<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="methods-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.23289.1</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Method Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>A non-fluorescent HaloTag blocker for improved measurement and visualization of protein synthesis in living cells</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 1; peer review: 2 approved]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Cohen</surname>
                        <given-names>Laurie D.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Boulos</surname>
                        <given-names>Ayub</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Ziv</surname>
                        <given-names>Noam E.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Resources</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0001-9197-326X</uri>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Faculty of Medicine, Rappaport Institute and Network Biology Research Laboratories, Technion - Israel Institute of Technology, Haifa, 32000, Israel</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:noamz@netvision.net.il">noamz@netvision.net.il</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>28</day>
                <month>4</month>
                <year>2020</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2020</year>
            </pub-date>
            <volume>9</volume>
            <elocation-id>ISF-302</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>20</day>
                    <month>4</month>
                    <year>2020</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2020 Cohen LD et al.</copyright-statement>
                <copyright-year>2020</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/9-302/pdf"/>
            <abstract>
                <p>
                    <bold>Background:</bold> HaloTag is a modified bacterial enzyme that binds rapidly and irreversibly to an array of synthetic ligands, including chemical dyes. When expressed in live cells in conjunction with a protein of interest, HaloTag can be used to study protein trafficking, synthesis, and degradation. For instance, sequential HaloTag labeling with spectrally separable dyes can be used to separate preexisting protein pools from proteins newly synthesized following experimental manipulations or the passage of time. Unfortunately, incomplete labeling by the first dye, or labeling by residual, trapped dye pools can confound interpretation.</p>
                <p>
                    <bold>Methods</bold>: Labeling specificity of newly synthesized proteins could be improved by blocking residual binding sites. To that end, we synthesized a non-fluorescent, cell permeable blocker (1-chloro-6-(2-propoxyethoxy)hexane; CPXH), essentially the HaloTag ligand backbone without the reactive amine used to attach fluorescent groups.</p>
                <p>
                    <bold>Results</bold>: High-content imaging was used to quantify the ability of CPXH to block HaloTag ligand binding in live HEK cells expressing a fusion protein of mTurquoise2 and HaloTag. Full saturation was observed at CPXH concentrations of 5-10 &#x00b5;M at 30 min. No overt effects on cell viability were observed at any concentration or treatment duration. The ability of CPXH to improve the reliability of newly synthesized protein detection was then demonstrated in live cortical neurons expressing the mTurquoise2-HaloTag fusion protein, in both single and dual labeling time lapse experiments. Practically no labeling was observed after blocking HaloTag binding sites with CPXH when protein synthesis was suppressed with cycloheximide, confirming the identification of newly synthesized protein copies as such, while providing estimates of protein synthesis suppression in these experiments.</p>
                <p>
                    <bold>Conclusions:</bold> CPXH is a reliable (and inexpensive) non-fluorescent ligand for improving assessment of protein-of-interest metabolism in live cells using HaloTag technology.</p>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>HaloTag</kwd>
                <kwd>Live Imaging</kwd>
                <kwd>Protein Synthesis</kwd>
            </kwd-group>
            <funding-group>
                <award-group id="fund-1" xlink:href="http://dx.doi.org/10.13039/501100001663">
                    <funding-source>Volkswagen Foundation</funding-source>
                    <award-id>ZN3455</award-id>
                </award-group>
                <award-group id="fund-2" xlink:href="http://dx.doi.org/10.13039/501100001736">
                    <funding-source>German-Israeli Foundation for Scientific Research and Development</funding-source>
                    <award-id>I-1437-418.13/2017</award-id>
                </award-group>
                <award-group id="fund-3" xlink:href="http://dx.doi.org/10.13039/501100003977">
                    <funding-source>Israel Science Foundation</funding-source>
                    <award-id>1470/18</award-id>
                </award-group>
                <award-group id="fund-4" xlink:href="http://dx.doi.org/10.13039/501100011835">
                    <funding-source>Nieders&#x00e4;chsischen Krebsgesellschaft</funding-source>
                    <award-id>ZN3455</award-id>
                </award-group>
                <funding-statement>This work was supported by funding from the Israel Science Foundation (grant no. 1470/18), The German Israeli Foundation for Research and Development (grant no. I-1437-418.13/2017), the state of Lower-Saxony and the Volkswagen Foundation, Hannover, Germany (grant no. ZN-3455), the Allen and Jewel Prince Center for Neurodegenerative Disorders of the Brain and the Rappaport Family Institute for Research in the Medical Sciences.</funding-statement>
                <funding-statement>
                    <italic>The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.</italic>
                </funding-statement>
            </funding-group>
        </article-meta>
    </front>
    <body>
        <sec sec-type="intro">
            <title>Introduction</title>
            <p>The 33 kDa HaloTag protein
                <sup>
                    <xref ref-type="bibr" rid="ref-1">1</xref>
                </sup> is a modified haloalkane dehalogenase enzyme which bonds covalently to a variety of synthetic ligands (reporters), including chemical dyes. HaloTag dyes do not suffer from some of the drawbacks of traditional fluorescent proteins such as slow tag maturation, tendency to oligomerize, and photoswitching artifacts
                <sup>
                    <xref ref-type="bibr" rid="ref-2">2</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-4">4</xref>
                </sup>. HaloTag fusion proteins can be followed in living cells or 
                <italic toggle="yes">in vivo</italic> for long time durations without label dissociation
                <sup>
                    <xref ref-type="bibr" rid="ref-1">1</xref>,
                    <xref ref-type="bibr" rid="ref-5">5</xref>
                </sup>. Thus, the HaloTag system represents an attractive method for studying protein localization, dynamics, trafficking, synthesis and degradation. Besides HaloTag, other labeling systems based on similar principles have been developed (e.g. SNAP tag, CLIP tag;
                <sup>
                    <xref ref-type="bibr" rid="ref-6">6</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-9">9</xref>
                </sup>). Compared to SNAP tag, however, the HaloTag system offers superior binding (e.g. 
                <xref ref-type="bibr" rid="ref-10">10</xref>&#x2013;
                <xref ref-type="bibr" rid="ref-12">12</xref>) and brightness
                <sup>
                    <xref ref-type="bibr" rid="ref-13">13</xref>
                </sup>. Moreover, a wide selection of bright, photostable, cell-permeable HaloTag compatible dyes with rapid labeling kinetics and low nonspecific staining (e.g. 
                <xref ref-type="bibr" rid="ref-14">14</xref>,
                <xref ref-type="bibr" rid="ref-15">15</xref>) is now available.</p>
            <p>Both the HaloTag
                <sup>
                    <xref ref-type="bibr" rid="ref-1">1</xref>,
                    <xref ref-type="bibr" rid="ref-4">4</xref>,
                    <xref ref-type="bibr" rid="ref-16">16</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-20">20</xref>
                </sup> and the SNAP tag
                <sup>
                    <xref ref-type="bibr" rid="ref-7">7</xref>,
                    <xref ref-type="bibr" rid="ref-21">21</xref>,
                    <xref ref-type="bibr" rid="ref-22">22</xref>
                </sup> systems have been used with spectrally distinct dyes to visualize newly synthesized proteins, to differentiate between populations of newly formed versus aged proteins, to follow proteins at different subcellular locations and to measure protein half-lifetimes
                <sup>
                    <xref ref-type="bibr" rid="ref-23">23</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-31">31</xref>
                </sup>. In such experiments, however, incomplete labeling &#x2013; that is, binding sites that remain dye-free, as well as fluorescence from residual unbound ligands &#x2013; represent significant confounds. Notably, ligands can remain in the cells even after multiple washes (due to slow efflux and reduced active clearance capability, especially in unhealthy cells or at low serum levels; Promega &#x201c;Focus on Imaging&#x201d; HaloTag protocol; see also 
                <xref ref-type="bibr" rid="ref-32">32</xref>). Moreover, in some cell types, such as cultured neurons, excessive washes can be detrimental
                <sup>
                    <xref ref-type="bibr" rid="ref-29">29</xref>,
                    <xref ref-type="bibr" rid="ref-33">33</xref>
                </sup>. Saturation of binding sites can be realized by applying fluorescent ligands in large excess (e.g. 
                <xref ref-type="bibr" rid="ref-34">34</xref>) or Succinimidyl Ester ligands after masking their reactive groups
                <sup>
                    <xref ref-type="bibr" rid="ref-32">32</xref>
                </sup>. This, however, is costly and can introduce other problems, such as the nonspecific labeling mentioned above and even cell toxicity.</p>
            <p>Incomplete binding presents a particularly problematic confound when attempting to identify newly synthesized copies of tagged proteins of interest or measure their turnover. Thus for example, 15% unlabeled binding sites, for a protein with a half-life of 5 days, labeled a second time after 24 hours can lead to an erroneous half-life estimate of ~2.5 days, not to mention the misidentification of about half of newly labeled proteins as newly synthesized ones. This confound can be avoided almost entirely by using highly specific, non-fluorescent reagents for blocking residual unbound sites.</p>
            <p>Affordable nonfluorescent blockers
                <sup>
                    <xref ref-type="bibr" rid="ref-9">9</xref>,
                    <xref ref-type="bibr" rid="ref-22">22</xref>
                </sup> are available for the SNAP tag system. Until most recently, however, there has been a paucity of affordable, nonfluorescent HaloTag compatible blockers. Solutions based on commercially available ligands tend to be costly
                <sup>
                    <xref ref-type="bibr" rid="ref-32">32</xref>,
                    <xref ref-type="bibr" rid="ref-35">35</xref>
                </sup> and may not cross the cell membrane efficiently
                <sup>
                    <xref ref-type="bibr" rid="ref-36">36</xref>
                </sup>.</p>
            <p>In this study we present an inexpensive, non-fluorescent, cell-permeable HaloTag blocker, 1-chloro-6-(2-propoxyethoxy)hexane, which is well-tolerated both in cell lines and in primary neuronal cultures, and demonstrate its application for following newly synthesized protein using single and dual-color HaloTag labeling.</p>
            <p>In the course of this study, four other nonfluorescent compounds were screened as potential HaloTag compatible blockers, of which 7-bromoheptanol was selected as a preferred reagent
                <sup>
                    <xref ref-type="bibr" rid="ref-37">37</xref>
                </sup>. We nevertheless present our findings, in which the characteristics of our alternative blocking reagent and its utility for following protein synthesis in live cells are described, with the hope that it will prove to be useful as well.</p>
            <p>All raw images and quantifications are available as 
                <italic toggle="yes">Underlying data</italic>
                <sup>
                    <xref ref-type="bibr" rid="ref-38">38</xref>
                </sup>.</p>
        </sec>
        <sec sec-type="results">
            <title>Results</title>
            <sec>
                <title>A fusion protein for quantifying HaloTag blocking efficacy in living cells</title>
                <p>In order to quantify blocking efficacy in living cells, a method was needed to estimate the abundance of HaloTag binding sites (total &#x2013; free and bound) in individual cells. We reasoned that reporter proteins containing one HaloTag binding site and one copy of a fluorescent protein (FP) would be useful in this regard, as this would allow normalization of HaloTag ligand fluorescence to FP fluorescence and thus calculation of fractional HaloTag labeling values, independent of fusion protein expression levels. To that end, we created a fusion protein of HaloTag and the fluorescent protein mTurquoise2
                    <sup>
                        <xref ref-type="bibr" rid="ref-39">39</xref>
                    </sup> encoded as a single polypeptide (HaloTag-mTurq2; 
                    <xref ref-type="fig" rid="f1">Figure 1A</xref>). The DNA coding for the fusion protein was inserted into a third generation lentivirus backbone to allow lentivirus-based expression as well as transfection-based methods (see 
                    <italic toggle="yes">Methods</italic>). As shown in 
                    <xref ref-type="fig" rid="f1">Figure 1B</xref>, expression of this construct (in rat cortical neurons in culture, in this case) allowed us to simultaneously measure HaloTag ligand binding (Janelia Fluor JF635HT
                    <sup>
                        <xref ref-type="bibr" rid="ref-15">15</xref>
                    </sup>; a generous gift from Jonathan Grimm and Luke Lavis, Janelia Research Campus) and FP fluorescence in individual cells. As might be expected, no JF635HT binding was observed in neighboring cells devoid of mTurq2 fluorescence, suggesting that HaloTag ligand binding was highly specific. In our hands, neurons expressing HaloTag-mTurq2 could be imaged for many hours (&gt;15) without noticeable toxicity, damage, or negative effects on cell morphology. This fusion construct was thus used in subsequent experiments to quantify the fractional degree of HaloTag ligand binding in live cells.</p>
                <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                    <label>Figure 1. </label>
                    <caption>
                        <title>A fusion protein for studying HaloTag labeling and blocker efficacy.</title>
                        <p>(
                            <bold>A</bold>) A lentivirus-based construct for expressing a HaloTag-mTurquoise2 fusion protein in living cells. UBC = Homo sapiens ubiquitin C; WPRE = woodchuck hepatitis virus posttranscriptional regulatory element. (
                            <bold>B</bold>) A cortical neuron in primary culture (17 days in culture) expressing the HaloTag-mTurq2 fusion protein, before (left) and after (right) labeling with JF635HT ligand (100nM, 1 hour). Bar, 20&#x00b5;m.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/25710/f4a2d6ba-69a7-456e-9d5a-3891df3bfe0a_figure1.gif"/>
                </fig>
            </sec>
            <sec>
                <title>Synthesis and efficacy of a non-fluorescent HaloTag blocker</title>
                <p>Most HaloTag ligands are based on a chlorinated alkyl chain with a reactive group for attaching fluorescent probes on the opposite side. Here, we synthesized the same ligand without the reactive group, reasoning that its binding properties would be similar but its ability to move across cell membranes improved, and its non-specific reactivity reduced, by the removal of the terminal polar amine group. The resulting molecule {(1-chloro-6-(2-propoxyethoxy)hexane; CID 63684368)} referred to here as CPXH is shown in 
                    <xref ref-type="fig" rid="f2">Figure 2A</xref>.</p>
                <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                    <label>Figure 2. </label>
                    <caption>
                        <title>Blocking efficacy of CPXH.</title>
                        <p>(
                            <bold>A</bold>) Chemical structure of CPXH {1-chloro-6-(2-propoxyethoxy)hexane}, the non-fluorescent, cell-permeable HaloTag blocker tested in this study. (
