<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.19901.1</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>Bio-electrosprayed human neural stem cells are viable and maintain their differentiation potential</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 1; peer review: 1 approved, 2 approved with reservations]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Helenes Gonz&#x00e1;lez</surname>
                        <given-names>Citlali</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Jayasinghe</surname>
                        <given-names>Suwan N.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Ferretti</surname>
                        <given-names>Patrizia</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-3590-6772</uri>
                    <xref ref-type="corresp" rid="c2">b</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Stem Cell and Regenerative Medicine Section, UCL Great Ormond Street Institute of Child Health, University College London, London, WC1N 1EH, UK</aff>
                <aff id="a2">
                    <label>2</label>BioPhysics Group, Department of Mechanical Engineering, University College London, London, WC1E 7JE, UK</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:citlali.gonzalez.12@ucl.ac.uk">citlali.gonzalez.12@ucl.ac.uk</email>
                </corresp>
                <corresp id="c2">
                    <label>b</label>
                    <email xlink:href="mailto:p.ferretti@ucl.ac.uk">p.ferretti@ucl.ac.uk</email>
                </corresp>
                <fn fn-type="con">
                    <p>CHG designed and performed experiments, analysed data, obtained funding and wrote the manuscript; SNJ advised and provided training on bio-electrospray and reviewed the manuscript; PF planned research, obtained funding, and wrote the manuscript.</p>
                </fn>
                <fn fn-type="conflict">
                    <p>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>17</day>
                <month>4</month>
                <year>2020</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2020</year>
            </pub-date>
            <volume>9</volume>
            <elocation-id>267</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>2</day>
                    <month>4</month>
                    <year>2020</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2020 Helenes Gonz&#x00e1;lez C et al.</copyright-statement>
                <copyright-year>2020</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/9-267/pdf"/>
            <abstract>
                <p>
                    <bold>Background:</bold> Bio-electrospray (BES) is a jet-based delivery system driven by an electric field that has the ability to form micro to nano-sized droplets. It holds great potential as a tissue engineering tool as it can be used to place cells into specific patterns. As the human central nervous system (CNS) cannot be studied 
                    <italic toggle="yes">in vivo</italic> at the cellular and molecular level, 
                    <italic toggle="yes">in vitro</italic> CNS models are needed. Human neural stem cells (hNSCs) are the CNS building block as they can generate both neurones and glial cells.</p>
                <p>
                    <bold>Methods:</bold> Here we assessed for the first time how hNSCs respond to BES. To this purpose, different hNSC lines were sprayed at 10 kV and their ability to survive, grow and differentiate was assessed at different time points.</p>
                <p>
                    <bold>Results:</bold> BES induced only a small and transient decrease in hNSC metabolic activity, from which cells recovered by day 6, and no significant increase in cell death was observed, as assessed by flow cytometry. Furthermore, bio-electrosprayed hNSCs differentiated as efficiently as controls into neurones, astrocytes and oligodendrocytes as shown by morphological, protein and gene expression analysis.</p>
                <p>
                    <bold>Conclusions:</bold> This study highlights the robustness of hNSCs and identifies BES as a suitable technology that could be developed for the direct deposition of these cells in specific locations and configurations.</p>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>bio-electrospray</kwd>
                <kwd>death</kwd>
                <kwd>differentiation</kwd>
                <kwd>human</kwd>
                <kwd>in vitro</kwd>
                <kwd>neural stem cells</kwd>
                <kwd>neurone</kwd>
                <kwd>survival</kwd>
            </kwd-group>
            <funding-group>
                <award-group id="fund-1" xlink:href="http://dx.doi.org/10.13039/501100000265">
                    <funding-source>Medical Research Council</funding-source>
                    <award-id>G070089</award-id>
                </award-group>
                <award-group id="fund-2" xlink:href="http://dx.doi.org/10.13039/501100000272">
                    <funding-source>National Institute for Health Research</funding-source>
                    <award-id>BRC4877</award-id>
                </award-group>
                <award-group id="fund-3" xlink:href="http://dx.doi.org/10.13039/501100003141">
                    <funding-source>Consejo Nacional de Ciencia y Tecnolog&#x00ed;a</funding-source>
                    <award-id>217404</award-id>
                </award-group>
                <award-group id="fund-4" xlink:href="http://dx.doi.org/10.13039/100004440">
                    <funding-source>Wellcome Trust</funding-source>
                    <award-id>GR082557</award-id>
                </award-group>
                <funding-statement>This work was supported by a CONACYT Graduate Fellowship (Fellow No. 217404) to CHG and the National Institute for Health Research (NIHR) Biomedical Research Centre Great Ormond Street Biomedical Research Centre (GOSH BRC). The human embryonic and foetal material was provided by the Human Developmental Biology Resource (http://hdbr.org), jointly funded by the Medical Research Council (grant G070089) and The Wellcome Trust (grant GR082557).</funding-statement>
                <funding-statement>
                    <italic>The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.</italic>
                </funding-statement>
            </funding-group>
        </article-meta>
    </front>
    <body>
        <sec sec-type="intro">
            <title>Introduction</title>
            <p>Electrospraying is a very useful technique for fabricating micro- and nano-structures of different composition, texture and shape using a wide range of materials and cells. When cells are electrosprayed, the technique is known as bio-electrospray (BES). BES consists of a jet-based delivery system connected to an electric field that has the ability to generate nano-sized and cell-laden microdroplets (
                <xref ref-type="bibr" rid="ref-23">Jayasinghe &amp; Townsend-Nicholson, 2006</xref>; 
                <xref ref-type="bibr" rid="ref-21">Jayasinghe, 2011</xref>; 
                <xref ref-type="bibr" rid="ref-30">Poncelet 
                    <italic toggle="yes">et al</italic>., 2012</xref>). This is due to the difference in electric potential between the charged needle and the ground electrode that forms an electric field, accelerating the charged cell suspension within the needle and forming an unstable jet. This methodology has the advantage of having the potential to achieve single-cell delivery, giving a more homogeneous cell distribution within a 3-dimensional (3D) construct, as well as being very suitable for microencapsulation (
                <xref ref-type="bibr" rid="ref-2">Boda 
                    <italic toggle="yes">et al</italic>., 2018</xref>; 
                <xref ref-type="bibr" rid="ref-21">Jayasinghe, 2011</xref>; 
                <xref ref-type="bibr" rid="ref-30">Poncelet 
                    <italic toggle="yes">et al</italic>., 2012</xref>). The configuration needed to obtain micro to nano-sized droplets and a near mono-distribution can be achieved by adjusting BES conditions (
                <xref ref-type="bibr" rid="ref-22">Jayasinghe 
                    <italic toggle="yes">et al</italic>., 2006</xref>; 
                <xref ref-type="bibr" rid="ref-23">Jayasinghe &amp; Townsend-Nicholson, 2006</xref>). Other strategies adopted to obtain such a high resolution require small diameter needles, resulting in shear stress to the cells and an inability to process high-density and/or viscous cell suspensions (
                <xref ref-type="bibr" rid="ref-15">Greig &amp; Jayasinghe, 2008</xref>; 
                <xref ref-type="bibr" rid="ref-18">Hall 
                    <italic toggle="yes">et al</italic>., 2008</xref>).</p>
            <p>An important consideration for cell-based applications is that the high voltages and spraying action could have an adverse effect on the cells, and this may differ among cell types. Although it has been demonstrated that BES does not significantly affect a range of mammalian cells, and even small organisms, its effect have never been studied on human neural stem cells (hNSCs), the building block of the nervous system (
                <xref ref-type="bibr" rid="ref-6">Clarke &amp; Jayasinghe, 2008</xref>; 
                <xref ref-type="bibr" rid="ref-13">Geach 
                    <italic toggle="yes">et al</italic>., 2009</xref>; 
                <xref ref-type="bibr" rid="ref-19">Hong 
                    <italic toggle="yes">et al</italic>., 2010</xref>; 
                <xref ref-type="bibr" rid="ref-24">Jayasinghe 
                    <italic toggle="yes">et al</italic>., 2011</xref>; 
                <xref ref-type="bibr" rid="ref-25">Joly 
                    <italic toggle="yes">et al</italic>., 2009</xref>; 
                <xref ref-type="bibr" rid="ref-36">Tezera 
                    <italic toggle="yes">et al</italic>., 2017</xref>).</p>
            <p>hNSCs either derived from the embryonic nervous system or differentiated from pluripotent stem cells provide an ideal source for modelling the human nervous system. hNSCs have the capacity to self-renew and differentiate into the major cell types of the brain, neurones and glia (oligodendrocytes and astrocytes), and hold the potential to repair damaged tissue in the central nervous system (CNS) (
                <xref ref-type="bibr" rid="ref-1">Bianco &amp; Robey, 2001</xref>; 
                <xref ref-type="bibr" rid="ref-12">Gage &amp; Temple, 2013</xref>). This makes them invaluable for the development of 3D models for the study of normal and abnormal developmental mechanisms, neurodegenerative disorders, neural repair and high-throughput screening of putative neuroactive drugs (
                <xref ref-type="bibr" rid="ref-5">Breier 
                    <italic toggle="yes">et al</italic>., 2010</xref>; 
                <xref ref-type="bibr" rid="ref-12">Gage &amp; Temple, 2013</xref>; 
                <xref ref-type="bibr" rid="ref-17">Gu 
                    <italic toggle="yes">et al</italic>., 2016</xref>). There is also much interest in using hNSC to develop 3D systems for transplantation into the damaged CNS (
                <xref ref-type="bibr" rid="ref-33">Somaa 
                    <italic toggle="yes">et al</italic>., 2017</xref>; 
                <xref ref-type="bibr" rid="ref-40">Vishwakarma 
                    <italic toggle="yes">et al</italic>., 2014</xref>).</p>
            <p>Given the encouraging results from a few studies on mouse neural cells and human astrocytoma (
                <xref ref-type="bibr" rid="ref-7">Eagles 
                    <italic toggle="yes">et al</italic>., 2006</xref>; 
                <xref ref-type="bibr" rid="ref-8">Eddaoudi 
                    <italic toggle="yes">et al</italic>., 2010</xref>; 
                <xref ref-type="bibr" rid="ref-22">Jayasinghe &amp; Townsend-Nicholson, 2006</xref>; 
                <xref ref-type="bibr" rid="ref-26">Mongkoldhumrongkul 
                    <italic toggle="yes">et al</italic>., 2009a</xref>), we wished to establish whether hNSCs could be bio-electrosprayed, and specifically assess whether the procedure affected their survival and ability to undergo multi-lineage differentiation. Extensive analysis of hNSC survival/death and differentiation showed that hNSCs withstand the BES procedure vey well and could successfully differentiate towards neuronal, astrocyte and oligodendrocyte lineages with no alteration in gene expression following neuronal differentiation. Together, this study demonstrates that hNSCs remain viable over prolonged periods post-treatment and are capable of withstanding the pressure and stresses of being handled as high-density cell suspensions within a needle at a high voltage.</p>
        </sec>
        <sec sec-type="methods">
            <title>Methods</title>
            <sec>
                <title>Materials</title>
                <p>Unless otherwise indicated, chemicals were purchased from Sigma-Aldrich (UK). Dulbecco&#x2019;s Modified Eagle Medium/Nutrient Mixture F-12 GlutaMAX
                    <sup>TM</sup> (DMEM/F12), Neurobasal&#x00ae;-A Medium, foetal bovine serum (FBS), N-2 (100x) and B-27 (50x) supplements were from Gibco, FGF-2, EGF and PDGF-aa from Peprotech, propidium iodide (PI) from Invitrogen and Allophycocyanin (APC) Annexin V from BD Pharmingen.</p>
            </sec>
            <sec>
                <title>Human neural stem cell culture</title>
                <p>Human brain embryonic tissue was provided by the Human Developmental Biology Resource (HDBR, 
                    <ext-link ext-link-type="uri" xlink:href="http://www.hdbr.org/">http://www.hdbr.org/</ext-link>). All procedures using human tissue were carried out in accordance with the Human Tissue Act 2006 with informed consent (REC reference: 18/LO/0822) for study participation under ethical approval (NRES Committee London &#x2013; Fulham, London, UK). The hNSC lines used in this study had been derived from embryonic brain tissue at Carnegie Stage (Cs)17 and Cs23, and grown on laminin, as previously described (
                    <xref ref-type="bibr" rid="ref-35">Taylor 
                        <italic toggle="yes">et al</italic>., 2019</xref>; 
                    <xref ref-type="bibr" rid="ref-38">U 
                        <italic toggle="yes">et al</italic>., 2014</xref>; 
                    <xref ref-type="bibr" rid="ref-39">Vagaska 
                        <italic toggle="yes">et al</italic>., 2016</xref>). In brief, cells were seeded at a density of ~11,000 cells/cm
                    <sup>2</sup> and grown at 37&#x00b0;C in a humidified incubator with 5% CO
                    <sub>2</sub> in medium containing: Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12) supplemented with 1% (v/v) penicillin/streptomycin, 1% (v/v) 100x N2, 2% (v/v) B27, 20 ng/ml FGF-2, 20 ng/ml EGF, 50 &#x00b5;g/ml, BSA fraction V, 5 &#x00b5;g/ml heparin and 10 &#x00b5;g/ml laminin.</p>
            </sec>
            <sec>
                <title>Differentiation protocols</title>
                <p>Differentiation was induced when hNSCs had reached confluency, approximately 3 days after plating.</p>
                <p>
                    <italic toggle="yes">Neuronal differentiation.</italic> After 10 days in a medium consisting of DMEM containing Glutamax supplemented with 1% penicillin/streptomycin, 10 &#x00b5;M forskolin, 5 mM KCl, 2 mM valproic acid, 1 &#x00b5;M hydrocortisone and 5 &#x00b5;g/ml insulin for 10 days, cells were maintained in with Neurobasal&#x00ae;-A Medium supplemented with 1% L-glutamine, 1% penicillin/streptomycin and 2% B27 for 18 days (4 weeks total differentiation time). Protocol adapted from 
                    <xref ref-type="bibr" rid="ref-16">Guasti 
                        <italic toggle="yes">et al</italic>. (2012)</xref>.</p>
                <p>
