<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">F1000Research</journal-id>
            <journal-title-group>
                <journal-title>F1000Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2046-1402</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/f1000research.21299.1</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>Multidrug-resistant 
                    <italic>Campylobacter jejuni, Campylobacter coli and Campylobacter lari</italic> isolated from asymptomatic school-going children in Kibera slum, Kenya</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 1; peer review: 2 approved with reservations]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Gitahi</surname>
                        <given-names>Nduhiu</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0001-6302-5908</uri>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Gathura</surname>
                        <given-names>Peter B.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Gicheru</surname>
                        <given-names>Michael M.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-8662-2665</uri>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Wandia</surname>
                        <given-names>Beautice M.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Nordin</surname>
                        <given-names>Annika</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a3">3</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Department of Public Health, Pharmacology &amp; Toxicology, University of Nairobi, Nairobi, 00100, Kenya</aff>
                <aff id="a2">
                    <label>2</label>Department of Zoological Sciences, Kenyatta University, Nairobi, 00100, Kenya</aff>
                <aff id="a3">
                    <label>3</label>Department of Energy and Technology, Swedish University of Agricultural Science, Uppsala, Sweden</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:nduhiugitahi@gmail.com">nduhiugitahi@gmail.com</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>7</day>
                <month>2</month>
                <year>2020</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2020</year>
            </pub-date>
            <volume>9</volume>
            <elocation-id>92</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>30</day>
                    <month>1</month>
                    <year>2020</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2020 Gitahi N et al.</copyright-statement>
                <copyright-year>2020</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://f1000research.com/articles/9-92/pdf"/>
            <abstract>
                <p>
                    <bold>Background:</bold> The objective of this study was to determine the prevalence of thermophilic 
                    <italic toggle="yes">Campylobacter</italic> spp. in asymptomatic school-going children and establish the antibiotic resistant patterns of the isolates towards the drugs used to treat campylobacteriosis, including macrolides, quinolones and tetracycline. 
                    <italic toggle="yes">Campylobacter</italic> spp. are a leading cause of enteric illness and have only recently shown resistant to antibiotics.</p>
                <p>
                    <bold>Methods:</bold> This study isolated 
                    <italic toggle="yes">Campylobacter</italic> spp., including 
                    <italic toggle="yes">Campylobacter coli</italic>, 
                    <italic toggle="yes">Campylobacter jejuni</italic> and 
                    <italic toggle="yes">Campylobacter lari</italic>, in stool samples from asymptomatic school-going children in one of the biggest urban slums in Kenya. The disc diffusion method using EUCAST breakpoints was used to identify antibiotic-resistant isolates, which were further tested for genes encoding for tetracycline resistances using primer-specific polymerase chain reaction.</p>
                <p>
                    <bold>Results:</bold> In total, 580 stool samples were collected from 11 primary schools considering both gender and age. Subjecting 294 biochemically characterized 
                    <italic toggle="yes">Campylobacter</italic> spp. isolates to genus-specific PCR, 106 (18.27% of stool samples) isolates were confirmed 
                    <italic toggle="yes">Campylobacter</italic> spp. Out of the 106 isolates, 28 (4.83%) were 
                    <italic toggle="yes">Campylobacter coli</italic>, 44 (7.58%) were 
                    <italic toggle="yes">Campylobacter jejuni</italic> while 11 (1.89%) were 
                    <italic toggle="yes">Campylobacter lari</italic>. 
                    <italic toggle="yes">Campylobacter jejuni</italic> had the highest number of isolates that were multi-drug resistant, with 26 out of the 28 tested isolates being resistant to ciprofloxacin (5 mg), nalidixic acid (30 mg), tetracycline (30 mg) and erythromycin (15 mg).</p>
                <p>
                    <bold>Conclusions:</bold> In conclusion, a one-health approach, which considers overlaps in environment, animals and human ecosystems, is recommended in addressing campylobacteriosis in humans, since animals are the main reservoirs and environmental contamination is evident.</p>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>Multidrug</kwd>
                <kwd>resistance</kwd>
                <kwd>Campylobacter</kwd>
                <kwd>genes</kwd>
                <kwd>asymptomatic</kwd>
            </kwd-group>
            <funding-group>
                <award-group id="fund-1" xlink:href="http://dx.doi.org/10.13039/501100004359">
                    <funding-source>Vetenskapsr&#x00e5;det</funding-source>
                    <award-id>348-2014-3508</award-id>
                </award-group>
                <award-group id="fund-2" xlink:href="http://dx.doi.org/10.13039/501100004828">
                    <funding-source>Grand Challenges Canada</funding-source>
                    <award-id>S70659-01-10</award-id>
                </award-group>
                <funding-statement>This research received funding from Grand Challenges Canada (grant number S7 0659-01-10) and Swedish Research Council VR (reference No.348-2014-3508).</funding-statement>
                <funding-statement>
                    <italic>The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.</italic>
                </funding-statement>
            </funding-group>
        </article-meta>
    </front>
    <body>
        <sec sec-type="intro">
            <title>Introduction</title>
            <p>
                <italic toggle="yes">Campylobacter</italic> spp. infection is a leading cause of enteric illness
                <sup>
                    <xref ref-type="bibr" rid="ref-1">1</xref>,
                    <xref ref-type="bibr" rid="ref-2">2</xref>
                </sup>, manifesting as mild-to-severe diarrhoea with watery loose stool that is often followed by bloody diarrhoea
                <sup>
                    <xref ref-type="bibr" rid="ref-3">3</xref>
                </sup>. Infections also manifest as meningitis, pneumonia, miscarriage, severe form of Guillain-Barre syndrome (GBS) and reactive arthritis (ReA) and irritable bowel syndrome (IBS)
                <sup>
                    <xref ref-type="bibr" rid="ref-3">3</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-5">5</xref>
                </sup>. Isolation of pathogenic 
                <italic toggle="yes">Campylobacter</italic> spp. from asymptomatic children would be as a result of the pathogens not expressing the virulence factor cytolethal distending toxin, which is able to induce host cell apoptosis. Pathogenesis could also be influenced by host immune system and pathogens adaptation strategies
                <sup>
                    <xref ref-type="bibr" rid="ref-6">6</xref>
                </sup>. Other factors like motility and chemotaxis affect effective 
                <italic toggle="yes">Campylobacter</italic> colonization and pathogenesis; these have been shown to vary in mutants
                <sup>
                    <xref ref-type="bibr" rid="ref-7">7</xref>
                </sup>.</p>
            <p>
                <italic toggle="yes">Campylobacter</italic> spp. are found in the intestinal tract of wild and domestic animals, particularly in birds, asymptomatically as temporal carriers but causing illness in humans
                <sup>
                    <xref ref-type="bibr" rid="ref-3">3</xref>
                </sup>. The bacteria can survive up to five months at -20&#x00b0;C but die off in a few days at room temperature
                <sup>
                    <xref ref-type="bibr" rid="ref-5">5</xref>,
                    <xref ref-type="bibr" rid="ref-8">8</xref>,
                    <xref ref-type="bibr" rid="ref-9">9</xref>
                </sup>. They are vulnerable to air exposure, drying, low pH and heating
                <sup>
                    <xref ref-type="bibr" rid="ref-3">3</xref>
                </sup>. Three species, namely 
                <italic toggle="yes">C. jejuni, C. coli</italic> and 
                <italic toggle="yes">C. lari</italic>, account for 99% of human 
                <italic toggle="yes">Campylobacter</italic> spp. isolates, with 
                <italic toggle="yes">C. jejuni</italic> contributing 90% of the isolates. 
                <italic toggle="yes">C. fetus</italic> and 
                <italic toggle="yes">C. upsaliensis</italic> have also been isolated in humans
                <sup>
                    <xref ref-type="bibr" rid="ref-10">10</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-12">12</xref>
                </sup>.</p>
            <p>Distinguishing between 
                <italic toggle="yes">Campylobacter species</italic> using phenotypic methods is difficult; however, genotypic methods have been developed that are capable of distinguishing species. This has enabled more elaborate epidemiological understanding of Campylobacteriosis, thus identification of the sources and routes of infection
                <sup>
                    <xref ref-type="bibr" rid="ref-13">13</xref>,
                    <xref ref-type="bibr" rid="ref-14">14</xref>
                </sup>. The use of multiplex PCR methods has resulted in cheap, rapid and sensitive genetic identification procedures
                <sup>
                    <xref ref-type="bibr" rid="ref-15">15</xref>
                </sup>. </p>
            <p>It was not until recently that 
                <italic toggle="yes">Campylobacter</italic> spp. was shown to exhibit multidrug resistance (MDR). Before that, the bacteria were considered to be susceptible
                <sup>
                    <xref ref-type="bibr" rid="ref-16">16</xref>
                </sup>. Tetracycline is one of the antimicrobial agents against which 
                <italic toggle="yes">Campylobacter spp.</italic> have showed resistance. In 
                <italic toggle="yes">Campylobacter</italic> spp.
                <italic toggle="yes">,</italic> tetracycline resistance has been reported to have been mediated by more than one tetracycline resistance (
                <italic toggle="yes">tet</italic>) genes. The 
                <italic toggle="yes">tet</italic>(O) gene is the ribosomal protection protein and plays the primary part in tetracycline resistance in 
                <italic toggle="yes">C. jejuni</italic> and 
                <italic toggle="yes">C. coli</italic>
                <sup>
                    <xref ref-type="bibr" rid="ref-17">17</xref>,
                    <xref ref-type="bibr" rid="ref-18">18</xref>
                </sup>. This is transferred as a plasmid encoded gene
                <sup>
                    <xref ref-type="bibr" rid="ref-19">19</xref>
                </sup> or as non-self-mobile form when transferred through the chromosome
                <sup>
                    <xref ref-type="bibr" rid="ref-17"/>
                </sup>. Similarly, the 
                <italic toggle="yes">tet</italic>(S) gene is a ribosomal protein gene which is transferable through the same channels like the 
                <italic toggle="yes">tet</italic>(O) gene. The 
                <italic toggle="yes">tet</italic>(A) gene encodes the 46 kDa membrane-bound efflux protein. This protein carries tetracycline from the cell membrane and its first known resistance role in 
                <italic toggle="yes">Campylobacter</italic> spp. was reported in 2014
                <sup>
                    <xref ref-type="bibr" rid="ref-16">16</xref>
                </sup>. </p>
            <p>In 
                <italic toggle="yes">Campylobacter</italic> spp. resistance to the antibiotic quinolone is mainly due to a single point mutation in the quinolone resistance determination region of 
                <italic toggle="yes">gyrA</italic> gene (QRDF)
                <sup>
                    <xref ref-type="bibr" rid="ref-20">20</xref>,
                    <xref ref-type="bibr" rid="ref-21">21</xref>
                </sup>, at amino acid 86 by replacement of Thr by Ile
                <sup>
                    <xref ref-type="bibr" rid="ref-22">22</xref>
                </sup>. Occasionally, mutation in topoisomerase IV (ParC) results to resistance against quinolones. Other amino acids substitutions have been reported by Paddock 
                <italic toggle="yes">et al</italic>. and others
                <sup>
                    <xref ref-type="bibr" rid="ref-23">23</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-26">26</xref>
                </sup>. In 
                <italic toggle="yes">Campylobacter</italic> there has been no documented mutational change to the 
                <italic toggle="yes">gyrB</italic> subunit gene in relation to resistance against quinolones; however, Piddock 
                <italic toggle="yes">et al</italic>.
                <sup>
                    <xref ref-type="bibr" rid="ref-22">22</xref>
                </sup>, and	Changkwanyeun 
                <italic toggle="yes">et al</italic>.
                <sup>
                    <xref ref-type="bibr" rid="ref-27">27</xref>
                </sup> noted that resistance to ciprofloxacin in 
                <italic toggle="yes">Campylobacter</italic> is mediated by mutations on the 
                <italic toggle="yes">gyrA</italic> gene.</p>
        </sec>
        <sec sec-type="methods">
            <title>Methods</title>
            <sec>
                <title>Study area and background</title>
                <p>The study was carried out at primary schools located at Kibera informal settlement, Nairobi County, Kenya in July 2015. Kibera is located at an altitude of 1670 m above sea level, at latitude 36&#x00b0;50&#x2019; east and longitude 1&#x00b0;17&#x2019; south, about 140 km south of the equator. Kibera is located 5 km South of Nairobi Central Business District (CBD), the Capital of Kenya. Kibera is divided into 9 official villages. The average living place is 3 m
                    <sup>2</sup>, with an average of 5 persons per place. The study site presents a population with diverse enteric infections
                    <sup>
                        <xref ref-type="bibr" rid="ref-28">28</xref>
                    </sup>. In total, 11 primary schools with pupil population ranging from 120 to 189 were randomly sampled and, 40 to 80 stool samples collected from pupils in each school, depending on the school population, making a total of 580 stool samples. With a known prevalence of 40.7% of soil transmitted helminths in school going children in urban Kenya, the formula by Martin 
                    <italic toggle="yes">et al</italic>. (1998) was used to determine the desired minimum sample size. The schools were distributed in five administrative villages, namely Lindi, Silanga, Laini Saba, Gatwekera and Mashimoni. Participants&#x2019; parents provided written consent through the care givers. This was done during parents&#x2019; school meetings, where parents were informed of the intended study and its benefits, those who agreed their children to participate were issued with consent forms for them to sign and return to their class teacher. Only those who their parents consented participated in the study.</p>
                <p>Research clearances were given by National Commission for Science, Technology and Innovation (research clearance permit No. 3756) and ethical clearance (PKU/278/1274) was granted by Kenyatta University Ethical Review Committees.</p>
                <p>
                    <bold>
                        <italic toggle="yes">Campylobacter spp. culture.</italic>
                    </bold> In the laboratory, 5 g of freshly collected faecal sample was pre-enriched by suspending the faeces in 45 ml buffered peptone water (BPW) (Oxoid, Hampshire, England) and incubating the suspension at 42&#x00b0;C for 18 hours in a 50-ml closed culture tube. The pre-enrichment was inoculated onto modified campylobacter charcoal-cefoperazone deoxycholate (mCCDA) agar plates with supplement (polymyxin B 2500IU, rifampincin 5 mg, trimethoprim 5 mg and cycloheximide 50 mg) using a sterile swab and the plates incubated at 45&#x00b0;C for up to 48 hours under anaerobic conditions. The mCCDA culture media (Oxoid, Hampshire, England) was prepared according to manufacturer&#x2019;s instructions and stored at 4&#x00b0;C until use. Anaerobic conditions were achieved by adding a 21.3-g sachet of CampyGen
                    <sup>TM</sup> 3.5 L (Oxoid, Hampshire, England) in an anaerobic jar with the cultures resulting to a maximum of 13.2% O
                    <sub>2</sub> within 24 hours and 9.5% CO
                    <sub>2</sub> in 1 hours. After 24 hours of incubation, the plates were checked for characteristic growth and plates without growth were re-incubated for an additional 24 hours. Characteristic colonies (grey/white or creamy grey in colour with moist appearance) were examined and counted. Distinct colonies were harvested and tested for oxidase and peroxidase breakdown, by picking a portion of distinct colony with a sterile wire loop and placing it on a drop of 30% hydrogen peroxide on a clean microscope slide. Production of effervescent air bubbles was recorded as peroxidases positive. The same colonies were tested for cytochrome oxidase enzyme production by placing a portion of the test colony onto oxidase paper impregnated with NNN&#x2019;N&#x2019; tetramethyl-p-phenylene-diamine dihydrochloride (Oxoid, Basingstoke, UK). Purple colour change was recorded as positive reaction. Reactive colonies were processed for DNA and a portion stored in skimmed milk at -80&#x00b0;C for further characterization.</p>
                <p>
                    <bold>
                        <italic toggle="yes">DNA preparation from bacteria colonies and multiplex PCR.</italic>