                            <bold>B</bold>) Testing CPXH blocking efficacy. HaloTag-mTurq2 was expressed in HEK293 cells growing in 96 well plates. The cells were treated with 0.01, 0.1 ,1 ,5, or 10 &#x00b5;M CPXH, or carrier solution (0.1% DMSO in cell culture media), for 10, 30, 60, 90, or 120 minutes (all combinations of concentration and duration). The cells were washed with cell culture media and labeled with JF635HT (100nM for 30 minutes). The cells were then washed with HBSS and imaged. Imaging was carried out on an automated high-content imaging system, providing reads from &gt;10,000 cells per concentration and time point per experiment (2 separate experiments). Note that cells at t=0 were treated with CPXH and washed immediately, and were thus exposed to the blocker for anywhere between a few seconds and a minute. (
                            <bold>C</bold>) Representative images of JF635HT labeling in mTurq2-positive HEK293 cells. Cells were exposed to CPXH (or carrier solution) at indicated concentrations and durations. Bar, 50&#x00b5;m. (
                            <bold>D</bold>) JF635HT / mTurq2 (background-corrected) fluorescence ratios at the CPXH concentrations and incubation times tested. Only fields of view with at least 90 mTurq2 positive cells were included (8 to 16 fields of view per condition, two separate experiments). Error bars represent SEM of fields of view.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/25710/f4a2d6ba-69a7-456e-9d5a-3891df3bfe0a_figure2.gif"/>
                </fig>
                <p>To test the efficacy of CPXH as a non-fluorescent HaloTag blocker, and characterize its useful concentrations and blocking kinetics, we expressed HaloTag-mTurq2 in HEK293 cells, and treated the cells with 0.01, 0.1, 1, 5, or 10 &#x00b5;M of CPXH, or carrier solution, for 10, 30, 60, 90, or 120 minutes (all combinations of treatment durations and concentrations). The cells were then washed and labeled with JF635HT at a final concentration of 100 nM for 30 minutes (
                    <xref ref-type="fig" rid="f2">Figure 2B</xref>). Imaging was carried out on an automated high-content imaging system, providing reads from &gt;10,000 cells per concentration and time point per experiment (two separate experiments). Background corrected JF635HT/mTurq2 fluorescence ratios were then calculated for all concentrations and durations. As shown in 
                    <xref ref-type="fig" rid="f2">Figure 2C, D</xref>, 30-minute exposures to 5 or 10 &#x00b5;M CPXH completely prevented labeling with JF635HT, suggesting saturation of practically all HaloTag binding sites. Nearly full saturation was also attained following exposure to 1 &#x00b5;M CPXH for 120 min.</p>
                <p>To examine the potential cytotoxicity of CPXH, HEK293 cells were treated with CPXH at a concentration of 0.01, 0.1, 1, 5, or 10 &#x00b5;M or carrier solution, for 10, 30, 60, 90, or 120 minutes and cell viability was tested using a Live/Dead assay (see 
                    <italic toggle="yes">Methods</italic>) and high-content screening microscopy. Cell death was found to be negligible at all concentrations and treatment durations tested (0.89&#x00b1;0.44%, average &#x00b1; standard deviation; maximum ~2% cell death) with no dependence whatsoever on CPXH concentration or exposure duration. Furthermore, in networks of rat cortical neurons grown on multielectrode arrays
                    <sup>
                        <xref ref-type="bibr" rid="ref-40">40</xref>
                    </sup>, levels of spontaneous network activity - a sensitive measure of neuronal viability - did not decline following chronic exposure to 10 &#x00b5;M CPXH for 18 and 47 hours (two experiments; see 
                    <italic toggle="yes">Underlying data</italic>
                    <sup>
                        <xref ref-type="bibr" rid="ref-38">38</xref>
                    </sup>). These findings suggest that CPXH is a non-toxic, efficient blocker of HaloTag binding sites.</p>
            </sec>
            <sec>
                <title>Using HaloTag and CPXH to follow newly synthesized proteins</title>
                <p>An exciting application of HaloTag technology concerns the labeling of newly synthesized copies of proteins of interest and following their fates thereafter. As explained in the Introduction, correct interpretation of such experiments necessitates the complete labeling of all HaloTag binding sites in preexisting protein copies. In preliminary experiments, and in agreement with prior studies
                    <sup>
                        <xref ref-type="bibr" rid="ref-32">32</xref>,
                        <xref ref-type="bibr" rid="ref-37">37</xref>
                    </sup> we noted that applying a second fluorescent HaloTag ligand (Oregon Green, Promega, or JF635HT) immediately following apparently saturating labeling with a first ligand (JF635HT or Oregon Green, Promega) still resulted in significant labeling with the second ligand, indicating incomplete saturation of HaloTag binding sites, as exemplified in 
                    <xref ref-type="fig" rid="f3">Figure 3</xref>.</p>
                <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                    <label>Figure 3. </label>
                    <caption>
                        <title>Significant residual free binding sites after conventional labeling with fluorescent HaloTag ligand.</title>
                        <p>(
                            <bold>A</bold>) mTurq2-positive neurons in cell culture were labeled with Oregon Green HaloTag ligand (Promega 100nM, 1 hour), washed, and labeled immediately with JF635HT ligand. (
                            <bold>B</bold>) Applying JF635HT resulted in significant labeling, indicating incomplete saturation of HaloTag binding sites. JF635HT labeling occurred also when using a 10-fold higher concentration of Oregon Green (Promega 1 &#x00b5;M, 1hour; not shown). Bar, 20&#x00b5;m.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/25710/f4a2d6ba-69a7-456e-9d5a-3891df3bfe0a_figure3.gif"/>
                </fig>
                <p>As a proof of principle, we examined whether unambiguous identification of newly synthesized proteins would be facilitated by using CPXH to block residual binding sites. To that end, we performed single and dual-labeling time-lapse experiments of neurons expressing HaloTag-mTurq2, using CPXH to block residual binding sites before applying the (second) label. In the first set of experiments (
                    <xref ref-type="fig" rid="f4">Figure 4</xref> and 
                    <xref ref-type="fig" rid="f5">Figure 5</xref>), neurons expressing HaloTag-mTurq2 were first treated with CPXH (10 &#x00b5;M) for 30 minutes. The cells were then washed, JF635HT was added to the cell culture media (without washing it out) and the cells were followed by time-lapse imaging for &gt;12 hours. In a second set (
                    <xref ref-type="fig" rid="f6">Figure 6</xref>), blocking with CPXH was preceded by labeling with Oregon Green ligand (Promega). Changes in JF635HT (and Oregon Green) labeling over time were quantified by measuring, on a cell-by-cell basis, the ratio of JF635HT (or Oregon Green) to mTurq2 fluorescence in mTurq2-positive cells. To correct for nonspecific label accumulation, fluorescence values in neighboring mTurq2-negative cells were obtained at each time point and subtracted from JF635HT / Oregon Green fluorescence in mTurq2-positive cells. As shown in 
                    <xref ref-type="fig" rid="f4">Figure 4C</xref>, 
                    <xref ref-type="fig" rid="f5">Figure 5C</xref> and 
                    <xref ref-type="fig" rid="f6">Figure 6C</xref>, initial JF635HT labeling was negligible; with time, however, JF635HT fluorescence gradually increased, probably reflecting the labeling of newly synthesized HaloTag-mTurq2 copies. This was observed for cell bodies and dendrites (
                    <xref ref-type="fig" rid="f4">Figure 4</xref> and 
                    <xref ref-type="fig" rid="f6">Figure 6</xref>) as well as distal axon &#x2018;beds&#x2019; (
                    <xref ref-type="fig" rid="f5">Figure 5</xref>), albeit at slower rates, as might be expected for newly synthesized protein copies delivered from remote somatic protein synthesis facilities. Interestingly, we noted that labeling with Oregon Green ligand was associated with strong, non-specific labeling that washed out relatively slowly. In contrast, very low levels of non-specific JF635HT labeling were observed even after prolonged periods in the presence of this ligand.</p>
                <fig fig-type="figure" id="f4" orientation="portrait" position="float">
                    <label>Figure 4. </label>
                    <caption>
                        <title>CPXH improves the reliability of newly synthesized protein detection in living cells.</title>
                        <p>(
                            <bold>A</bold>) Neurons expressing HaloTag-mTurq2 were first treated with CPXH (10 &#x00b5;M) for 30 minutes. The cells were then washed, followed by addition of JF635HT to the cell culture media (100nM, without washing it out), and the cells were followed by time-lapse imaging. (
                            <bold>B</bold>) Example of mTurq2-positive cortical neuron (17 days in culture) treated as described in A and followed by time lapse imaging. Bar, 20&#x00b5;m. (
                            <bold>C</bold>) Changes in JF635HT labeling over time were quantified by measuring, on a cell-by-cell basis, the ratio of JF635HT to mTurq2 fluorescence in mTurq2-positive cells. Background corrected JF635HT/mTurq2 fluorescence ratios for three different neurons are shown. Images in B belong to Cell 1. Note the negligible labeling immediately after exposure to JF635HT (compare with 
                            <xref ref-type="fig" rid="f3">Figure 3B</xref>).</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/25710/f4a2d6ba-69a7-456e-9d5a-3891df3bfe0a_figure4.gif"/>
                </fig>
                <fig fig-type="figure" id="f5" orientation="portrait" position="float">
                    <label>Figure 5. </label>
                    <caption>
                        <title>CPXH improves the reliability of newly synthesized protein detection in axons of living neurons.</title>
                        <p>(
                            <bold>A</bold>) Imaging of axon &#x2018;beds&#x2019; belonging to neurons expressing HaloTag-mTurq2. Neurons were treated as in 
                            <xref ref-type="fig" rid="f4">Figure 4</xref>. (
                            <bold>B</bold>) Example of axon bed belonging to mTurq2-positive cortical neuron(s). Bar, 20 &#x00b5;m. (
                            <bold>C</bold>) Gradual changes in JF635HT labeling over time in axons enclosed in the yellow rectangle in B. Note the negligible labeling immediately after exposure to JF635HT. Bar, 10 &#x00b5;m. (
                            <bold>D</bold>) ratio of JF635HT to mTurq2 fluorescence in mTurq2-positive axons (average of 10 regions per field of view). Background corrected JF635HT/mTurq2 fluorescence ratios for three different axon beds are shown. Images in (
                            <bold>B</bold>) and (
                            <bold>C</bold>) belong to Region 1. Note the slow increase in JF635HT fluorescence, as might be expected in cellular regions at significant distance from the neurons&#x2019; major sites of protein synthesis (i.e., the cell bodies).</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/25710/f4a2d6ba-69a7-456e-9d5a-3891df3bfe0a_figure5.gif"/>
                </fig>
                <fig fig-type="figure" id="f6" orientation="portrait" position="float">
                    <label>Figure 6. </label>
                    <caption>
                        <title>Dual-color labeling time-lapse of neurons expressing HaloTag-mTurq2.</title>
                        <p>(
                            <bold>A</bold>) Neurons expressing HaloTag-mTurq2 were labeled with Oregon Green ligand (Promega 1 &#x00b5;M, 30 min), washed, and blocked with CPXH (10 &#x00b5;M) for 30 minutes. The cells were then washed and labeled with JF635HT and followed by time-lapse imaging. (
                            <bold>B</bold>) Example of mTurq2-positive cortical neuron (14 days in culture) treated as described in A and followed by time lapse imaging. Bar, 20&#x00b5;m. (
                            <bold>C</bold>) Changes in JF635HT, and (
                            <bold>D</bold>) Oregon Green labeling over time were quantified by measuring, on a cell-by-cell basis, the ratio of JF635HT (or Oregon Green) to mTurq2 fluorescence in mTurq2-positive cells. Background corrected fluorescence ratios for three neurons are shown. Images in B belong to Cell 1.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/25710/f4a2d6ba-69a7-456e-9d5a-3891df3bfe0a_figure6.gif"/>
                </fig>
                <p>These experiments thus suggest that CPXH can greatly facilitate unambiguous identification of newly synthesized proteins in live cells and through continuous HaloTag labeling.</p>
            </sec>
            <sec>
                <title>Labeling following CPXH blocking when protein synthesis is suppressed</title>
                <p>The accumulation of JF635HT in the experiments of 
                    <xref ref-type="fig" rid="f4">Figure 4</xref>&#x2013;
                    <xref ref-type="fig" rid="f6">Figure 6</xref> presumably reflected the accumulation of newly synthesized HaloTag-mTurq2. To validate this assumption, we examined JF635HT labeling after cells were blocked with CPXH and then exposed to the potent protein synthesis inhibitor cycloheximide (CHX; 100 &#x00b5;g/ml). Specifically, cortical neurons expressing HaloTag-mTurq2 were treated with CPXH as described above. The cells were then washed and exposed to CHX or carrier solution for 24 hours, followed by JF635HT labeling. As shown in 
                    <xref ref-type="fig" rid="f7">Figure 7</xref>, practically no labeling was observed following the 24-hour exposure to CHX; In fact, quantification revealed a nearly 40-fold reduction in labeling intensity (
                    <xref ref-type="fig" rid="f7">Figure 7C</xref>). These findings support the aforementioned presumption, and, at the same time, provide a quantitative assessment of protein synthesis suppression by CHX in these preparations.</p>
                <fig fig-type="figure" id="f7" orientation="portrait" position="float">
                    <label>Figure 7. </label>
                    <caption>
                        <title>Proteins labeled with fluorescent HaloTag ligands following CPXH blocking reflect newly synthesized protein copies.</title>
                        <p>(
                            <bold>A</bold>) Cortical neurons expressing HaloTag-mTurq2 were treated with CPXH. The cells were washed and thereafter exposed to cycloheximide (CHX) or carrier solution (0.1% DMSO in cell culture media) for 24 hours, followed by JF635HT labeling. (
                            <bold>B</bold>) JF635HT labeling in two such neurons (left: 24-hour CHX; right: 24-hour carrier solution). Scale bar 20&#x00b5;m. (
                            <bold>C</bold>) 24-hour protein synthesis suppression resulted in a nearly 40-fold (39.2) reduction in JF635HT labeling intensity. There were 81 and 178 neurons, CHX and carrier solutions, respectively, 4 replicates per condition from 2 separate experiments. Average + SEM, t-test assuming unequal variances.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/25710/f4a2d6ba-69a7-456e-9d5a-3891df3bfe0a_figure7.gif"/>
                </fig>
            </sec>
        </sec>
        <sec sec-type="discussion | conclusions">
            <title>Discussion and conclusions</title>
            <p>The findings described above suggest that CPXH is a potent non-fluorescent, cell-permeable, and non-toxic HaloTag ligand. We first characterized its blocking kinetics and their dependence on CPXH concentration. We then demonstrated that CPXH can improve the fidelity of experiments aimed at following newly synthesized proteins in living cells. Finally, we show how this blocker might be useful for quantifying protein synthesis inhibitor efficacy in living cells.</p>
            <p>A recent study
                <sup>
                    <xref ref-type="bibr" rid="ref-37">37</xref>
                </sup> identified 7-bromoheptanol as an alternative low-toxicity HaloTag-blocking agent, and demonstrated its usefulness for measuring protein turnover at the population and single cell level. The authors suggested that this agent could be potentially used for estimating the synthesis rate of proteins of interest within individual cells. The experiments shown here (
                <xref ref-type="fig" rid="f4">Figure 4</xref>&#x2013;
                <xref ref-type="fig" rid="f6">Figure 6</xref>) confirm this suggestion. Moreover, the use of the HaloTag-mTurq2 fusion protein in our experiments provided confidence that the gradual labeling observed over time in mTurq2-positive cells reflected 
                <italic toggle="yes">bona-fide</italic> HaloTag labeling, and not, e.g., non-specific accumulation of labels in cells, while providing means for normalizing HaloTag labeling to total numbers of HaloTag binding sites. We note that normalization to mTurq2 levels in such experiments might be somewhat imperfect, as new mTurq2 is synthesized alongside new HaloTag binding sites. Yet at least at initial time points, the contribution of newly synthesized mTurq2 to total mTurq2 fluorescence is probably insignificant, even less so if total HaloTag-mTurq2 levels remain more or less constant.</p>