                    <italic toggle="yes">Oligodendrocyte differentiation.</italic> hNSCs were first incubated in DMEM/F12 containing 1% penicillin/streptomycin, 1% N2, 10 nM forskolin, 10 ng/ml FGF-2 and 10 ng/ml PDGF-aa for 14 days, and then in DMEM/F12 medium supplemented with 1% penicillin/streptomycin, 1% N2, 30 ng/ml tri-iodothyronine, 200 &#x00b5;M ascorbic acid and 10 ng/ml PDGF-aa for 7 days. PDGF-aa was then removed and cell incubated for a further 2 weeks to allow maturation (5 weeks total differentiation time).</p>
                <p>
                    <italic toggle="yes">Astrocytic differentiation.</italic> This was induced by incubating hNSCs in DMEM/F12 supplemented with 10% (v/v) FBS and 1% penicillin/streptomycin for 2 weeks.</p>
            </sec>
            <sec>
                <title>BES configuration and cell preparation</title>
                <p>The BES system consisted of a high-voltage power supply (Glassman Europe Ltd., FP-30, Tadley, UK.) with a syringe pump (Harvard Apparatus) holding a needle of 1.5-mm outer diameter (0.8&#x2013;0.9 mm inner diameter). The voltage was set at 10 kV and the flow rate at 250 ml/h. The procedure was carried out inside a class II biosafety cabinet to ensure sterility. hNSC suspensions with a density of ~1.3&#x00d7;10
                    <sup>6</sup> cells per ml were divided into 1 experimental and 2 control groups, all run in triplicate. The experimental hNSCs were taken to the the bio-electrospray facility, which was located in a different building, and sprayed (BES group). One control group was transported to the BES facility but not sprayed (TC), and the other was left in the tissue culture laboratory (LC). All groups were replated at the same time.</p>
            </sec>
            <sec>
                <title>Analysis of cell death and survival</title>
                <p>The live/dead staining was performed 24 hours after BES. Hoechst 33258 and propidium iodide dissolved in phosphate buffered saline (PBS) were added to the culture medium at final concentrations of 2 &#x03bc;g/ml and 5 &#x03bc;g/ml, respectively. After a 2-hour incubation, cells were viewed and imaged using an IX71inverted microscope from Olympus equipped with a Lumen 200 metal arc lamp (Prior Scientific) and a monochrome ORCA-R2 digital camera (Hamamatsu Corp.) All images were processed with 
                    <ext-link ext-link-type="uri" xlink:href="https://fiji.sc/">Fiji</ext-link> software (Java 8 version) (
                    <xref ref-type="bibr" rid="ref-32">Schindelin 
                        <italic toggle="yes">et al</italic>., 2012</xref>).</p>
                <p>Cells viability/metabolic activity was assessed 1, 3 and 6 days after BES by the MTT (3-(4, 5-dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide) assay. In brief, cells were incubated for 2 hours in medium containing 10% MTT (stock solution 5 mg/ml in DMSO), after which the absorbance was measured at 595 nm with a spectrophotometer (Multiscan FC ThermoScientific).</p>
                <p>Flow cytometry analysis was performed immediately after and 3 days after BES. Roughly 1&#x00d7;10
                    <sup>6</sup> hNSCs per sample were resuspended in 500 &#x00b5;l of 1:100 APC-Annexin V conjugate:Annexin V binding buffer (10 mM HEPES, 150 mM NaCl, 5 mM KCl, 5 mM MgCl
                    <sub>2</sub> and 1.8 mM CaCl
                    <sub>2</sub> adjusted with NaOH to pH 7.4). Samples were kept at room temperature (RT) in the dark for 20 minutes before adding propidium iodide (PI) to a final concentration of 5 &#x00b5;g/ml. Stained cells were kept on ice until loading on a BD FACSCalibur TM to carry out flow cytometry analysis. Data was analysed using Kaluza 1.3 software. As a positive control, hNSCs were treated with 10 &#x00b5;m thapsigargin for 24 hours to induce cell death prior to flow cytometry</p>
            </sec>
            <sec>
                <title>Immunocytochemistry</title>
                <p>Cells were fixed with 4% (w/v) paraformaldehyde (PFA) pH 7.4 for 15 minutes at RT, rinsed in PBS (phosphate buffer saline) and incubated in blocking solution (10% FBS, 3% BSA and 0.2% TritonX-100 in PBS) for 1 hour at RT. Incubation with primary and secondary antibodies at the indicated dilutions (
                    <xref ref-type="table" rid="T1">Table 1</xref>) was overnight at 4&#x00b0;C, and for 1 hour at RT, respectively. The nuclear stain Hoechst 33258 (2 &#x03bc;g/ml) was added to the secondary antibody solution. Cells were mounted with Citifluor (Citifluor Ltd). An IX71inverted microscope (Olympus) with a monochrome ORCA-R2 digital camera (Hamamatsu Corp.) was used to acquire images. All images were processed with Fiji software (
                    <xref ref-type="bibr" rid="ref-32">Schindelin 
                        <italic toggle="yes">et al</italic>., 2012</xref>).</p>
                <table-wrap id="T1" orientation="portrait" position="anchor">
                    <label>Table 1. </label>
                    <caption>
                        <title>Primary and secondary antibodies used for immunofluorescence.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="center" colspan="6" rowspan="1">Primary Antibodies</th>
                            </tr>
                            <tr>
                                <th align="left" colspan="1" rowspan="1">
                                    <italic toggle="yes">Target</italic>
                                </th>
                                <th align="left" colspan="1" rowspan="1">
                                    <italic toggle="yes">Antibody type (species)</italic>
                                </th>
                                <th align="left" colspan="1" rowspan="1">
                                    <italic toggle="yes">Supplier</italic>
                                </th>
                                <th align="left" colspan="1" rowspan="1">
                                    <italic toggle="yes">Product</italic>
                                    <break/>
                                    <italic toggle="yes">Number</italic>
                                </th>
                                <th align="left" colspan="1" rowspan="1">
                                    <italic toggle="yes">Dilution</italic>
                                </th>
                                <th align="left" colspan="1" rowspan="1">
                                    <italic toggle="yes">RRID</italic>
                                </th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">NeuN</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Monoclonal (mouse)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Millipore</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">MAB377</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1/100</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AB_2298772</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">NF200</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Polyclonal (rabbit)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Sigma</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">N4142</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1/100</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AB_477272</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">S100&#x03b2;</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Polyclonal (rabbit)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Dako</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Z0311</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1/100</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AB_10013383</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">DCX</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Polyclonal (rabbit)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Invitrogen</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">48-1200</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1/200</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AB_2533840</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">MAP2</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Monoclonal (mouse)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Life Technologies</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">131500</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1/200</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AB_2533001</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">GFAP</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Polyclonal (rabbit)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Millipore</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AB5804</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1/500</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AB_2109645</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Vimentin</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Monoclonal (mouse)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Dako</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GA630</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1/500</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AB_2827759</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">O4</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Monoclonal (mouse)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">R&amp;D</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">MAB1326</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1/100</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AB_357617</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">A2B5</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Monoclonal (mouse)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">R&amp;D</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">MAB1416</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1/100</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AB_357687</td>
                            </tr>
                            <tr>
                                <th align="center" colspan="6" rowspan="1">Secondary Antibodies</th>
                            </tr>
                            <tr>
                                <th align="left" colspan="1" rowspan="1">
                                    <italic toggle="yes">Target</italic>
                                </th>
                                <th align="left" colspan="1" rowspan="1">
                                    <italic toggle="yes">Host (fluorophore)</italic>
                                </th>
                                <th align="left" colspan="1" rowspan="1">
                                    <italic toggle="yes">Supplier</italic>
                                </th>
                                <th align="left" colspan="1" rowspan="1">
                                    <italic toggle="yes">Product</italic>
                                    <break/>
                                    <italic toggle="yes">Number</italic>
                                </th>
                                <th align="left" colspan="1" rowspan="1">
                                    <italic toggle="yes">Dilution</italic>
                                </th>
                                <th align="left" colspan="1" rowspan="1">
                                    <italic toggle="yes">RRID</italic>
                                </th>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Mouse IgG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Donkey (Alexa Fluor 488)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Molecular Probes</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">A-21202</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1/500</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AB_141607</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Rabbit IgG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Donkey (Alexa Fluor 594)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Molecular Probes</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">A-21207</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1/500</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AB_141637</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Mouse IgM</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Goat (Alexa Fluor 488)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Molecular Probes</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">A-21042</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1/500</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AB_2535711</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
            </sec>
            <sec>
                <title>RNA analysis by reverse transcription-PCR (RT-PCR)</title>
                <p>RNA was extracted from cell pellets using RNeasy Mini Kit (Qiagen) according to the manufacturer&#x2019;s protocol. Complementary DNA (cDNA) was prepared from 500 ng of extracted RNA using MMLV reverse transcriptase (Promega) following the manufacturers protocol. Reverse transcription reactions were performed using a PTC-100 thermal cycler (MJ Research, Inc.). The sequences of the primers and conditions used are shown in 
                    <xref ref-type="table" rid="T2">Table 2</xref>. PCR reactions were performed in a Veriti Thermal Cycler (Applied Biosciences). To exclude contamination of the reagents, no-template controls (NTC) where water instead of cDNA was included were run in each experiment. A cDNA sample from a human embryonic brain (22 weeks post conception) was used as positive controls. Amplified products were separated by gel electrophoresis using 1.5% (w/v) agarose gels in tri-acetate EDTA (TAE) buffer and 1X SYBR Safe dye (ThermoFisher Scientific). Semi-quantification of the bands was performed using Fiji software (
                    <xref ref-type="bibr" rid="ref-32">Schindelin 
                        <italic toggle="yes">et al</italic>., 2012</xref>) and the housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), used to normalize expression.</p>
                <table-wrap id="T2" orientation="portrait" position="anchor">
                    <label>Table 2. </label>
                    <caption>
                        <title>List of human primers and conditions used for transcript amplification.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1">Gene</th>
                                <th align="center" colspan="1" rowspan="1">Primer Sequences</th>
                                <th align="center" colspan="1" rowspan="1">Annealing
                                    <break/>temperature (&#x00b0;C)</th>
                                <th align="center" colspan="1" rowspan="1">Cycle
                                    <break/>N&#x00b0;</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>GAPDH</bold>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>Fw</bold> CCTTCATTGACCTCAACTACATGGT
                                    <break/>
                                    <bold>Rv</bold> CTAAGCAGTTGGTGGTGCAGGA</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">56</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">30</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>MAP2</bold>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>Fw</bold> CCACCTGAGATTAAGGATCA
                                    <break/>
                                    <bold>Rv</bold> GGCTTACTTTGCTTCTCTGA</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">59</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">30</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>OLIG2</bold>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>Fw</bold> CAGAAGCGCTGATGGTCATA
                                    <break/>
                                    <bold>Rv</bold> TCGGCAGTTTTGGGTTATTC</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">56</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">32</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>GFAP</bold>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>Fw</bold> GAAGCTCCAGGATGAAACCA
                                    <break/>
