<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.14836.1</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>Diurnal variation in the proinflammatory activity of urban fine particulate matter (PM
                    <sub>2.5</sub>) by 
                    <italic>in vitro</italic> assays</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 1; peer review: awaiting peer review]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Lovett</surname>
                        <given-names>Christopher</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0003-4037-3971</uri>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Cacciottolo</surname>
                        <given-names>Mafalda</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Shirmohammadi</surname>
                        <given-names>Farimah</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Haghani</surname>
                        <given-names>Amin</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Morgan</surname>
                        <given-names>Todd E.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Sioutas</surname>
                        <given-names>Constantinos</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Finch</surname>
                        <given-names>Caleb E.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Department of Civil and Environmental Engineering, University of Southern California, Los Angeles, CA, 90089, USA</aff>
                <aff id="a2">
                    <label>2</label>Leonard Davis School of Gerontology, University of Southern California, Los Angeles, CA, 90089, USA</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:clovett@usc.edu">clovett@usc.edu</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>15</day>
                <month>5</month>
                <year>2018</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2018</year>
            </pub-date>
            <volume>7</volume>
            <elocation-id>596</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>10</day>
                    <month>5</month>
                    <year>2018</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2018 Lovett C et al.</copyright-statement>
                <copyright-year>2018</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/7-596/pdf"/>
            <abstract>
                <p>
                    <bold>Background:</bold> Ambient particulate matter (PM) smaller than 2.5 &#x00b5;m in diameter (PM
                    <sub>2.5</sub>) undergoes diurnal changes in chemical composition due to photochemical oxidation. In this study we examine the relationships between oxidative activity and inflammatory responses associated with these diurnal chemical changes. Because secondary PM contains a higher fraction of oxidized PM species, we hypothesized that PM
                    <sub>2.5</sub> collected during afternoon hours would induce a greater inflammatory response than primary, morning PM
                    <sub>2.5</sub>.</p>
                <p>
                    <bold>Methods:</bold> Time-integrated aqueous slurry samples of ambient PM
                    <sub>2.5</sub> were collected using a direct aerosol-into-liquid collection system during defined morning and afternoon time periods. PM
                    <sub>2.5</sub> samples were collected for 5 weeks in the late summer (August-September) of 2016 at a central Los Angeles site. Morning samples, largely consisting of fresh primary traffic emissions (primary PM), were collected from 6&#x2013;9am (am-PM
                    <sub>2.5</sub>), and afternoon samples were collected from 12&#x2013;4pm (pm-PM
                    <sub>2.5</sub>), when PM composition is dominated by products of photochemical oxidation (secondary PM). The two diurnally phased PM
                    <sub>2.5</sub> slurries (am- and pm-PM
                    <sub>2.5</sub>) were characterized for chemical composition and BV-2 microglia were assayed 
                    <italic toggle="yes">in vitro</italic> for oxidative and inflammatory gene responses.</p>
                <p>
                    <bold>Results:</bold> Contrary to expectations, the am-PM
                    <sub>2.5</sub> slurry had more proinflammatory activity than the pm-PM
                    <sub>2.5</sub> slurry as revealed by nitric oxide (NO) induction, as well as the upregulation of proinflammatory cytokines IL-1&#x03b2;, IL-6, and CCL2 (MCP-1), as assessed by messenger RNA production.</p>
                <p>
                    <bold>Conclusions:</bold> The diurnal differences observed in this study may be in part attributed to the greater content of transition metals and water-insoluble organic carbon (WIOC) of am-PM
                    <sub>2.5</sub> (primary PM) vs. pm-PM
                    <sub>2.5</sub> (secondary PM), as these two classes of compounds can increase PM
                    <sub>2.5</sub> toxicity.</p>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>Photochemistry</kwd>
                <kwd>Los Angeles</kwd>
                <kwd>PM2.5</kwd>
                <kwd>Oxidative stress</kwd>
                <kwd>Traffic</kwd>
                <kwd>Primary PM</kwd>
                <kwd>Secondary PM</kwd>
                <kwd>Neuroinflammation</kwd>
            </kwd-group>
            <funding-group>
                <award-group id="fund-1">
                    <funding-source>National Insitutes of Health</funding-source>
                    <award-id>RF1-AG051521-01</award-id>
                    <award-id>R21-AG050201-01A1</award-id>
                </award-group>
                <award-group id="fund-2">
                    <funding-source>University of Southern California Viterbi Dean&#x2019;s Ph.D. Fellowship</funding-source>
                </award-group>
                <funding-statement>This study was supported in part by the University of Southern California Viterbi Dean&#x2019;s Ph.D. Fellowship, and by NIH research grants RF1-AG051521-01 and R21-AG050201-01A1.</funding-statement>
            </funding-group>
        </article-meta>
    </front>
    <body>
        <sec sec-type="intro">
            <title>Introduction</title>
            <p>Particulate matter (PM) with an aerodynamic diameter less than 2.5 &#x00b5;m (fine PM or PM
                <sub>2.5</sub>), is associated with diverse health problems and chronic diseases, including asthma, chronic obstructive pulmonary disease (COPD), lung cancer, and coronary heart disease (
                <xref ref-type="bibr" rid="ref-12">Delfino 
                    <italic toggle="yes">et al.</italic>, 2005</xref>; 
                <xref ref-type="bibr" rid="ref-13">Delfino 
                    <italic toggle="yes">et al.</italic>, 2011</xref>; 
                <xref ref-type="bibr" rid="ref-14">Dockery 
                    <italic toggle="yes">et al.</italic>, 1993</xref>; 
                <xref ref-type="bibr" rid="ref-15">Dominici 
                    <italic toggle="yes">et al.</italic>, 2006</xref>; 
                <xref ref-type="bibr" rid="ref-75">Kaufman 
                    <italic toggle="yes">et al.</italic>, 2016</xref>; 
                <xref ref-type="bibr" rid="ref-27">Kim 
                    <italic toggle="yes">et al.</italic>, 2013</xref>; 
                <xref ref-type="bibr" rid="ref-30">Landrigan 
                    <italic toggle="yes">et al.</italic>, 2018</xref>; 
                <xref ref-type="bibr" rid="ref-47">Shah 
                    <italic toggle="yes">et al.</italic>, 2013</xref>). Findings of recent epidemiological studies extend chronic PM
                <sub>2.5</sub> exposure risk to Alzheimer&#x2019;s disease and accelerated cognitive decline (
                <xref ref-type="bibr" rid="ref-1">Cacciottolo 
                    <italic toggle="yes">et al.</italic>, 2017</xref>; 
                <xref ref-type="bibr" rid="ref-5">Chen 
                    <italic toggle="yes">et al.</italic>, 2015</xref>; 
                <xref ref-type="bibr" rid="ref-4">Chen 
                    <italic toggle="yes">et al.</italic>, 2017</xref>). Corresponding rodent models show robust indicators of inflammatory and oxidative stress to PM
                <sub>2.5</sub> fractions in pathological responses of aorta (
                <xref ref-type="bibr" rid="ref-32">Li 
                    <italic toggle="yes">et al.</italic>, 2003</xref>), brain (
                <xref ref-type="bibr" rid="ref-7">Cheng 
                    <italic toggle="yes">et al.</italic>, 2016b</xref>; 
                <xref ref-type="bibr" rid="ref-31">Levesque 
                    <italic toggle="yes">et al.</italic>, 2011</xref>; 
                <xref ref-type="bibr" rid="ref-37">MohanKumar 
                    <italic toggle="yes">et al.</italic>, 2008</xref>; 
                <xref ref-type="bibr" rid="ref-38">Morgan 
                    <italic toggle="yes">et al.</italic>, 2011</xref>), and lung (
                <xref ref-type="bibr" rid="ref-59">Zhang 
                    <italic toggle="yes">et al.</italic>, 2012</xref>).</p>
            <p>In addition to the epidemiological associations with chronic disease, we must also consider diurnal variations in airborne particulate matter chemistry that are not included in most long-term epidemiological studies. Diurnal variation in air pollution toxicity is suggested by diurnal variations in emergency department admissions for dementia (
                <xref ref-type="bibr" rid="ref-34">Linares 
                    <italic toggle="yes">et al.</italic>, 2017</xref>), ischemic stroke (
                <xref ref-type="bibr" rid="ref-23">Han 
                    <italic toggle="yes">et al.</italic>, 2016</xref>), and respiratory conditions (
                <xref ref-type="bibr" rid="ref-10">Darrow 
                    <italic toggle="yes">et al.</italic>, 2011</xref>). Although these admissions were more strongly associated with ozone than with PM
                <sub>2.5</sub> in all three of these studies, diurnal changes in PM
                <sub>2.5</sub> chemistry must also be considered as an influencing factor. Freshly emitted primary PM undergoes photochemical oxidation reactions over the course of the day, catalyzed by ultraviolet (UV) sunlight, which results in diverse oxidized organic and inorganic products (secondary PM) (
                <xref ref-type="bibr" rid="ref-18">Forstner 
                    <italic toggle="yes">et al.</italic>, 1997</xref>; 
                <xref ref-type="bibr" rid="ref-22">Grosjean &amp; Seinfeld, 1989</xref>), along with concomitant changes in PM toxicity. These diurnal changes in PM
                <sub>2.5</sub> composition and associated toxicity are relevant to and may inform future long-term epidemiological studies of primary and secondary particulate matter. While prior studies in the Los Angeles air basin have shown extensive diurnal variations in PM composition and size, the findings of PM oxidative activity have been inconsistent and differ between various assays of oxidative potential (
                <xref ref-type="bibr" rid="ref-42">Saffari 
                    <italic toggle="yes">et al.</italic>, 2015</xref>; 
                <xref ref-type="bibr" rid="ref-54">Verma 
                    <italic toggle="yes">et al.</italic>, 2009</xref>; 
                <xref ref-type="bibr" rid="ref-56">Wang 
                    <italic toggle="yes">et al.</italic>, 2013b</xref>).</p>
            <p>The current study further examined diurnal variations in composition and oxidative potential of PM samples collected at the central Los Angeles site used in the three studies mentioned above. However, unlike these earlier studies, PM samples were collected by a direct aerosol-into-liquid collection method to provide time-integrated aqueous PM
                <sub>2.5</sub> slurries for both morning and afternoon periods. This technology allows for a more comprehensive analysis than the filterable (i.e. water extracted) particulate samples examined in our prior studies (
                <xref ref-type="bibr" rid="ref-38">Morgan 
                    <italic toggle="yes">et al.</italic>, 2011</xref>; 
                <xref ref-type="bibr" rid="ref-42">Saffari 
                    <italic toggle="yes">et al.</italic>, 2015</xref>; 
                <xref ref-type="bibr" rid="ref-54">Verma 
                    <italic toggle="yes">et al.</italic>, 2009</xref>; 