            <p>The cell entry, binding kinetics and affinity of CPXH were not compared here to those of 7-bromoheptanol and thus their advantages and disadvantages with respect to each other remain unknown. Given that the structure of CPXH is essentially identical to the backbone of most HaloTag ligands, it might be expected to be as affine and effective as the commonly used fluorescent ligands themselves. Hopefully, future studies will provide further information on these and other agents that optimize the utility of HaloTags and their like.</p>
        </sec>
        <sec sec-type="methods">
            <title>Methods</title>
            <sec>
                <title>Nonfluorescent HaloTag blocker CPXH</title>
                <p>HaloTag blocker 1-chloro-6-(2-propoxyethoxy)hexane (CID 63684368) was synthesized at our request by AKos Consulting &amp; Solutions, GmbH. The dry material was dissolved in DMSO to prepare a 10 mM stock solution, which was stored in small aliquots at -20&#x00b0;C until used.</p>
            </sec>
            <sec>
                <title>HaloTag-mTurquoise2 construct</title>
                <p>FU-HaloTag-mTurq2-Wm was generated based on FU-PSD95-mTurq2-Wm
                    <sup>
                        <xref ref-type="bibr" rid="ref-41">41</xref>
                    </sup>. Briefly, AgeI-HaloTag-XhoI (911 bp; sequence below) was synthesized 
                    <italic toggle="yes">de novo</italic> based on the Halotag sequence from Promega pFN23A HaloTag&#x00ae; CMVd2 Flexi&#x00ae; Vector, 9PIG286 (
                    <ext-link ext-link-type="uri" xlink:href="https://worldwide.promega.com/-/media/files/vector-sequences/flexi/pfn23a.txt">https://worldwide.promega.com/-/media/files/vector-sequences/flexi/pfn23a.txt</ext-link>). FU-PSD95-mTurq2-Wm was cut with AgeI and XhoI and the PSD-95 segment was removed, replaced by AgeI-HaloTag-XhoI and ligated to obtain FU-HaloTag-Turq2-Wm. Cloning and custom gene synthesis was done by Genscript (Piscataway NJ, US). Positioning the HaloTag at the N-terminus was based on the literature (e.g. 
                    <xref ref-type="bibr" rid="ref-42">42</xref>) and on the structure of the protein of interest.</p>
                <p>AgeI-HaloTag-XhoI:</p>
                <p>ACCGGTCGCCACCATGGCAGAAATCGGTACTGGCTTTCCATTCGACCCCCATTATGTGGAAGTCCTGGGCGAGCGCATGCACTACGTCGATGTTGGTCCGCGCGATGGCACCCCTGTGCTGTTCCTGCACGGTAACCCGACCTCCTCCTACGTGTGGCGCAACATCATCCCGCATGTTGCACCGACCCATCGCTGCATTGCTCCAGACCTGATCGGTATGGGCAAATCCGACAAACCAGACCTGGGTTATTTCTTCGACGACCACGTCCGCTTCATGGATGCCTTCATCGAAGCCCTGGGTCTGGAAGAGGTCGTCCTGGTCATTCACGACTGGGGCTCCGCTCTGGGTTTCCACTGGGCCAAGCGCAATCCAGAGCGCGTCAAAGGTATTGCATTTATGGAGTTCATCCGCCCTATCCCGACCTGGGACGAATGGCCAGAATTTGCCCGCGAGACCTTCCAGGCCTTCCGCACCACCGACGTCGGCCGCAAGCTGATCATCGATCAGAACGTTTTTATCGAGGGTACGCTGCCGATGGGTGTCGTCCGCCCGCTGACTGAAGTCGAGATGGACCATTACCGCGAGCCGTTCCTGAATCCTGTTGACCGCGAGCCACTGTGGCGCTTCCCAAACGAGCTGCCAATCGCCGGTGAGCCAGCGAACATCGTCGCGCTGGTCGAAGAATACATGGACTGGCTGCACCAGTCCCCTGTCCCGAAGCTGCTGTTCTGGGGCACCCCAGGCGTTCTGATCCCACCGGCCGAAGCCGCTCGCCTGGCCAAAAGCCTGCCTAACTGCAAGGCTGTGGACATCGGCCCGGGTCTGAATCTGCTGCAAGAAGACAACCCGGACCTGATCGGCAGCGAGATCGCGCGCTGGCTGTCGACGCTGGAGATTTCCGGCGCTCGAG</p>
            </sec>
            <sec>
                <title>HaloTag ligands</title>
                <p>Janelia Fluor 635 HaloTag ligand (JF635HT
                    <sup>
                        <xref ref-type="bibr" rid="ref-15">15</xref>
                    </sup>; 100 nM) was incubated for 30 minutes (or 1 hour; experiment of 
                    <xref ref-type="fig" rid="f3">Figure 3</xref>) at 37&#x00b0;C, 5% CO
                    <sub>2</sub>. Oregon Green cell permeable ligand (100nM for 1 hour / 1 &#x00b5;M for 30 minutes; experiments of 
                    <xref ref-type="fig" rid="f3">Figure 3</xref> and 
                    <xref ref-type="fig" rid="f6">Figure 6</xref>, respectively; Promega) was applied at 37&#x00b0;C, 5% CO
                    <sub>2</sub>, then repeatedly washed to remove unbound ligand.</p>
            </sec>
            <sec>
                <title>Cell lines</title>
                <p>HEK293 cells were grown in DMEM supplemented with 10% FBS at 37&#x00b0;C, 5% CO
                    <sub>2</sub>. The cells were transfected with HaloTag-mTurq2 using Calfectin (Signagen) transfection according to the manufacturer&#x2019;s protocol. In brief, one hour before transfection the media was replaced with complete medium with serum and antibiotics. HaloTag-mTurq2 DNA was diluted in serum-free, high glucose DMEM. Calfectin reagent was added to the tube, and pipetted 3&#x2013;4 times to mix. The mixture was incubated for 10&#x2013;15 minutes, and applied dropwise to the cells. The plate was swirled gently to mix and returned to the incubator. At 12&#x2013;18 hours following transfection the media was replaced with fresh culture media. HEK293 cells were reseeded into 96-well glass-bottom microplates (&#x00b5;Clear, Black; Greiner) 24 hours after transfection (20k cells per well). At 24 hours after reseeding, the cells were washed twice in Hanks Balanced Salt Solution (HBSS).</p>
            </sec>
            <sec>
                <title>Primary cultures of rat cortical neurons</title>
                <p>Primary cultures of rat cortical neurons were prepared as described previously
                    <sup>
                        <xref ref-type="bibr" rid="ref-43">43</xref>
                    </sup> using a protocol approved by the Technion committee for the supervision of animal experiments (IL-116-08-71). Briefly, cortices of two 1-2-day-old Wistar rats of either sex (Charles River, UK) were dissected following rapid decapitation, dissociated by trypsin treatment followed by trituration using a siliconized Pasteur pipette, and plated onto 22&#x00d7;22 mm coverslips coated with polyethylenimine (Sigma) inside 8-mm-diameter glass cylinder microwells (Bellco Glass). Cells were initially grown in medium containing Minimum Essential Medium (MEM; Sigma), 25 mg/l insulin (Sigma), 20 mM glucose (Sigma), 2 mM L-glutamine (Sigma), 11 mg/l gentamycin sulfate (Sigma), and 10% NuSerum (Becton Dickinson Labware). The preparation was then transferred to a humidified tissue culture incubator and maintained at 37&#x00b0;C in a 95% air and 5% CO
                    <sub>2</sub> mixture. Half the volume of the culture medium was replaced every 7 days with cell culture medium similar to the medium described above but devoid of NuSerum, containing a lower concentration of L-glutamine (Sigma, 0.5 mM), and 2% B-27 supplement (Gibco). Neurons used in these experiments came from approximately 20 separate preparations. HaloTag-mTurq2 DNA was expressed by calcium phosphate transfection, or by addition of HaloTag-mTurq2 lentiviral particles to the neuronal cultures (as detailed below).</p>
            </sec>
            <sec>
                <title>Calcium phosphate transfection</title>
                <p>Cortical neurons were transfected with HaloTag-mTurq2 by calcium phosphate transfection 9&#x2013;11 days after plating, as described previously
                    <sup>
                        <xref ref-type="bibr" rid="ref-44">44</xref>
                    </sup>. Neurons were imaged within the cloning cylinders 14&#x2013;21 days after plating, in the cell culture media.</p>
            </sec>
            <sec>
                <title>Lentivirus production and lentiviral transduction</title>
                <p>HaloTag&#x2013;mTurq2 lentiviral particles were produced in house using a commercially available kit (ViraPower&#x2122;, ThermoFisher Scientific). Briefly, 80%-confluent HEK293T cells were transfected using Lipofectamine 2000 (Invitrogen) with a mixture of three Virapower kit packaging plasmids (pLP1, pLP2, pLP/VSVG), and the expression vector. Lentiviral stocks were prepared by collecting the supernatant 48 hours after transfection, filtering by a 0.45-&#x03bc;m filter, and storing the liquid in small aliquots at -80&#x00b0;C. To express the DNA in cultures of neuronal cells, 4 days after plating the neurons, 1.5 &#x03bc;l of HaloTag-mTurq2 virus were added to each of the cortical neuronal cultures. Neurons were imaged within the cloning cylinders 14&#x2013;21 days after plating, in the cell culture media.</p>
            </sec>
            <sec>
                <title>Protein synthesis inhibition experiments</title>
                <p>Experiments were carried out on neurons grown in culture for 2.5 to 3 weeks. The original cell culture media was set aside and CPXH was applied for 30 minutes (10 &#x00b5;M in cell culture media). The cells were then washed three times in cell culture media and the original media was returned. Cycloheximide (100 &#x00b5;g/ml, Sigma) or carrier solution was then applied and the cells were returned to a 37&#x00b0;C, 5% CO
                    <sub>2</sub> incubator. 24 hours later, JF635HT was added to the cells for 30 minutes, and the cells were imaged immediately.</p>
            </sec>
            <sec>
                <title>Cell viability testing</title>
                <p>Propidium Iodide and NucBlue Live reagent (Hoechst 33342) staining (ReadyProbes Cell Viability Imaging Kit Blue/Red; Thermo) were applied according to the manufacturer&#x2019;s instructions to assess cell viability in HEK293 cells. The cells were treated with different blocker concentrations (0.01, 0.1, 1, 5, 10 &#x00b5;M, or carrier solution) for a range of time durations (0, 10, 30, 60, 90, or 120 minutes). After treatment with the blocker, the cells were washed twice in HBSS. The two reagents were applied (two drops per ml of each reagent); NucBlue was applied for 15 minutes, and Propidium Iodide was applied just before imaging (for less than 10 minutes). The cells were washed with HBSS, and imaged. Nine sites (3&#x00d7;3 grid) per well were automatically selected at fixed positions relative to the microplate. Total cell count per field of view (NucBlue positive cells) and dead cell count per field of view (cells stained positive for both NucBlue and Propidium Iodide) were calculated by the imaging system&#x2019;s integrated software. Cell viability in each well was assayed by calculating the average ratio (from nine fields of view) of dead cell count to total cell count for each concentration and duration. Only fields of view with at least 50 NucBlue-positive cells were included.</p>
            </sec>
            <sec>
                <title>Microscopy and image analysis</title>
                <p>Neuronal cultures were imaged on a custom-designed confocal laser scanning microscope
                    <sup>
                        <xref ref-type="bibr" rid="ref-43">43</xref>
                    </sup> using a 40X, 1.3 NA Fluar objective. Images were collected by averaging six frames at three focal planes spaced 0.8 &#x00b5;m apart. All data were collected at a resolution of 640&#x00d7;480 pixels, at 12 bits per pixel. Excitation of mTurq2 was performed at 457 nm. Emission was read using either 467-493 nm or 465-485 band pass filters. Excitation of JF635HT was performed at 633 nm. Emission was read using a 635 nm long-pass filter (Semrock). Excitation of Oregon Green was performed at 488nm. Emission was read using a 500&#x2013;550 nm band pass filter (Chroma).</p>
                <p>Image analysis was performed using custom-written software (&#x201c;OpenView&#x201d;; available on request; analyses could also be performed using other software packages, such as 
                    <ext-link ext-link-type="uri" xlink:href="https://imagej.nih.gov/ij/">ImageJ</ext-link>) by placing rectangular regions of interest on cell bodies and dendrites (4 to 7 regions per cell, 
                    <xref ref-type="fig" rid="f4">Figure 4</xref> and 
                    <xref ref-type="fig" rid="f6">Figure 6</xref>), axons (10 regions, 
                    <xref ref-type="fig" rid="f5">Figure 5</xref>), or cell bodies (
                    <xref ref-type="fig" rid="f7">Figure 7</xref>) of mTurq2-positive neurons using the mTurq2 channel. Fluorescence values of all channels were then collected from these regions and average values were calculated for each neuron or axonal bed. To correct for background fluorescence and non-specific labeling, regions of interest were placed on mTurq2-negative areas (
                    <xref ref-type="fig" rid="f4">Figure 4</xref>&#x2013;
                    <xref ref-type="fig" rid="f6">Figure 6</xref>) or mTurq2-negative somata (
                    <xref ref-type="fig" rid="f7">Figure 7</xref>) and these values were subtracted from all fluorescence readings for all channels and all time points.</p>
                <p>Imaging of HEK293 cells was done in a 5% CO
                    <sub>2</sub>, temperature-controlled 37&#x00b0;C microscope chamber of a high-content imaging system (ImageXpress, Molecular Devices). The cells were washed with HBSS before imaging. A single Z-section (2048&#x00d7;2048 pixels, 16 bits per pixel) was obtained automatically at each site using a 20x objective and the system&#x2019;s sCMOS camera. For non-fluorescent blocker efficacy measurements, 25 sites (a 5&#x00d7;5 grid, automatically selected) were imaged in each well. mTurq2 images were acquired using the following filter set: 438/29nm (ex.), 458nm (dichroic), 483/32nm (em.); JF635HT images were acquired using the following filter set: 562/40nm (ex.), 593nm (dichroic), 641nmLP (em.). For the live-dead assay, nine sites (3&#x00d7;3 grid) per well were automatically selected at fixed positions relative to the microplate using the following filters sets for NucBlue (377/50 nm, 409 nm, 447/60 nm,) and propidium iodide (562/40 nm, 593 nm, 624/40 nm; ex., dichroic, em., respectively). Data analysis was performed automatically using the imaging system&#x2019;s integrated software, and data were thereafter exported to Microsoft Excel for further analysis.</p>
                <p>Images for figures were processed by uniform contrast enhancement and low-pass filtering using Adobe Photoshop and prepared for presentation using Microsoft PowerPoint.</p>
            </sec>
        </sec>
        <sec>
            <title>Data availability</title>
            <sec>
                <title>Underlying data</title>
                <p>Figshare: A non-fluorescent HaloTag blocker for improved measurement and visualization of protein synthesis in living cells. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.12115509.v1">https://doi.org/10.6084/m9.figshare.12115509.v1</ext-link>
                    <sup>
                        <xref ref-type="bibr" rid="ref-38">38</xref>
                    </sup>.</p>
                <p>This project contains the following underlying data:</p>
                <list list-type="bullet">
                    <list-item>
                        <p>Cohen Boulos Ziv Data Fig 1 (ZIP). (Image data underlying Figure 1.)</p>
                    </list-item>
                    <list-item>
                        <p>Cohen Boulos Ziv Data Fig 2 (ZIP). (Image data and quantification of blocking efficacy underlying Figure 2.)</p>
                    </list-item>
                    <list-item>
                        <p>Cohen Boulos Ziv Data Fig 3 (ZIP). (Image data underlying Figure 3.)</p>
                    </list-item>
                    <list-item>
                        <p>Cohen Boulos Ziv Data Fig 4 (ZIP). (Image data underlying Figure 4.)</p>
                    </list-item>
                    <list-item>
                        <p>Cohen Boulos Ziv Data Fig 5 (ZIP). (Image data and fluorescence quantification underlying Figure 5).</p>
                    </list-item>
                    <list-item>
                        <p>Cohen Boulos Ziv Data Fig 6 (ZIP). (Image data and fluorescence quantification underlying Figure 6.)</p>
                    </list-item>
                    <list-item>
                        <p>Cohen Boulos Ziv Data Fig 7 (ZIP). (Image data and fluorescence quantification underlying Figure 7.)</p>
                    </list-item>
                </list>
                <p>Data are available under the terms of the 
                    <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/legalcode">Creative Commons Attribution 4.0 International license</ext-link> (CC-BY 4.0).</p>
            </sec>
        </sec>
    </body>
    <back>
        <ack>
            <title>Acknowledgments</title>
            <p>We are grateful to Jonathan Grimm and Luke Lavis (Janelia Research Campus, HHMI, USA) for the Janelia Fluor 635HT ligand, and to the Ciechanover lab (Technion Faculty of Medicine, Haifa, Israel) for reagents and instrumentation for the HEK293 cells experiments.</p>
        </ack>
        <ref-list>
            <ref id="ref-1">
                <label>1</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Los</surname>
                            <given-names>GV</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Encell</surname>
                            <given-names>LP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>McDougall</surname>
                            <given-names>MG</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>HaloTag: a novel protein labeling technology for cell imaging and protein analysis.</article-title>
                    <source>