                                    <bold>Rv</bold> ACCTCCTCCTCGTGGATCTT</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">56</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">30</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>NEFH (NF-H)</bold>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>Fw</bold> TAGCCGCTTACAGAAAACTC
                                    <break/>
                                    <bold>Rv</bold> AGACTTCTCCACCACTTTGA</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">56</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">32</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>SLC1A3</bold>
                                    <break/>
                                    <bold>(GLAST)</bold>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>Fw</bold> CTCACAGTCACCGCTGTCAT
                                    <break/>
                                    <bold>Rv</bold> CCATCTTCCCTGATGCCTTA</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">56</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">32</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>ENO2 (NSE)</bold>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>Fw</bold> CTGATGCTGGAGTTGGATGG
                                    <break/>
                                    <bold>Rv</bold> CCATTGATCACGTTGAAGGC</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">56</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">32</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
            </sec>
            <sec>
                <title>Statistical analysis</title>
                <p>Each experiment was performed in biological triplicates unless stated otherwise. Statistical analysis was carried out with two-way ANOVA followed by Tukey&#x2019;s multiple comparison test. Results are expressed as mean &#x00b1; standard error of the mean. Differences were considered to be significant if p &#x2264; 0.05.</p>
            </sec>
        </sec>
        <sec sec-type="results">
            <title>Results</title>
            <sec>
                <title>Assessment of hNSC viability after BES</title>
                <p>We first investigated whether hNSC viability is affected immediately after and at different times after bioelectrospraying (BES). Three groups were compared in all experiments: bio-electrosprayed hNSCs (BES) and two control groups, the BES control hNSCs (cells transported to the BES laboratory, but not sprayed; TC) and the tissue culture laboratory control hNSCs (cells not transported to the BES laboratory; LC).</p>
                <p>At 24 hours after spraying, cells were double stained with Hoechst dye and PI to detect dead cells. No apparent difference in cell death between BES and control groups was observed by cell imaging (
                    <xref ref-type="fig" rid="f1">Figure 1A</xref>). To further assess the effect of BES on cell viability, hNSCs were labelled with PI and annexin V, a marker of apoptosis, immediately after spraying (
                    <xref ref-type="fig" rid="f1">Figure 1B</xref>) and 3 days later (
                    <xref ref-type="fig" rid="f1">Figure 1C</xref>). Cells were analysed by flow cytometry to detect early apoptotic (low PI and high APC-Annexin V), and late apoptotic/necrotic cells (high PI) as shown in 
                    <xref ref-type="fig" rid="f1">Figure 1B, C</xref>. As summarized in 
                    <xref ref-type="fig" rid="f1">Figure 1D</xref>, over 94% of cells were viable in all groups immediately after spraying (Day 0), and over 95% were viable at 3 days, with low levels of early apoptosis detected at both time points (1% and 0.5%, respectively). To establish whether BES affected cell behaviour over time, their metabolic activity, that reflects number of cells in the culture, was assessed by the MTT assay on day 1, 3 and 6 after BES. Metabolic activity increased over six days in all samples, although it was lower in the BES group than in the laboratory control at 1 and 3 days; however, by 6 days, no difference was observed among control and BES groups (
                    <xref ref-type="fig" rid="f1">Figure 1E</xref>). Together, these results suggest that BES does not negatively affect hNSCs viability over time.</p>
                <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                    <label>Figure 1. </label>
                    <caption>
                        <title>Viability of human neural stem cells (hNSCs) after bio-electrospray.</title>
                        <p>
                            <bold>A</bold>) Staining with propidium iodide (PI, red) and Hoechst 33258 (blue) in live hNSCs (Cs 17, passage 22) 24 hours after spraying (BES) and in non-sprayed controls (TC: taken to the BES laboratory but non-sprayed; LC: not moved from the tissue culture laboratory). All pictures are at the same magnification. 
                            <bold>B</bold>&#x2013;
                            <bold>C</bold>) Analysis of Annexin V- and PI- positive cells by flow cytometry immediately after spraying (
                            <bold>B</bold>) and 3 days after spraying (
                            <bold>C</bold>). Representative scatter plots showing early apoptotic (EA), and apoptotic plus necrotic cell population (A&amp;N) measured as percentages of total gated cells. 
                            <bold>D</bold>) Cell populations represented as percentages of total gated cells. No significant difference in the percentage of viable cells is observed between BES and controls (biological triplicates presented as mean &#x00b1; SEM) as assessed by two way ANOVA. 
                            <bold>E</bold>) hNSC metabolic activity assessed by the MTT assay 1, 3 and 6 days after BES. Data represent mean absorbance &#x00b1;SEM, n=6; * p &#x2264; 0.05, ** p &#x2264; 0.01 as assessed by two way ANOVA and Tukey&#x2019;s multiple comparisons test.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/21837/d986af93-d1aa-45cf-852d-84c0df9a27d0_figure1.gif"/>
                </fig>
            </sec>
            <sec>
                <title>Assessment of hNSCs differentiation potential after BES</title>
                <p>To establish whether BES affected hNSCs differentiation capacity, two hNSCs lines were differentiated along the neuronal and glial lineages (astrocytes and oligodendrocytes). After 4 weeks of neuronal differentiation, processes that had started to grow at 10 days (see Extended data) had extended further in all groups, as shown by phase contrast images (
                    <xref ref-type="fig" rid="f2">Figure 2</xref> and 
                    <italic toggle="yes">Extended data</italic>, Supplementary Figure S2) (
                    <xref ref-type="bibr" rid="ref-11">Ferretti &amp; Helenes Gonz&#x00e1;lez, 2020b</xref>). Immunofluorescence labelling for neuronal markers revealed comparable expression of the mature neuronal markers microtubule-associated protein 2 (MAP2), neurofilament 200 (NF200) and neuronal nuclear protein (NeuN) (
                    <xref ref-type="fig" rid="f2">Figure 2</xref> and 
                    <italic toggle="yes">Extended data</italic>, Supplementary Figure S1 and S2) (
                    <xref ref-type="bibr" rid="ref-11">Ferretti &amp; Helenes Gonz&#x00e1;lez, 2020b</xref>) in the control and BES groups. In contrast, no significant expression of doublecortin (DCX), a marker of newly born and migrating neurons was detected in any group (
                    <italic toggle="yes">Extended data</italic>, Supplementary Figure S1) (
                    <xref ref-type="bibr" rid="ref-11">Ferretti &amp; Helenes Gonz&#x00e1;lez, 2020b</xref>). These indicated that the BES process did not compromise hNSC neuronal differentiation.</p>
                <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                    <label>Figure 2. </label>
                    <caption>
                        <title>Neuronal differentiation of hNSCs after bio-electrospray assessed by phase contrast imaging and double-labelling for neuronal markers.</title>
                        <p>Sprayed (BES) and control (TC: taken to the BES laboratory but non-sprayed; LC: not moved from the tissue culture laboratory) hNSCs (Cs 17, passage 22) differentiated for 4 weeks. Note typical neuronal morphology and neurite extension and expression of the neuronal markers, MAP2, microtubule-associated protein 2 (green), and NF200, neurofilament 200 (red). Nuclei are counterstained with Hoechst 33258 (blue). All phase contrast images are at the same magnification.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/21837/d986af93-d1aa-45cf-852d-84c0df9a27d0_figure2.gif"/>
                </fig>
                <p>Upon induction of astrocyte differentiation, hNSC morphology rapidly changed in both control and BES groups, with cells becoming more spread and flatter than in undifferentiated controls, consistent with astrocytic differentiation (
                    <xref ref-type="fig" rid="f3">Figure 3</xref> and 
                    <italic toggle="yes">Extended data</italic>, Supplementary Figure S3) (
                    <xref ref-type="bibr" rid="ref-11">Ferretti &amp; Helenes Gonzalez, 2020b</xref>). This was further supported by expression of vimentin and glial fibrillary acidic protein (GFAP). Together, comparable morphological appearance and glial markers expression in all groups indicates that BES does not interfere with astrocytic differentiation of hNSCs.</p>
                <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                    <label>Figure 3. </label>
                    <caption>
                        <title>Astrocyte differentiation of hNSCs after bio-electrospray assessed by phase contrast imaging and double-labelling for astrocyte markers.</title>
                        <p>Sprayed (BES) and control (TC: taken to the BES laboratory but non-sprayed; LC: not moved from the tissue culture laboratory) hNSCs (Cs 17, passage 22) differentiated for 2 weeks. Note the flatten morphology typical of astrocytes morphology and expression of astrocyte markers, Vimentin (green) and GFAP (glial fibrillary acidic protein; red). Nuclei are counterstained with Hoechst 33258 (blue). All phase contrast images are at the same magnification.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/21837/d986af93-d1aa-45cf-852d-84c0df9a27d0_figure3.gif"/>
                </fig>
                <p>Finally, the effect of BES on oligodendrocyte differentiation was tested. At 5 weeks of differentiation after BES, both control and BES cultures had acquired a branched morphology with long processes (
                    <xref ref-type="fig" rid="f4">Figure 4</xref> and 
                    <italic toggle="yes">Extended data</italic>, Supplementary Figure S4) (
                    <xref ref-type="bibr" rid="ref-11">Ferretti &amp; Helenes Gonz&#x00e1;lez, 2020b</xref>). Labelling of oligodendrocyte progenitor markers revealed a few cells positive for the oligodendrocyte marker, O4 (
                    <xref ref-type="fig" rid="f4">Figure 4</xref> and 
                    <italic toggle="yes">Extended data</italic>, Supplementary Figure S4) (
                    <xref ref-type="bibr" rid="ref-11">Ferretti &amp; Helenes Gonz&#x00e1;lez, 2020b</xref>), and several positive for A2B5, that is expressed in oligodendrocyte progenitor cells (
                    <xref ref-type="fig" rid="f4">Figure 4</xref>). There was no visible difference in the expression of these markers between BES cells and their controls, indicating that the BES process does not alter the oligodendrocyte differentiation.</p>
                <fig fig-type="figure" id="f4" orientation="portrait" position="float">
                    <label>Figure 4. </label>
                    <caption>
                        <title>Oligodendrocyte differentiation of hNSC assessed after bio-electrospray by phase contrast imaging and immunostaining.</title>
                        <p>Sprayed (BES) and control (TC: taken to the BES laboratory but non-sprayed; LC: not moved from the tissue culture laboratory) hNSCs (Cs 17, passage 22) differentiated for 5 weeks. Note the presence of cells with different morphologies with a few expressing the oligodendrocyte marker, O4, and a larger proportion the glial precursor marker, A2B5. Nuclei are counterstained with Hoechst 33258 (blue). All phase contrast images are the same magnification.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/21837/d986af93-d1aa-45cf-852d-84c0df9a27d0_figure4.gif"/>
                </fig>
            </sec>
            <sec>
                <title>Effect of BES on gene expression in neuronally differentiated hNSCs</title>
                <p>The effect of BES on neuronal differentiation was further investigated at the gene expression level in hNSCs after 4 weeks of neuronal differentiation. As mixed cultures are normally obtained following neuronal induction, rather than pure neuronal populations, both neuronal and glial markers were assessed to establish whether BES changed the balance of differentiation among these cell types. Transcripts for the neuronal markers, NF200, neuron-specific enolase (NSE) and MAP2, as well as the glial markers glutamate aspartate transporter (GLAST), Olig2 and GFAP were detected in all groups by RT-PCR (
                    <xref ref-type="fig" rid="f5">Figure 5A&#x2013;C</xref> and 
                    <italic toggle="yes">Extended data</italic>, Supplementary Figure S5A&#x2013;C) (
                    <xref ref-type="bibr" rid="ref-11">Ferretti &amp; Helenes Gonz&#x00e1;lez, 2020b</xref>). To obtain more quantitative information, gene expression was further investigated by semi-quantitative RT-PCR analysis in two hNSC lines (
                    <xref ref-type="fig" rid="f5">Figure 5D</xref> and 
                    <italic toggle="yes">Extended data</italic>, Supplementary Figure S5D) (
                    <xref ref-type="bibr" rid="ref-11">Ferretti &amp; Helenes Gonz&#x00e1;lez, 2020b</xref>). Relative expression of genes was normalised to GAPDH. No significant differences in glial marker expression between the control and BES groups was observed in either line. Also, neuronal markers were expressed at comparable levels, with the exception of NF200, which was expressed at slightly higher levels in the BES group in one of the cell lines (
                    <italic toggle="yes">Extended data</italic>, Supplementary Figure S5D) (
                    <xref ref-type="bibr" rid="ref-11">Ferretti &amp; Helenes Gonz&#x00e1;lez, 2020b</xref>). Overall, the expression of all but one marker were unchanged, suggesting no significant effects resulted from BES.</p>
                <fig fig-type="figure" id="f5" orientation="portrait" position="float">
                    <label>Figure 5. </label>
                    <caption>
                        <title>Expression of neural markers in hNSCs neuronally differentiated for 4 weeks after bio-electrospray assessed by RT-PCR.</title>
                        <p>
                            <bold>A</bold>&#x2013;
                            <bold>C</bold>. Expression of neuronal markers (
                            <bold>A</bold>), glial markers (
                            <bold>B</bold>), and a reference house-keeping gene, GAPDH, (
                            <bold>C</bold>) in biological triplicates of sprayed (BES) and control (TC: taken to the BES laboratory but non-sprayed; LC: not moved from the tissue culture laboratory) hNSCs (Cs 17, passage 25). MAP2: microtubule-associated protein 2; NF200: neurofilament 200; NSE: neuron-specific enolase; GFAP: glial fibrillary acidic protein; GLAST: glutamate aspartate transporter; OLIG2: oligodendrocyte transcription factor 2; GAPDH: glyceraldehyde 3-phosphate dehydrogenase. +CTRL: human embryonic brain cDNA used as positive control; NTC: no template control using water instead of cDNA. 