                <xref ref-type="bibr" rid="ref-57">Woodward 
                    <italic toggle="yes">et al.</italic>, 2017a</xref>).</p>
            <p>Microglia were used for 
                <italic toggle="yes">in vitro</italic> assays of oxidative and inflammatory responses to PM
                <sub>2.5</sub> exposures because of their increasingly recognized role in environmental neurotoxicology (
                <xref ref-type="bibr" rid="ref-29">Krafft, 2015</xref>). Air pollution can induce premature microglial activation, as documented in rodent models (
                <xref ref-type="bibr" rid="ref-6">Cheng 
                    <italic toggle="yes">et al.</italic>, 2016a</xref>; 
                <xref ref-type="bibr" rid="ref-24">Hanamsagar &amp; Bilbo, 2017</xref>; 
                <xref ref-type="bibr" rid="ref-38">Morgan 
                    <italic toggle="yes">et al.</italic>, 2011</xref>) and as indicated for young adults living in the highly polluted Mexico City (
                <xref ref-type="bibr" rid="ref-2">Calderon-Garciduenas 
                    <italic toggle="yes">et al.</italic>, 2008</xref>; 
                <xref ref-type="bibr" rid="ref-3">Calderon-Garciduenas 
                    <italic toggle="yes">et al.</italic>, 2018</xref>). Microglia (BV-2) cell cultures were assayed for induction of nitric oxide (NO) and for proinflammatory gene mRNA responses of interleukins 6 and 1&#x03b2; (IL-6 &amp; IL-1&#x03b2;), and monocyte chemoattractant protein 1 (MCP-1), also known as chemokine (C-C motif) ligand 2 (CCL2). These markers were chosen because of their 
                <italic toggle="yes">in vivo</italic> and 
                <italic toggle="yes">in vitro</italic> responses to ultrafine PM shown in prior studies (
                <xref ref-type="bibr" rid="ref-7">Cheng 
                    <italic toggle="yes">et al.</italic>, 2016b</xref>; 
                <xref ref-type="bibr" rid="ref-38">Morgan 
                    <italic toggle="yes">et al.</italic>, 2011</xref>; 
                <xref ref-type="bibr" rid="ref-58">Woodward 
                    <italic toggle="yes">et al.</italic>, 2017b</xref>).</p>
            <p>We hypothesized that afternoon PM
                <sub>2.5</sub> (pm-PM
                <sub>2.5</sub>), with its high proportion of secondary photochemical oxidation products, would have greater oxidative and proinflammatory activity than freshly emitted, primary PM collected during morning hours (am-PM
                <sub>2.5</sub>).</p>
        </sec>
        <sec sec-type="methods">
            <title>Methods</title>
            <sec>
                <title>Particulate sample collection</title>
                <p>All sampling was done at the University of Southern California Particle Instrumentation Unit (PIU), located approximately 150 meters downwind (east) of the Los Angeles I-110 freeway (34&#x00b0;1&#x2019;9&#x201d; N, 118&#x00b0;16&#x2019;38&#x201d; W). PM
                    <sub>2.5</sub> samples were collected weekdays during the morning rush hour period of 6am&#x2013;9am, as well as during the afternoon hours of 12pm&#x2013;4pm, when photochemical products of primary PM oxidation are dominant in the atmosphere. The 5-week sampling campaign was conducted during late summer (August and September) of 2016, ensuring maximum UV sunlight exposure to enhance photochemical oxidation reactions.</p>
                <p>Particle collection employed a novel high-volume aerosol-into-liquid collector developed and built at USC&#x2019;s Sioutas Aerosol Laboratory, which provides concentrated slurries of fine and/or ultrafine PM (
                    <xref ref-type="bibr" rid="ref-55">Wang 
                        <italic toggle="yes">et al.</italic>, 2013a</xref>). A 2.5 &#x00b5;m cut-point slit impactor at the inlet to the online sampling system removed PM larger than 2.5 &#x00b5;m in diameter and ensured that only PM
                    <sub>2.5</sub> was captured in the aerosol-into-liquid collector. This sampler operates at 200 liters per minute (lpm) flow; two inlet aerosol streams, each at 100 lpm flow, are merged and passed through a steam bath where ultrapure water vapor condenses on the surfaces of airborne particles, growing the droplets to 2&#x2013;3 &#x03bc;m in diameter. Downstream of the hot water bath, particles enter an electronic chiller, where they are cooled and condensed, passing through an impactor and accumulating in the aerosol-into-liquid collector as an aqueous PM
                    <sub>2.5</sub> slurry. For each sampling condition, morning and afternoon, one time-integrated slurry sample was collected for chemical speciation and biological assays.</p>
            </sec>
            <sec>
                <title>PM gravimetric analysis</title>
                <p>To determine mass loadings of the PM
                    <sub>2.5</sub> slurry samples, 47 mm Zefluor filters (Pall Life Sciences, Ann Arbor, MI, USA) were used to capture PM
                    <sub>2.5</sub> passing through a parallel airstream at a flow rate of 9 lpm. Mass of the PM
                    <sub>2.5</sub> filter samples was determined gravimetrically by pre- and post-weighing the Zefluor filters, equilibrated at controlled temperature (22&#x2013;24 &#x00b0;C) and relative humidity (of 40&#x2013;50%) conditions. Slurry PM concentrations were calculated from the filter mass loadings and air volume sampled per time period.</p>
            </sec>
            <sec>
                <title>PM chemical species analysis</title>
                <p>Aqueous PM
                    <sub>2.5</sub> slurry samples were analyzed for metals and trace elements, total carbon (TC), and inorganic ions. Analyses were performed in triplicate on one aliquot of each slurry, morning (am-PM
                    <sub>2.5</sub>) and afternoon (pm-PM
                    <sub>2.5</sub>). Total metals and trace elements were quantified using magnetic-sectored Inductively Coupled Plasma Mass Spectroscopy (SF-ICPMS) following acid extraction, while analysis of the samples for inorganic anions was achieved by ion chromatography (IC) (
                    <xref ref-type="bibr" rid="ref-60">Zhang 
                        <italic toggle="yes">et al.</italic>, 2008</xref>). Total carbon was determined using a Sievers 900 Total Carbon Analyzer (
                    <xref ref-type="bibr" rid="ref-76">Sullivan 
                        <italic toggle="yes">et al.</italic>, 2004</xref>). Uncertainty values for all analyses are reported in the results as analytical error. Each uncertainty value is calculated as the square root of the sum of squares of the instrument and blank uncertainty components (S.D. of triplicate analyses, S.D. of triplicate blank measurements).</p>
            </sec>
            <sec>
                <title>Microglial 
                    <italic toggle="yes">in vitro</italic> assays</title>
                <p>
                    <bold>
                        <italic toggle="yes">BV-2 Cell Culture.</italic>
                    </bold> PM
                    <sub>2.5</sub> slurry samples were assayed with immortalized BV-2 microglia (
                    <ext-link ext-link-type="uri" xlink:href="https://web.expasy.org/cellosaurus/CVCL_0182">RRID: CVCL_0182</ext-link>) (
                    <xref ref-type="bibr" rid="ref-16">Eun 
                        <italic toggle="yes">et al.</italic>, 2017</xref>; 
                    <xref ref-type="bibr" rid="ref-21">Gresa-Arribas 
                        <italic toggle="yes">et al.</italic>, 2012</xref>). BV-2 cells were cultured in Dulbecco&#x2019;s Modified Eagle&#x2019;s Medium/Ham&#x2019;s F12 50/50 Mix (DMEM F12 50/50; # 11320033, Life Technologies, Carlsbad, CA) supplemented with 10% fetal bovine serum (FBS; #45000&#x2013;734, VWR, Radnor, PA), 1% penicillin/streptomycin (#P4333&#x2013;100ML, Sigma-Aldrich, St. Louis, MO), and 1% L-glutamine (Glutamax; #35050061, Life Technologies, Carlsbad, CA) in a humidified incubator (37 &#x00b0;C/5% CO
                    <sub>2</sub>). For cell treatments, PM
                    <sub>2.5</sub> slurries were diluted in the same isotonic and pH-balanced culture media and applied to cells for up to 24 hours. Cell culture experiments were done in triplicate per endpoint.</p>
                <p>
                    <bold>
                        <italic toggle="yes">Nitrite Assay.</italic>
                    </bold> Nitric oxide (NO) was assayed in BV-2 cell media by the Griess reagent (
                    <xref ref-type="bibr" rid="ref-7">Cheng 
                        <italic toggle="yes">et al.</italic>, 2016b</xref>; 
                    <xref ref-type="bibr" rid="ref-26">Ignarro 
                        <italic toggle="yes">et al.</italic>, 1993</xref>). BV-2 cells at 60&#x2013;70% confluence in 96-well plates (2 &#x00d7; 10
                    <sup>6</sup> cells/plate) were treated with both am-PM
                    <sub>2.5</sub> and pm-PM
                    <sub>2.5</sub> at doses of 1, 5 and 20 &#x00b5;g/mL, 200 &#x00b5;L/well. At 30-minute, 60-minute and 24-hour timepoints, duplicate 50 &#x00b5;L aliquots of cell media were removed from each treatment well and transferred to a new 96-well plate. Within this same 96-well plate, a series of nitrite standards (50 &#x00b5;L/well) ranging from 0.10 to 10 &#x00b5;M prepared from a NaNO
                    <sub>2</sub> stock solution were added, thus allowing a standardization curve to be generated for use in determining the NO concentration in each treatment well from measured absorbance data. After transferring all aliquots, 50 &#x00b5;L of Griess reagent was added to each well and the plate was allowed to incubate at room temperature (21&#x2013;23 &#x00b0;C) for 10 minutes, followed by spectrophotometric analysis at 548 nm absorbance using a SpectraMax M2 microplate reader (Molecular Devices, San Jose, CA, USA). The nitrite assay was performed in triplicate, with six data points collected at each PM
                    <sub>2.5</sub> concentration per condition.</p>
                <p>
                    <bold>
                        <italic toggle="yes">Quantitative Polymerase Chain Reaction (qPCR).</italic>
                    </bold> The quantitative polymerase chain reaction (qPCR) assay was used to quantify upregulation of cytokines and chemokines associated with the microglial neuroinflammatory response, including IL-6, CCL2 (MCP-1), and IL-1&#x03b2;. BV-2 microglia were seeded in 6-well plates at 10
                    <sup>6</sup> cells/well and grown overnight at 37 &#x00b0;C/5% CO
                    <sub>2</sub>, followed by treatment with aqueous am-PM
                    <sub>2.5</sub> and pm-PM
                    <sub>2.5</sub> slurries diluted to 10 &#x03bc;g/ml in isotonic and pH-balanced cell culture media. A control condition, consisting of pure media diluted with ultrapure water, was also prepared. After 24 hours of incubation, treated cells were trypsinized and harvested for RNA extraction. Total cell RNA was extracted using the TRIzol reagent (Invitrogen, Carlsbad, CA), and cDNA was prepared from 1 &#x03bc;g of RNA (RT Master Mix, BioPioneer, San Diego, CA). Specific primers for each gene were used in conjunction with the qPCR Master Mix (BioPioneer) to run real time qPCR reactions.</p>
                <p>Genes examined by qPCR included 
                    <underline>IL-1&#x03b2;</underline> (forward: 5&#x2019; CTAAAGTATGGGCTGGACTG 3&#x2019;; reverse: 5&#x2019; GGCTCTCTTTGAACAGAATG 3&#x2019;), 
                    <underline>IL-6</underline> (forward: 5&#x2019; TGCCTTCTTGGGACTGATGCT 3&#x2019;; reverse: 5&#x2019; GCATCCATCATTTCTTTGTAT 3&#x2019;), 
                    <underline>MCP-1</underline> (forward: 5&#x2019; CCCAATGAGTAGGCTGGAGA 3&#x2019;; reverse: 5&#x2019; TCTGGACCCATTCCTTCTTG 3&#x2019;), and 
                    <underline>GAPDH</underline> (forward: 5&#x2019; AGACAGCCGCATCTTCTTGT 3&#x2019;; reverse: 5&#x2019; CTTGCCGTGGGTAGAGTCAT 3&#x2019;) (Integrated DNA Technologies, Skokie, IL). Data were normalized to GAPDH and quantified as &#x0394;&#x0394;Ct. qPCR was repeated, with 12 data points collected per treatment (am-PM
                    <sub>2.5</sub> and pm-PM
                    <sub>2.5</sub>; 10 &#x00b5;g/mL).</p>
                <p>
                    <bold>
                        <italic toggle="yes">Statistical analysis.</italic>