                    </bold> For DNA preparation, three distinct colonies from pure bacteria cultures were lifted with a sterile wire loop and suspended in 0.5 ml sterile, distilled water. The suspension was boiled for 30 minutes in a water bath. After cooling to room temperature, the preparation was centrifuged at 2000 x g and the supernatant harvested and stored at -20&#x00b0;C until analysis by polymerase chain reaction (PCR). PCR was first undertaken to confirm 
                    <italic toggle="yes">Campylobacter</italic> genus for the isolates after which three specific species were also identified: 
                    <italic toggle="yes">C. coli</italic>, 
                    <italic toggle="yes">C. jejuni</italic> and 
                    <italic toggle="yes">C. lari</italic>. The Campylobacter DNA preparation (2 &#x00b5;l) was amplified in a 25 &#x00b5;l reaction mix by mixing 2.5 &#x00b5;l 10X PCR buffer (Coraload), 0.5 &#x00b5;l dNTPs, 0.125 &#x00b5;l Taq DNA polymerase (Inqaba biotec, Pretoria, South Africa) and 0.1 &#x00b5;l of each specific primer to 10 pmole (Inqaba Biotec, Pretoria, South Africa), 2 &#x00b5;l DNA template and 18.657 &#x00b5;l DNAse/RNAse-free distilled water. The DNA was amplified using a program of initial heating at 94&#x00b0;C for 5 min followed by 30 cycles of denaturation at 94&#x00b0;C for 1 minutes, annealing at 56&#x00b0;C for 1 min, extension at 72&#x00b0;C for 1 min with a final extension of 72&#x00b0;C for 10 min using a Veriti 96 wells thermocycler, (Applied Biosystems, model 9902, Singapore) in 0.2-ml PCR tubes. The PCR products were kept at -20&#x00b0;C until gel electrophoresis was done.</p>
                <p>The Campylobacter genus-specific primers, C412F and C1228 R, described by Linton 
                    <italic toggle="yes">et al</italic>.
                    <sup>
                        <xref ref-type="bibr" rid="ref-29">29</xref>
                    </sup> were used to amplify a 812 bp fragment within the 16S rRNA gene of Campylobacter species using forward primer C412F 5&#x2019;-GGATGACACTTTTCGGAGC-3&#x2019; and reverse primer; C1228R 5&#x2019;-R-CATTGTAGCACGTGTGTC-3&#x2019;. Multiplex PCR was carried out for 
                    <italic toggle="yes">C. jejuni</italic> and 
                    <italic toggle="yes">C. coli</italic> with specific primers CjejlpxAF, CjejipxAR (shared by both species) and CcollpxAF, described by Klena 
                    <italic toggle="yes">et al</italic>.
                    <sup>
                        <xref ref-type="bibr" rid="ref-15">15</xref>
                    </sup> to amplify 331 bp and 391 bp fragment flanking the 
                    <italic toggle="yes">lpxA</italic> gene. The primer sequences were; CjejlpxAF (forward) 5&#x2019;-ACAACTTGGTGACGATGTTGTA-3&#x2019;, CjejipxAR (reverse, shared by CjejlpxA and CcollpxA) 5&#x2019;-CAATCATGDGCDATATGASAATAHGCCAT-3&#x2019; for 
                    <italic toggle="yes">C. jejuni</italic> and for 
                    <italic toggle="yes">C. coli</italic> CcollpxAF (forward) 5&#x2019;-AGACAAATAAGAGAGAATCAG -3&#x2019;. The 
                    <italic toggle="yes">C. lari</italic> specific primers were forward primer lpxAC
                    <italic toggle="yes">,</italic> 5&#x2019;-AGACAATAAGAGAGAATCAG-3&#x2019; and reverse primer lpxARKK2M, 5&#x2019;CAATCATGDGCDATATGASAATAHGCCAT-3&#x2019;.</p>
                <p>The PCR products were visualized by electrophoresis in a 1.5% agarose (Genetics analysis grade, Fisher Scientific, New Jersey) gel stained with 0.02% ethidium bromide and amplicons identified against molecular marker (50 bp DNA ladder, England Biolab) run alongside the samples.</p>
                <p>For confirmation, the positively identified PCR products were submitted for sequencing. The PCR products were fist purified using exonuclease1, shrimp alkaline phosphatase mixture (ExoSAP mix) according to the manufacturer&#x2019;s instructions. Briefly, this was done by adding 2.5 &#x00b5;l of ExoSAP mix to 10 &#x00b5;l PCR product. The mixture was then incubated at 37&#x00b0;C for 30 minutes and reaction stopped by heating at 95&#x00b0;C for 5 minutes. The clean PCR product was then quantified using a fluorimeter (Qubit 2.0, Invitrogen, USA). The clean DNA was first labelled with BigDye terminator v3.1kit (Applied Biosystem, CA, USA) according to the manufacturer&#x2019;s instructions and loaded into Genetic Analyzer (ABI 3730 capillary analyser; Applied Biosystems, Foster City, CA, USA) for sequencing. Sequences were obtained in ABI files that were opened and edited to remove unspecific ends using 
                    <ext-link ext-link-type="uri" xlink:href="https://bioedit.software.informer.com/">BioEdit</ext-link> version 7.0.4 (Hall, CA, USA) software. Clean sequences were then submitted to 
                    <ext-link ext-link-type="uri" xlink:href="http://blast.ncbi.nlm.nih.govblast.cgi/">NCBI GenBank</ext-link> database and 
                    <ext-link ext-link-type="uri" xlink:href="https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch">BLASTn</ext-link> program used to test for homology and genetic identity of bacteria isolates.</p>
                <p>
                    <bold>
                        <italic toggle="yes">Antimicrobial sensitivity test (AST) for PCR-confirmed Campylobacter spp..</italic>
                    </bold> 
                    <italic toggle="yes">Campylobacter</italic> spp. isolates were phenotypically tested for resistance using selected antimicrobial agents according to European committee on antimicrobial susceptibility testing (EUCAST)
                    <sup>
                        <xref ref-type="bibr" rid="ref-30">30</xref>
                    </sup>. Only those antibiotics with EUCAST established breakpoints were tested, namely tetracyclines (tetracycline 30 mg), quinolones (ciprofloxacin 5 mg, naladixic acid 30 mg) and macrolides (erythromycin 15mg). Mueller-Hinton agar plates plus 5% de-fibrinated horse blood with 20 mg/L &#x03b2;-nicotinamide adenine dinucleotide Mueller-Hinton fastidious (&#x03b2;-NAD (MH-F)); (Oxoid, Basingstoke, UK) were prepared and dried at 35&#x00b0;C, with the lid removed, for 15 min prior to inoculation to reduce swarming. Inoculum turbidity was adjusted to McFarland 0.5 prior to inoculation. The antibiotic discs were placed on the inoculated plates using a sterile multi-disc dispenser and incubated in a microaerobic environment at 41&#x00b1;1&#x00b0;C for 24 hours. Isolates with insufficient growth after 24 hours of incubation were re-incubated immediately and inhibition zones read after a total of 40&#x2013;48 hours incubation. The inhibition zones were defined by the point showing no growth when viewed from the front of the plate with the lid removed and with reflected light.</p>
                <p>
                    <bold>
                        <italic toggle="yes">Genotypic characterization of Campylobacter spp. isolates for antimicrobial resistance.</italic>
                    </bold> The 90 antibiotic resistant, PCR-characterized 
                    <italic toggle="yes">Campylobacter</italic> spp. isolates including; 11 
                    <italic toggle="yes">C. lari</italic>, 30 
                    <italic toggle="yes">C. coli</italic> and 49 
                    <italic toggle="yes">C. jejuni</italic> were selected for demonstration of genes encoding for resistance to tetracyclines. Presence of four tetracycline resistance genes, 
                    <italic toggle="yes">tet</italic>(A), 
                    <italic toggle="yes">tet</italic>(B), 
                    <italic toggle="yes">tet</italic>(C) and 
                    <italic toggle="yes">tet</italic>(O), were tested. Multiplex PCR was carried out as described above. Primers used for amplification of products encoding for the resistant genes to tetracyclines are shown in 
                    <xref ref-type="table" rid="T1">Table 1</xref>.</p>
                <table-wrap id="T1" orientation="portrait" position="anchor">
                    <label>Table 1. </label>
                    <caption>
                        <title>Primers used for identifying tetracyclines encoding genes in selected bacteria isolates.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1">Primer sequence 5&#x2019;-3&#x2019;</th>
                                <th align="left" colspan="1" rowspan="1">Direction</th>
                                <th align="left" colspan="1" rowspan="1">PCR
                                    <break/>product, bp</th>
                                <th align="left" colspan="1" rowspan="1">genes</th>
                                <th align="left" colspan="1" rowspan="1">Reference</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1">GTGAAACCCAACATACCCC</td>
                                <td align="left" colspan="1" rowspan="1">Forward</td>
                                <td align="left" colspan="1" rowspan="1">577</td>
                                <td align="left" colspan="1" rowspan="1">
                                    <italic toggle="yes">Tet</italic>(A)</td>
                                <td align="left" colspan="1" rowspan="1">
                                    <xref ref-type="bibr" rid="ref-31">31</xref>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1">GAAGGCAAGCAGGATGTAG</td>
                                <td align="left" colspan="1" rowspan="1">Reverse</td>
                                <td align="left" colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1">CCTCAGCTTCTCAACGCGT</td>
                                <td align="left" colspan="1" rowspan="1">Forward</td>
                                <td align="left" colspan="1" rowspan="1">635</td>
                                <td align="left" colspan="1" rowspan="1">
                                    <italic toggle="yes">Tet</italic>(B)</td>
                                <td align="left" colspan="1" rowspan="1">
                                    <xref ref-type="bibr" rid="ref-31">31</xref>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1">GCACCTTGCTGAGACTCTT</td>
                                <td align="left" colspan="1" rowspan="1">Reverse</td>
                                <td align="left" colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1">ACTTGGAGCCACTATCGAC</td>
                                <td align="left" colspan="1" rowspan="1">Forward</td>
                                <td align="left" colspan="1" rowspan="1">880</td>
                                <td align="left" colspan="1" rowspan="1">
                                    <italic toggle="yes">Tet</italic>(C)</td>
                                <td align="left" colspan="1" rowspan="1">
                                    <xref ref-type="bibr" rid="ref-32">32</xref>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1">CTACAATCCATGCCAACCC</td>
                                <td align="left" colspan="1" rowspan="1">Reverse</td>
                                <td align="left" colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1">AACTTAGGCATTCTGGCTCAC</td>
                                <td align="left" colspan="1" rowspan="1">Forward</td>
                                <td align="left" colspan="1" rowspan="1">515</td>
                                <td align="left" colspan="1" rowspan="1">
                                    <italic toggle="yes">Tet</italic>(O)</td>
                                <td align="left" colspan="1" rowspan="1">
                                    <xref ref-type="bibr" rid="ref-33">33</xref>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1">TCCCACTGTTCCATATCGTCA</td>
                                <td align="left" colspan="1" rowspan="1">Reverse</td>
                                <td align="left" colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1"/>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
            </sec>
        </sec>
        <sec sec-type="results">
            <title>Results</title>
            <p>Of the 580 stool samples collected in 11 schools in Kibera, 294 (51%) were phenotypically characterized as suspect 
                <italic toggle="yes">Campylobacter</italic> spp. When these isolates were subjected to PCR using genus and species-specific primers, 106 (18%) isolates were confirmed to be 
                <italic toggle="yes">Campylobacter</italic> spp. Among the 106 isolates, 28 (4.8%) were 
                <italic toggle="yes">C. coli</italic>, 44 (7.6%) 
                <italic toggle="yes">C. jejuni</italic> while 11 (1.9%) were 
                <italic toggle="yes">C. lari</italic> (
                <xref ref-type="fig" rid="f1">Figure 1</xref>). In total, 23 (4.0%) 
                <italic toggle="yes">Campylobacter</italic> isolates were not species identified as belonging to 
                <italic toggle="yes">C. coli</italic>, 
                <italic toggle="yes">C. jejuni</italic> or 
                <italic toggle="yes">C. lari</italic> (
                <xref ref-type="table" rid="T2">Table 2</xref>).</p>
            <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                <label>Figure 1. </label>
                <caption>
                    <title>Ethidium bromide stained 1.5% agarose gel electrophoresis of 
                        <italic toggle="yes">Campylobacter coli</italic> (391 bp) and 
                        <italic toggle="yes">C. jejuni</italic> (331 bp) in a multiplex PCR with a 100-bp ladder.</title>
                    <p>From left to right, lane 1 and 2 positive samples; mixture of 
                        <italic toggle="yes">Campylobacter jejuni</italic> and 
                        <italic toggle="yes">Campylobacter coli</italic> obtained from sequenced laboratory isolates (PHPT 1 &amp;2). Lane 3 negative control: purified water. Lanes 4, 5, 9, 11 and 12: 
                        <italic toggle="yes">C. jejuni</italic>. Lanes 6, 8 and 15: 
                        <italic toggle="yes">Campylobacter coli</italic>. Lanes 7, 10, 13 and 14: negative samples. Lane 16: 100-bp ladder.</p>
                </caption>
                <graphic orientation="portrait" position="float" xlink:href="https://f1000research-files.f1000.com/manuscripts/23456/244b357e-3fcf-48ce-a5d4-35fafaa0d725_figure1.gif"/>
            </fig>
            <table-wrap id="T2" orientation="portrait" position="anchor">
                <label>Table 2. </label>
                <caption>
                    <title>Molecular characterization by polymerase chain reaction of Campylobacter spp. isolates from school going children&#x2019;s stool samples.</title>
                </caption>
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="left" colspan="1" rowspan="1">School</th>
                            <th align="center" colspan="1" rowspan="1">
                                <italic toggle="yes">C. coli</italic>
                            </th>
                            <th align="center" colspan="1" rowspan="1">
                                <italic toggle="yes">C. jejuni</italic>
                            </th>
                            <th align="center" colspan="1" rowspan="1">
                                <italic toggle="yes">C. lari</italic>
                            </th>
                            <th align="center" colspan="1" rowspan="1">Other 
                                <italic toggle="yes">C.</italic> spp.</th>
                            <th align="center" colspan="1" rowspan="1">Total 
                                <italic toggle="yes">Campylobacter</italic>
                                <break/>spp.</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td align="left" colspan="1" rowspan="1">A</td>
                            <td align="left" colspan="1" rowspan="1">0</td>
                            <td align="left" colspan="1" rowspan="1">0</td>
                            <td align="left" colspan="1" rowspan="1">0</td>
                            <td align="left" colspan="1" rowspan="1">5</td>
                            <td align="left" colspan="1" rowspan="1">8.5% (5/59)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1">B</td>
                            <td align="left" colspan="1" rowspan="1">3</td>
                            <td align="left" colspan="1" rowspan="1">0</td>
                            <td align="left" colspan="1" rowspan="1">2</td>
                            <td align="left" colspan="1" rowspan="1">3</td>
                            <td align="left" colspan="1" rowspan="1">21% (8/38)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1">C</td>
                            <td align="left" colspan="1" rowspan="1">0</td>
                            <td align="left" colspan="1" rowspan="1">0</td>
                            <td align="left" colspan="1" rowspan="1">2</td>
                            <td align="left" colspan="1" rowspan="1">3</td>
                            <td align="left" colspan="1" rowspan="1">8.1% (5/62)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1">D</td>
                            <td align="left" colspan="1" rowspan="1">6</td>
                            <td align="left" colspan="1" rowspan="1">7</td>
                            <td align="left" colspan="1" rowspan="1">0</td>
                            <td align="left" colspan="1" rowspan="1">2</td>
                            <td align="left" colspan="1" rowspan="1">34% (15/44)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1">E</td>
                            <td align="left" colspan="1" rowspan="1">8</td>
                            <td align="left" colspan="1" rowspan="1">9</td>
                            <td align="left" colspan="1" rowspan="1">1</td>
                            <td align="left" colspan="1" rowspan="1">2</td>
                            <td align="left" colspan="1" rowspan="1">25% (20/79)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1">F</td>
                            <td align="left" colspan="1" rowspan="1">0</td>
                            <td align="left" colspan="1" rowspan="1">3</td>
                            <td align="left" colspan="1" rowspan="1">0</td>
                            <td align="left" colspan="1" rowspan="1">1</td>
                            <td align="left" colspan="1" rowspan="1">21% (4/19)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1">G</td>
                            <td align="left" colspan="1" rowspan="1">5</td>
                            <td align="left" colspan="1" rowspan="1">10</td>
                            <td align="left" colspan="1" rowspan="1">1</td>
                            <td align="left" colspan="1" rowspan="1">2</td>
                            <td align="left" colspan="1" rowspan="1">23% (18/80)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1">H</td>
                            <td align="left" colspan="1" rowspan="1">0</td>
                            <td align="left" colspan="1" rowspan="1">3</td>
                            <td align="left" colspan="1" rowspan="1">1</td>
                            <td align="left" colspan="1" rowspan="1">1</td>
                            <td align="left" colspan="1" rowspan="1">9.4% (5/53)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1">I</td>
                            <td align="left" colspan="1" rowspan="1">0</td>