                            <bold>D</bold>) Relative expression of neuronal and glial markers assessed by densitometry. Data are means &#x00b1; SEM of band intensity normalised to GAPDH. No significant difference in gene expression is observed (two way ANOVA).</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/21837/d986af93-d1aa-45cf-852d-84c0df9a27d0_figure5.gif"/>
                </fig>
            </sec>
        </sec>
        <sec sec-type="discussion">
            <title>Discussion</title>
            <p>Only a few studies on the effect of BES on human cells have been carried out; these focussed on human mesenchymal stem cells (MSCs), either primary or hTERT immortalized, and tumour cells (
                <xref ref-type="bibr" rid="ref-4">Braghirolli 
                    <italic toggle="yes">et al</italic>., 2013</xref>; 
                <xref ref-type="bibr" rid="ref-8">Eddaoudi 
                    <italic toggle="yes">et al</italic>., 2010</xref>; 
                <xref ref-type="bibr" rid="ref-26">Mongkoldhumrongkul 
                    <italic toggle="yes">et al</italic>., 2009a</xref>; 
                <xref ref-type="bibr" rid="ref-41">Ye 
                    <italic toggle="yes">et al</italic>., 2015</xref>). In this study, to our knowledge we show for the first time that hNSCs can withstand the BES procedure without any negative effect on their self-renewal capacity and importantly on their neuronal and glial differentiation potential. The high voltage of 10kV used here, the pressure applied by the syringe pump, the flow rate, the high-density solution in a small-bore needle (0.8&#x2013;0.9 mm) and the handling of the cells in a separate laboratory had limited impact on hNSCs. It is well established that high voltages can be detrimental to cells, for example when cells are electroporated (
                <xref ref-type="bibr" rid="ref-37">Traitcheva &amp; Berg, 2010</xref>). However, the fact that BES operates at high voltage but low current, in the nano-ampere range (
                <xref ref-type="bibr" rid="ref-29">Pakes 
                    <italic toggle="yes">et al</italic>., 2011</xref>; 
                <xref ref-type="bibr" rid="ref-30">Poncelet 
                    <italic toggle="yes">et al</italic>., 2012</xref>), could help explain why cells do not show adverse effects when subjected to high voltages. Recently, a study assessing the effect of bioprinting on Schwann cells and myoblasts has suggested that this technique affects their viability and proliferative activity (
                <xref ref-type="bibr" rid="ref-28">Ning 
                    <italic toggle="yes">et al</italic>., 2018</xref>). Therefore, at least for some cell types, BES could provide a valuable alternative to bioprinting.</p>
            <sec>
                <title>hNSCs viability is not affected by BES</title>
                <p>Our findings on the safety of BES on hNSCs are consistent with findings in a number of cell types and organisms previously investigated, including mesenchymal cells (
                    <xref ref-type="bibr" rid="ref-19">Hong 
                        <italic toggle="yes">et al</italic>., 2010</xref>; 
                    <xref ref-type="bibr" rid="ref-20">Irvine 
                        <italic toggle="yes">et al</italic>., 2007</xref>; 
                    <xref ref-type="bibr" rid="ref-24">Jayasinghe 
                        <italic toggle="yes">et al</italic>., 2011</xref>; 
                    <xref ref-type="bibr" rid="ref-41">Ye 
                        <italic toggle="yes">et al</italic>., 2015</xref>), immortalised mouse neural cells and human astrocytoma cells (
                    <xref ref-type="bibr" rid="ref-7">Eagles 
                        <italic toggle="yes">et al</italic>., 2006</xref>; 
                    <xref ref-type="bibr" rid="ref-8">Eddaoudi 
                        <italic toggle="yes">et al</italic>., 2010</xref>; 
                    <xref ref-type="bibr" rid="ref-23">Jayasinghe &amp; Townsend-Nicholson, 2006</xref>), and nematodes (
                    <xref ref-type="bibr" rid="ref-27">Mongkoldhumrongkul 
                        <italic toggle="yes">et al</italic>., 2010</xref>). In all these studies, a survival of up to 90% after BES was observed. Notably, the hNSCs displayed an even higher survival rate (&gt;94%), suggesting that these human stem cells are more robust than most of the cells previously studied.</p>
                <p>Another difference between previous studies and ours is the length of time we monitored the cells for. Here, not only we measured metabolic activity up to 6 days, but also monitored the cells over weeks in the differentiation experiments, where undifferentiated controls were run in parallel. The use of two controls also showed that an initial small decrease in metabolic activity on BES samples was partly due to the transfer of the samples to the BES laboratory, and that full recovery had occurred by day 6. Viability of rabbit bone marrow-derived MSCs after BES was lower than that of hNSCs, with a metabolic/proliferation rate significantly lower than in controls even at a lower bio-electrospraying voltage than that used in our study (
                    <xref ref-type="bibr" rid="ref-31">Sahoo 
                        <italic toggle="yes">et al</italic>., 2010</xref>). Together, the combination of cell death and survival assays and long-term monitoring used here provides clear evidence that BES does not affect hNSCs viability either immediately or over time.</p>
            </sec>
            <sec>
                <title>hNSCs differentiation potential is maintained after BES</title>
                <p>Our tri-lineage differentiation study has clearly shown no changes in hNSC differentiation potential after BES. As from previous reports, hNSC induction of neuronal differentiation resulted in a heterogeneous population of cells, and this was comparable across groups as shown by mRNA expression (
                    <xref ref-type="bibr" rid="ref-14">Glaser 
                        <italic toggle="yes">et al</italic>., 2007</xref>; 
                    <xref ref-type="bibr" rid="ref-17">Gu 
                        <italic toggle="yes">et al</italic>., 2016</xref>; 
                    <xref ref-type="bibr" rid="ref-34">Sun 
                        <italic toggle="yes">et al</italic>., 2008</xref>). Astrocytic differentiation resulted in a more homogeneous population and all cells expressed vimentin and GFAP, though at different extents. The low number of cells positive for the oligodendrocyte marker O4 upon induction of oligodendrocyte differentiation is comparable in control and BES groups, and consistent with the long time required for human oligodendrocyte maturation. Indeed, a marker of less mature cells, A2B5, was expressed in a much higher proportion of cells.</p>
                <p>This again supports the view that hNSCs are very resistant to external stimuli. This may be a property of human stem cells or of neural stem cells, or both, and extensive investigation will be required to compare stem cell types across species to clarify this issue. Rabbit bone marrow-derived MSCs have been shown to maintain differentiation potential along three mesenchymal lineages after BES at a lower voltage than the one used here (
                    <xref ref-type="bibr" rid="ref-31">Sahoo 
                        <italic toggle="yes">et al</italic>., 2010</xref>). By contrast, human MSCs derived from human deciduous tooth pulp appear to better withstand BES even at higher voltage (15 kV), as well as maintain tri-lineage differentiation potential (
                    <xref ref-type="bibr" rid="ref-4">Braghirolli 
                        <italic toggle="yes">et al</italic>., 2013</xref>; 
                    <xref ref-type="bibr" rid="ref-3">Braghirolli 
                        <italic toggle="yes">et al</italic>., 2015</xref>). Also human adipose-derived MSCs (ADSCs) survived and differentiated efficiently after BES (
                    <xref ref-type="bibr" rid="ref-41">Ye 
                        <italic toggle="yes">et al</italic>., 2015</xref>).</p>
            </sec>
        </sec>
        <sec sec-type="conclusions">
            <title>Conclusion</title>
            <p>Analysis of cell viability, tri-lineage differentiation capacity and gene expression demonstrated that the BES process does not adversely affect hNSCs either in the short or long term. Notably, it highlighted the robustness of these human stem cells. In conclusion, this study shows that BES is a suitable tool for the direct handling of hNSCs. Therefore, it may provide a suitable technology for deposition of hNSCs to specific locations in damaged nervous system 
                <italic toggle="yes">in vivo</italic> or within suitable scaffolds for neural tissue engineering. Furthermore, this approach could be developed to generate well-controlled human neural 3D models for studying neural development or disease and responses to putative novel therapeutic interventions.</p>
        </sec>
        <sec>
            <title>Data availability</title>
            <sec>
                <title>Underlying data</title>
                <p>Harvard Dataverse: Bio-electrosprayed human neural stem cells are viable and maintain their differentiation potential- Underlying data of main figures. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.7910/DVN/CAASEG">https://doi.org/10.7910/DVN/CAASEG</ext-link> (
                    <xref ref-type="bibr" rid="ref-10">Ferretti &amp; Helenes Gonz&#x00e1;lez, 2020a</xref>).</p>
                <p>This project contains the raw uncropped images used to produce each figure, in addition to flow cytometry, cell viability and RT-PCR output data.</p>
                <p>Harvard Dataverse: Bio-electrosprayed human neural stem cells are viable and maintain their differentiation potential- Underlying data of supplementary figures. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.7910/DVN/CLGEWR">https://doi.org/10.7910/DVN/CLGEWR</ext-link> (
                    <xref ref-type="bibr" rid="ref-9">Ferretti, 2020</xref>).</p>
                <p>This project contains the raw uncropped images used to produce each of the supplementary figures (see 
                    <italic toggle="yes">Extended data</italic>), in addition to RT-PCR output data for Supplementary Figure S5D.</p>
            </sec>
            <sec>
                <title>Extended data</title>
                <p>Harvard Dataverse: Bio-electrosprayed human neural stem cells are viable and maintain their differentiation potential- Extended data. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.7910/DVN/M8ZFNR">https://doi.org/10.7910/DVN/M8ZFNR</ext-link> (
                    <xref ref-type="bibr" rid="ref-11">Ferretti &amp; Helenes Gonz&#x00e1;lez, 2020b</xref>).</p>
                <p>This project contains the file &#x2018;Supplementary figures.pdf&#x2019;, which contains the following extended data: 
                    <list id="L1" list-type="bullet">
                        <list-item>
                            <p>
                                <bold>Figure S1 Expression of neuronal markers in hNSCs after 4 weeks of differentiation.</bold> (A&#x2013;B) Neuronal nuclear protein (NeuN) and doublecortin (DCX) in sprayed (BES) and control (TC: taken to the BES laboratory but non-sprayed; LC: not moved from the tissue culture laboratory) in two hNSC lines, Cs 17, passage 22 (A) and Cs23, passage 20 (B). Nuclei are counterstained with Hoechst 33258 (blue).</p>
                        </list-item>
                        <list-item>
                            <p>
                                <bold>Figure S2. Neuronal differentiation of hNSCs after bio-electrospray assessed by phase contrast imaging and double-labelling for neuronal markers.</bold> Sprayed (BES) and control (TC: taken to the BES laboratory but non-sprayed; LC: not moved from the tissue culture laboratory) hNSCs (Cs 23, passage 20) differentiated for 4 weeks. Note typical neuronal morphology and neurite extension and expression of the neuronal markers, MAP2, microtubule-associated protein 2 (green), and NF200, neurofilament 200 (red). Nuclei are counterstained with Hoechst 33258 (blue). All phase contrast images are at the same magnification.</p>
                        </list-item>
                        <list-item>
                            <p>
                                <bold>Figure S3. Astrocyte differentiation of hNSCs after bio-electrospray assessed by phase contrast imaging and double-labelling for astrocyte markers.</bold> Sprayed (BES) and control (TC: taken to the BES laboratory but non-sprayed; LC: not moved from the tissue culture laboratory) hNSCs (Cs 23, passage 20) differentiated for 2 weeks. Note the flatten morphology typical of astrocytes morphology and expression of astrocyte markers, Vimentin (green) and GFAP (glial fibrillary acidic protein; red). Nuclei are counterstained with Hoechst 33258 (blue). All phase contrast images are at the same magnification.</p>
                        </list-item>
                        <list-item>
                            <p>
                                <bold>Figure S4. Oligodendrocyte differentiation of hNSC assessed after bio-electrospray by phase contrast imaging and immunostaining.</bold> Sprayed (BES) and control (TC: taken to the BES laboratory but non-sprayed; LC: not moved from the tissue culture laboratory) hNSCs (Cs 23, passage 20) differentiated for 5 weeks. Note the presence of cells with different morphologies with a few expressing the oligodendrocyte marker, O4, and a larger proportion the glial precursor marker, A2B5. Nuclei are counterstained with Hoechst 33258 (blue). All phase contrast images are the same magnification.</p>
                        </list-item>
                        <list-item>
                            <p>
                                <bold>Figure S5. Expression of neural markers in hNSCs neuronally differentiated for 4 weeks after bio-electrospray assessed by RT-PCR.</bold> (A-C) Expression of neuronal markers (A), glial markers (B), and a reference house-keeping gene (C) in biological triplicates of sprayed (BES) and control (TC: taken to the BES laboratory but non-sprayed; LC: not moved from the tissue culture laboratory) hNSCs (Cs 23, passage 22). MAP2: microtubule-associated protein 2; NF200: neurofilament 200; NSE: neuron-specific enolase; GFAP: glial fibrillary acidic protein; GLAST: glutamate aspartate transporter; OLIG2: oligodendrocyte transcription factor 2; GAPDH: glyceraldehyde 3-phosphate dehydrogenase. +CTRL: human embryonic brain cDNA used as positive control (22 weeks post conception); NTC: no template control using water instead of cDNA. (D) Relative expression of neuronal and glial markers assessed by densitometry. Data are means &#x00b1; SEM of band intensity normalised to GAPDH. Increased NF200 expression (* 
                                <italic toggle="yes">p</italic> 0.05) is observed in the BES group (two way ANOVA with Tukey&#x2019;s multiple comparisons test).</p>
                        </list-item>
                    </list>
</p>
                <p>Data are available under the terms of the 
                    <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/publicdomain/zero/1.0/">Creative Commons Zero &#x201c;No rights reserved&#x201d; data waiver</ext-link> (CC0 1.0 Public domain dedication).</p>
            </sec>
        </sec>
    </body>
    <back>
        <ack>
            <title>Acknowledgements</title>
            <p>We wish to thank Dr Dale Moulding at the ICH Microscopy Facility for his advice on image acquisition and Dr Ayad Eddaoudi for help with flow cytometry data acquisition.</p>
        </ack>
        <ref-list>
            <ref id="ref-1">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Bianco</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Robey</surname>
                            <given-names>PG</given-names>
                        </name>
</person-group>:
                    <article-title>Stem cells in tissue engineering.</article-title>
                    <source>