                    </bold> Results were evaluated by 2-way repeated measures ANOVA statistical analysis and Bonferroni post hoc tests using GraphPad Prism (v. 6.04) statistical software.</p>
            </sec>
        </sec>
        <sec sec-type="results">
            <title>Results</title>
            <sec>
                <title>Nitric Oxide (NO)</title>
                <p>A dose-dependent NO response to PM
                    <sub>2.5</sub> treatments relative to control was observed at all timepoints (30 min., 60 min., 24 hr.), which was greater for am-PM
                    <sub>2.5</sub> than pm-PM
                    <sub>2.5</sub> exposures (
                    <xref ref-type="fig" rid="f1">Figure 1</xref>). am-PM
                    <sub>2.5</sub> samples induced consistently higher levels of NO for all concentrations and post-exposure timepoints, with a peak effect, 7-fold greater than control (p = 0.0077), observed at 60 minutes in response to the highest am-PM
                    <sub>2.5</sub> dose of 20 &#x00b5;g/mL (
                    <xref ref-type="fig" rid="f1">Figure 1A</xref>). At 30 minutes post-treatment, there was also a significant 5.3-fold increase of am-PM
                    <sub>2.5</sub> relative to control (p = 0.0020), and a significant difference between the responses to am-PM
                    <sub>2.5</sub> and pm-PM
                    <sub>2.5</sub>, with am-PM
                    <sub>2.5</sub> eliciting a 3.1-fold greater NO response than pm-PM
                    <sub>2.5</sub> (p = 0.0094). There was also a significant a significant 2.9-fold increase of am-PM
                    <sub>2.5</sub> relative to control (p = 0.0007) at 24 hours post-treatment. The NO responses to pm-PM
                    <sub>2.5</sub> paralleled the effects of am-PM
                    <sub>2.5</sub> exposures, but were at least 50% smaller (
                    <xref ref-type="fig" rid="f1">Figure 1B</xref>): the 20 &#x00b5;g/mL pm-PM
                    <sub>2.5</sub> treatment induced 1.7-, 3.5-, and 2.0-fold increases in NO concentration relative to control at 30 min., 60 min. and 24 hrs., respectively, but these effects were not significant.</p>
                <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                    <label>Figure 1. </label>
                    <caption>
                        <title>Nitric oxide (NO) induction by microglia.</title>
                        <p>BV-2 microglial responses to PM
                            <sub>2.5</sub> slurries 
                            <italic toggle="yes">in vitro</italic>, assayed in culture media by the Griess reaction (control = 1.0 &#x00b5;M nitrite, dashed line). 
                            <bold>A.</bold> Morning samples (am-PM
                            <sub>2.5</sub>); 
                            <bold>B.</bold> Afternoon samples (pm-PM
                            <sub>2.5</sub>). am-PM
                            <sub>2.5</sub> samples induced consistently higher NO responses for all concentrations and post-exposure timepoints. At 30 minutes post-treatment, there was a significant effect of am-PM
                            <sub>2.5</sub>, as well as a significant difference between the responses to am-PM
                            <sub>2.5</sub> and pm-PM
                            <sub>2.5</sub> (overall ANOVA: p = 0.0017; am-PM
                            <sub>2.5</sub> 20 &#x00b5;g/mL vs. control: 5.3-fold increase, p = 0.0020; am-PM
                            <sub>2.5</sub> 20 &#x00b5;g/mL vs. pm-PM
                            <sub>2.5</sub> 20 &#x00b5;g/mL: 3.1-fold increase, p = 0.0094). There was also a significant effect of am-PM
                            <sub>2.5</sub> at 60 minutes post-treatment (overall ANOVA: p = 0.010; am-PM
                            <sub>2.5</sub> 20 &#x00b5;g/mL vs. control: 7.0-fold increase, p = 0.0077). At 24 hours a significant effect of am-PM
                            <sub>2.5</sub> treatment was also observed (overall ANOVA: p = 0.0005; am-PM
                            <sub>2.5</sub> 20 &#x00b5;g/mL vs. control: 2.9-fold increase, p = 0.0007). Mean &#x00b1; SE (n = 3 experiments). 2-way repeated measures ANOVA statistical analysis with Bonferroni post hoc tests: *p&lt;0.05, **p&lt;0.01, ***p&lt;0.005, ****p&lt;0.0001.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/16149/6d6b5192-e580-4e16-9920-927e5f8152c3_figure1.gif"/>
                </fig>
            </sec>
            <sec>
                <title>Inflammatory gene responses</title>
                <p>BV-2 cells were treated with 10 &#x03bc;g/ml of am-PM
                    <sub>2.5</sub> and pm-PM
                    <sub>2.5</sub> and analyzed for mRNA responses by qPCR after 24 hours incubation. The 10 &#x03bc;g/ml dose was chosen as below threshold for metabolic impairment based on prior studies from our group (e.g. 
                    <xref ref-type="bibr" rid="ref-7">Cheng 
                        <italic toggle="yes">et al.</italic>, 2016b</xref>; 
                    <xref ref-type="bibr" rid="ref-38">Morgan 
                        <italic toggle="yes">et al.</italic>, 2011</xref>; 
                    <xref ref-type="bibr" rid="ref-58">Woodward 
                        <italic toggle="yes">et al.</italic>, 2017b</xref>). Induction of all three cytokines was increased by both morning and afternoon PM
                    <sub>2.5</sub> samples, with more modest responses to pm-PM
                    <sub>2.5</sub> (
                    <xref ref-type="fig" rid="f2">Figure 2</xref>). As shown in 
                    <xref ref-type="fig" rid="f2">Figure 2A</xref>, treatment with am-PM
                    <sub>2.5</sub> induced a significant 4.8-fold increase in IL-1&#x03b2; expression relative to control (p = 0.0070). Both am-PM
                    <sub>2.5</sub> and pm-PM
                    <sub>2.5</sub> induced significant increases in IL-6 mRNA production relative to control, with am-PM
                    <sub>2.5</sub> exposure resulting in a 5.1-fold increase (p &lt; 0.0001) and pm-PM
                    <sub>2.5</sub> resulting in a 3.5-fold increase (p = 0.0046) (
                    <xref ref-type="fig" rid="f2">Figure 2B</xref>). Treatment with am-PM
                    <sub>2.5</sub> also induced a significant 2.0-fold increase in MCP-1 mRNA production (p = 0.0022), while pm-PM
                    <sub>2.5</sub> had a 33% smaller effect (
                    <xref ref-type="fig" rid="f2">Figure 2C</xref>). This difference in MCP-1 mRNA production induced by am-PM
                    <sub>2.5</sub> as compared to pm-PM
                    <sub>2.5</sub> was marginally significant (p = 0.0527).</p>
                <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                    <label>Figure 2. </label>
                    <caption>
                        <title>Inflammatory gene mRNA induction in microglia.</title>
                        <p>After exposing BV-2 cells to 10&#x00b5;g/mL of morning (am-PM
                            <sub>2.5</sub>) and afternoon (pm-PM
                            <sub>2.5</sub>) slurries, cellular mRNA production was assessed by qPCR. Relative to control, both am-PM
                            <sub>2.5</sub> and pm-PM
                            <sub>2.5</sub> exposures increased mRNA levels of 
                            <bold>A.</bold> Interleukin 1&#x03b2; (IL-1&#x03b2;), 
                            <bold>B.</bold> Interleukin 6 (IL-6), and 
                            <bold>C.</bold> monocyte chemoattractant protein 1 (MCP-1). Treatment with am-PM
                            <sub>2.5</sub> induced a significant 4.8-fold increase in IL-1&#x03b2; expression relative to control (overall ANOVA: p = 0.0090; am-PM
                            <sub>2.5</sub>: 4.8-fold increase, p = 0.0070). Both am-PM
                            <sub>2.5</sub> and pm-PM
                            <sub>2.5</sub> induced significant increases in IL-6 mRNA production (overall ANOVA: p &lt; 0.0001; am-PM
                            <sub>2.5</sub>: 5.1-fold increase, p &lt; 0.0001; pm-PM
                            <sub>2.5</sub>: 3.5-fold increase, p = 0.0046). Treatment with am-PM
                            <sub>2.5</sub> also induced a significant increase in MCP-1 mRNA production, while pm-PM
                            <sub>2.5</sub> had an effect 33% smaller than am-PM
                            <sub>2.5</sub> (overall ANOVA: p = 0.0028; am-PM
                            <sub>2.5</sub>: 2.0-fold increase, p = 0.0022; am-PM
                            <sub>2.5</sub> vs. pm-PM
                            <sub>2.5</sub>: p = 0.0527). Mean &#x00b1; SE (n = 12). 2-way repeated measures ANOVA statistical analysis with Bonferroni post hoc tests: *p&lt;0.05, **p&lt;0.01, ***p&lt;0.005, ****p&lt;0.0001.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/16149/6d6b5192-e580-4e16-9920-927e5f8152c3_figure2.gif"/>
                </fig>
            </sec>
            <sec>
                <title>Chemical composition of PM
                    <sub>2.5</sub> slurry samples</title>
                <p>The am-PM
                    <sub>2.5</sub> and pm-PM
                    <sub>2.5</sub> time-integrated aqueous slurry samples were analyzed for chemical composition, including total carbon (TC), inorganic ions, and total metals and trace elements, and are presented as PM
                    <sub>2.5</sub> mass fractions in 
                    <xref ref-type="fig" rid="f3">Figures 3A, 3B, and 3C</xref>, respectively. PM
                    <sub>2.5</sub> TC content decreased by 40% from morning (0.50 &#x03bc;g/&#x03bc;g-PM) to afternoon (0.31 &#x03bc;g/&#x03bc;g-PM) (
                    <xref ref-type="fig" rid="f3">Figure 3A</xref>). Mass concentrations of inorganic secondary ions (NO
                    <sub>3</sub>
                    <sup>-</sup>, SO
                    <sub>4</sub>
                    <sup>2-</sup>, NH
                    <sub>4</sub>
                    <sup>+</sup>, Na
                    <sup>+</sup>) were approximately 5-fold higher in the afternoon as compared to morning slurries (
                    <xref ref-type="fig" rid="f3">Figure 3B</xref>). For the sixteen metals and trace elements analyzed, the am-PM
                    <sub>2.5</sub> slurry contained higher mass concentrations of several measured elements as compared to the pm-PM
                    <sub>2.5</sub> slurry (
                    <xref ref-type="fig" rid="f3">Figure 3C</xref>, note log scale; 
                    <xref ref-type="other" rid="ST1">Table S1, Supplementary File 1</xref>). Arsenic, chromium, and manganese showed the largest diurnal decline, represented as am-PM
                    <sub>2.5</sub>:pm-PM
                    <sub>2.5</sub> ratios: arsenic (11.6), chromium (7.9), and manganese (6.0).</p>
                <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                    <label>Figure 3. </label>
                    <caption>
                        <title>Chemical analyses.</title>
                        <p>Time-integrated PM
                            <sub>2.5</sub> slurries collected during morning (6&#x2013;9am) and afternoon (12&#x2013;4pm) periods analyzed for 
                            <bold>A.</bold> Total Carbon (TC), 
                            <bold>B.</bold> Inorganic ions (ion chromatography), 
                            <bold>C.</bold> Total metals and trace elements (ICP-MS). Mean values presented are based on triplicate analysis of one sample aliquot. Error bars represent laboratory uncertainty values based on contributions of analytical error (standard deviation) and blank subtraction (standard deviation of at least three method blanks).</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/16149/6d6b5192-e580-4e16-9920-927e5f8152c3_figure3.gif"/>
                </fig>
                <supplementary-material id="DS0" orientation="portrait" position="float" xlink:href="https://f1000researchdata.s3.amazonaws.com/datasets/14836/d106027f-31ff-48b0-b663-d1eb5c23162d_Data.7z">
                    <label>The following raw data sets are provided as comma separated values (.csv) files</label>
                    <caption>
                        <p>PM_Diurnal_Variation_NO_Fig1_DATA</p>
                        <p>PM_Diurnal_Variation_qPCR_Fig2_DATA</p>