                            <td align="left" colspan="1" rowspan="1">4</td>
                            <td align="left" colspan="1" rowspan="1">1</td>
                            <td align="left" colspan="1" rowspan="1">0</td>
                            <td align="left" colspan="1" rowspan="1">17% (5/30)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1">J</td>
                            <td align="left" colspan="1" rowspan="1">5</td>
                            <td align="left" colspan="1" rowspan="1">6</td>
                            <td align="left" colspan="1" rowspan="1">2</td>
                            <td align="left" colspan="1" rowspan="1">2</td>
                            <td align="left" colspan="1" rowspan="1">22% (15/69)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1">K</td>
                            <td align="left" colspan="1" rowspan="1">1</td>
                            <td align="left" colspan="1" rowspan="1">2</td>
                            <td align="left" colspan="1" rowspan="1">1</td>
                            <td align="left" colspan="1" rowspan="1">2</td>
                            <td align="left" colspan="1" rowspan="1">13% (6/47)</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1">Total</td>
                            <td align="left" colspan="1" rowspan="1">28</td>
                            <td align="left" colspan="1" rowspan="1">44</td>
                            <td align="left" colspan="1" rowspan="1">11</td>
                            <td align="left" colspan="1" rowspan="1">23</td>
                            <td align="left" colspan="1" rowspan="1">106</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1">Prevalence</td>
                            <td align="center" colspan="1" rowspan="1">4.8% (28/580)</td>
                            <td align="center" colspan="1" rowspan="1">7.6% (44/580)</td>
                            <td align="center" colspan="1" rowspan="1">1.9% (11/580)</td>
                            <td align="center" colspan="1" rowspan="1">3.9% (23/580)</td>
                            <td align="center" colspan="1" rowspan="1">18.3% (106/580)</td>
                        </tr>
                    </tbody>
                </table>
            </table-wrap>
            <sec>
                <title>Antimicrobial sensitivity test (AST) for confirmed 
                    <italic toggle="yes">Campylobacter</italic> spp.</title>
                <p>The EUCAST disk diffusion method was used to determine the resistance patterns of only the identified isolates, 68 (
                    <italic toggle="yes">C. jejuni, C. coli</italic> and 
                    <italic toggle="yes">C. lari</italic>) confirmed by PCR (
                    <xref ref-type="table" rid="T2">Table 2</xref>). Fifteen isolates were not recovered from storage culture after identification and thus not tested
                    <italic toggle="yes">.</italic> All of the antibiotics studied had isolates showing resistance towards them, with 96% of isolates resistant to tetracycline (30 mg), 93% to naladixic acid (30 mg) and all the isolates tested resistant to erythromycin (15 mg). The antibiotic that most isolates were sensitive to was ciprofloxacin (5 mg) which still had 84% of the isolates showing resistance (
                    <xref ref-type="table" rid="T3">Table 3</xref>). Of the four 
                    <italic toggle="yes">tet</italic> genes tested, 
                    <italic toggle="yes">tet</italic>(A) was most frequently identified in 20 (29.1%) of the isolates followed by 
                    <italic toggle="yes">tet</italic>(O) in 8 (11.7%) isolates and 
                    <italic toggle="yes">tet</italic>(C) in only 2 (2.9%) isolates. None of the isolates had more than one 
                    <italic toggle="yes">tet</italic> gene demonstrated. (
                    <xref ref-type="table" rid="T3">Table 3</xref>).</p>
                <table-wrap id="T3" orientation="portrait" position="anchor">
                    <label>Table 3. </label>
                    <caption>
                        <title>Drug resistant patterns of pathogenic 
                            <italic toggle="yes">Campylobacter</italic> spp. isolates from school children&#x2019;s stool samples, n=68 using EUCAST disk diffusion method (2016) and presence of genes coding for tetracycline resistance.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="2" valign="top">Antimicrobial agent</th>
                                <th align="center" colspan="1" rowspan="2" valign="top">Resistance genes (no. of
                                    <break/>isolates)</th>
                                <th align="center" colspan="4" rowspan="1" valign="top">Resistant isolates (EUCAST, 2016)</th>
                            </tr>
                            <tr>
                                <th align="center" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">C. jejuni</italic> (n=30)</th>
                                <th align="center" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">C. coli</italic> (n=27)</th>
                                <th align="center" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">C. lari</italic> (n=11)</th>
                                <th align="center" colspan="1" rowspan="1" valign="top">Total Resistance (%)</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Tetracyline (30 mg)</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">Tet</italic>(A) (20), 
                                    <italic toggle="yes">tet</italic>(B) (0), 
                                    <italic toggle="yes">tet</italic>(C)
                                    <break/>(2), 
                                    <italic toggle="yes">tet</italic>(O) (8)</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">30</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">26</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">11</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">67 (96)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Ciprofloxacin (5 mg)</td>
                                <td align="center" colspan="1" rowspan="2" valign="top">Genotyping not done</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">25</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">23</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">9</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">57 (84)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Naladixic acid (30 mg)</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">29</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">24</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">10</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">63 (93)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Erythromycin (15 mg)</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">Genotyping not done</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">30</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">27</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">11</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">68 (100)</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
            </sec>
            <sec>
                <title>Multidrug resistant profiles in 
                    <italic toggle="yes">Campylobacter</italic> spp. isolates</title>
                <p>Four MDR profiles were observed. All of the tested isolates were resistant to two or more antimicrobial agents, but the majority of isolates (84%) were resistant to all the antibiotics studied (profile 3 and 4). 
                    <italic toggle="yes">Campylobacter jejuni</italic> had the highest number of isolates that were MDR with 25 (37%) isolates being resistant to all four antibiotics tested (profile 1). 
                    <italic toggle="yes">C. coli</italic> had 23 (34%) isolates resistant to all the four antibiotics while 
                    <italic toggle="yes">C. lari</italic> had 9 (13%) isolates resistant to the four antibiotics. One (1.5%) 
                    <italic toggle="yes">C. jejuni</italic> and 
                    <italic toggle="yes">C. lari</italic> isolates was resistant to drugs in profile 2, while three (3%) 
                    <italic toggle="yes">C. coli</italic> isolates were in this profile. However, profile 4 had only one (1%) 
                    <italic toggle="yes">C. coli</italic> isolate while profile 4 had 2 (3%) 
                    <italic toggle="yes">C. lari,</italic> 4 (6%) 
                    <italic toggle="yes">C. coli</italic> and 5 (7%) 
                    <italic toggle="yes">C. jejuni</italic> MDR isolates (
                    <xref ref-type="table" rid="T4">Table 4</xref>).</p>
                <table-wrap id="T4" orientation="portrait" position="anchor">
                    <label>Table 4. </label>
                    <caption>
                        <title>Multidrug resistance (MDR) Campylobacter spp. isolates profile by antimicrobial sensitivity testing.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="2" valign="top">Drug (dose) profiles</th>
                                <th align="left" colspan="3" rowspan="1" valign="top">No of MDR resistant isolates
                                    <break/>per species</th>
                                <th align="left" colspan="1" rowspan="2" valign="top">MDR 
                                    <italic toggle="yes">Camylobacter</italic>
                                    <break/>spp. isolates (n=68)</th>
                            </tr>
                            <tr>
                                <th align="center" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">C. jejuni</italic>
                                    <break/>(n=30)</th>
                                <th align="center" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">C. coli</italic>
                                    <break/>(n=27)</th>
                                <th align="center" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">C. lari</italic>
                                    <break/>(n=11)</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">1. Ciprofloxacin (5 mg), nalidixic acid (30 mg),
                                    <break/>tetracycline (30 mg), erythromycin (15mg)</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">25</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">23</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">9</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">57 (84%)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">2. Nalidixic acid (30 mg), tetracycline (30 mg),
                                    <break/>erythromycin (15 mg)</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">3</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">5 (7.3%)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">3. Ciprofloxacin (5 mg), erythromycin (15mg)</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">5</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">4</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">2</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">11 (16%)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">4. Tetracycline (30 mg), erythromycin (15 mg)</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">0</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">0</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">1 (1.5%)</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
            </sec>
        </sec>
        <sec sec-type="discussion">
            <title>Discussions</title>
            <p>A prevalence of 18% 
                <italic toggle="yes">Campylobacter</italic> spp. in asymptomatic school going children was confirmed with PCR in this study. 
                <italic toggle="yes">Campylobacter</italic> isolation from healthy children has been reported in developing countries
                <sup>
                    <xref ref-type="bibr" rid="ref-34">34</xref>
                </sup> at a prevalence of 15%, which closely agrees with this study&#x2019;s findings. The authors attributed the infections with 
                <italic toggle="yes">Campylobacter</italic> to close contact with reservoir animals like chickens, as well as poor sanitation
                <sup>
                    <xref ref-type="bibr" rid="ref-20">20</xref>
                </sup>. Both of these factors are prominent in this study area, where chicken share housing with humans. The isolates were further characterized and 
                <italic toggle="yes">C. jejuni</italic> was isolated more frequently (7.6%) as compared to 
                <italic toggle="yes">C. coli</italic> (4.8%) and 
                <italic toggle="yes">C. lari</italic> (2%), whereas 4% were none of the three species analysed. This distribution between 
                <italic toggle="yes">Campylobacter</italic> species agrees with other reports from both developed and developing countries, as well as from Kenya
                <sup>
                    <xref ref-type="bibr" rid="ref-34">34</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref-36">36</xref>
                </sup>. Among the thermophilic 
                <italic toggle="yes">Campylobacter</italic> species, 
                <italic toggle="yes">C. upsaliensis</italic> was not characterised using PCR in this study. Phenotypic methods available for identification and differentiation of individual thermophilic 
                <italic toggle="yes">Campylobacter</italic> spp. are non-conclusive and more sensitive methods are recommended
                <sup>
                    <xref ref-type="bibr" rid="ref-37">37</xref>
                </sup>.</p>
            <p>The 
                <italic toggle="yes">Campylobacter</italic> spp. resistant to tetracycline had more 
                <italic toggle="yes">tet</italic>(A) genes than 
                <italic toggle="yes">tet</italic>(O) genes which were found in 20 (29%) and 8(12%) isolates respectively. This echoes Nguyen 
                <italic toggle="yes">et al</italic>.
                <sup>
                    <xref ref-type="bibr" rid="ref-20">20</xref>
                </sup> who identified more 
                <italic toggle="yes">tet</italic>(A) genes than 
                <italic toggle="yes">tet</italic>(O) genes in Kenyan 
                <italic toggle="yes">Campylobacter</italic> spp. isolates from chickens, at 35% and 13%. respectively. The high resistance rates obtained in this study, with 84% of isolates being resistant to all four agents, was in agreement with findings of Nguyen 
                <italic toggle="yes">et al</italic>.
                <sup>
                    <xref ref-type="bibr" rid="ref-20">20</xref>
                </sup> and Coker 
                <italic toggle="yes">et al</italic>.
                <sup>
                    <xref ref-type="bibr" rid="ref-34">34</xref>
                </sup> for chicken and human 
                <italic toggle="yes">Campylobacter</italic> isolates, respectively. Both studies reported more than 70% resistance to ciprofloxacin, nalidixic acid and tetracycline. However, these results contrast with those of a report on human 
                <italic toggle="yes">Campylobacter</italic> from diarrhoea cases in Western Kenya, where resistance towards ciprofloxacin were observed in 6% cases, towards nalidixic acid in 26%, and towards tetracycline in 18%. Erythromycin resistance in this study was also high, which contrasts the findings of Nguyen 
                <italic toggle="yes">et al</italic>.
                <sup>
                    <xref ref-type="bibr" rid="ref-20">20</xref>
                </sup> in chicken-isolated 
                <italic toggle="yes">Campylobacter</italic>. In the setting of the current study, with domestic animals hosted within the human settlements and poor sanitation, the possibility of cross-infection is very likely, as is horizontal transfer of antimicrobial resistance-encoding genes. Ciprofloxacin and erythromycin are the drugs of choice for 
                <italic toggle="yes">Campylobacter</italic> treatment. These drugs are often used in Kenya for self-treatment of infections other than gastroenteritis, and resistance can be expected to increase in developing countries
                <sup>
                    <xref ref-type="bibr" rid="ref-34">34</xref>
                </sup>.</p>
            <p>In conclusion, the World Health Organization has recommended a multi-tiered and goal-oriented approach to control 
                <italic toggle="yes">Campylobacter</italic> infections in both human and animals. Appropriate measures need to be taken on the various routes of transmission, including contaminated water and milk, through chlorination and pasteurization, respectively. Poultry, as the major reservoir, must be the main target
                <sup>
                    <xref ref-type="bibr" rid="ref-4">4</xref>
                </sup>.</p>
        </sec>
        <sec>
            <title>Data availability</title>
            <p>Figshare: Multidrug resistant Campylobacter jejuni, Campylobacter coli and Campylobacter lari isolated from asymptomatic school going children in Kibera slum, Kenya.xlsx. 
                <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.11302292">https://doi.org/10.6084/m9.figshare.11302292</ext-link>
                <sup>
                    <xref ref-type="bibr" rid="ref-38">38</xref>
                </sup>.</p>
            <p>File &#x2018;Multidrug resistant Campylobacter jejuni, Campylobacter coli and Campylobacter lari isolated from asymptomatic school going children in Kibera slum, Kenya.xlsx&#x2019; contains the bacterial species identified from samples, the antibiotic zones of inhibition and the presence or absence of antibiotic-resistance genes in each sample.</p>
            <p>Data are available under the terms of the 
                <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/legalcode">Creative Commons Attribution 4.0 International license</ext-link> (CC-BY 4.0).</p>
        </sec>
    </body>
    <back>
        <ack>
            <title>Acknowledgements</title>
            <p>The authors are grateful to the Grand Challenge Canada and the Swedish research Council VR for funding this study; the pupils, teachers and parents of the study schools; The contribution of the technical members of staff Department of Public Health Pharmacology &amp; Toxicology and the staff of Peepoople Kenya is highly acknowledged.</p>
        </ack>
        <ref-list>
            <ref id="ref-1">
                <label>1</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Havelaar</surname>
                            <given-names>AH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Haagsma</surname>
                            <given-names>JA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mangen</surname>
                            <given-names>MJ</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Disease burden of foodborne pathogens in the Netherlands, 2009.</article-title>
                    <source>