                        <italic toggle="yes">Nature.</italic>
</source>
                    <year>2001</year>;<volume>414</volume>(<issue>6859</issue>):<fpage>118</fpage>&#x2013;<lpage>21</lpage>.
                    <pub-id pub-id-type="pmid">11689957</pub-id>
                    <pub-id pub-id-type="doi">10.1038/35102181</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-2">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Boda</surname>
                            <given-names>SK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Xie</surname>
                            <given-names>J</given-names>
                        </name>
</person-group>:
                    <article-title>Electrospraying an enabling technology for pharmaceutical and biomedical applications: A review.</article-title>
                    <source>

                        <italic toggle="yes">J Aerosol Sci.</italic>
</source>
                    <year>2018</year>;<volume>125</volume>:<fpage>164</fpage>&#x2013;<lpage>181</lpage>.
                    <pub-id pub-id-type="pmid">30662086</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.jaerosci.2018.04.002</pub-id>
                    <pub-id pub-id-type="pmcid">6333098</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-4">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Braghirolli</surname>
                            <given-names>DI</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zamboni</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Acasigua</surname>
                            <given-names>GA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Association of electrospinning with electrospraying: a strategy to produce 3D scaffolds with incorporated stem cells for use in tissue engineering.</article-title>
                    <source>

                        <italic toggle="yes">Int J Nanomedicine.</italic>
</source>
                    <year>2015</year>;<volume>10</volume>:<fpage>5159</fpage>&#x2013;<lpage>69</lpage>.
                    <pub-id pub-id-type="pmid">26316747</pub-id>
                    <pub-id pub-id-type="doi">10.2147/IJN.S84312</pub-id>
                    <pub-id pub-id-type="pmcid">4542624</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-3">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Braghirolli</surname>
                            <given-names>DI</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zamboni</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Chagastelles</surname>
                            <given-names>PC</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Bio-electrospraying of human mesenchymal stem cells: an alternative for tissue engineering.</article-title>
                    <source>