                        <p>PM_Diurnal_Variation_TC_Fig3A_DATA</p>
                        <p>PM_Diurnal_Variation_Ions_Fig3B_DATA</p>
                        <p>PM_Diurnal_Variation_Metals_Fig3C_DATA</p>
                    </caption>
                </supplementary-material>
            </sec>
        </sec>
        <sec sec-type="discussion">
            <title>Discussion</title>
            <p>Diurnal variations in urban PM
                <sub>2.5</sub> oxidative and proinflammatory activity showed consistent decreases from morning to afternoon sampling periods in two independent 
                <italic toggle="yes">in vitro</italic> assays using the BV-2 microglia cell line. The collection of total PM
                <sub>2.5</sub> as an aqueous slurry was enabled by direct aerosol-into-liquid sampling that more efficiently captures water-insoluble components of ambient PM
                <sub>2.5</sub> than traditional filter-based sampling methods used in several prior studies (e.g. 
                <xref ref-type="bibr" rid="ref-42">Saffari 
                    <italic toggle="yes">et al.</italic>, 2015</xref>; 
                <xref ref-type="bibr" rid="ref-54">Verma 
                    <italic toggle="yes">et al.</italic>, 2009</xref>). These slurry samples are more representative of the full range of ambient PM components and their toxicities than filter-trapped and water eluted PM. Additionally, the results of the NO assay and the qPCR assay for inflammatory gene responses extend findings from the widely used dithiothreitol (DTT) and alveolar macrophage (dichlorodihydrofluorescein, DCFH) assays for oxidative potential, which can be confounded by oxidative recycling from transition metals (
                <xref ref-type="bibr" rid="ref-17">Forman &amp; Finch, 2018</xref>). Our findings, that primary PM
                <sub>2.5</sub> results in a greater oxidative and proinflammatory response than secondary PM
                <sub>2.5</sub>, are contrary to expectations based on prior reports that secondary, photo-oxidized PM exhibits greater oxidative activity than primary PM.</p>
            <p>Previous studies of diurnal variations in PM composition and oxidative activity have not been consistent and were limited in using only simple assays of oxidative potential (i.e. DTT and DCFH) on filter-captured PM. Relying solely on oxidative potential measures such as the DTT and DCFH assays provides us with only an imprecise measure of cellular oxidative and proinflammatory activity that lacks specificity. The current study improves on the experimental design of past studies by utilizing direct measures of acute oxidative stress and inflammation, including free radical production induced by PM as nitric oxide (NO) and cellular proinflammatory mRNA responses. Additionally, by using the direct aerosol-into-liquid method to collect aqueous slurries in our study, water-insoluble PM species were more efficiently captured, providing samples more representative of the full range of ambient PM components and their toxicities.</p>
            <p>Further insight into the sources of particulate toxicity may be gleaned by the apportionment of redox properties to its water soluble and insoluble chemical components, including water-soluble and water-insoluble organic carbon (WSOC and WIOC, respectively). WSOC species are generally defined as hydrophilic, while WIOC are hydrophobic (
                <xref ref-type="bibr" rid="ref-53">Turpin &amp; Lim, 2001</xref>). 
                <xref ref-type="bibr" rid="ref-56">Wang 
                    <italic toggle="yes">et al.</italic> (2013b)</xref> collected aqueous PM
                <sub>2.5</sub> slurries by a similar aerosol-into-liquid sampling method, and found that increased WIOC content in PM
                <sub>2.5</sub>, relative to WSOC content, was highly correlated with redox activity on a per mass basis, indicating a greater intrinsic toxicity of WIOC as compared to WSOC. While this study was limited by its use of the DCFH assay, the greater oxidative potential associated with increased WIOC mass concentrations was attributed to organic compounds such as PAHs, as well as iron and other transition metals.</p>
            <p>Our results indicate that morning PM
                <sub>2.5</sub>, which contains a greater proportion of water-insoluble species, may be intrinsically more toxic and induce greater cellular oxidative stress, than afternoon PM
                <sub>2.5</sub> samples that contain a larger mass fraction of oxidized, water-soluble species that are products of photochemical reactions in the atmosphere (
                <xref ref-type="bibr" rid="ref-46">Seinfeld &amp; Pandis, 2016</xref>), including the inorganic secondary ions NO
                <sub>3</sub>
                <sup>-</sup>, SO
                <sub>4</sub>
                <sup>2-</sup>, NH
                <sub>4</sub>
                <sup>+</sup>, and Na
                <sup>+</sup>. The mechanisms underlying the greater toxicity of primary, morning PM
                <sub>2.5</sub> may involve non-polar WIOC components, such as PAHs, being able to more easily permeate the hydrophobic lipid-bilayer of cell membranes to trigger the formation of intracellular oxidative species and induce proinflammatory cytokine formation via an acute oxidative stress response.</p>
            <p>Primary, traffic-derived PM
                <sub>2.5</sub> also consists of greater concentrations of redox active and other toxic metals, as compared to the bulk of secondary PM
                <sub>2.5</sub>, which consists largely of hydrophilic products of photochemical oxidation. The metals and trace elements we found to be more prevalent in the morning slurry sample included the heavy metals vanadium, chromium, nickel, and arsenic, which are emitted by vehicles both as fuel combustion products as well as remnants of motor oil degradation (
                <xref ref-type="bibr" rid="ref-20">Geller 
                    <italic toggle="yes">et al.</italic>, 2006</xref>), copper, which is associated with vehicular brake wear (
                <xref ref-type="bibr" rid="ref-19">Garg 
                    <italic toggle="yes">et al.</italic>, 2000</xref>; 
                <xref ref-type="bibr" rid="ref-44">Sanders 
                    <italic toggle="yes">et al.</italic>, 2003</xref>; 
                <xref ref-type="bibr" rid="ref-51">Sternbeck 
                    <italic toggle="yes">et al.</italic>, 2002</xref>), and zinc, which is primarily a product of tire deterioration (
                <xref ref-type="bibr" rid="ref-49">Singh 
                    <italic toggle="yes">et al.</italic>, 2002</xref>). Elevated levels of these metals in both collection periods correspond to vehicular emissions as the major source of primary particles in close proximity to the I-110 freeway. We believe the higher proportions of these metals and WIOC components in primary PM
                <sub>2.5</sub> dominant in the morning hours, as compared to photo-oxidized secondary PM
                <sub>2.5</sub> prevalent in the afternoon, are responsible for the diurnal variation in acute oxidative stress observed in the current study.</p>
        </sec>
        <sec>
            <title>Summary and conclusions</title>
            <p>The data presented in this study demonstrate that urban PM
                <sub>2.5</sub> collected during the morning rush hour (6&#x2013;9am), when primary, traffic-derived PM emissions are dominant, induces greater oxidative and proinflammatory responses in cells as compared to PM
                <sub>2.5</sub> collected in the afternoon (12&#x2013;4pm), which contains a higher proportion of photo-oxidized, secondary PM products. Two 
                <italic toggle="yes">in vitro</italic> assays of the cellular inflammatory response consistently demonstrated greater oxidative and proinflammatory activity due to primary (morning) PM
                <sub>2.5</sub> exposure. We attribute this effect to the greater transition metal and water-insoluble organic carbon (WIOC) content of primary PM
                <sub>2.5</sub>, two classes of PM components that increase toxicity (
                <xref ref-type="bibr" rid="ref-8">Cho 
                    <italic toggle="yes">et al.</italic>, 2005</xref>; 
                <xref ref-type="bibr" rid="ref-25">Hu 
                    <italic toggle="yes">et al.</italic>, 2008</xref>; 
                <xref ref-type="bibr" rid="ref-33">Li 
                    <italic toggle="yes">et al.</italic>, 2009</xref>; 
                <xref ref-type="bibr" rid="ref-48">Shirmohammadi 
                    <italic toggle="yes">et al.</italic>, 2015</xref>; 
                <xref ref-type="bibr" rid="ref-52">Tao 
                    <italic toggle="yes">et al.</italic>, 2003</xref>; 
                <xref ref-type="bibr" rid="ref-60">Zhang 
                    <italic toggle="yes">et al.</italic>, 2008</xref>). Our study also improves upon previous research of diurnal variations in PM-induced oxidative stress by utilizing a unique aerosol-into-liquid PM collection system that more efficiently captures water insoluble components, thus providing complete aqueous PM samples more representative of ambient PM.</p>
            <p>This research will ultimately help us gain a more complete understanding of the complex nature of particulate matter and how its composition and proinflammatory effects change over time due to photochemical aging in the atmosphere. The Southern California climate of Los Angeles with abundant sunshine, compounded with dense vehicular traffic, generates ubiquitous primary and secondary PM throughout the year. Identifying the health effects of these pollutants is critical as we strive to understand the underlying mechanisms of PM-induced oxidative stress, neuroinflammation and associated morbidity. Our findings may help in further elucidating the role of PM in the etiology, onset and development of widespread, chronic diseases that plague urban populations, including cancer, cardiac and respiratory distress, and neurodegenerative disorders such as Alzheimer&#x2019;s disease.</p>
        </sec>
        <sec>
            <title>Data availability</title>
            <p>The data referenced by this article are under copyright with the following copyright statement: Copyright: &#x00ef;&#x00bf;&#x00bd; 2018 Lovett C et al.</p>
            <p>Data associated with the article are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication).
                <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/publicdomain/zero/1.0/"/>
            </p>
            <p>Dataset 1: The following raw data sets are provided as comma separated values (.csv) files: 
                <ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.5256/f1000research.14836.d203329">10.5256/f1000research.14836.d203329</ext-link> (
                <xref ref-type="bibr" rid="ref-35">Lovett 
                    <italic toggle="yes">et al.</italic>, 2018</xref>)</p>
            <p>PM_Diurnal_Variation_NO_Fig1_DATA</p>
            <p>PM_Diurnal_Variation_qPCR_Fig2_DATA</p>
            <p>PM_Diurnal_Variation_TC_Fig3A_DATA</p>
            <p>PM_Diurnal_Variation_Ions_Fig3B_DATA</p>
            <p>PM_Diurnal_Variation_Metals_Fig3C_DATA</p>
        </sec>
    </body>
    <back>
        <sec id="SM1" sec-type="supplementary-material">
            <title>Supplementary material</title>
            <p id="ST1">
                <bold>Table S1.</bold> Average concentrations and uncertainty values of total carbon, inorganic ions, metals and trace elements in ambient PM
                <sub>2.5</sub> slurry samples collected during morning and afternoon periods.</p>
            <p>
                <ext-link ext-link-type="uri" xlink:href="https://f1000researchdata.s3.amazonaws.com/supplementary/14836/02bf92df-ec5c-4f4c-87fc-0b62e13d6955.docx">Click here to access the data</ext-link>.</p>
        </sec>
        <ref-list>
            <ref id="ref-1">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Cacciottolo</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Driscoll</surname>
                            <given-names>I</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Particulate air pollutants, APOE alleles and their contributions to cognitive impairment in older women and to amyloidogenesis in experimental models.</article-title>
                    <source>

