                    <year>2002</year>;<volume>6</volume>(<issue>3</issue>):<fpage>150</fpage>&#x2013;<lpage>154</lpage>.
                    <pub-id pub-id-type="pmid">12271347</pub-id>
                    <pub-id pub-id-type="doi">10.1007/s00784-002-0168-1</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-20">
                <label>20</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
				
                        <name name-style="western">
                            <surname>M&#x00fc;ller</surname>
                            <given-names>HD</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Eick</surname>
                            <given-names>S</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Moritz</surname>
                            <given-names>A</given-names>
                        </name>
				
                        <etal/>
			</person-group>:
                    <article-title>Cytotoxicity and Antimicrobial Activity of Oral Rinses 
                        <italic toggle="yes">In Vitro</italic>.</article-title>
                    <source>
				
                        <italic toggle="yes">Biomed Res Int.</italic>
			</source>
                    <year>2017</year>;<volume>2017</volume>: 4019723.
                    <pub-id pub-id-type="pmid">28401154</pub-id>
                    <pub-id pub-id-type="doi">10.1155/2017/4019723</pub-id>
                    <pub-id pub-id-type="pmcid">5376431</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-21">
                <label>21</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
				
                        <name name-style="western">
                            <surname>Afonina</surname>
                            <given-names>E</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Stauber</surname>
                            <given-names>R</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Pavlakis</surname>
                            <given-names>GN</given-names>
                        </name>
			</person-group>:
                    <article-title>The human poly(A)-binding protein 1 shuttles between the nucleus and the cytoplasm.</article-title>
                    <source>
				
                        <italic toggle="yes">J Biol Chem.</italic>
			</source>
                    <year>1998</year>;<volume>273</volume>(<issue>21</issue>):<fpage>13015</fpage>&#x2013;<lpage>13021</lpage>.
                    <pub-id pub-id-type="pmid">9582337</pub-id>
                    <pub-id pub-id-type="doi">10.1074/jbc.273.21.13015</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-22">
                <label>22</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">
				
                        <name name-style="western">
                            <surname>El Basuony</surname>
                            <given-names>SAH</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>El Hossary</surname>
                            <given-names>N</given-names>
                        </name>
				
                        <name name-style="western">
                            <surname>Raouf Amin</surname>
                            <given-names>N</given-names>
                        </name>
			</person-group>:
                    <article-title>Dataset 1 in: Apoptosis inducing effects of chlorhexidine and essential oil mouthwashes on BHK-21 fibroblast cell line: An 
                        <italic toggle="yes">in vitro</italic> study.</article-title>
                    <source>
				
                        <italic toggle="yes">F1000Research.</italic>
			</source>
                    <year>2018</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.5256/f1000research.16337.d220684">http://www.doi.org/10.5256/f1000research.16337.d220684</ext-link>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report40531">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.17846.r40531</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Lallier</surname>
                        <given-names>Thomas E.</given-names>
                    </name>
                    <xref ref-type="aff" rid="r40531a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r40531a1">
                    <label>1</label>Department of Oral Biology, Louisiana State University Health Science Center, New Orleans, LA, USA</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>18</day>
                <month>1</month>
                <year>2019</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2019 Lallier TE</copyright-statement>
                <copyright-year>2019</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport40531" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.16337.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>reject</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>The authors demonstrate that chlorohexidine (CHX)- and essential oil (EO)-containing mouth rinses induce cell death in fibroblasts in culture. They attempt to prove that this is through apoptosis, using qPCR to quantify the expression of Annexin V (Annexin-A5) in these cells. Unfortunately, this assay is flawed.&#x00a0;Annexin V is a normally-expressed protein that happens to bind to phosphatidylserine, a phospholipid normally on the cytoplasmic leaflet of the plasma membrane. During apoptosis, this inner leaflet is exposed to the extracellular environment.&#x00a0;Thus, Annexin V can be used to identify apoptotic cells fluorometrically.&#x00a0;An increase in Annexin V transcript expression has not been linked with apoptosis.&#x00a0;Furthermore, apoptosis is a post-translational event involving cytochromes, caspases and other proteins (e.g. BCL2 and BAX), and thus cannot be detected using a transcriptional assay like qPCR.</p>
            <p> </p>
            <p> Thus, the only finding of this manuscript is that these mouth rinses lead to cell death, which is neither novel nor worthy of independent indexing.</p>
            <p> </p>
            <p> The manuscript also contains numerous other errors (e.g.&#x00a0;the photomicrographs in Figure 1 are of too little contrast to demonstrate anything, and are not even properly identified), and this is not yet ready for indexing.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>No</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>No</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>No</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>No</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>No</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>No</p>
            <p>Reviewer Expertise:</p>
            <p>Cell biology, including cell survival, cell attachment, cell migration assays, as well as qPCR , ELISA, and immunocytochemistry</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.</p>
        </body>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report39910">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.17846.r39910</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>ElShafei</surname>
                        <given-names>Marwa Mokbel</given-names>
                    </name>
                    <xref ref-type="aff" rid="r39910a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r39910a1">
                    <label>1</label>Oral Pathology Department, Faculty of Dentistry, Misr International University, Cairo, Egypt</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>9</day>
                <month>11</month>
                <year>2018</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2018 ElShafei MM</copyright-statement>
                <copyright-year>2018</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport39910" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.16337.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>In my opinion normality tests should be performed before statistical tests and considering the small sample size, non-parametric tests could have been used. The article is approved, though a recommendation can be added after the conclusion in order to recommend further studies to evaluate the amount and percentage of mouth wash absorption to the connective tissue and hence reaching fibroblasts as the direct effect on the cell line doesn't mimic the real life effect.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>I cannot comment. A qualified statistician is required.</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>NA</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
</article>