                        <italic toggle="yes">ACS Chem Biol.</italic>
</source>
                    <year>2008</year>;<volume>3</volume>(<issue>6</issue>):<fpage>373</fpage>&#x2013;<lpage>82</lpage>.
                    <pub-id pub-id-type="pmid">18533659</pub-id>
                    <pub-id pub-id-type="doi">10.1021/cb800025k</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-2">
                <label>2</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Chudakov</surname>
                            <given-names>DM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Matz</surname>
                            <given-names>MV</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lukyanov</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Fluorescent proteins and their applications in imaging living cells and tissues.</article-title>
                    <source>

                        <italic toggle="yes">Physiol Rev.</italic>
</source>
                    <year>2010</year>;<volume>90</volume>(<issue>3</issue>):<fpage>1103</fpage>-<lpage>63</lpage>.
                    <pub-id pub-id-type="pmid">20664080</pub-id>
                    <pub-id pub-id-type="doi">10.1152/physrev.00038.2009</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-3">
                <label>3</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Morisaki</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>McNally</surname>
                            <given-names>JG</given-names>
                        </name>
</person-group>:
                    <article-title>Photoswitching-free FRAP analysis with a genetically encoded fluorescent tag.</article-title>
                    <source>

                        <italic toggle="yes">PLoS One.</italic>
</source>
                    <year>2014</year>;<volume>9</volume>(<issue>9</issue>):<fpage>e107730</fpage>.
                    <pub-id pub-id-type="pmid">25233348</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0107730</pub-id>
                    <pub-id pub-id-type="pmcid">4169462</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-4">
                <label>4</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>England</surname>
                            <given-names>CG</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Luo</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Cai</surname>
                            <given-names>W</given-names>
                        </name>
</person-group>:
                    <article-title>HaloTag technology: a versatile platform for biomedical applications.</article-title>
                    <source>