                        <italic toggle="yes">Transl Psychiatry.</italic>
</source>
                    <year>2017</year>;<volume>7</volume>(<issue>1</issue>):<fpage>e1022</fpage>.
                    <pub-id pub-id-type="pmid">28140404</pub-id>
                    <pub-id pub-id-type="doi">10.1038/tp.2016.280</pub-id>
                    <pub-id pub-id-type="pmcid">5299391</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-3">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Calder&#x00f3;n-Garcidue&#x00f1;as</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>G&#x00f3;nzalez-Maciel</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Reynoso-Robles</surname>
                            <given-names>R</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Hallmarks of Alzheimer disease are evolving relentlessly in Metropolitan Mexico City infants, children and young adults. APOE4 carriers have higher suicide risk and higher odds of reaching NFT stage V at &#x2264; 40 years of age.</article-title>
                    <source>

                        <italic toggle="yes">Environ Res.</italic>
</source>
                    <year>2018</year>;<volume>164</volume>:<fpage>475</fpage>&#x2013;<lpage>487</lpage>.
                    <pub-id pub-id-type="pmid">29587223</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.envres.2018.03.023</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-2">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Calder&#x00f3;n-Garcidue&#x00f1;as</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Solt</surname>
                            <given-names>AC</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Henr&#x00ed;quez-Rold&#x00e1;n</surname>
                            <given-names>C</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Long-term air pollution exposure is associated with neuroinflammation, an altered innate immune response, disruption of the blood-brain barrier, ultrafine particulate deposition, and accumulation of amyloid beta-42 and alpha-synuclein in children and young adults.</article-title>
                    <source>

