ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Article

Terminal investment induced by a bacteriophage in a rhizosphere bacterium

[version 1; peer review: 2 approved with reservations]
PUBLISHED 02 Oct 2012
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

Abstract

Despite knowledge about microbial responses to abiotic stress, few studies have investigated stress responses to antagonistic species, such as competitors, predators and pathogens. While it is often assumed that interacting populations of bacteria and phage will coevolve resistance and exploitation strategies, an alternative is that individual bacteria tolerate or evade phage predation through inducible responses to phage presence. Using the microbial model Pseudomonas fluorescens SBW25 and its lytic DNA phage SBW25Φ2, we demonstrate the existence of an inducible response in the form of a transient increase in population growth rate, and found that the response was induced by phage binding. This response was accompanied by a decrease in bacterial cell size, which we propose to be an associated cost. We discuss these results in the context of bacterial ecology and phage-bacteria co-evolution.

Keywords

stress / inducible response / Pseudomonas fluorescens / bacteriophages

Introduction

Pathogens are ubiquitous in natural communities1 and the antagonistic interactions they establish with their hosts are recognized as one of the main drivers of evolutionary diversification2,3. Hosts can reduce the impact of pathogens through three non-mutually exclusive processes4: (i) avoidance of either infected individuals, habitats where the pathogen is prevalent, or of the pathogen itself5, (ii) resistance to the actual infection process or post-infection immune defences6, and (iii) tolerance7. Research on these responses has generally focused on animal and plant models, but there is growing appreciation that microbes, particularly bacteria, can exhibit similar responses. For instance, bacteria can be selected for heightened levels of genetic resistance towards infection by pathogens810. On the other hand, although bacteria are known to display plastic responses to various types of environmental stresses11,12 and to competition13, it is unknown whether they can do so when faced with natural enemies such as bacteriophages.

Plastic responses are an adaptive phenotypic change following an environmental stimulus, occurring without a concurrent change in the genotype14. They may involve behavioural, physiological or phenological changes15,16, and be triggered by direct or indirect contact with the stimulus17 or through communication with neighbouring organisms18. Phenotypic plasticity is considered to be a genetic adaptation to variable environments, but given the diversity of associated mechanisms and behaviours, it is not known to what extent different stimuli translate into different responses15,19.

Individual-level interactions between bacteria and phage may be conducive to induced responses. The first step of bacteriophage infection is the binding of phage proteins to bacterial surface proteins20, which then triggers conformational changes to both proteins21. Surface proteins used by the bacterium for signal transduction are known to be targets of bacteriophage adsorption22 and as such could trigger a response when bacteriophage binding is detected. Such a response would allow a bacterium to react to the pathogen and to eventually either evade or reduce the effects of the infection. Lytic phages are prime candidates for organisms against which bacteria may have evolved a stress response, because they typically interact with their host over short timescales, and death is inevitable once the phage has injected its DNA into a sensitive bacterial cell.

In addition, bacteriophages are widely distributed in the environment20 and interact with their hosts over relatively small spatial scales23 and throughout most of the year24,25. This could select for the expression of induced structural, physiological or behavioural responses to different enemies. Also, bacteria employ signalling pathways and have a known ability to communicate within populations26. Such pathways could induce and synchronise inducible responses before predators and pathogens are encountered, or at least before they have spread through the population, or before the point beyond which cell death is certain. All of these factors suggest that plastic stress responses to phage should be a common feature of bacterial cells and that such responses would have important repercussions for ecological and evolutionary interactions between phage and bacterial populations. Although molecular responses of bacteria to bacteriophages have been characterized27, the behavioral, ecological, and selective consequences of such responses are not known.

Here we demonstrate that when confronted with phage, bacteria express transient increases in division rate at a cost to individual biomass accumulation28. Specifically, we employ the rhizosphere bacterium Pseudomonas fluorescens SBW2529 to investigate how its population growth rate is affected by exposure to inactivated populations of is lytic bacteriophage SBW25Φ230. We find that bacteria exposed to inactivated phage increase their fission rate nearly two-fold at 24 hours post-exposure. This is followed by a continual decrease in fission rate relative to the control. We also show that bacteria exposed to inactivated phage were smaller in size compared to controls. All of these effects were enhanced as the density of inactivated phage was increased. The results are consistent with a behavioural strategy that increases allocation to reproduction under stressful conditions (i.e., “terminal investment”). Terminal investment is well characterised for other host-parasite associations31, but to our knowledge has not previously been observed in bacteria and phage.