                        <italic toggle="yes">Bioconjug Chem.</italic>
</source>
                    <year>2015</year>;<volume>26</volume>(<issue>6</issue>):<fpage>975</fpage>&#x2013;<lpage>86</lpage>.
                    <pub-id pub-id-type="pmid">25974629</pub-id>
                    <pub-id pub-id-type="doi">10.1021/acs.bioconjchem.5b00191</pub-id>
                    <pub-id pub-id-type="pmcid">4482335</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-5">
                <label>5</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Masch</surname>
                            <given-names>JM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Steffens</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Fischer</surname>
                            <given-names>J</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Robust nanoscopy of a synaptic protein in living mice by organic-fluorophore labeling.</article-title>
                    <source>

                        <italic toggle="yes">Proc Natl Acad Sci U S A.</italic>
</source>
                    <year>2018</year>;<volume>115</volume>(<issue>34</issue>):<fpage>E8047</fpage>&#x2013;<lpage>E8056</lpage>.
                    <pub-id pub-id-type="pmid">30082388</pub-id>
                    <pub-id pub-id-type="doi">10.1073/pnas.1807104115</pub-id>
                    <pub-id pub-id-type="pmcid">6112726</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-6">
                <label>6</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Keppler</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Gendreizig</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Gronemeyer</surname>
                            <given-names>T</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>A general method for the covalent labeling of fusion proteins with small molecules 
                        <italic toggle="yes">in vivo</italic>.</article-title>
                    <source>

                        <italic toggle="yes">Nat Biotechnol.</italic>
</source>
                    <year>2003</year>;<volume>21</volume>(<issue>21</issue>):<fpage>86</fpage>&#x2013;<lpage>9</lpage>.
                    <pub-id pub-id-type="pmid">12469133</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nbt765</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-7">
                <label>7</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Keppler</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Pick</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Arrivoli</surname>
                            <given-names>C</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Labeling of fusion proteins with synthetic fluorophores in live cells.</article-title>
                    <source>

                        <italic toggle="yes">Proc Natl Acad Sci U S A.</italic>
</source>
                    <year>2004</year>;<volume>101</volume>(<issue>27</issue>):<fpage>9955</fpage>&#x2013;<lpage>9</lpage>.
                    <pub-id pub-id-type="pmid">15226507</pub-id>
                    <pub-id pub-id-type="doi">10.1073/pnas.0401923101</pub-id>
                    <pub-id pub-id-type="pmcid">454197</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-8">
                <label>8</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Gautier</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Juillerat</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Heinis</surname>
                            <given-names>C</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>An engineered protein tag for multiprotein labeling in living cells.</article-title>
                    <source>

                        <italic toggle="yes">Chem Biol.</italic>
</source>
                    <year>2008</year>;<volume>15</volume>(<issue>2</issue>):<fpage>128</fpage>&#x2013;<lpage>36</lpage>.
                    <pub-id pub-id-type="pmid">18291317</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.chembiol.2008.01.007</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-9">
                <label>9</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Bodor</surname>
                            <given-names>DL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rodr&#x00ed;guez</surname>
                            <given-names>MG</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Moreno</surname>
                            <given-names>N</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Analysis of protein turnover by quantitative SNAP-based pulse-chase imaging.</article-title>
                    <source>

                        <italic toggle="yes">Curr Protoc Cell Biol.</italic>
</source>
                    <year>2012</year>;<volume>Chapter 8</volume>:<fpage>Unit8.8</fpage>.
                    <pub-id pub-id-type="pmid">23129118</pub-id>
                    <pub-id pub-id-type="doi">10.1002/0471143030.cb0808s55</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-10">
                <label>10</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Sun</surname>
                            <given-names>X</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zhang</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Baker</surname>
                            <given-names>B</given-names>
                        </name>
</person-group>:
                    <article-title>Development of SNAP-tag fluorogenic probes for wash-free fluorescence imaging.</article-title>
                    <source>

                        <italic toggle="yes">Chembiochem.</italic>
</source>
                    <year>2011</year>;<volume>12</volume>(<issue>14</issue>):<fpage>2217</fpage>&#x2013;<lpage>26</lpage>.
                    <pub-id pub-id-type="pmid">21793150</pub-id>
                    <pub-id pub-id-type="doi">10.1002/cbic.201100173</pub-id>
                    <pub-id pub-id-type="pmcid">3213346</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-11">
                <label>11</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Encell</surname>
                            <given-names>LP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Friedman Ohana</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zimmerman</surname>
                            <given-names>K</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Development of a dehalogenase-based protein fusion tag capable of rapid, selective and covalent attachment to customizable ligands.</article-title>
                    <source>

                        <italic toggle="yes">Curr Chem Genomics.</italic>
</source>
                    <year>2012</year>;<volume>6</volume>:<fpage>55</fpage>&#x2013;<lpage>71</lpage>.
                    <pub-id pub-id-type="pmid">23248739</pub-id>
                    <pub-id pub-id-type="doi">10.2174/1875397301206010055</pub-id>
                    <pub-id pub-id-type="pmcid">3520037</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-12">
                <label>12</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kohl</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ng</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Cachero</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Ultrafast tissue staining with chemical tags.</article-title>
                    <source>

                        <italic toggle="yes">Proc Natl Acad Sci U S A.</italic>
</source>
                    <year>2014</year>;<volume>111</volume>(<issue>36</issue>):<fpage>E3805</fpage>&#x2013;<lpage>14</lpage>.
                    <pub-id pub-id-type="pmid">25157152</pub-id>
                    <pub-id pub-id-type="doi">10.1073/pnas.1411087111</pub-id>
                    <pub-id pub-id-type="pmcid">4246963</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-13">
                <label>13</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Erdmann</surname>
                            <given-names>RS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Baguley</surname>
                            <given-names>SW</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Richens</surname>
                            <given-names>JH</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Labeling Strategies Matter for Super-Resolution Microscopy: A Comparison between HaloTags and SNAP-tags.</article-title>
                    <source>