                        <italic toggle="yes">Biomicrofluidics.</italic>
</source>
                    <year>2013</year>;<volume>7</volume>(<issue>4</issue>):<fpage>44130</fpage>.
                    <pub-id pub-id-type="pmid">24404063</pub-id>
                    <pub-id pub-id-type="doi">10.1063/1.4819747</pub-id>
                    <pub-id pub-id-type="pmcid">3772937</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-5">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Breier</surname>
                            <given-names>JM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Gassmann</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kayser</surname>
                            <given-names>R</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Neural progenitor cells as models for high-throughput screens of developmental neurotoxicity: state of the science.</article-title>
                    <source>

                        <italic toggle="yes">Neurotoxicol Teratol.</italic>
</source>
                    <year>2010</year>;<volume>32</volume>(<issue>1</issue>):<fpage>4</fpage>&#x2013;<lpage>15</lpage>.
                    <pub-id pub-id-type="pmid">19559083</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.ntt.2009.06.005</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-6">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Clarke</surname>
                            <given-names>JD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jayasinghe</surname>
                            <given-names>SN</given-names>
                        </name>
</person-group>:
                    <article-title>Bio-electrosprayed multicellular zebrafish embryos are viable and develop normally.</article-title>
                    <source>

                        <italic toggle="yes">Biomed Mater.</italic>
</source>
                    <year>2008</year>;<volume>3</volume>(<issue>1</issue>):<fpage>011001</fpage>.
                    <pub-id pub-id-type="pmid">18458487</pub-id>
                    <pub-id pub-id-type="doi">10.1088/1748-6041/3/1/011001</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-7">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Eagles</surname>
                            <given-names>PA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Qureshi</surname>
                            <given-names>AN</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jayasinghe</surname>
                            <given-names>SN</given-names>
                        </name>
</person-group>:
                    <article-title>Electrohydrodynamic jetting of mouse neuronal cells.</article-title>
                    <source>

                        <italic toggle="yes">Biochem J.</italic>
</source>
                    <year>2006</year>;<volume>394</volume>(<issue>Pt 2</issue>):<fpage>375</fpage>&#x2013;<lpage>378</lpage>.
                    <pub-id pub-id-type="pmid">16393140</pub-id>
                    <pub-id pub-id-type="doi">10.1042/BJ20051838</pub-id>
                    <pub-id pub-id-type="pmcid">1408668</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-8">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Eddaoudi</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Townsend-Nicholson</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Timms</surname>
                            <given-names>JF</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Molecular characterisation of post-bio-electrosprayed human brain astrocytoma cells.</article-title>
                    <source>

                        <italic toggle="yes">Analyst.</italic>
</source>
                    <year>2010</year>;<volume>135</volume>(<issue>10</issue>):<fpage>2600</fpage>&#x2013;<lpage>2612</lpage>.
                    <pub-id pub-id-type="pmid">20694206</pub-id>
                    <pub-id pub-id-type="doi">10.1039/c0an00213e</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-9">
                <mixed-citation publication-type="data">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ferretti</surname>
                            <given-names>P</given-names>
                        </name>
</person-group>:
                    <article-title>"Bio-electrosprayed human neural stem cells are viable and maintain their differentiation potential- Underlying data of supplementary figures".</article-title>Harvard Dataverse, V2.<year>2020</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.7910/DVN/CLGEWR">http://www.doi.org/10.7910/DVN/CLGEWR</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-10">
                <mixed-citation publication-type="data">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ferretti</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Helenes Gonz&#x00e1;lez</surname>
                            <given-names>C</given-names>
                        </name>
</person-group>:
                    <article-title>"Bio-electrosprayed human neural stem cells are viable and maintain their differentiation potential- Underlying data of main figures".</article-title>Harvard Dataverse, V3.<year>2020a</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.7910/DVN/CAASEG">http://www.doi.org/10.7910/DVN/CAASEG</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-11">
                <mixed-citation publication-type="data">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ferretti</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Helenes Gonz&#x00e1;lez</surname>
                            <given-names>C</given-names>
                        </name>
</person-group>:
                    <article-title>"Bio-electrosprayed human neural stem cells are viable and maintain their differentiation potential- Extended data".</article-title>Harvard Dataverse, V1.<year>2020b</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.7910/DVN/M8ZFNR">http://www.doi.org/10.7910/DVN/M8ZFNR</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-12">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Gage</surname>
                            <given-names>FH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Temple</surname>
                            <given-names>S</given-names>
                        </name>
</person-group>:
                    <article-title>Neural stem cells: generating and regenerating the brain.</article-title>
                    <source>

                        <italic toggle="yes">Neuron.</italic>
</source>
                    <year>2013</year>;<volume>80</volume>(<issue>3</issue>):<fpage>588</fpage>&#x2013;<lpage>601</lpage>.
                    <pub-id pub-id-type="pmid">24183012</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.neuron.2013.10.037</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-13">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Geach</surname>
                            <given-names>TJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mongkoldhumrongkul</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zimmerman</surname>
                            <given-names>LB</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Bio-electrospraying living 
                        <italic toggle="yes">Xenopus tropicalis</italic> embryos: investigating the structural, functional and biological integrity of a model organism.</article-title>
                    <source>

                        <italic toggle="yes">Analyst.</italic>
</source>
                    <year>2009</year>;<volume>134</volume>(<issue>4</issue>):<fpage>743</fpage>&#x2013;<lpage>747</lpage>.
                    <pub-id pub-id-type="pmid">19305925</pub-id>
                    <pub-id pub-id-type="doi">10.1039/b817827e</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-14">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Glaser</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Pollard</surname>
                            <given-names>SM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Smith</surname>
                            <given-names>A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Tripotential differentiation of adherently expandable neural stem (NS) cells.</article-title>
                    <source>

                        <italic toggle="yes">PLoS One.</italic>
</source>
                    <year>2007</year>;<volume>2</volume>(<issue>3</issue>):<fpage>e298</fpage>.
                    <pub-id pub-id-type="pmid">17356704</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0000298</pub-id>
                    <pub-id pub-id-type="pmcid">1808430</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-15">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Greig</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jayasinghe</surname>
                            <given-names>SN</given-names>
                        </name>
</person-group>:
                    <article-title>Genomic, genetic and physiological effects of bio-electrospraying on live cells of the model yeast 
                        <italic toggle="yes">Saccharomyces cerevisiae</italic>.</article-title>
                    <source>

                        <italic toggle="yes">Biomed Mater.</italic>
</source>
                    <year>2008</year>;<volume>3</volume>(<issue>3</issue>):<fpage>034125</fpage>.
                    <pub-id pub-id-type="pmid">18765897</pub-id>
                    <pub-id pub-id-type="doi">10.1088/1748-6041/3/3/034125</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-17">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Guasti</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Prasongchean</surname>
                            <given-names>W</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kleftouris</surname>
                            <given-names>G</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>High plasticity of pediatric adipose tissue-derived stem cells: too much for selective skeletogenic differentiation?</article-title>
                    <source>

                        <italic toggle="yes">Stem Cells Transl Med.</italic>
</source>
                    <year>2012</year>;<volume>1</volume>(<issue>5</issue>):<fpage>384</fpage>&#x2013;<lpage>395</lpage>.
                    <pub-id pub-id-type="pmid">23197817</pub-id>
                    <pub-id pub-id-type="doi">10.5966/sctm.2012-0009</pub-id>
                    <pub-id pub-id-type="pmcid">3659709</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-16">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Gu</surname>
                            <given-names>Q</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tomaskovic-Crook</surname>
                            <given-names>E</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lozano</surname>
                            <given-names>R</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Functional 3D Neural Mini-Tissues from Printed Gel-Based Bioink and Human Neural Stem Cells.</article-title>
                    <source>

                        <italic toggle="yes">Adv Healthc Mater.</italic>
</source>
                    <year>2016</year>;<volume>5</volume>(<issue>12</issue>):<fpage>1429</fpage>&#x2013;<lpage>1438</lpage>.
                    <pub-id pub-id-type="pmid">27028356</pub-id>
                    <pub-id pub-id-type="doi">10.1002/adhm.201600095</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-18">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hall</surname>
                            <given-names>RP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ogilvie</surname>
                            <given-names>CM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Aarons</surname>
                            <given-names>E</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Genetic, genomic and physiological state studies on single-needle bio-electrosprayed human cells.</article-title>
                    <source>

                        <italic toggle="yes">Analyst.</italic>
</source>
                    <year>2008</year>;<volume>133</volume>(<issue>10</issue>):<fpage>1347</fpage>&#x2013;<lpage>1351</lpage>.
                    <pub-id pub-id-type="pmid">18810280</pub-id>
                    <pub-id pub-id-type="doi">10.1039/b806901h</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-19">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hong</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>deMello</surname>
                            <given-names>AJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jayasinghe</surname>
                            <given-names>SN</given-names>
                        </name>
</person-group>:
                    <article-title>Bio-electrospraying and droplet-based microfluidics: control of cell numbers within living residues.</article-title>
                    <source>

                        <italic toggle="yes">Biomed Mater.</italic>
</source>
                    <year>2010</year>;<volume>5</volume>(<issue>2</issue>):<fpage>21001</fpage>.
                    <pub-id pub-id-type="pmid">20234087</pub-id>
                    <pub-id pub-id-type="doi">10.1088/1748-6041/5/2/021001</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-20">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Irvine</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Arumuganathar</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>McEwan</surname>
                            <given-names>JR</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Coaxial Aerodynamically Assisted Bio-jets: A Versatile Paradigm for Directly Engineering Living Primary Organisms.</article-title>
                    <source>

                        <italic toggle="yes">Eng Life Sci.</italic>
</source>
                    <year>2007</year>;<volume>7</volume>(<issue>6</issue>):<fpage>599</fpage>&#x2013;<lpage>610</lpage>.
                    <pub-id pub-id-type="doi">10.1002/elsc.200720219</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-21">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Jayasinghe</surname>
                            <given-names>SN</given-names>
                        </name>
</person-group>:
                    <article-title>Bio-electrosprays: from bio-analytics to a generic tool for the health sciences.</article-title>
                    <source>

                        <italic toggle="yes">Analyst.</italic>
</source>
                    <year>2011</year>;<volume>136</volume>(<issue>5</issue>):<fpage>878</fpage>&#x2013;<lpage>890</lpage>.
                    <pub-id pub-id-type="pmid">21271004</pub-id>
                    <pub-id pub-id-type="doi">10.1039/c0an00830c</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-22">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Jayasinghe</surname>
                            <given-names>SN</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Eagles</surname>
                            <given-names>PA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Qureshi</surname>
                            <given-names>AN</given-names>
                        </name>
</person-group>:
                    <article-title>Electric field driven jetting: an emerging approach for processing living cells.</article-title>
                    <source>

                        <italic toggle="yes">Biotechnol J.</italic>
</source>
                    <year>2006</year>;<volume>1</volume>(<issue>1</issue>):<fpage>86</fpage>&#x2013;<lpage>94</lpage>.
                    <pub-id pub-id-type="pmid">16892229</pub-id>
                    <pub-id pub-id-type="doi">10.1002/biot.200500025</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-23">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Jayasinghe</surname>
                            <given-names>SN</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Townsend-Nicholson</surname>
                            <given-names>A</given-names>
                        </name>
</person-group>:
                    <article-title>Stable electric-field driven cone-jetting of concentrated biosuspensions.</article-title>
                    <source>