                        <italic toggle="yes">Toxicol Pathol.</italic>
</source>
                    <year>2008</year>;<volume>36</volume>(<issue>2</issue>):<fpage>289</fpage>&#x2013;<lpage>310</lpage>.
                    <pub-id pub-id-type="pmid">18349428</pub-id>
                    <pub-id pub-id-type="doi">10.1177/0192623307313011</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-4">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Chen</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kwong</surname>
                            <given-names>JC</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Copes</surname>
                            <given-names>R</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Living near major roads and the incidence of dementia, Parkinson&#x2019;s disease, and multiple sclerosis: a population-based cohort study.</article-title>
                    <source>

                        <italic toggle="yes">Lancet.</italic>
</source>
                    <year>2017</year>;<volume>389</volume>(<issue>10070</issue>):<fpage>718</fpage>&#x2013;<lpage>726</lpage>.
                    <pub-id pub-id-type="pmid">28063597</pub-id>
                    <pub-id pub-id-type="doi">10.1016/S0140-6736(16)32399-6</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-5">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Chen</surname>
                            <given-names>JC</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wellenius</surname>
                            <given-names>GA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Ambient air pollution and neurotoxicity on brain structure: Evidence from women&#x2019;s health initiative memory study.</article-title>
                    <source>

                        <italic toggle="yes">Ann Neurol.</italic>
</source>
                    <year>2015</year>;<volume>78</volume>(<issue>3</issue>):<fpage>466</fpage>&#x2013;<lpage>476</lpage>.
                    <pub-id pub-id-type="pmid">26075655</pub-id>
                    <pub-id pub-id-type="doi">10.1002/ana.24460</pub-id>
                    <pub-id pub-id-type="pmcid">4546504</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-6">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Cheng</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Davis</surname>
                            <given-names>DA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hasheminassab</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Urban traffic-derived nanoparticulate matter reduces neurite outgrowth via TNF&#x03b1; 
                        <italic toggle="yes">in vitro</italic>.</article-title>
                    <source>

                        <italic toggle="yes">J Neuroinflammation.</italic>
</source>
                    <year>2016a</year>;<volume>13</volume>(<issue>1</issue>):<fpage>19</fpage>.
                    <pub-id pub-id-type="pmid">26810976</pub-id>
                    <pub-id pub-id-type="doi">10.1186/s12974-016-0480-3</pub-id>
                    <pub-id pub-id-type="pmcid">4727336</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-7">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Cheng</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Saffari</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sioutas</surname>
                            <given-names>C</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Nanoscale Particulate Matter from Urban Traffic Rapidly Induces Oxidative Stress and Inflammation in Olfactory Epithelium with Concomitant Effects on Brain.</article-title>
                    <source>

                        <italic toggle="yes">Environ Health Perspect.</italic>
</source>
                    <year>2016b</year>;<volume>124</volume>(<issue>10</issue>):<fpage>1537</fpage>&#x2013;<lpage>1546</lpage>.
                    <pub-id pub-id-type="pmid">27187980</pub-id>
                    <pub-id pub-id-type="doi">10.1289/EHP134</pub-id>
                    <pub-id pub-id-type="pmcid">5047762</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-8">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Cho</surname>
                            <given-names>AK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sioutas</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Miguel</surname>
                            <given-names>AH</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Redox activity of airborne particulate matter at different sites in the Los Angeles Basin.</article-title>
                    <source>

                        <italic toggle="yes">Environ Res.</italic>
</source>
                    <year>2005</year>;<volume>99</volume>(<issue>1</issue>):<fpage>40</fpage>&#x2013;<lpage>47</lpage>.
                    <pub-id pub-id-type="pmid">16053926</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.envres.2005.01.003</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-10">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Darrow</surname>
                            <given-names>LA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Klein</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sarnat</surname>
                            <given-names>JA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The use of alternative pollutant metrics in time-series studies of ambient air pollution and respiratory emergency department visits.</article-title>
                    <source>

                        <italic toggle="yes">J Expo Sci Environ Epidemiol.</italic>
</source>
                    <year>2011</year>;<volume>21</volume>(<issue>1</issue>):<fpage>10</fpage>&#x2013;<lpage>9</lpage>.
                    <pub-id pub-id-type="pmid">19756042</pub-id>
                    <pub-id pub-id-type="doi">10.1038/jes.2009.49</pub-id>
                    <pub-id pub-id-type="pmcid">3743225</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-12">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Delfino</surname>
                            <given-names>RJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sioutas</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Malik</surname>
                            <given-names>S</given-names>
                        </name>
</person-group>:
                    <article-title>Potential role of ultrafine particles in associations between airborne particle mass and cardiovascular health.</article-title>
                    <source>

                        <italic toggle="yes">Environ Health Persp.</italic>
</source>
                    <year>2005</year>;<volume>113</volume>(<issue>8</issue>):<fpage>934</fpage>&#x2013;<lpage>46</lpage>.
                    <pub-id pub-id-type="pmid">16079061</pub-id>
                    <pub-id pub-id-type="pmcid">1280331</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-13">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Delfino</surname>
                            <given-names>RJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Staimer</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Vaziri</surname>
                            <given-names>ND</given-names>
                        </name>
</person-group>:
                    <article-title>Air pollution and circulating biomarkers of oxidative stress.</article-title>
                    <source>

                        <italic toggle="yes">Air Qual Atmos Hlth.</italic>
</source>
                    <year>2011</year>;<volume>4</volume>(<issue>1</issue>):<fpage>37</fpage>&#x2013;<lpage>52</lpage>.
                    <pub-id pub-id-type="pmid">23626660</pub-id>
                    <pub-id pub-id-type="doi">10.1007/s11869-010-0095-2</pub-id>
                    <pub-id pub-id-type="pmcid">3634798</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-14">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Dockery</surname>
                            <given-names>DW</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Pope</surname>
                            <given-names>CA</given-names>
                            <suffix>3rd</suffix>
                        </name>

                        <name name-style="western">
                            <surname>Xu</surname>
                            <given-names>X</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>An association between air pollution and mortality in six U.S. cities.</article-title>
                    <source>

                        <italic toggle="yes">N Engl J Med.</italic>
</source>
                    <year>1993</year>;<volume>329</volume>(<issue>24</issue>):<fpage>1753</fpage>&#x2013;<lpage>1759</lpage>.
                    <pub-id pub-id-type="pmid">8179653</pub-id>
                    <pub-id pub-id-type="doi">10.1056/NEJM199312093292401</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-15">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Dominici</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Peng</surname>
                            <given-names>RD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bell</surname>
                            <given-names>ML</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Fine particulate air pollution and hospital admission for cardiovascular and respiratory diseases.</article-title>
                    <source>

                        <italic toggle="yes">JAMA.</italic>
</source>
                    <year>2006</year>;<volume>295</volume>(<issue>10</issue>):<fpage>1127</fpage>&#x2013;<lpage>1134</lpage>.
                    <pub-id pub-id-type="pmid">16522832</pub-id>
                    <pub-id pub-id-type="doi">10.1001/jama.295.10.1127</pub-id>
                    <pub-id pub-id-type="pmcid">3543154</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-16">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Eun</surname>
                            <given-names>CS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lim</surname>
                            <given-names>JS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lee</surname>
                            <given-names>J</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The protective effect of fermented 
                        <italic toggle="yes">Curcuma longa</italic> L. on memory dysfunction in oxidative stress-induced C6 gliomal cells, proinflammatory-activated BV2 microglial cells, and scopolamine-induced amnesia model in mice.</article-title>
                    <source>

                        <italic toggle="yes">BMC Complement Altern Med.</italic>
</source>
                    <year>2017</year>;<volume>17</volume>(<issue>1</issue>):<fpage>367</fpage>.
                    <pub-id pub-id-type="pmid">28716085</pub-id>
                    <pub-id pub-id-type="doi">10.1186/s12906-017-1880-3</pub-id>
                    <pub-id pub-id-type="pmcid">5514491</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-17">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Forman</surname>
                            <given-names>HJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Finch</surname>
                            <given-names>CE</given-names>
                        </name>
</person-group>:
                    <article-title>A critical review of assays for hazardous components of air pollution.</article-title>
                    <source>

                        <italic toggle="yes">Free Radical Biol Med.</italic>
</source>
                    <year>2018</year>;<volume>117</volume>:<fpage>202</fpage>&#x2013;<lpage>217</lpage>.
                    <pub-id pub-id-type="pmid">29407794</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.freeradbiomed.2018.01.030</pub-id>
                    <pub-id pub-id-type="pmcid">5845809</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-18">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Forstner</surname>
                            <given-names>HJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Flagan</surname>
                            <given-names>RC</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Seinfeld</surname>
                            <given-names>JH</given-names>
                        </name>
</person-group>:
                    <article-title>Secondary organic aerosol from the photooxidation of aromatic hydrocarbons: Molecular composition.</article-title>
                    <source>

                        <italic toggle="yes">Environ Sci Technol.</italic>
</source>
                    <year>1997</year>;<volume>31</volume>(<issue>5</issue>):<fpage>1345</fpage>&#x2013;<lpage>1358</lpage>.
                    <pub-id pub-id-type="doi">10.1021/es9605376</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-19">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Garg</surname>
                            <given-names>BD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Cadle</surname>
                            <given-names>SH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mulawa</surname>
                            <given-names>PA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Brake wear particulate matter emissions.</article-title>
                    <source>

                        <italic toggle="yes">Environ Sci Technol.</italic>
</source>
                    <year>2000</year>;<volume>34</volume>(<issue>21</issue>):<fpage>4463</fpage>&#x2013;<lpage>4469</lpage>.
                    <pub-id pub-id-type="doi">10.1021/es001108h</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-20">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Geller</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Biswas</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sioutas</surname>
                            <given-names>C</given-names>
                        </name>
</person-group>:
                    <article-title>Determination of particle effective density in urban environments with a differential mobility analyzer and aerosol particle mass analyzer.</article-title>
                    <source>

                        <italic toggle="yes">Aerosol Sci Tech.</italic>
</source>
                    <year>2006</year>;<volume>40</volume>(<issue>9</issue>):<fpage>709</fpage>&#x2013;<lpage>723</lpage>.
                    <pub-id pub-id-type="doi">10.1080/02786820600803925</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-21">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Gresa-Arribas</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Vi&#x00e9;itez</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Dentesano</surname>
                            <given-names>G</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Modelling neuroinflammation 
                        <italic toggle="yes">in vitro</italic>: a tool to test the potential neuroprotective effect of anti-inflammatory agents.</article-title>
                    <source>

                        <italic toggle="yes">PLoS One.</italic>
</source>
                    <year>2012</year>;<volume>7</volume>(<issue>9</issue>):<fpage>e45227</fpage>.
                    <pub-id pub-id-type="pmid">23028862</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0045227</pub-id>
                    <pub-id pub-id-type="pmcid">3447933</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-22">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Grosjean</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Seinfeld</surname>
                            <given-names>JH</given-names>
                        </name>
</person-group>:
                    <article-title>Parameterization of the formation potential of secondary organic aerosols.</article-title>
                    <source>