                        <italic toggle="yes">Cell Chem Biol.</italic>
</source>
                    <year>2019</year>;<volume>26</volume>(<issue>4</issue>):<fpage>584</fpage>&#x2013;<lpage>592</lpage>.
                    <pub-id pub-id-type="pmid">30745239</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.chembiol.2019.01.003</pub-id>
                    <pub-id pub-id-type="pmcid">6474801</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-14">
                <label>14</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Grimm</surname>
                            <given-names>JB</given-names>
                        </name>

                        <name name-style="western">
                            <surname>English</surname>
                            <given-names>BP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Chen</surname>
                            <given-names>J</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>A general method to improve fluorophores for live-cell and single-molecule microscopy.</article-title>
                    <source>

                        <italic toggle="yes">Nat Methods.</italic>
</source>
                    <year>2015</year>;<volume>12</volume>(<issue>10</issue>):<fpage>244</fpage>&#x2013;<lpage>50</lpage>.
                    <pub-id pub-id-type="pmid">25599551</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nmeth.3256</pub-id>
                    <pub-id pub-id-type="pmcid">4344395</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-15">
                <label>15</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Grimm</surname>
                            <given-names>JB</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Muthusamy</surname>
                            <given-names>AK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Liang</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>A general method to fine-tune fluorophores for live-cell and 
                        <italic toggle="yes">in vivo</italic> imaging.</article-title>
                    <source>

                        <italic toggle="yes">Nat Methods.</italic>
</source>
                    <year>2017</year>;<volume>14</volume>(<issue>10</issue>):<fpage>987</fpage>&#x2013;<lpage>94</lpage>.
                    <pub-id pub-id-type="pmid">28869757</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nmeth.4403</pub-id>
                    <pub-id pub-id-type="pmcid">5621985</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-16">
                <label>16</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Seki</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yoshino</surname>
                            <given-names>KI</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tanaka</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Establishment of a novel fluorescence-based method to evaluate chaperone-mediated autophagy in a single neuron.</article-title>
                    <source>

                        <italic toggle="yes">PLoS One.</italic>
</source>
                    <year>2012</year>;<volume>7</volume>(<issue>2</issue>):<fpage>e31232</fpage>.
                    <pub-id pub-id-type="pmid">22363588</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0031232</pub-id>
                    <pub-id pub-id-type="pmcid">3280339</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-17">
                <label>17</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Mossuto</surname>
                            <given-names>MF</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sannino</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mazza</surname>
                            <given-names>D</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>A dynamic study of protein secretion and aggregation in the secretory pathway.</article-title>
                    <source>

                        <italic toggle="yes">PLoS One.</italic>
</source>
                    <year>2014</year>;<volume>9</volume>(<issue>10</issue>):<fpage>e108496</fpage>.
                    <pub-id pub-id-type="pmid">25279560</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0108496</pub-id>
                    <pub-id pub-id-type="pmcid">4184786</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-18">
                <label>18</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Eenjes</surname>
                            <given-names>E</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Dragich</surname>
                            <given-names>JM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kampinga</surname>
                            <given-names>HH</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Distinguishing aggregate formation and aggregate clearance using cell-based assays.</article-title>
                    <source>

                        <italic toggle="yes">J Cell Sci.</italic>
</source>
                    <year>2016</year>;<volume>129</volume>(<issue>6</issue>):<fpage>1260</fpage>&#x2013;<lpage>70</lpage>.
                    <pub-id pub-id-type="pmid">26818841</pub-id>
                    <pub-id pub-id-type="doi">10.1242/jcs.179978</pub-id>
                    <pub-id pub-id-type="pmcid">4813294</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-19">
                <label>19</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Yoon</surname>
                            <given-names>YJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wu</surname>
                            <given-names>B</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Buxbaum</surname>
                            <given-names>AR</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Glutamate-induced RNA localization and translation in neurons.</article-title>
                    <source>

                        <italic toggle="yes">Proc Natl Acad Sci U S A.</italic>
</source>
                    <year>2016</year>;<volume>113</volume>(<issue>44</issue>):<fpage>E6877</fpage>&#x2013;<lpage>86</lpage>.
                    <pub-id pub-id-type="pmid">27791158</pub-id>
                    <pub-id pub-id-type="doi">10.1073/pnas.1614267113</pub-id>
                    <pub-id pub-id-type="pmcid">5098659</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-20">
                <label>20</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Takahashi</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>He</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tang</surname>
                            <given-names>Z</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>An autophagy assay reveals the ESCRT-III component CHMP2A as a regulator of phagophore closure.</article-title>
                    <source>

                        <italic toggle="yes">Nat Commun.</italic>
</source>
                    <year>2018</year>;<volume>9</volume>(<issue>1</issue>):<fpage>2855</fpage>.
                    <pub-id pub-id-type="pmid">30030437</pub-id>
                    <pub-id pub-id-type="doi">10.1038/s41467-018-05254-w</pub-id>
                    <pub-id pub-id-type="pmcid">6054611</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-21">
                <label>21</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Jansen</surname>
                            <given-names>LE</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Black</surname>
                            <given-names>BE</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Foltz</surname>
                            <given-names>DR</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Propagation of centromeric chromatin requires exit from mitosis.</article-title>
                    <source>

                        <italic toggle="yes">J Cell Biol.</italic>
</source>
                    <year>2007</year>;<volume>176</volume>(<issue>6</issue>):<fpage>795</fpage>&#x2013;<lpage>805</lpage>.
                    <pub-id pub-id-type="pmid">17339380</pub-id>
                    <pub-id pub-id-type="doi">10.1083/jcb.200701066</pub-id>
                    <pub-id pub-id-type="pmcid">2064054</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-22">
                <label>22</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Bojkowska</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Santoni de Sio</surname>
                            <given-names>F</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Barde</surname>
                            <given-names>I</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Measuring 
                        <italic toggle="yes">in vivo</italic> protein half-life.</article-title>
                    <source>

                        <italic toggle="yes">Chem Biol.</italic>
</source>
                    <year>2011</year>;<volume>18</volume>(<issue>6</issue>):<fpage>805</fpage>&#x2013;<lpage>15</lpage>.
                    <pub-id pub-id-type="pmid">21700215</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.chembiol.2011.03.014</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-23">
                <label>23</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Huybrechts</surname>
                            <given-names>SJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Van Veldhoven</surname>
                            <given-names>PP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Brees</surname>
                            <given-names>C</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Peroxisome dynamics in cultured mammalian cells.</article-title>
                    <source>

                        <italic toggle="yes">Traffic.</italic>
</source>
                    <year>2009</year>;<volume>10</volume>(<issue>11</issue>):<fpage>1722</fpage>&#x2013;<lpage>33</lpage>.
                    <pub-id pub-id-type="pmid">19719477</pub-id>
                    <pub-id pub-id-type="doi">10.1111/j.1600-0854.2009.00970.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-24">
                <label>24</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Okada</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zhang</surname>
                            <given-names>W</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Peterhoff</surname>
                            <given-names>C</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Proteomic identification of sorting nexin 6 as a negative regulator of BACE1-mediated APP processing.</article-title>
                    <source>

                        <italic toggle="yes">FASEB J.</italic>
</source>
                    <year>2010</year>;<volume>24</volume>(<issue>8</issue>):<fpage>2783</fpage>&#x2013;<lpage>94</lpage>.
                    <pub-id pub-id-type="pmid">20354142</pub-id>
                    <pub-id pub-id-type="doi">10.1096/fj.09-146357</pub-id>
                    <pub-id pub-id-type="pmcid">2909280</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-25">
                <label>25</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>He</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Xu</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zhang</surname>
                            <given-names>C</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Identification of a lysosomal pathway that modulates glucocorticoid signaling and the inflammatory response.</article-title>
                    <source>

                        <italic toggle="yes">Sci Signal.</italic>
</source>
                    <year>2011</year>;<volume>4</volume>(<issue>180</issue>):<fpage>ra44</fpage>.
                    <pub-id pub-id-type="pmid">21730326</pub-id>
                    <pub-id pub-id-type="doi">10.1126/scisignal.2001450</pub-id>
                    <pub-id pub-id-type="pmcid">3684214</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-26">
                <label>26</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Manetti</surname>
                            <given-names>ME</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Geden</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bott</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Stability of the tumor suppressor merlin depends on its ability to bind paxillin LD3 and associate with &#x03b2;1 integrin and actin at the plasma membrane.</article-title>
                    <source>

                        <italic toggle="yes">Biol Open.</italic>
</source>
                    <year>2012</year>;<volume>1</volume>(<issue>10</issue>):<fpage>949</fpage>&#x2013;<lpage>57</lpage>.
                    <pub-id pub-id-type="pmid">23213372</pub-id>
                    <pub-id pub-id-type="doi">10.1242/bio.20122121</pub-id>
                    <pub-id pub-id-type="pmcid">3507182</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-27">
                <label>27</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Urh</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rosenberg</surname>
                            <given-names>M</given-names>
                        </name>
</person-group>:
                    <article-title>HaloTag, a platform technology for protein analysis.</article-title>
                    <source>

                        <italic toggle="yes">Curr Chem Genomics.</italic>
</source>
                    <year>2012</year>;<volume>6</volume>:<fpage>72</fpage>&#x2013;<lpage>8</lpage>.
                    <pub-id pub-id-type="pmid">23213345</pub-id>
                    <pub-id pub-id-type="doi">10.2174/1875397301206010072</pub-id>
                    <pub-id pub-id-type="pmcid">3480824</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-28">
                <label>28</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Wang</surname>
                            <given-names>HY</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lin</surname>
                            <given-names>YP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mitchell</surname>
                            <given-names>CK</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Two-color fluorescent analysis of connexin 36 turnover: relationship to functional plasticity.</article-title>
                    <source>

                        <italic toggle="yes">J Cell Sci.</italic>
</source>
                    <year>2015</year>;<volume>128</volume>(<issue>21</issue>):<fpage>3888</fpage>&#x2013;<lpage>97</lpage>.
                    <pub-id pub-id-type="pmid">26359298</pub-id>
                    <pub-id pub-id-type="doi">10.1242/jcs.162586</pub-id>
                    <pub-id pub-id-type="pmcid">4647165</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-29">
                <label>29</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kratschke</surname>
                            <given-names>MM</given-names>
                        </name>
</person-group>:
                    <article-title>Investigating PSD-95 turnover at the synapse using the HaloTag technology.</article-title>
                    <source>

                        <italic toggle="yes">Doctoral dissertation.</italic>
</source>
                    <year>2018</year>; Supervisor: Grant SG. Retrieved from: Edinburgh Medical School thesis and dissertation collection,
                    <ext-link ext-link-type="uri" xlink:href="https://era.ed.ac.uk/handle/1842/31131">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-30">
                <label>30</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Alber</surname>
                            <given-names>AB</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Paquet</surname>
                            <given-names>ER</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Biserni</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Single live cell monitoring of protein turnover reveals intercellular variability and cell-cycle dependence of degradation rates.</article-title>
                    <source>