                        <italic toggle="yes">Lab Chip.</italic>
</source>
                    <year>2006</year>;<volume>6</volume>(<issue>8</issue>):<fpage>1086</fpage>&#x2013;<lpage>1090</lpage>.
                    <pub-id pub-id-type="pmid">16874383</pub-id>
                    <pub-id pub-id-type="doi">10.1039/b606508m</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-24">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Jayasinghe</surname>
                            <given-names>SN</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Warnes</surname>
                            <given-names>G</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Scotton</surname>
                            <given-names>CJ</given-names>
                        </name>
</person-group>:
                    <article-title>Bio-electrosprayed living composite matrix implanted into mouse models.</article-title>
                    <source>

                        <italic toggle="yes">Macromol Biosci.</italic>
</source>
                    <year>2011</year>;<volume>11</volume>(<issue>10</issue>):<fpage>1364</fpage>&#x2013;<lpage>1369</lpage>.
                    <pub-id pub-id-type="pmid">21755598</pub-id>
                    <pub-id pub-id-type="doi">10.1002/mabi.201100131</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-25">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Joly</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jennings</surname>
                            <given-names>BH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jayasinghe</surname>
                            <given-names>SN</given-names>
                        </name>
</person-group>:
                    <article-title>Development and fertility studies on post-bio-electrosprayed 
                        <italic toggle="yes">Drosophila melanogaster</italic> embryos.</article-title>
                    <source>

                        <italic toggle="yes">Biomicrofluidics.</italic>
</source>
                    <year>2009</year>;<volume>3</volume>(<issue>4</issue>):<fpage>44107</fpage>.
                    <pub-id pub-id-type="pmid">20216969</pub-id>
                    <pub-id pub-id-type="doi">10.1063/1.3267044</pub-id>
                    <pub-id pub-id-type="pmcid">2835287</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-26">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Mongkoldhumrongkul</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Flanagan</surname>
                            <given-names>JM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jayasinghe</surname>
                            <given-names>SN</given-names>
                        </name>
</person-group>:
                    <article-title>Direct jetting approaches for handling stem cells.</article-title>
                    <source>

                        <italic toggle="yes">Biomed Mater.</italic>
</source>
                    <year>2009a</year>;<volume>4</volume>(<issue>1</issue>):<fpage>015018</fpage>.
                    <pub-id pub-id-type="pmid">19193972</pub-id>
                    <pub-id pub-id-type="doi">10.1088/1748-6041/4/1/015018</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-27">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Mongkoldhumrongkul</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Swain</surname>
                            <given-names>SC</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jayasinghe</surname>
                            <given-names>SN</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Bio-electrospraying the nematode 
                        <italic toggle="yes">Caenorhabditis elegans</italic>: studying whole-genome transcriptional responses and key life cycle parameters.</article-title>
                    <source>

                        <italic toggle="yes">J R Soc Interface.</italic>
</source>
                    <year>2010</year>;<volume>7</volume>(<issue>45</issue>):<fpage>595</fpage>&#x2013;<lpage>601</lpage>.
                    <pub-id pub-id-type="pmid">19776148</pub-id>
                    <pub-id pub-id-type="doi">10.1098/rsif.2009.0364</pub-id>
                    <pub-id pub-id-type="pmcid">2842783</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-28">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ning</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Betancourt</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Schreyer</surname>
                            <given-names>D</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Characterization of Cell Damage and Proliferative Ability during and after Bioprinting.</article-title>
                    <source>

                        <italic toggle="yes">ACS Biomater Sci Eng.</italic>
</source>
                    <year>2018</year>;<volume>4</volume>(<issue>11</issue>):<fpage>3906</fpage>&#x2013;<lpage>3918</lpage>.
                    <pub-id pub-id-type="doi">10.1021/acsbiomaterials.8b00714</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-29">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Pakes</surname>
                            <given-names>NK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jayasinghe</surname>
                            <given-names>SN</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Williams</surname>
                            <given-names>RS</given-names>
                        </name>
</person-group>:
                    <article-title>Bio-electrospraying and aerodynamically assisted bio-jetting the model eukaryotic 
                        <italic toggle="yes">Dictyostelium discoideum</italic>: assessing stress and developmental competency post treatment.</article-title>
                    <source>

                        <italic toggle="yes">J R Soc Interface.</italic>
</source>
                    <year>2011</year>;<volume>8</volume>(<issue>61</issue>):<fpage>1185</fpage>&#x2013;<lpage>1191</lpage>.
                    <pub-id pub-id-type="pmid">21288957</pub-id>
                    <pub-id pub-id-type="doi">10.1098/rsif.2010.0696</pub-id>
                    <pub-id pub-id-type="pmcid">3119884</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-30">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Poncelet</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>de Vos</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Suter</surname>
                            <given-names>N</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Bio-electrospraying and cell electrospinning: progress and opportunities for basic biology and clinical sciences.</article-title>
                    <source>

                        <italic toggle="yes">Adv Healthc Mater.</italic>
</source>
                    <year>2012</year>;<volume>1</volume>(<issue>1</issue>):<fpage>27</fpage>&#x2013;<lpage>34</lpage>.
                    <pub-id pub-id-type="pmid">23184685</pub-id>
                    <pub-id pub-id-type="doi">10.1002/adhm.201100001</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-31">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sahoo</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lee</surname>
                            <given-names>WC</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Goh</surname>
                            <given-names>JC</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Bio-electrospraying: A potentially safe technique for delivering progenitor cells.</article-title>
                    <source>

                        <italic toggle="yes">Biotechnol Bioeng.</italic>
</source>
                    <year>2010</year>;<volume>106</volume>(<issue>4</issue>):<fpage>690</fpage>&#x2013;<lpage>698</lpage>.
                    <pub-id pub-id-type="pmid">20229515</pub-id>
                    <pub-id pub-id-type="doi">10.1002/bit.22734</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-32">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Schindelin</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Arganda-Carreras</surname>
                            <given-names>I</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Frise</surname>
                            <given-names>E</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Fiji: an open-source platform for biological-image analysis.</article-title>
                    <source>

                        <italic toggle="yes">Nat Methods.</italic>
</source>
                    <year>2012</year>;<volume>9</volume>(<issue>7</issue>):<fpage>676</fpage>&#x2013;<lpage>682</lpage>.
                    <pub-id pub-id-type="pmid">22743772</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nmeth.2019</pub-id>
                    <pub-id pub-id-type="pmcid">3855844</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-33">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Somaa</surname>
                            <given-names>FA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>TY</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Niclis</surname>
                            <given-names>JC</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Peptide-Based Scaffolds Support Human Cortical Progenitor Graft Integration to Reduce Atrophy and Promote Functional Repair in a Model of Stroke.</article-title>
                    <source>

                        <italic toggle="yes">Cell Rep.</italic>
</source>
                    <year>2017</year>;<volume>20</volume>(<issue>8</issue>):<fpage>1964</fpage>&#x2013;<lpage>1977</lpage>.
                    <pub-id pub-id-type="pmid">28834757</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.celrep.2017.07.069</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-34">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sun</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Pollard</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Conti</surname>
                            <given-names>L</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Long-term tripotent differentiation capacity of human neural stem (NS) cells in adherent culture.</article-title>
                    <source>

                        <italic toggle="yes">Mol Cell Neurosci.</italic>
</source>
                    <year>2008</year>;<volume>38</volume>(<issue>2</issue>):<fpage>245</fpage>&#x2013;<lpage>258</lpage>.
                    <pub-id pub-id-type="pmid">18450476</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.mcn.2008.02.014</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-35">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Taylor</surname>
                            <given-names>AC</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Helenes Gonz&#x00e1;lez</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ferretti</surname>
                            <given-names>P</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Spontaneous differentiation of human neural stem cells on nanodiamond.</article-title>
                    <source>

                        <italic toggle="yes">Adv Biosyst.</italic>
</source>
                    <year>2019</year>;<volume>3</volume>(<issue>4</issue>):<fpage>1800299</fpage>.
                    <pub-id pub-id-type="doi">10.1002/adbi.201800299</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-36">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Tezera</surname>
                            <given-names>LB</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bielecka</surname>
                            <given-names>MK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Chancellor</surname>
                            <given-names>A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Dissection of the host-pathogen interaction in human tuberculosis using a bioengineered 3-dimensional model.</article-title>
                    <source>

                        <italic toggle="yes">eLife.</italic>
</source>
                    <year>2017</year>;<volume>6</volume>: pii: e21283.
                    <pub-id pub-id-type="pmid">28063256</pub-id>
                    <pub-id pub-id-type="doi">10.7554/eLife.21283</pub-id>
                    <pub-id pub-id-type="pmcid">5238961</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-37">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Traitcheva</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Berg</surname>
                            <given-names>H</given-names>
                        </name>
</person-group>:
                    <article-title>Electroporation and alternating current cause membrane permeation of photodynamic cytotoxins yielding necrosis and apoptosis of cancer cells.</article-title>
                    <source>

                        <italic toggle="yes">Bioelectrochemistry.</italic>
</source>
                    <year>2010</year>;<volume>79</volume>(<issue>2</issue>):<fpage>257</fpage>&#x2013;<lpage>260</lpage>.
                    <pub-id pub-id-type="pmid">20494629</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.bioelechem.2010.02.005</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-38">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>U</surname>
                            <given-names>KP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Subramanian</surname>
                            <given-names>V</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Nicholas</surname>
                            <given-names>AP</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Modulation of calcium-induced cell death in human neural stem cells by the novel peptidylarginine deiminase-AIF pathway.</article-title>
                    <source>

                        <italic toggle="yes">BBA Mol Cell Res.</italic>
</source>
                    <year>2014</year>;<volume>1843</volume>(<issue>6</issue>):<fpage>1162</fpage>&#x2013;<lpage>1171</lpage>.
                    <pub-id pub-id-type="pmid">24607566</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.bbamcr.2014.02.018</pub-id>
                    <pub-id pub-id-type="pmcid">3996523</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-39">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Vagaska</surname>
                            <given-names>B</given-names>
                        </name>

                        <name name-style="western">
                            <surname>New</surname>
                            <given-names>SE</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Alvarez-Gonz&#x00e1;lez</surname>
                            <given-names>C</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>MHC-class-II are expressed in a subpopulation of human neural stem cells 
                        <italic toggle="yes">in vitro</italic> in an IFN&#x03b3;-independent fashion and during development.</article-title>
                    <source>

                        <italic toggle="yes">Sci Rep.</italic>
</source>
                    <year>2016</year>;<volume>6</volume>:<fpage>24251</fpage>.
                    <pub-id pub-id-type="pmid">27080443</pub-id>
                    <pub-id pub-id-type="doi">10.1038/srep24251</pub-id>
                    <pub-id pub-id-type="pmcid">4832187</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-40">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Vishwakarma</surname>
                            <given-names>SK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bardia</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tiwari</surname>
                            <given-names>SK</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Current concept in neural regeneration research: NSCs isolation, characterization and transplantation in various neurodegenerative diseases and stroke: A review.</article-title>
                    <source>