                        <italic toggle="yes">Atmos Environ (1967).</italic>
</source>
                    <year>1989</year>;<volume>23</volume>(<issue>8</issue>):<fpage>1733</fpage>&#x2013;<lpage>1747</lpage>.
                    <pub-id pub-id-type="doi">10.1016/0004-6981(89)90058-9</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-23">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Han</surname>
                            <given-names>MH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yi</surname>
                            <given-names>HJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kim</surname>
                            <given-names>YS</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Association between Diurnal Variation of Ozone Concentration and Stroke Occurrence: 24-Hour Time Series Study.</article-title>
                    <source>

                        <italic toggle="yes">PLoS One.</italic>
</source>
                    <year>2016</year>;<volume>11</volume>(<issue>3</issue>):<fpage>e0152433</fpage>.
                    <pub-id pub-id-type="pmid">27015421</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0152433</pub-id>
                    <pub-id pub-id-type="pmcid">4807846</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-24">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hanamsagar</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bilbo</surname>
                            <given-names>SD</given-names>
                        </name>
</person-group>:
                    <article-title>Environment matters: microglia function and dysfunction in a changing world.</article-title>
                    <source>

                        <italic toggle="yes">Curr Opin Neurobiol.</italic>
</source>
                    <year>2017</year>;<volume>47</volume>:<fpage>146</fpage>&#x2013;<lpage>155</lpage>.
                    <pub-id pub-id-type="pmid">29096243</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.conb.2017.10.007</pub-id>
                    <pub-id pub-id-type="pmcid">5732848</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-25">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hu</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Polidori</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Arhami</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Redox activity and chemical speciation of size fractioned PM in the communities of the Los Angeles-Long Beach harbor.</article-title>
                    <source>

                        <italic toggle="yes">Atmos Chem Phys.</italic>
</source>
                    <year>2008</year>;<volume>8</volume>(<issue>21</issue>):<fpage>6439</fpage>&#x2013;<lpage>6451</lpage>.
                    <pub-id pub-id-type="doi">10.5194/acp-8-6439-2008</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-26">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ignarro</surname>
                            <given-names>LJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Fukuto</surname>
                            <given-names>JM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Griscavage</surname>
                            <given-names>JM</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Oxidation of nitric oxide in aqueous solution to nitrite but not nitrate: comparison with enzymatically formed nitric oxide from L-arginine.</article-title>
                    <source>

                        <italic toggle="yes">Proc Natl Acad Sci USA.</italic>
</source>
                    <year>1993</year>;<volume>90</volume>(<issue>17</issue>):<fpage>8103</fpage>&#x2013;<lpage>8107</lpage>.
                    <pub-id pub-id-type="pmid">7690141</pub-id>
                    <pub-id pub-id-type="doi">10.1073/pnas.90.17.8103</pub-id>
                    <pub-id pub-id-type="pmcid">47296</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-75">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kaufman</surname>
                            <given-names>JD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Adar</surname>
                            <given-names>SD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Barr</surname>
                            <given-names>RG</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Association between air pollution and coronary artery calcification within six metropolitan areas in the USA (the Multi-Ethnic Study of Atherosclerosis and Air Pollution): a longitudinal cohort study.</article-title>
                    <source>

                        <italic toggle="yes">Lancet.</italic>
</source>
                    <year>2016</year>;<volume>388</volume>(<issue>10045</issue>):<fpage>696</fpage>&#x2013;<lpage>704</lpage>.
                    <pub-id pub-id-type="pmid">27233746</pub-id>
                    <pub-id pub-id-type="doi">10.1016/S0140-6736(16)00378-0</pub-id>
                    <pub-id pub-id-type="pmcid">5019949</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-27">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kim</surname>
                            <given-names>KH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jahan</surname>
                            <given-names>SA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kabir</surname>
                            <given-names>E</given-names>
                        </name>
</person-group>:
                    <article-title>A review on human health perspective of air pollution with respect to allergies and asthma.</article-title>
                    <source>

                        <italic toggle="yes">Environ Int.</italic>
</source>
                    <year>2013</year>;<volume>59</volume>:<fpage>41</fpage>&#x2013;<lpage>52</lpage>.
                    <pub-id pub-id-type="pmid">23770580</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.envint.2013.05.007</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-29">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Krafft</surname>
                            <given-names>AD</given-names>
                        </name>
</person-group>:
                    <article-title>The use of glial data in human health assessments of environmental contaminants.</article-title>
                    <source>

                        <italic toggle="yes">Toxicology.</italic>
</source>
                    <year>2015</year>;<volume>333</volume>:<fpage>127</fpage>&#x2013;<lpage>136</lpage>.
                    <pub-id pub-id-type="pmid">25912087</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.tox.2015.04.011</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-30">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Landrigan</surname>
                            <given-names>PJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Fuller</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Acosta</surname>
                            <given-names>NJR</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The 
                        <italic toggle="yes">Lancet</italic> Commission on pollution and health.</article-title>
                    <source>

                        <italic toggle="yes">Lancet.</italic>
</source>
                    <year>2018</year>;<volume>391</volume>(<issue>10119</issue>):<fpage>462</fpage>&#x2013;<lpage>512</lpage>.
                    <pub-id pub-id-type="pmid">29056410</pub-id>
                    <pub-id pub-id-type="doi">10.1016/S0140-6736(17)32345-0</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-31">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Levesque</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Taetzsch</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lull</surname>
                            <given-names>ME</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Diesel exhaust activates and primes microglia: Air pollution, neuroinflammation, and regulation of dopaminergic neurotoxicity.</article-title>
                    <source>

                        <italic toggle="yes">Environ Health Persp.</italic>
</source>
                    <year>2011</year>;<volume>119</volume>(<issue>8</issue>):<fpage>1149</fpage>&#x2013;<lpage>1155</lpage>.
                    <pub-id pub-id-type="pmid">21561831</pub-id>
                    <pub-id pub-id-type="doi">10.1289/ehp.1002986</pub-id>
                    <pub-id pub-id-type="pmcid">3237351</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-32">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hao</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Phalen</surname>
                            <given-names>RF</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Particulate air pollutants and asthma. a paradigm for the role of oxidative stress in PM-induced adverse health effects.</article-title>
                    <source>

                        <italic toggle="yes">Clin Immunol.</italic>
</source>
                    <year>2003</year>;<volume>109</volume>(<issue>3</issue>):<fpage>250</fpage>&#x2013;<lpage>265</lpage>.
                    <pub-id pub-id-type="pmid">14697739</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.clim.2003.08.006</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-33">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bramble</surname>
                            <given-names>LA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The adjuvant effect of ambient particulate matter is closely reflected by the particulate oxidant potential.</article-title>
                    <source>

                        <italic toggle="yes">Environ Health Perspect.</italic>
</source>
                    <year>2009</year>;<volume>117</volume>(<issue>7</issue>):<fpage>1116</fpage>&#x2013;<lpage>1123</lpage>.
                    <pub-id pub-id-type="pmid">19654922</pub-id>
                    <pub-id pub-id-type="doi">10.1289/ehp.0800319</pub-id>
                    <pub-id pub-id-type="pmcid">2717139</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-34">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Linares</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Culqui</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Carmona</surname>
                            <given-names>R</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Short-term association between environmental factors and hospital admissions due to dementia in Madrid.</article-title>
                    <source>

                        <italic toggle="yes">Environ Res.</italic>
</source>
                    <year>2017</year>;<volume>152</volume>:<fpage>214</fpage>&#x2013;<lpage>220</lpage>.
                    <pub-id pub-id-type="pmid">27810678</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.envres.2016.10.020</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-35">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Lovett</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Cacciottolo</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Shirmohammadi</surname>
                            <given-names>F</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Dataset 1 in: Diurnal variation in the proinflammatory activity of urban fine particulate matter (PM
                        <sub>2.5</sub>) by 
                        <italic toggle="yes">in vitro</italic> assays.</article-title>
                    <source>

                        <italic toggle="yes">F1000Research.</italic>
</source>
                    <year>2018</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://dx.doi.org/10.5256/f1000research.14836.d203329">Data Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-37">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>MohanKumar</surname>
                            <given-names>SM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Campbell</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Block</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Particulate matter, oxidative stress and neurotoxicity.</article-title>
                    <source>

                        <italic toggle="yes">Neurotoxicology.</italic>
</source>
                    <year>2008</year>;<volume>29</volume>(<issue>3</issue>):<fpage>479</fpage>&#x2013;<lpage>488</lpage>.
                    <pub-id pub-id-type="pmid">18289684</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.neuro.2007.12.004</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-38">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Morgan</surname>
                            <given-names>TE</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Davis</surname>
                            <given-names>DA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Iwata</surname>
                            <given-names>N</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Glutamatergic neurons in rodent models respond to nanoscale particulate urban air pollutants 
                        <italic toggle="yes">in vivo</italic> and 
                        <italic toggle="yes">in vitro</italic>.</article-title>
                    <source>

                        <italic toggle="yes">Environ Health Persp.</italic>
</source>
                    <year>2011</year>;<volume>119</volume>(<issue>7</issue>):<fpage>1003</fpage>&#x2013;<lpage>1009</lpage>.
                    <pub-id pub-id-type="pmid">21724521</pub-id>
                    <pub-id pub-id-type="doi">10.1289/ehp.1002973</pub-id>
                    <pub-id pub-id-type="pmcid">3222976</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-42">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Saffari</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hasheminassab</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>D</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Impact of primary and secondary organic sources on the oxidative potential of quasi-ultrafine particles (PM
                        <sub>0.25</sub>) at three contrasting locations in the Los Angeles Basin.</article-title>
                    <source>

                        <italic toggle="yes">Atmospheric Environment.</italic>
</source>
                    <year>2015</year>;<volume>120</volume>:<fpage>286</fpage>&#x2013;<lpage>296</lpage>.
                    <pub-id pub-id-type="doi">10.1016/j.atmosenv.2015.09.022</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-44">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sanders</surname>
                            <given-names>PG</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Xu</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Dalka</surname>
                            <given-names>TM</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Airborne brake wear debris: size distributions, composition, and a comparison of dynamometer and vehicle tests.</article-title>
                    <source>