                        <italic toggle="yes">Int J Food Microbiol.</italic>
</source>
                    <year>2012</year>;<volume>156</volume>(<issue>3</issue>):<fpage>231</fpage>&#x2013;<lpage>8</lpage>.
                    <pub-id pub-id-type="pmid">22541392</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.ijfoodmicro.2012.03.029</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-2">
                <label>2</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Scallan</surname>
                            <given-names>E</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hoekstra</surname>
                            <given-names>RM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Angulo</surname>
                            <given-names>FJ</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Foodborne illness acquired in the United States--major pathogens.</article-title>
                    <source>

                        <italic toggle="yes">Emerg Infect Dis.</italic>
</source>
                    <year>2011</year>;<volume>17</volume>(<issue>1</issue>):<fpage>7</fpage>&#x2013;<lpage>15</lpage>.
                    <pub-id pub-id-type="pmid">21192848</pub-id>
                    <pub-id pub-id-type="doi">10.3201/eid1701.p11101</pub-id>
                    <pub-id pub-id-type="pmcid">3375761</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-3">
                <label>3</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Nachamkin</surname>
                            <given-names>I</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Blaser</surname>
                            <given-names>MJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tompkins</surname>
                            <given-names>LS</given-names>
                        </name>
</person-group>:
                    <article-title>
                        <italic toggle="yes">Campylobacter jejuni</italic> current status and future trends.</article-title>
                    <source>