                        <italic toggle="yes">Mol Cell.</italic>
</source>
                    <year>2018</year>;<volume>71</volume>(<issue>6</issue>):<fpage>1079</fpage>&#x2013;<lpage>1091.e9</lpage>.
                    <pub-id pub-id-type="pmid">30146318</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.molcel.2018.07.023</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-31">
                <label>31</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Alber</surname>
                            <given-names>AB</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Suter</surname>
                            <given-names>DM</given-names>
                        </name>
</person-group>:
                    <article-title>Single-cell Quantification of Protein Degradation Rates by Time-Lapse Fluorescence Microscopy in Adherent Cell Culture.</article-title>
                    <source>

                        <italic toggle="yes">J Vis Exp.</italic>
</source>
                    <year>2018</year>;<volume>132</volume>.
                    <pub-id pub-id-type="pmid">29443092</pub-id>
                    <pub-id pub-id-type="doi">10.3791/56604</pub-id>
                    <pub-id pub-id-type="pmcid">5912353</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-32">
                <label>32</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Yamaguchi</surname>
                            <given-names>K</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Inoue</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ohara</surname>
                            <given-names>O</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Pulse-chase experiment for the analysis of protein stability in cultured mammalian cells by covalent fluorescent labeling of fusion proteins.</article-title>
                    <source>

                        <italic toggle="yes">Methods Mol Biol.</italic>
</source>
                    <year>2009</year>;<volume>577</volume>:<fpage>121</fpage>&#x2013;<lpage>31</lpage>.
                    <pub-id pub-id-type="pmid">19718513</pub-id>
                    <pub-id pub-id-type="doi">10.1007/978-1-60761-232-2_10</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-33">
                <label>33</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Cohen</surname>
                            <given-names>LD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zuchman</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sorokina</surname>
                            <given-names>O</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Metabolic Turnover of Synaptic Proteins: Kinetics, Interdependencies and Implications for Synaptic Maintenance.</article-title>
                    <source>

                        <italic toggle="yes">PLoS One.</italic>
</source>
                    <year>2013</year>;<volume>8</volume>:<fpage>e63191</fpage>.
                    <pub-id pub-id-type="pmid">23658807</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0063191</pub-id>
                    <pub-id pub-id-type="pmcid">3642143</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-34">
                <label>34</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Lepore</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Taylor</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Landgraf</surname>
                            <given-names>D</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Quantification of very low-abundant proteins in bacteria using the HaloTag and epi-fluorescence microscopy.</article-title>
                    <source>

                        <italic toggle="yes">Sci Rep.</italic>
</source>
                    <year>2019</year>;<volume>9</volume>(<issue>1</issue>):<fpage>7902</fpage>.
                    <pub-id pub-id-type="pmid">31133640</pub-id>
                    <pub-id pub-id-type="doi">10.1038/s41598-019-44278-0</pub-id>
                    <pub-id pub-id-type="pmcid">6536506</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-35">
                <label>35</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Rhodes</surname>
                            <given-names>JDP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Haarhuis</surname>
                            <given-names>JHI</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Grimm</surname>
                            <given-names>JB</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Cohesin Can Remain Associated with Chromosomes during DNA Replication.</article-title>
                    <source>

                        <italic toggle="yes">Cell Rep.</italic>
</source>
                    <year>2017</year>;<volume>20</volume>(<issue>12</issue>):<fpage>2749</fpage>&#x2013;<lpage>55</lpage>.
                    <pub-id pub-id-type="pmid">28930671</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.celrep.2017.08.092</pub-id>
                    <pub-id pub-id-type="pmcid">5613076</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-36">
                <label>36</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kumagai</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ikeda</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Motozawa</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Quantitative measurement of GPCR endocytosis via pulse-chase covalent labeling.</article-title>
                    <source>

                        <italic toggle="yes">PLoS One.</italic>
</source>
                    <year>2015</year>;<volume>10</volume>(<issue>5</issue>):<fpage>e0129394</fpage>.
                    <pub-id pub-id-type="pmid">26020647</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0129394</pub-id>
                    <pub-id pub-id-type="pmcid">4447269</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-37">
                <label>37</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Merrill</surname>
                            <given-names>RA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Song</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kephart</surname>
                            <given-names>RA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>A robust and economical pulse-chase protocol to measure the turnover of HaloTag fusion proteins.</article-title>
                    <source>

                        <italic toggle="yes">J Biol Chem.</italic>
</source>
                    <year>2019</year>;<volume>294</volume>(<issue>44</issue>):<fpage>16164</fpage>&#x2013;<lpage>71</lpage>.
                    <pub-id pub-id-type="pmid">31511325</pub-id>
                    <pub-id pub-id-type="doi">10.1074/jbc.RA119.010596</pub-id>
                    <pub-id pub-id-type="pmcid">6827285</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-38">
                <label>38</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Cohen</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Boulos</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ziv</surname>
                            <given-names>NE</given-names>
                        </name>
</person-group>:
                    <article-title>A non-fluorescent HaloTag blocker for improved measurement and visualization of protein synthesis in living cells</article-title>. Dataset.
                    <source>

                        <italic toggle="yes">Figshare.</italic>
</source>
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.6084/m9.figshare.12115509.v1">http://www.doi.org/10.6084/m9.figshare.12115509.v1</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-39">
                <label>39</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Goedhart</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>von Stetten</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Noirclerc-Savoye</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Structure-guided evolution of cyan fluorescent proteins towards a quantum yield of 93%.</article-title>
                    <source>

                        <italic toggle="yes">Nat Commun.</italic>
</source>
                    <year>2012</year>;<volume>3</volume>:<fpage>751</fpage>.
                    <pub-id pub-id-type="pmid">22434194</pub-id>
                    <pub-id pub-id-type="doi">10.1038/ncomms1738</pub-id>
                    <pub-id pub-id-type="pmcid">3316892</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-40">
                <label>40</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Minerbi</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kahana</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Goldfeld</surname>
                            <given-names>L</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Long-term relationships between synaptic tenacity, synaptic remodeling, and network activity.</article-title>
                    <source>

                        <italic toggle="yes">PLoS Biol.</italic>
</source>
                    <year>2009</year>;<volume>7</volume>(<issue>6</issue>):<fpage>e1000136</fpage>.
                    <pub-id pub-id-type="pmid">19554080</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pbio.1000136</pub-id>
                    <pub-id pub-id-type="pmcid">2693930</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-41">
                <label>41</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Dvorkin</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ziv</surname>
                            <given-names>NE</given-names>
                        </name>
</person-group>:
                    <article-title>Relative contributions of specific activity histories and spontaneous processes to size remodeling of glutamatergic synapses.</article-title>
                    <source>

                        <italic toggle="yes">PLoS Biol.</italic>
</source>
                    <year>2016</year>;<volume>14</volume>(<issue>10</issue>):<fpage>e1002572</fpage>.
                    <pub-id pub-id-type="pmid">27776122</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pbio.1002572</pub-id>
                    <pub-id pub-id-type="pmcid">077109</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-42">
                <label>42</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Peterson</surname>
                            <given-names>SN</given-names>
                        </name>
</person-group>:
                    <article-title>The HaloTag: Improving Soluble Expression and Applications in Protein Functional Analysis.</article-title>
                    <source>

                        <italic toggle="yes">Curr Chem Genomics.</italic>
</source>
                    <year>2012</year>;<volume>6</volume>:<fpage>8</fpage>&#x2013;<lpage>17</lpage>.
                    <pub-id pub-id-type="pmid">23115610</pub-id>
                    <pub-id pub-id-type="doi">10.2174/1875397301206010008</pub-id>
                    <pub-id pub-id-type="pmcid">3480702</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-43">
                <label>43</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Tsuriel</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Geva</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zamorano</surname>
                            <given-names>P</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Local sharing as a predominant determinant of synaptic matrix molecular dynamics.</article-title>
                    <source>

                        <italic toggle="yes">PLoS Biol.</italic>
</source>
                    <year>2006</year>;<volume>4</volume>(<issue>9</issue>):<fpage>e271</fpage>.
                    <pub-id pub-id-type="pmid">16903782</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pbio.0040271</pub-id>
                    <pub-id pub-id-type="pmcid">1540708 </pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-44">
                <label>44</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Bresler</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Shapira</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Boeckers</surname>
                            <given-names>T</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Postsynaptic density assembly is fundamentally different from presynaptic active zone assembly.</article-title>
                    <source>