                        <italic toggle="yes">Environ Sci Technol.</italic>
</source>
                    <year>2003</year>;<volume>37</volume>(<issue>18</issue>):<fpage>4060</fpage>&#x2013;<lpage>4069</lpage>.
                    <pub-id pub-id-type="pmid">14524436</pub-id>
                    <pub-id pub-id-type="doi">10.1021/es034145s</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-46">
                <mixed-citation publication-type="book">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Seinfeld</surname>
                            <given-names>JH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Pandis</surname>
                            <given-names>SN</given-names>
                        </name>
</person-group>:
                    <article-title>Atmospheric chemistry and physics: from air pollution to climate change.</article-title>John Wiley &amp; Sons.<year>2016</year>.
                    <ext-link ext-link-type="uri" xlink:href="https://books.google.co.in/books?id=XqDcCwAAQBAJ&amp;printsec=frontcover">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-47">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Shah</surname>
                            <given-names>AS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Langrish</surname>
                            <given-names>JP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Nair</surname>
                            <given-names>H</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Global association of air pollution and heart failure: a systematic review and meta-analysis.</article-title>
                    <source>

                        <italic toggle="yes">Lancet.</italic>
</source>
                    <year>2013</year>;<volume>382</volume>(<issue>9897</issue>):<fpage>1039</fpage>&#x2013;<lpage>1048</lpage>.
                    <pub-id pub-id-type="pmid">23849322</pub-id>
                    <pub-id pub-id-type="doi">10.1016/S0140-6736(13)60898-3</pub-id>
                    <pub-id pub-id-type="pmcid">3809511</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-48">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Shirmohammadi</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hasheminassab</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>D</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Oxidative potential of coarse particulate matter (PM
                        <sub>(10-2.5)</sub>) and its relation to water solubility and sources of trace elements and metals in the Los Angeles Basin.</article-title>
                    <source>

                        <italic toggle="yes">Environ Sci-Proc Imp.</italic>
</source>
                    <year>2015</year>;<volume>17</volume>(<issue>12</issue>):<fpage>2110</fpage>&#x2013;<lpage>2121</lpage>.
                    <pub-id pub-id-type="pmid">26560404</pub-id>
                    <pub-id pub-id-type="doi">10.1039/c5em00364d</pub-id>
                    <pub-id pub-id-type="pmcid">4666786</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-49">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Singh</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jaques</surname>
                            <given-names>PA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sioutas</surname>
                            <given-names>C</given-names>
                        </name>
</person-group>:
                    <article-title>Size distribution and diurnal characteristics of particle-bound metals in source and receptor sites of the Los Angeles Basin.</article-title>
                    <source>

                        <italic toggle="yes">Atmos Environ.</italic>
</source>
                    <year>2002</year>;<volume>36</volume>(<issue>10</issue>):<fpage>1675</fpage>&#x2013;<lpage>1689</lpage>.
                    <pub-id pub-id-type="doi">10.1016/S1352-2310(02)00166-8</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-51">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sternbeck</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sj&#x00f6;din</surname>
                            <given-names>&#x00c5;</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Andr&#x00e9;asson</surname>
                            <given-names>K</given-names>
                        </name>
</person-group>:
                    <article-title>Metal emissions from road traffic and the influence of resuspension&#x2014;results from two tunnel studies.</article-title>
                    <source>

                        <italic toggle="yes">Atmos Environ.</italic>
</source>
                    <year>2002</year>;<volume>36</volume>(<issue>30</issue>):<fpage>4735</fpage>&#x2013;<lpage>4744</lpage>.
                    <pub-id pub-id-type="doi">10.1016/S1352-2310(02)00561-7</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-76">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sullivan</surname>
                            <given-names>AP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Weber</surname>
                            <given-names>RJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Clements</surname>
                            <given-names>AL</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>A method for on-line measurement of water-soluble organic carbon in ambient aerosol particles: Results from an urban site.</article-title>
                    <source>

                        <italic toggle="yes">Geophys Res Lett.</italic>
</source>
                    <year>2004</year>;<volume>31</volume>(<issue>13</issue>).
                    <pub-id pub-id-type="doi">10.1029/2004GL019681</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-52">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Tao</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Gonzalez-Flecha</surname>
                            <given-names>B</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kobzik</surname>
                            <given-names>L</given-names>
                        </name>
</person-group>:
                    <article-title>Reactive oxygen species in pulmonary inflammation by ambient particulates.</article-title>
                    <source>

                        <italic toggle="yes">Free Radical Bio Med.</italic>
</source>
                    <year>2003</year>;<volume>35</volume>(<issue>4</issue>):<fpage>327</fpage>&#x2013;<lpage>340</lpage>.
                    <pub-id pub-id-type="pmid">12899936</pub-id>
                    <pub-id pub-id-type="doi">10.1016/S0891-5849(03)00280-6</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-53">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Turpin</surname>
                            <given-names>BJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lim</surname>
                            <given-names>HJ</given-names>
                        </name>
</person-group>:
                    <article-title>Species contributions to PM2.5 mass concentrations: revisiting common assumptions for estimating organic mass.</article-title>
                    <source>

                        <italic toggle="yes">Aerosol Sci Tech.</italic>
</source>
                    <year>2001</year>;<volume>35</volume>(<issue>1</issue>):<fpage>602</fpage>&#x2013;<lpage>610</lpage>.
                    <pub-id pub-id-type="doi">10.1080/02786820119445</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-54">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Verma</surname>
                            <given-names>V</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ning</surname>
                            <given-names>Z</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Cho</surname>
                            <given-names>AK</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Redox activity of urban quasi-ultrafine particles from primary and secondary sources.</article-title>
                    <source>

                        <italic toggle="yes">Atmos Environ.</italic>
</source>
                    <year>2009</year>;<volume>43</volume>(<issue>40</issue>):<fpage>6360</fpage>&#x2013;<lpage>6368</lpage>.
                    <pub-id pub-id-type="doi">10.1016/j.atmosenv.2009.09.019</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-55">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Pakbin</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Saffari</surname>
                            <given-names>A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Development and evaluation of a high-volume Aerosol-into-liquid collector for fine and ultrafine particulate matter.</article-title>
                    <source>

                        <italic toggle="yes">Aerosol Sci Tech.</italic>
</source>
                    <year>2013a</year>;<volume>47</volume>(<issue>11</issue>):<fpage>1226</fpage>&#x2013;<lpage>1238</lpage>.
                    <pub-id pub-id-type="doi">10.1080/02786826.2013.830693</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-56">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Pakbin</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Shafer</surname>
                            <given-names>MM</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Macrophage reactive oxygen species activity of water-soluble and water-insoluble fractions of ambient coarse, PM
                        <sub>2.5</sub> and ultrafine particulate matter (PM) in Los Angeles.</article-title>
                    <source>

                        <italic toggle="yes">Atmos Environ.</italic>
</source>
                    <year>2013b</year>;<volume>77</volume>:<fpage>301</fpage>&#x2013;<lpage>310</lpage>.
                    <pub-id pub-id-type="doi">10.1016/j.atmosenv.2013.05.031</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-57">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Woodward</surname>
                            <given-names>NC</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Levine</surname>
                            <given-names>MC</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Haghani</surname>
                            <given-names>A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Toll-like receptor 4 in glial inflammatory responses to air pollution 
                        <italic toggle="yes">in vitro</italic> and 
                        <italic toggle="yes">in vivo</italic>.</article-title>
                    <source>

                        <italic toggle="yes">J Neuroinflamm.</italic>
</source>
                    <year>2017a</year>;<volume>14</volume>(<issue>1</issue>):<fpage>84</fpage>.
                    <pub-id pub-id-type="pmid">28410596</pub-id>
                    <pub-id pub-id-type="doi">10.1186/s12974-017-0858-x</pub-id>
                    <pub-id pub-id-type="pmcid">5391610</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-58">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Woodward</surname>
                            <given-names>NC</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Pakbin</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Saffari</surname>
                            <given-names>A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Traffic-related air pollution impact on mouse brain accelerates myelin and neuritic aging changes with specificity for CA1 neurons.</article-title>
                    <source>

                        <italic toggle="yes">Neurobiol Aging.</italic>
</source>
                    <year>2017b</year>;<volume>53</volume>:<fpage>48</fpage>&#x2013;<lpage>58</lpage>.
                    <pub-id pub-id-type="pmid">28212893</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.neurobiolaging.2017.01.007</pub-id>
                    <pub-id pub-id-type="pmcid">5388507</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-59">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Zhang</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Liu</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Davies</surname>
                            <given-names>KJ</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Nrf2-regulated phase II enzymes are induced by chronic ambient nanoparticle exposure in young mice with age-related impairments.</article-title>
                    <source>

                        <italic toggle="yes">Free Radical Bio Med.</italic>
</source>
                    <year>2012</year>;<volume>52</volume>(<issue>9</issue>):<fpage>2038</fpage>&#x2013;<lpage>2046</lpage>.
                    <pub-id pub-id-type="pmid">22401859</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.freeradbiomed.2012.02.042</pub-id>
                    <pub-id pub-id-type="pmcid">3342863</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-60">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Zhang</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Schauer</surname>
                            <given-names>JJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Shafer</surname>
                            <given-names>MM</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Source apportionment of 
                        <italic toggle="yes">in vitro</italic> reactive oxygen species bioassay activity from atmospheric particulate matter.</article-title>
                    <source>

                        <italic toggle="yes">Environ Sci Technol.</italic>
</source>
                    <year>2008</year>;<volume>42</volume>(<issue>19</issue>):<fpage>7502</fpage>&#x2013;<lpage>7509</lpage>.
                    <pub-id pub-id-type="pmid">18939593</pub-id>
                    <pub-id pub-id-type="doi">10.1021/es800126y</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
</article>