                        <italic toggle="yes">American Society for Microbiology.</italic>
</source>Washington D.C.<year>1992</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://agris.fao.org/agris-search/search.do?recordID=US9520340">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-4">
                <label>4</label>
                <mixed-citation publication-type="journal">
                    <collab>World Health Organization: </collab>
                    <article-title>Antimicrobial resistance: global report on surveillance</article-title>.<year>2014</year>;<fpage>1</fpage>&#x2013;<lpage>7</lpage>.
                    <ext-link ext-link-type="uri" xlink:href="https://apps.who.int/iris/handle/10665/112642">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-5">
                <label>5</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Blaser</surname>
                            <given-names>MJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Perez</surname>
                            <given-names>GP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Smith</surname>
                            <given-names>PF</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Extra intestinal 
                        <italic toggle="yes">Campylobacter jejuni</italic> and 
                        <italic toggle="yes">Campylobacter coli</italic> infections: host factors and strain characteristics</article-title>
                    <source>

                        <italic toggle="yes">J Infect Dis.</italic>
</source>
                    <year>1986</year>;<volume>153</volume>(<issue>3</issue>):<fpage>552</fpage>&#x2013;<lpage>559</lpage>.
                    <pub-id pub-id-type="pmid">3512731</pub-id>
                    <pub-id pub-id-type="doi">10.1093/infdis/153.3.552</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-6">
                <label>6</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Dasti</surname>
                            <given-names>JI</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tareen</surname>
                            <given-names>AM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lugert</surname>
                            <given-names>R</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>
                        <italic toggle="yes">Campylobacter jejuni</italic>: a brief overview on pathogenicity-associated factors and disease-mediating mechanisms.</article-title>
                    <source>