                        <italic toggle="yes">J Adv Res.</italic>
</source>
                    <year>2014</year>;<volume>5</volume>(<issue>3</issue>):<fpage>277</fpage>&#x2013;<lpage>294</lpage>.
                    <pub-id pub-id-type="pmid">25685495</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.jare.2013.04.005</pub-id>
                    <pub-id pub-id-type="pmcid">4294738</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-41">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ye</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>He</surname>
                            <given-names>Z</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lin</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Bio-electrospraying is a safe technology for delivering human adipose-derived stem cells.</article-title>
                    <source>

                        <italic toggle="yes">Biotechnol Lett.</italic>
</source>
                    <year>2015</year>;<volume>37</volume>(<issue>2</issue>):<fpage>449</fpage>&#x2013;<lpage>456</lpage>.
                    <pub-id pub-id-type="pmid">25280732</pub-id>
                    <pub-id pub-id-type="doi">10.1007/s10529-014-1693-0</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report62499">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.21837.r62499</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Pranke</surname>
                        <given-names>Patricia</given-names>
                    </name>
                    <xref ref-type="aff" rid="r62499a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0003-4698-6314</uri>
                </contrib>
                <aff id="r62499a1">
                    <label>1</label>Hematology and Stem Cell Laboratory, Faculty of Pharmacy, Universidade Federal do Rio Grande do Sul (UFRGS), Porto Alegre, Brazil</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>22</day>
                <month>5</month>
                <year>2020</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2020 Pranke P</copyright-statement>
                <copyright-year>2020</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport62499" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.19901.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>The article analyzes the effect of the bio-electrospray (BES) technique on human neural stem cells (hNSCs). Although the BES provoked a decrease in hNSC metabolic activity, there was no increase in hNSC death. The differentiated assays were also successful, showing that the BES did not adversely affect the differentiation capacity of the hNSCs or their gene expression.</p>
            <p> The figures are very illustrative and very well executed.</p>
            <p> Please correct VERY instead of &#x201c;VEY well and could&#x2026;.&#x201d; In the line 1 on the second column of the Introduction.</p>
            <p> The paper is very well written and it could probably be indexed without additional revision.</p>
            <p> Having said that, there are a few minor errors which could be adjusted, but they are small details.</p>
            <p> I have 6 more additional examples if you need them.</p>
            <p> &#x00a0;In the Abstract:</p>
            <p> &#x201c;Bio-electrospray (BES) is a jet based&#x201d; &#x2013; change to &#x201c;Bio-electrospraying (BSE)&#x201d;</p>
            <p> &#x201c;&#x2026;has the ability to form...&#x201d; &#x2013; &#x201c;..has the ability of forming...&#x201d;</p>
            <p> &#x201c;...different hNSC lines..' &#x2013; '...a number of hNSC lines...&#x201d;</p>
            <p> &#x201c;...from which cells recovered...&#x201d; &#x2013; &#x201c;...from which the cells recovered...&#x201d;</p>
            <p> &#x201c;...as efficiently as controls&#x2026;&#x201d; &#x2013; &#x201c;...as efficiently as the controls&#x2026;&#x201d;</p>
            <p> &#x201c;...and oligodentocytes as shown by...&#x201d; &#x2013; &#x201c;...and oligodentrocytes, as shown by...&#x201d;</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Yes</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Tissue engineering and regenerative medicine - area of stem cell and nanotechnology (electrospinning mainly)</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
        <sub-article article-type="response" id="comment5617-62499">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Ferretti</surname>
                            <given-names>Patrizia</given-names>
                        </name>
                        <aff>UCL Great Ormond Street Institute of Child Health, UK</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No conflict of interest.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>15</day>
                    <month>6</month>
                    <year>2020</year>
                </pub-date>
            </front-stub>
            <body>
                <p>We thank you the Reviewer for their kind comments and useful suggestion which we have incorporated in the revised version of the manuscript.</p>
            </body>
        </sub-article>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report62498">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.21837.r62498</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Xie</surname>
                        <given-names>Jingwei</given-names>
                    </name>
                    <xref ref-type="aff" rid="r62498a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-8126-1397</uri>
                </contrib>
                <aff id="r62498a1">
                    <label>1</label>Department of Surgery&#x2010;Transplant and Mary and Dick Holland Regenerative Medicine Program, College of Medicine, University of Nebraska Medical Center, Omaha, NE, USA</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>11</day>
                <month>5</month>
                <year>2020</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2020 Xie J</copyright-statement>
                <copyright-year>2020</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport62498" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.19901.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>This work reports bioelectrospray of human neural stem cells and examines the survival, growth, and differentiation after bioelectrospray. This is an interesting work as bioelectrospray could be used to deposit human neural stem cells to form patterns for forming and studying complex neural tissue constructs. Overall, this work is satisfactory. However, authors should provide details of the bioelectrospray process. For example, how long for the process? In addition, the flow rate 250 ml/h seems too high. Please double check.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Yes</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>No source data required</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Electrospray, Biomaterials, Tissue Regeneration</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
        <sub-article article-type="response" id="comment5616-62498">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Ferretti</surname>
                            <given-names>Patrizia</given-names>
                        </name>
                        <aff>UCL Great Ormond Street Institute of Child Health, UK</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No conflict of interest.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>15</day>
                    <month>6</month>
                    <year>2020</year>
                </pub-date>
            </front-stub>
            <body>
                <p>We thank the Reviewer for this comment. It should be noted that this study focused on the initial&#x00a0;crucial question concerning cell viability and maintenance of differentiation capability after bioelectrospraying rather than on the formation&#x00a0;of the stable cone jet mode needed to obtain micro to nano-sized droplets. Hence, a high flow rate was used to evaluate cell viability when exposed to the&#x00a0;high voltage and needle constraints of BES. Because of the high flow rate, cells were subjected to the voltage for less than a minute. This study provides the foundation for the use&#x00a0;of hNSCs to&#x00a0;refine&#x00a0;the conditions&#x00a0;for achieving&#x00a0;a stable cone jet mode.&#x00a0;To this purpose,&#x00a0;flow rate adjustments, single or coaxial needle arrangement, and liquid properties mentioned will need to be analysed.</p>
            </body>
        </sub-article>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report62497">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.21837.r62497</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Davies</surname>
                        <given-names>Jamie A.</given-names>
                    </name>
                    <xref ref-type="aff" rid="r62497a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0001-6660-4032</uri>
                </contrib>
                <aff id="r62497a1">
                    <label>1</label>Deanery of Biomedical Sciences, University of Edinburgh, Edinburgh, UK</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>1</day>
                <month>5</month>
                <year>2020</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2020 Davies JA</copyright-statement>
                <copyright-year>2020</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport62497" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.19901.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>Overall, this study is a report of useful, incremental research. Previous reports, including some by the same lead author, have shown that a range of mammalian cells tolerate BES well. This report effectively says &#x201c;and so do hNSCs&#x201d;. Not a surprise (there was no obvious reason that the wouldn't) but a useful thing to know nevertheless.</p>
            <p> </p>
            <p> Specific comments:</p>
            <p> </p>
            <p> I liked your use of both transported and un-transported controls.</p>
            <p> </p>
            <p> In the methods, it would be helpful to have catalogue numbers of all of the biologics (growth factors etc), because these can be purchased in subtly different forms (native, recombinant, etc). Knowing the exact one helps the cause of reproducibility.</p>
            <p> </p>
            <p> In the first paragraph of the Introduction, 3 lines up, it would be helpful to know what BES conditions can be altered (otherwise it is hard to make the comparison with the less advantageous techniques mentioned in the subsequent sentence).</p>
            <p> </p>
            <p> Methods, 2
                <sup>nd</sup> paragraph, last line &#x2013; what is N2? If it is the culture supplement that ThermoFisher (and maybe others) sell, please give a reference or at least an explanation.</p>
            <p> </p>
            <p> Can you say more about the needle? (eg supplier code) and the field strength (you keep quoting 10kV, but not the distance over which this potential exists). Again, this is for reproducibility.</p>
            <p> </p>
            <p> It is also critical that you provide more information about the BES setup (distances etc); assuming this is one you have described in previous publications, you can just cite these publications. But without this information, nobody could reproduce this work.</p>
            <p> </p>
            <p> Strictly, the whole manuscript requires careful copy-editing to remove minor errors of punctuation and syntax, but these errors do not make the existing manuscript too hard to understand.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Yes</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>No</p>
            <p>Reviewer Expertise:</p>
            <p>Tissue engineering &amp; Synthetic Biology (but my reservations, which are purely about more methodological details being needed in places, do not depend on any deep expertise).</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
        <sub-article article-type="response" id="comment5615-62497">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Ferretti</surname>
                            <given-names>Patrizia</given-names>
                        </name>
                        <aff>UCL Great Ormond Street Institute of Child Health, UK</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No competoing interest.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>15</day>
                    <month>6</month>
                    <year>2020</year>
                </pub-date>
            </front-stub>
            <body>
                <p>We are grateful to the Reviewer for his helpful comments.&#x00a0;
                    <bold>&#x201c;</bold>In the methods, it would be helpful to have catalogue numbers of all of the biologics (growth factors etc), because these can be purchased in subtly different forms (native, recombinant, etc). Knowing the exact one helps the cause of reproducibility.&#x201d;</p>
                <p>This has been included, but please note that full information about a couple of reagents is still missing because we do not have access to it due to the current lockdown to control the Covid-19 pandemic.</p>
                <p>&#x201c;In the first paragraph of the Introduction, 3 lines up, it would be helpful to know what BES conditions can be altered (otherwise it is hard to make the comparison with the less advantageous techniques mentioned in the subsequent sentence).&#x201d;</p>
                <p>The configuration needed to obtain micro to nano-sized droplets, and a near mono-distribution can be achieved by adjusting BES conditions&#x00a0;to obtain a stable cone jet mode. The primary conditions to consider are viscosity and electrical conductivity of the sprayed liquid. Ideally, the cell-laden suspension should have high viscosity and low electrical conductivity. A coaxial arrangement with an outer needle carrying an encapsulating biomaterial and an inner needle carrying the cells in suspension could also be considered (Jayasinghe and Townsend-Nicholson, 2006).&#x00a0;This has now been specified.</p>
                <p>&#x00a0;&#x201c;Can you say more about the needle? (eg supplier code) and the field strength (you keep quoting&#x00a0;10kV, but not the distance over which this potential exists). Again, this is for reproducibility. It is also critical that you provide more information about the BES setup (distances etc); assuming this is one you have described in previous publications, you can just cite these publications. But without this information, nobody could reproduce this work.&#x201d;</p>
                <p>The needle used in these studies&#x00a0;are similar to those used in our previous studies
                    <sup>[x]</sup>, and is a standard straight cut hypodermic needle made of stainless steel. The field strength was 0.2kv/mm (10kv over 50mm) and a reference has been added: O'Neill HC, Maalouf WE, Harper JC, Jayasinghe SN. Bio-electrosprayed human sperm remain viable. 
                    <italic>Materials Today</italic>. 2019; 1;31:21-30.
                    <bold>&#x201c;</bold>
                </p>
            </body>
        </sub-article>
    </sub-article>
</article>