                        <italic toggle="yes">J Neurosci.</italic>
</source>
                    <year>2004</year>;<volume>24</volume>(<issue>6</issue>):<fpage>1507</fpage>&#x2013;<lpage>20</lpage>.
                    <pub-id pub-id-type="pmid">14960624</pub-id>
                    <pub-id pub-id-type="doi">10.1523/JNEUROSCI.3819-03.2004</pub-id>
                    <pub-id pub-id-type="pmcid">6730341</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report62881">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.25710.r62881</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>tom Dieck</surname>
                        <given-names>Susanne</given-names>
                    </name>
                    <xref ref-type="aff" rid="r62881a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-5884-8640</uri>
                </contrib>
                <aff id="r62881a1">
                    <label>1</label>Synaptic Plasticity Department, Max Planck Institute for Brain Research, Frankfurt am Main, Germany</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>26</day>
                <month>5</month>
                <year>2020</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2020 tom Dieck S</copyright-statement>
                <copyright-year>2020</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport62881" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.23289.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>In this manuscript Cohen 
                <italic>et al.</italic> describe a valuable addition to the HaloTag toolbox. They developed and characterized an efficient and inexpensive non-fluorescent blocker (ligand) of HaloTag sites. They&#x00a0;make use of a fluorescent protein/HaloTag fusion-based experimental design to evaluate relative labeling of HaloTag sites with fluorescent ligands offering the advantage to normalize and also quantify background labeling. As a result they present a strategy to robustly identify and label newly synthesized HaloTag proteins without several current pitfalls.</p>
            <p> </p>
            <p> The need of such a low-cost, efficient blocker is underlined by the simultaneous development of a similar compound in a different lab (as properly cited).&#x00a0;</p>
            <p> The manuscript without doubt describes a very useful compound and method in sufficient detail to be used by others as it is. As an improvement, a couple of small points could be discussed in more detail to guide the reader through potential further uses, pitfalls or limitations or could be presented with more of the available information embedded into the figures:</p>
            <p> Related to Figure 2: 
                <list list-type="bullet">
                    <list-item>
                        <p>As important for the method in the text regarding the quantification in D the points of &#x2018;complete&#x2019; blocking are discussed. It nonetheless would be helpful to also have a sentence on the data without and with low concentration of CPXH (e.g. high variability between time points in the 0&#x00b5;M).</p>
                    </list-item>
                    <list-item>
                        <p>Add a line how similar this is for neurons (was the concentration used in the following experiments based on the HEK data or determined independently).</p>
                    </list-item>
                    <list-item>
                        <p>Toxicity of new compounds and also influence on physiology is an important issue (especially in neurons). The authors have addressed this by not only live/dead assays in HEK cells but also generated data by long-term CPXH incubation on neuronal network activity. This important dataset should be present in a main figure.</p>
                    </list-item>
                </list> Related to Figure 4-6/discussion: 
                <list list-type="bullet">
                    <list-item>
                        <p>The use of a fluorescent protein-HaloTag fusion as a means to normalize the fluorescence from a HaloTag ligand over time helps to follow the time-resolved behavior but also adds a source of influence on the apparent behavior that is not readily visible when only the normalized data are presented. In the discussion the authors mention that this normalization might be imperfect but only discuss one side of the imperfection: the overall influence of newly synthesized mTurq on total mTurq (which is indeed most likely not very high). What is missing from my point of view is the discussion of the influence of mTurq fluorescence decline over time as e.g. visible in Fig. 4B. Is this bleaching? What is the order of magnitude of this effect on the apparent increase in relative ligand fluorescence? At least for one of the figures the non-normalized data of all fluorescent partners could be presented alongside the normalized ones.</p>
                    </list-item>
                    <list-item>
                        <p>The potential effect of residual CPXH labeling after washout on the onset of ligand labeling of newly synthesized protein should be discussed: Is there any detectable lag phase? Does the shape of the curve in the early time points give any hints that an ongoing labeling after washing is either negligible or should be considered?&#x00a0;</p>
                    </list-item>
                    <list-item>
                        <p>Regarding the Oregon Green labeling: it is not clear to me whether the sentence &#x2018;Interestingly, we noted that labeling with Oregon Green ligand was associated with strong non-specific labeling that washed out relatively slowly&#x2019; refers to transfected cells or all cells (I guess all). The visible variation of Oregon Green fluorescence in the images in 6B should be discussed. It could also be worth addressing how short labeling with different ligands and CPXH chase might help to determine how &#x2018;reliable&#x2019; a fluorescent ligand can be used for time-resolved studies.</p>
                    </list-item>
                </list> Related to Figure 7: 
                <list list-type="bullet">
                    <list-item>
                        <p>Just out of curiosity and not necessary for description of the method at all: since often protein synthesis inhibitors are used at much shorter timescales &#x2013; did you check how complete is the protein synthesis block judged by this method and under the conditions given after up to 1 hr?</p>
                    </list-item>
                </list>
            </p>
            <p>Is the rationale for developing the new method (or application) clearly explained?</p>
            <p>Yes</p>
            <p>Is the description of the method technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions about the method and its performance adequately supported by the findings presented in the article?</p>
            <p>Yes</p>
            <p>If any results are presented, are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Are sufficient details provided to allow replication of the method development and its use by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>neuronal cell biology, protein synthesis</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
        <sub-article article-type="response" id="comment5573-62881">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Ziv</surname>
                            <given-names>Noam</given-names>
                        </name>
                        <aff>Technion, Israel</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No competing interests</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>2</day>
                    <month>6</month>
                    <year>2020</year>
                </pub-date>
            </front-stub>
            <body>
                <p>We thank the reviewer for the supportive and constructive review.</p>
                <p> </p>
                <p> Responses below are interleaved with the original comments&#x00a0;:</p>
                <p> </p>
                <p> Related to Figure 2: 
                    <list list-type="bullet">
                        <list-item>
                            <p>As important for the method in the text regarding the quantification in D the points of &#x2018;complete&#x2019; blocking are discussed. It nonetheless would be helpful to also have a sentence on the data without and with low concentration of CPXH (e.g. high variability between time points in the 0&#x00b5;M).</p>
                        </list-item>
                    </list> Indeed. We now address these observations in the legend of Figure 2.</p>
                <p> &#x00a0; 
                    <list list-type="bullet">
                        <list-item>
                            <p>Add a line how similar this is for neurons (was the concentration used in the following experiments based on the HEK data or determined independently).</p>
                        </list-item>
                    </list> The concentrations were based on measurements made in HEK cells. This is now stated in the main text.</p>
                <p> &#x00a0; 
                    <list list-type="bullet">
                        <list-item>
                            <p>Toxicity of new compounds and also influence on physiology is an important issue (especially in neurons). The authors have addressed this by not only live/dead assays in HEK cells but also generated data by long-term CPXH incubation on neuronal network activity. This important dataset should be present in a main figure.</p>
                        </list-item>
                    </list> Data on toxicity, including MEA recordings, were moved to the main text (Figure 2E, F)</p>
                <p> Related to Figure 4-6/discussion: 
                    <list list-type="bullet">
                        <list-item>
                            <p>The use of a fluorescent protein-HaloTag fusion as a means to normalize the fluorescence from a HaloTag ligand over time helps to follow the time-resolved behavior but also adds a source of influence on the apparent behavior that is not readily visible when only the normalized data are presented. In the discussion the authors mention that this normalization might be imperfect but only discuss one side of the imperfection: the overall influence of newly synthesized mTurq on total mTurq (which is indeed most likely not very high). What is missing from my point of view is the discussion of the influence of mTurq fluorescence decline over time as e.g. visible in Fig. 4B. Is this bleaching? What is the order of magnitude of this effect on the apparent increase in relative ligand fluorescence? At least for one of the figures the non-normalized data of all fluorescent partners could be presented alongside the normalized ones.</p>
                        </list-item>
                    </list> This is an excellent point. These data were analyzed for all neurons and three examples are now shown in Figure 4D. We found that indeed, in some (about half of the neurons), some decay of mTurq2 fluorescence was observed (13% after 10 hours on average, up to 37% in the most extreme case). These observations and their implications are now detailed and discussed in the Results and Discussion. 
                    <list list-type="bullet">
                        <list-item>
                            <p>The potential effect of residual CPXH labeling after washout on the onset of ligand labeling of newly synthesized protein should be discussed: Is there any detectable lag phase? Does the shape of the curve in the early time points give any hints that an ongoing labeling after washing is either negligible or should be considered?&#x00a0;</p>
                        </list-item>
                    </list> This too is a good point. At the time scales and imaging frequency of the experiments described here, lag phases on the order of minutes would be undetectable. We found no overt evidence for lag phases on longer time scales, but until rigorous measurements of CPXH efflux rates are carried out, this confound should be brought into account. This is now mentioned explicitly in the Discussion.</p>
                <p> &#x00a0; 
                    <list list-type="bullet">
                        <list-item>
                            <p>Regarding the Oregon Green labeling: it is not clear to me whether the sentence &#x2018;Interestingly, we noted that labeling with Oregon Green ligand was associated with strong non-specific labeling that washed out relatively slowly&#x2019; refers to transfected cells or all cells (I guess all). The visible variation of Oregon Green fluorescence in the images in 6B should be discussed. It could also be worth addressing how short labeling with different ligands and CPXH chase might help to determine how &#x2018;reliable&#x2019; a fluorescent ligand can be used for time-resolved studies.</p>
                        </list-item>
                    </list> This matter is now explained in much more detail in the main text.</p>
                <p> Related to Figure 7: 
                    <list list-type="bullet">
                        <list-item>
                            <p>Just out of curiosity and not necessary for description of the method at all: since often protein synthesis inhibitors are used at much shorter timescales &#x2013; did you check how complete is the protein synthesis block judged by this method and under the conditions given after up to 1 hr?</p>
                        </list-item>
                    </list> No we did not; however, to do so one would need to use a protein that has a much higher turnover rate than mTurq2-HaloTag seems to have (as evidenced from Figures 4 to 6).</p>
            </body>
        </sub-article>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report62839">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.25710.r62839</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Ryan</surname>
                        <given-names>Timothy</given-names>
                    </name>
                    <xref ref-type="aff" rid="r62839a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0003-2533-9548</uri>
                </contrib>
                <aff id="r62839a1">
                    <label>1</label>Department of Biochemistry, Weill Cornell Medical College, New York, NY, 10021, USA</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>19</day>
                <month>5</month>
                <year>2020</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2020 Ryan T</copyright-statement>
                <copyright-year>2020</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport62839" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.23289.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>The authors present a useful and insightful study on an approach that leverages genetically encoded Halo-tags fused to a fluorescent protein to show how new protein synthesis can be readily detected using a novel colorless blocking agent. The experiments are clear, analyzed in quantitative detail and the results appear very robust. I have the following suggestions which I think would improve this manuscript: 
                <list list-type="order">
                    <list-item>
                        <p>There is only a side&#x00a0;mention of how the data of cell # 2 in Figure 6D should be interpreted. A cell was labeled with OG, chased with CPHX and the pulsed with JF646. Why would the OG fluorescence go down? Does this reflect some reversal of OG binding or purely background washout?</p>
                    </list-item>
                    <list-item>
                        <p>Related to this point the ability to use this scheme to get estimates of new protein synthesis does depend on the irreversibility of dyes binding to Halo. It seems this point could have been fleshed out a little more by asking how stable fluorescence in a fluorescent label followed by CPHX chase in more than just the anecdote in Fig 6.</p>
                    </list-item>
                    <list-item>
                        <p>It is probably worth discussing the fact that the measurements depend to a certain extent on the relative maturation times of the mTurq versus Halo proteins. I imagine is it not limiting on long time scales but could become so on shorter ones.</p>
                    </list-item>
                </list>
            </p>
            <p>Is the rationale for developing the new method (or application) clearly explained?</p>
            <p>Yes</p>
            <p>Is the description of the method technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions about the method and its performance adequately supported by the findings presented in the article?</p>
            <p>Yes</p>
            <p>If any results are presented, are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Are sufficient details provided to allow replication of the method development and its use by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>neuronal cell biology &amp; physiology; development of quantitative optical methods</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
        <sub-article article-type="response" id="comment5572-62839">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Ziv</surname>
                            <given-names>Noam</given-names>
                        </name>
                        <aff>Technion, Israel</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No competing interests</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>2</day>
                    <month>6</month>
                    <year>2020</year>
                </pub-date>
            </front-stub>
            <body>
                <p>Thank you for the supportive and constructive review.</p>
                <p> </p>
                <p> Responses follow, in the same order as the commentary:</p>
                <p> </p>
                <p> 1) This decay reflects slow OG ligand washout as determined by measuring OG fluorescence decay in somata and thick dendrites of neighboring, mTurq2 negative cells. The potentially slow efflux of this ligand is also documented by Promega (
                    <ext-link ext-link-type="uri" xlink:href="https://worldwide.promega.com/-/media/files/resources/protocols/technical-manuals/0/halotag-technology-focus-on-imaging-protocol.pdf?la=en">Technical Manual, HaloTag&#x00ae; Technology: Focus on Imaging</ext-link>, page 35). This is now explained in the Results.</p>
                <p> 2) We did not test the binding reversibility of any of the ligands, and this is indeed a potential confound in long experiments. We note that a) the literature indicates that HaloTag ligand binding is effectively irreversible and that b) CPXH is essentially the canonical HaloTag ligand lacking the reactive amine used for tagging it with fluorescent groups. Given the magnitude of the slow OG effect (comment #1), this is unlikely to be a major explanation for the observation in Fig. 6. &#x00a0;Nevertheless, we mention this potential confound in the Discussion.</p>
                <p> </p>
                <p> 3)&#x00a0;This is indeed a good point. We now mention it in the Discussion.</p>
            </body>
        </sub-article>
    </sub-article>
</article>