                        <italic toggle="yes">Int J Med Microbiol.</italic>
</source>
                    <year>2010</year>;<volume>300</volume>(<issue>4</issue>):<fpage>205</fpage>&#x2013;<lpage>11</lpage>.
                    <pub-id pub-id-type="pmid">19665925</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.ijmm.2009.07.002</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-7">
                <label>7</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>van Vliet</surname>
                            <given-names>AHM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ketley</surname>
                            <given-names>JM</given-names>
                        </name>
</person-group>:
                    <article-title>Pathogenesis of enteric 
                        <italic toggle="yes">Campylobacter</italic> infection.</article-title>
                    <source>

                        <italic toggle="yes">J Appl Microbiol.</italic>
</source>
                    <year>2001</year>;<volume>90</volume>:<fpage>45S</fpage>&#x2013;<lpage>56S</lpage>.
                    <pub-id pub-id-type="pmid">11422560</pub-id>
                    <pub-id pub-id-type="doi">10.1046/j.1365-2672.2001.01353.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-8">
                <label>8</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Castillo</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Escartin</surname>
                            <given-names>EF</given-names>
                        </name>
</person-group>:
                    <article-title>Survival of 
                        <italic toggle="yes">Campylobacter jejuni</italic>on sliced watermelon and papaya.</article-title>
                    <source>

                        <italic toggle="yes">J Food Prot.</italic>
</source>
                    <year>1994</year>;<volume>57</volume>(<issue>2</issue>):<fpage>166</fpage>&#x2013;<lpage>168</lpage>.
                    <pub-id pub-id-type="pmid">31113149</pub-id>
                    <pub-id pub-id-type="doi">10.4315/0362-028X-57.2.166</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-9">
                <label>9</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Fricker</surname>
                            <given-names>CR</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Park</surname>
                            <given-names>RWA</given-names>
                        </name>
</person-group>:
                    <article-title>A two-year study of the distribution of 'thermophilic' campylobacters in human, environmental and food samples from the Reading area with particular reference to toxin production and heat-stable serotype.</article-title>
                    <source>

                        <italic toggle="yes">J Appl Bacteriol.</italic>
</source>
                    <year>1989</year>;<volume>66</volume>(<issue>6</issue>):<fpage>477</fpage>&#x2013;<lpage>490</lpage>.
                    <pub-id pub-id-type="pmid">2753842</pub-id>
                    <pub-id pub-id-type="doi">10.1111/j.1365-2672.1989.tb04568.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-10">
                <label>10</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Linton</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Owen</surname>
                            <given-names>RJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Stanley</surname>
                            <given-names>J</given-names>
                        </name>
</person-group>:
                    <article-title>Primer sequences for genus Campylobacter Rapid identification by PCR of the lettuce treated with spray-contaminated irrigation water.</article-title>
                    <source>

                        <italic toggle="yes">J Food Prot.</italic>
</source>
                    <year>1996</year>;<volume>73</volume>:<fpage>1023</fpage>&#x2013;<lpage>9</lpage>.</mixed-citation>
            </ref>
            <ref id="ref-11">
                <label>11</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Patton</surname>
                            <given-names>DM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Shaffer</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Edmonds</surname>
                            <given-names>P</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Human disease associated with "Campylobacter upsaliensis" (catalase-negative or weakly positive Campylobacter species) in the United States.</article-title>
                    <source>

                        <italic toggle="yes">J Clin Microbiol.</italic>
</source>
                    <year>1989</year>;<volume>27</volume>(<issue>1</issue>):<fpage>66</fpage>&#x2013;<lpage>73</lpage>.
                    <pub-id pub-id-type="pmid">2913038</pub-id>
                    <pub-id pub-id-type="pmcid">267234</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-12">
                <label>12</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Klein</surname>
                            <given-names>BS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Vergeront</surname>
                            <given-names>JM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Blazer</surname>
                            <given-names>MJ</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Campylobacter Infection Associated With Raw Milk. An Outbreak of Gastroenteritis Due to Campylobacter Jejuni and Thermotolerant Campylobacter Fetus Subsp Fetus.</article-title>
                    <source>

                        <italic toggle="yes">JAMA.</italic>
</source>
                    <year>1986</year>;<volume>255</volume>(<issue>3</issue>):<fpage>361</fpage>&#x2013;<lpage>364</lpage>.
                    <pub-id pub-id-type="pmid">3753617</pub-id>
                    <pub-id pub-id-type="doi">10.1001/jama.1986.03370030081032</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-13">
                <label>13</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Frost</surname>
                            <given-names>JA</given-names>
                        </name>
</person-group>:
                    <article-title>Current epidemiological issues in human Campylobacteriosis.</article-title>
                    <source>

                        <italic toggle="yes">Symp Ser Soc Appl Microbiol.</italic>
</source>
                    <year>2001</year>;<volume>90</volume>(<issue>30</issue>):<fpage>85S</fpage>&#x2013;<lpage>95S</lpage>.
                    <pub-id pub-id-type="pmid">11422564</pub-id>
                    <pub-id pub-id-type="doi">10.1046/j.1365-2672.2001.01357.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-14">
                <label>14</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Wassenaar</surname>
                            <given-names>TM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Newell</surname>
                            <given-names>DG</given-names>
                        </name>
</person-group>:
                    <article-title>Genotyping of 
                        <italic toggle="yes">Campylobacter</italic> spp.</article-title>
                    <source>

                        <italic toggle="yes">Appl Environ Microbiol.</italic>
</source>
                    <year>2000</year>;<volume>66</volume>(<issue>1</issue>):<fpage>1</fpage>&#x2013;<lpage>9</lpage>.
                    <pub-id pub-id-type="pmid">10618195</pub-id>
                    <pub-id pub-id-type="doi">10.1128/aem.66.1.1-9.2000</pub-id>
                    <pub-id pub-id-type="pmcid">91777</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-15">
                <label>15</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Klena</surname>
                            <given-names>JD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Parker</surname>
                            <given-names>CT</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Knibb</surname>
                            <given-names>K</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Differentiation of 
                        <italic toggle="yes">Campylobacter coli, Campylobacter jejuni,</italic>

                        <italic toggle="yes">Campylobacter lari, </italic>and 
                        <italic toggle="yes">Campylobacter upsaliensis</italic> by a multiplex PCR developed from the nucleotide sequence of the lipid A gene lpxA.</article-title>
                    <source>

                        <italic toggle="yes">J Clin Microbiol.</italic>
</source>
                    <year>2004</year>;<volume>42</volume>(<issue>12</issue>):<fpage>5549</fpage>&#x2013;<lpage>5557</lpage>.
                    <pub-id pub-id-type="pmid">15583280</pub-id>
                    <pub-id pub-id-type="doi">10.1128/JCM.42.12.5549-5557.2004</pub-id>
                    <pub-id pub-id-type="pmcid">535264</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-16">
                <label>16</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Abdi-Hachesoo</surname>
                            <given-names>B</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Khoshbakht</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sharifiyazdi</surname>
                            <given-names>H</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Tetracycline Resistance Genes in 
                        <italic toggle="yes">Campylobacter jejuni</italic> and 
                        <italic toggle="yes">C. coli</italic> Isolated From Poultry Carcasses.</article-title>
                    <source>

                        <italic toggle="yes">Jundishapur J Microbiol.</italic>
</source>
                    <year>2014</year>;<volume>7</volume>(<issue>9</issue>):<fpage>e12129</fpage>.
                    <pub-id pub-id-type="pmid">25485062</pub-id>
                    <pub-id pub-id-type="doi">10.5812/jjm.12129</pub-id>
                    <pub-id pub-id-type="pmcid">4255377</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-17">
                <label>17</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Chopra</surname>
                            <given-names>I</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Roberts</surname>
                            <given-names>M</given-names>
                        </name>
</person-group>:
                    <article-title>Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance.</article-title>
                    <source>

                        <italic toggle="yes">Microbiol Mol Biol Rev.</italic>
</source>
                    <year>2001</year>;<volume>65</volume>(<issue>2</issue>):<fpage>232</fpage>&#x2013;<lpage>60</lpage>.
                    <pub-id pub-id-type="pmid">11381101</pub-id>
                    <pub-id pub-id-type="doi">10.1128/MMBR.65.2.232-260.2001</pub-id>
                    <pub-id pub-id-type="pmcid">99026</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-18">
                <label>18</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Mazi</surname>
                            <given-names>W</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Senok</surname>
                            <given-names>AC</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Al-Mahmeed</surname>
                            <given-names>A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Trends in antibiotic sensitivity pattern and molecular detection of tet (O)-mediated tetracycline resistance in 
                        <italic toggle="yes">Campylobacter jejuni</italic> isolates from human and poultry sources.</article-title>
                    <source>

                        <italic toggle="yes">Jpn J Infect Dis.</italic>
</source>
                    <year>2008</year>;<volume>61</volume>(<issue>1</issue>):<fpage>82</fpage>&#x2013;<lpage>4</lpage>.
                    <pub-id pub-id-type="pmid">18219143</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-19">
                <label>19</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Gibreel</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wetsch</surname>
                            <given-names>NM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Taylor</surname>
                            <given-names>DE</given-names>
                        </name>
</person-group>:
                    <article-title>Contribution of the CmeABC efflux pump to macrolide and tetracycline resistance in Campylobacter jejuni.</article-title>
                    <source>

                        <italic toggle="yes">Antimicrob Agents Chemother.</italic>
</source>
                    <year>2007</year>;<volume>51</volume>(<issue>9</issue>):<fpage>3212</fpage>&#x2013;<lpage>3216</lpage>.
                    <pub-id pub-id-type="pmid">17606685</pub-id>
                    <pub-id pub-id-type="doi">10.1128/AAC.01592-06</pub-id>
                    <pub-id pub-id-type="pmcid">2043232</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-20">
                <label>20</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Nguyen</surname>
                            <given-names>TNM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hotzel</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Njeru</surname>
                            <given-names>J</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Antimicrobial resistance of Campylobacter isolates from small scale and backyard chicken in Kenya.</article-title>
                    <source>

                        <italic toggle="yes">Gut Pathog.</italic>
</source>
                    <year>2016</year>;<volume>8</volume>(<issue>1</issue>):<fpage>39</fpage>.
                    <pub-id pub-id-type="pmid">27570543</pub-id>
                    <pub-id pub-id-type="doi">10.1186/s13099-016-0121-5</pub-id>
                    <pub-id pub-id-type="pmcid">5002103</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-21">
                <label>21</label>
                <mixed-citation publication-type="journal">
                    <collab>EFSA: </collab>
                    <article-title>Scientific opinion of the panel on biological hazards on a request from the European Food Safety Authority on foodborne antimicrobial resistance as a biological hazard.</article-title>
                    <source>

                        <italic toggle="yes">The EFSA J.</italic>
</source>
                    <year>2008</year>;<volume>765</volume>:<fpage>1</fpage>&#x2013;<lpage>87</lpage>.
                    <ext-link ext-link-type="uri" xlink:href="https://orbit.dtu.dk/en/publications/scientific-opinion-of-the-panel-on-biological-hazards-on-a-reques-3">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-22">
                <label>22</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Piddock</surname>
                            <given-names>LJV</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ricci</surname>
                            <given-names>V</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Pumbwe</surname>
                            <given-names>L</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Fluoroquinolone resistance in Campylobacter species from man and animals: detection of mutations in topoisomerase genes.</article-title>
                    <source>

                        <italic toggle="yes">J Antimicrob Chemother.</italic>
</source>
                    <year>2003</year>;<volume>51</volume>(<issue>1</issue>):<fpage>19</fpage>&#x2013;<lpage>26</lpage>.
                    <pub-id pub-id-type="pmid">12493783</pub-id>
                    <pub-id pub-id-type="doi">10.1093/jac/dkg033</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-23">
                <label>23</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hakanen</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jousimies-Somer</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Siitonen</surname>
                            <given-names>A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Fluoroquinolone resistance in 
                        <italic toggle="yes">Campylobacter jejuni</italic> isolates in travelers returning to Finland: association of ciprofloxacin resistance to travel destination.</article-title>
                    <source>

                        <italic toggle="yes">Emerg Infect Dis.</italic>
</source>
                    <year>2003</year>;<volume>9</volume>(<issue>2</issue>):<fpage>267</fpage>&#x2013;<lpage>70</lpage>.
                    <pub-id pub-id-type="pmid">12604004</pub-id>
                    <pub-id pub-id-type="doi">10.3201/eid0902.020227</pub-id>
                    <pub-id pub-id-type="pmcid">2901943</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-24">
                <label>24</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Bachoual</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ouabdesselam</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mory</surname>
                            <given-names>F</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Single or double mutational alterations of gyrA associated with fluoroquinolone resistance in 
                        <italic toggle="yes">Campylobacter jejuni</italic> and 
                        <italic toggle="yes">Campylobacter coli.</italic>
</article-title>
                    <source>

                        <italic toggle="yes">Microb Drug Resist.</italic>
</source>
                    <year>2001</year>;<volume>7</volume>(<issue>3</issue>):<fpage>257</fpage>&#x2013;<lpage>61</lpage>.
                    <pub-id pub-id-type="pmid">11759087</pub-id>
                    <pub-id pub-id-type="doi">10.1089/10766290152652800</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-25">
                <label>25</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Zirnstein</surname>
                            <given-names>G</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>Y</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Swaminathan</surname>
                            <given-names>B</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Ciprofloxacin resistance in 
                        <italic toggle="yes">Campylobacter jejuni</italic> isolates: detection of 
                        <italic toggle="yes">gyrA</italic> resistance mutations by mismatch amplification mutation assay PCR and DNA sequence analysis.</article-title>
                    <source>

                        <italic toggle="yes">J Clin Microbiol.</italic>
</source>
                    <year>1999</year>;<volume>37</volume>(<issue>10</issue>):<fpage>3276</fpage>&#x2013;<lpage>80</lpage>.
                    <pub-id pub-id-type="pmid">10488192</pub-id>
                    <pub-id pub-id-type="doi">10.1128/JCM.37.10.3276-3280.1999</pub-id>
                    <pub-id pub-id-type="pmcid">85547</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-26">
                <label>26</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ruiz</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Go&#x00f1;i</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Marco</surname>
                            <given-names>F</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Increased resistance to quinolones in 
                        <italic toggle="yes">Campylobacter jejuni</italic>a genetic analysis of gyrA gene mutations in quinolone-resistant clinical isolates.</article-title>
                    <source>

                        <italic toggle="yes">Microbiol Immunol.</italic>
</source>
                    <year>1998</year>;<volume>42</volume>(<issue>3</issue>):<fpage>223</fpage>&#x2013;<lpage>6</lpage>.
                    <pub-id pub-id-type="pmid">9580533</pub-id>
                    <pub-id pub-id-type="doi">10.1111/j.1348-0421.1998.tb02274.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-27">
                <label>27</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Changkwanyeun</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yamaguchi</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kongsoi</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Impact of mutations in DNA gyrase genes on quinolone resistance in 
                        <italic toggle="yes">Campylobacter jejuni</italic>.</article-title>
                    <source>

                        <italic toggle="yes">Drug Test Anal.</italic>
</source>
                    <year>2016</year>;<volume>8</volume>(<issue>10</issue>):<fpage>1071</fpage>-<lpage>1076</lpage>.
                    <pub-id pub-id-type="pmid">26857529</pub-id>
                    <pub-id pub-id-type="doi">10.1002/dta.1937</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-28">
                <label>28</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Karanja</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wambari</surname>
                            <given-names>E</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Okumu</surname>
                            <given-names>D</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>A study of awareness of malaria among Kibera population: Implication for community based intervention.</article-title>
                    <source>

                        <italic toggle="yes">J Natl Inst Public Health.</italic>
</source>
                    <year>2002</year>;<volume>51</volume>(<issue>1</issue>):<fpage>51</fpage>&#x2013;<lpage>55</lpage>.
                    <ext-link ext-link-type="uri" xlink:href="http://education.ku.ac.ke/images/stories/research/A%20Study%20of%20awareness%20of%20malaria%20among%20Kibera%20population.pdf">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-29">
                <label>29</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Linton</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Owen</surname>
                            <given-names>RJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Stanley</surname>
                            <given-names>J</given-names>
                        </name>
</person-group>:
                    <article-title>Primer sequences for genus Campylobacter Rapid identification by PCR of the lettuce treated with spray-contaminated irrigation water.</article-title>
                    <source>

                        <italic toggle="yes">J Food Prot.</italic>
</source>
                    <year>1996</year>;<volume>73</volume>:<fpage>1023</fpage>&#x2013;<lpage>9</lpage>.</mixed-citation>
            </ref>
            <ref id="ref-30">
                <label>30</label>
                <mixed-citation publication-type="journal">
                    <article-title>The European Committee on Antimicrobial Susceptibility Testing. Breakpoint tables for interpretation of MICs and zone diameters</article-title>. Version 9.0.<year> 2019</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.eucast.org/">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-31">
                <label>31</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Randall</surname>
                            <given-names>LP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Cooles</surname>
                            <given-names>SW</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Osborn</surname>
                            <given-names>MK</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Antibiotic resistance genes, integrons and multiple antibiotic resistance in thirty-five serotypes of Salmonella enterica isolated from humans and animals in the UK.</article-title>
                    <source>

                        <italic toggle="yes">J Antimicrob Chemother.</italic>
</source>
                    <year>2004</year>;<volume>53</volume>(<issue>2</issue>):<fpage>208</fpage>&#x2013;<lpage>216</lpage>.
                    <pub-id pub-id-type="pmid">14729766</pub-id>
                    <pub-id pub-id-type="doi">10.1093/jac/dkh070</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-32">
                <label>32</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Van</surname>
                            <given-names>TT</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Chin</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Chapman</surname>
                            <given-names>T</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Safety of raw meat and shellfish in Vietnam: an analysis of 
                        <italic toggle="yes">Escherichia coli</italic> isolations for antibiotic resistance and virulence genes.</article-title>
                    <source>

                        <italic toggle="yes">Int J Food Microbiol.</italic>
</source>
                    <year>2008</year>;<volume>124</volume>(<issue>3</issue>):<fpage>217</fpage>&#x2013;<lpage>223</lpage>.
                    <pub-id pub-id-type="pmid">18457892</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.ijfoodmicro.2008.03.029</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-33">
                <label>33</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Abdi-Hachesoo</surname>
                            <given-names>B</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Khoshbakht</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sharifiyazdi</surname>
                            <given-names>H</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Tetracycline Resistance Genes in 
                        <italic toggle="yes">Campylobacter jejuni</italic> and 
                        <italic toggle="yes">C. coli</italic> Isolated From Poultry Carcasses.</article-title>
                    <source>

                        <italic toggle="yes">Jundishapur J Microbiol.</italic>
</source>
                    <year>2014</year>;<volume>7</volume>(<issue>9</issue>):<fpage>e12129</fpage>.
                    <pub-id pub-id-type="pmid">25485062</pub-id>
                    <pub-id pub-id-type="doi">10.5812/jjm.12129</pub-id>
                    <pub-id pub-id-type="pmcid">4255377</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-34">
                <label>34</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Coker</surname>
                            <given-names>AO</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Isokpehi</surname>
                            <given-names>RD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Thomas</surname>
                            <given-names>BN</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Human Campylobacteriosis in Developing Countries.</article-title>
                    <source>

                        <italic toggle="yes">Emerg Infect Dis.</italic>
</source>
                    <year>2002</year>;<volume>8</volume>(<issue>3</issue>):<fpage>28</fpage>&#x2013;<lpage>32</lpage>.
                    <pub-id pub-id-type="pmid">11927019</pub-id>
                    <pub-id pub-id-type="doi">10.3201/eid0803.010233</pub-id>
                    <pub-id pub-id-type="pmcid">2732465</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-35">
                <label>35</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Brooks</surname>
                            <given-names>JT</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ochieng</surname>
                            <given-names>JB</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kumar</surname>
                            <given-names>L</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Surveillance for bacterial diarrhea and antimicrobial resistance in rural Western Kenya, 1997-2003.</article-title>
                    <source>

                        <italic toggle="yes">Clin Infect Dis.</italic>
</source>
                    <year>2006</year>;<volume>43</volume>(<issue>4</issue>):<fpage>393</fpage>&#x2013;<lpage>401</lpage>.
                    <pub-id pub-id-type="pmid">16838225</pub-id>
                    <pub-id pub-id-type="doi">10.1086/505866</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-36">
                <label>36</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Oberhelman</surname>
                            <given-names>RA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Taylor</surname>
                            <given-names>DN</given-names>
                        </name>
</person-group>:
                    <article-title>
                        <italic toggle="yes">Campylobacter</italic> infections in developing countries</article-title>. (ed): Nachamkin I., Blaser M.J,
                    <italic toggle="yes">Campylobacter</italic>, 2nd edition. Washington: American Society for Microbiology.<year>2000</year>;<fpage>139</fpage>&#x2013;<lpage>53</lpage>.</mixed-citation>
            </ref>
            <ref id="ref-37">
                <label>37</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Steinhauserova</surname>
                            <given-names>I</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ceskova</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Fojtikova</surname>
                            <given-names>K</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Identification and thermophilic 
                        <italic toggle="yes">Campylobacter</italic> spp. by phenotypic and molecular methods.</article-title>
                    <source>

                        <italic toggle="yes">J of App Micobiol.</italic>
</source>
                    <year>2001</year>;<volume>90</volume>(<issue>3</issue>):<fpage>470</fpage>&#x2013;<lpage>475</lpage>.
                    <pub-id pub-id-type="pmid">11298244</pub-id>
                    <pub-id pub-id-type="doi">10.1046/j.1365-2672.2001.01267.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-38">
                <label>38</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Gitahi</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Gathura</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Gicheru</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Multidrug resistant Campylobacter jejuni, Campylobacter coli and Campylobacter lari isolated from asymptomatic school going children in Kibera slum, Kenya.xlsx.</article-title>
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>Journal contribution.<year>2020</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.6084/m9.figshare.11302292.v2">http://www.doi.org/10.6084/m9.figshare.11302292.v2</ext-link>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report65988">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.23456.r65988</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Jeon</surname>
                        <given-names>Byeonghwa</given-names>
                    </name>
                    <xref ref-type="aff" rid="r65988a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-6665-5558</uri>
                </contrib>
                <aff id="r65988a1">
                    <label>1</label>Division of Environmental Health Sciences, School of Public Health, University of Minnesota, St. Paul, MN, USA</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>21</day>
                <month>7</month>
                <year>2020</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2020 Jeon B</copyright-statement>
                <copyright-year>2020</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport65988" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.21299.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>
                <bold>Abstract:</bold> 
                <list list-type="order">
                    <list-item>
                        <p>Background: Should read: the antibiotic resistance patterns of</p>
                    </list-item>
                    <list-item>
                        <p>Results: antibiotic concentrations, not the amount, need to be used. This applies to the entire manuscript.&#x00a0;</p>
                    </list-item>
                </list> </p>
            <p> 
                <bold>Introduction:</bold> 
                <list list-type="order">
                    <list-item>
                        <p>"It was not until recently that&#x00a0;
                            <italic>Campylobacter</italic>&#x00a0;spp. was shown to exhibit multidrug resistance (MDR). Before that, the bacteria were considered to be susceptible" it may be difficult to say like this as the MDR was reported more than two decades ago.&#x00a0;</p>
                    </list-item>
                    <list-item>
                        <p>Quinolone resistance determination region (QRDR).</p>
                    </list-item>
                    <list-item>
                        <p>Campylobacter does not have parC. Mutations in parC cause FQ resistance in E. coli and Salmonella; but this is not applied to Campylobacter.</p>
                    </list-item>
                </list> </p>
            <p> 
                <bold>Method:</bold> 
                <list list-type="order">
                    <list-item>
                        <p>Antibiotic concentrations, not the amount, are to be made known in the supplement.&#x00a0;&#x00a0;</p>
                    </list-item>
                    <list-item>
                        <p>Campylobacter is microaerophilic.&#x00a0; 'Anaerobic conditions' --&gt; 'Microaerobic conditions'.</p>
                    </list-item>
                    <list-item>
                        <p>Did the authors include a quality control strain to the antibiotic susceptibility test?&#x00a0;</p>
                    </list-item>
                </list> </p>
            <p> 
                <bold>Results:</bold> 
                <list list-type="order">
                    <list-item>
                        <p>Figure 1: There is no positive control for C. lari</p>
                    </list-item>
                </list> </p>
            <p> 
                <bold>Others:</bold> 
                <list list-type="order">
                    <list-item>
                        <p>Did&#x00a0;the asymptomatic children carrying Campylobacter have any previous experience of diarrhea? It may be an important point to discuss&#x00a0;whether Campylobacter-positive children are completely asymptomatic carriers or were recovering from Campylobacter exposure without manifesting clinical symptoms.</p>
                    </list-item>
                    <list-item>
                        <p>Overall, it reads well, but there are some minor English issues in some parts.&#x00a0;</p>
                    </list-item>
                </list>
            </p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Not applicable</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>No source data required</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Partly</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Partly</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Antibiotic resistance of foodborne pathogens</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report59720">
        <front-stub>
            <article-id pub-id-type="doi">10.5256/f1000research.23456.r59720</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Karama</surname>
                        <given-names>Musafiri</given-names>
                    </name>
                    <xref ref-type="aff" rid="r59720a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-6197-5309</uri>
                </contrib>
                <aff id="r59720a1">
                    <label>1</label>Veterinary Public Health Section, Department of Paraclinical Sciences, Faculty of Veterinary Science, University of Pretoria, Onderstepoort, South Africa</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>27</day>
                <month>3</month>
                <year>2020</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2020 Karama M</copyright-statement>
                <copyright-year>2020</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport59720" related-article-type="peer-reviewed-article" xlink:href="10.12688/f1000research.21299.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>The manuscript entitled &#x201c;Multidrug-resistant&#x00a0;
                <italic>Campylobacter jejuni, Campylobacter coli and Campylobacter lari</italic>&#x00a0;isolated from asymptomatic school-going children in Kibera slum, Kenya&#x201d; investigated the occurrence and antimicrobial resistance of 
                <italic>Campylobacter</italic> spp. among school-going children in a populous slum of Kenya. The study is well executed but will need wordsmithing to improve its readability.</p>
            <p> </p>
            <p> A weakness of this manuscript is the lack of recent citations in the reference list. I suggest the authors update the reference list by including at least more than 60% of references that have been published in the last 10 years or less. &#x00a0;The conclusion will also have to focus on the topic of the research (Campylobacter prevalence and antimicrobial resistance in young children).</p>
            <p> </p>
            <p> I have inserted in the manuscript my corrections and suggestions to improve its clarity and style. This can be found 
                <ext-link ext-link-type="uri" xlink:href="https://f1000researchdata.s3.amazonaws.com/linked/287810.F1000-Review-MKARAMA_nduhiu_gitahi-2020_03_09.docx">here</ext-link>.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>No</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Yes</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>No</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Molecular epidemiology of Foodborne pathogens: Pathogenic E. coli, Campylobacter and Salmonella and bacteriophages.</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
    </sub-article>
</article>