Results

Bacteria exposed to UV-inactivated phage display a statistically significant higher growth rate over the first 24 hours post-exposure than non-phage controls (Kruskal-Wallis, df=3, P = 0.006; Figure 1). After this period, the estimated doubling time of exposed bacteria increased (i.e., their populations grew slower), and did so for the next 48 hours. This decrease in growth rate compared to controls is suggestive of a cost to the higher fission rate observed over the first 24 hours (Figure 1). During the fourth day post-exposure, control and treatment bacteria showed no significant differences in doubling time (KW, df=3, P > 0.05). That exposed bacteria returned to their ancestral growth rate suggests that the response over the first 24 hours was due to phenotypic plasticity and not selection on faster growing genotypes. There was a marginally significant effect on population growth for bacteria exposed to different phage concentrations (KW, df=2, P < 0.02), suggesting that the encounter rate between bacteria and phage is important in determining the population-level strength of the fission response.

18fd6c78-5a15-4eff-b4de-24705537a203_figure1.gif

Figure 1. Maximum doubling time (in hours) of biomass produced by bacteria exposed to different concentrations of UV-inactivated phage.

This was measured for four consecutive days following four hours exposure. Bacteria exposed to phage grew significantly faster than controls over the first day, and then expressed an apparent cost in terms of smaller cell size that attenuated by the fourth day. Central points are the means of 12 replicates, and the bars are standard errors.

We hypothesized that faster doubling times would come at a cost to cell size, since cells would have less time to metabolize and convert absorbed nutrients into cell structure Twenty-four hours post-exposure, we found that phage-treated bacteria were two to three times smaller (as measured by mean cellular width) than the control (KW, df=3, P < 0.0001; Figure 2). This difference in size gradually decreased over the following 3 days, but in contrast to growth rate (Figure 1), bacteria did not attain their ancestral cell size by the end of the experiment (Figure 2). Analyses of the distribution of several flow cytometry profiles showed that a difference in cell shape is unlikely to explain this result (see data associated to this article). Finally, observations using a transmission electron microscope showed that the cells remained rod-shaped for all treatments.

18fd6c78-5a15-4eff-b4de-24705537a203_figure2.gif

Figure 2. Mean bacterial cell size (forward scatter parameter) exposed to different concentrations of UV-inactivated phage, as per the method in Figure 1.

Bacteria exposed to phage at different concentrations do not significantly differ in size. Points and bars are the same as in Figure 1.

We did not observe any difference in the impact of live phage on bacterial populations exposed to the different treatments (KW, df=2, P = 0.153), suggesting that the inducible response does not alter bacteria resistance to phage predation.

Discussion

Our experiments reveal a previously unexplored behavioural response to bacteriophage predation: phage induce bacteria to reproduce earlier in their cell cycle. We hypothesize that this response increases the survival chances of progeny under natural conditions and demonstrate that this behaviour comes at a fitness cost of reduced size of daughter cells. Our experiments with UV-inactivated phage further demonstrate that this response is specifically due to phage binding.

These results support and extend both theoretical32 and empirical33,34 predictions that victims may lessen the fitness impact of their natural enemies through early reproduction, to cases where phenotypic responses are plastic and temporary. Increased allocation to reproduction in stressful environments–termed “fecundity compensation” or “terminal investment”31 – although never studied in bacteria-phage associations to our knowledge – has been extensively studied for other host-parasite (or organism - stressor) interactions. Terminal investment is characterized by increased reproductive rate or the earlier onset of reproduction, if the prospect of future reproduction is low35. Examples of such responses include faster host maturation36, increased oviposition rate37, and the modification of traits involved in the onset of reproduction38,39.

Phenotypically plastic responses are important in that they allow individuals to cope with environmental change during their lifetimes40. As such, plasticity is expected to be favoured in variable environments when the costs of induction and phenotypic change compensate for probabilistic (expected) fitness loss41. Although it is difficult to generalize about constitutive costs of resistance across biological systems42,43, limited evidence suggests that genetically evolved, constitutive resistance in bacteria to their lytic phage could have costs of as much as 5–10% to relative fitness44.

We employed inactivated bacteriophages to evaluate how phage contact with the bacterial outer membrane mediates bacterial responses. Bacteria could be selected to exhibit an escape response in several, non-mutually exclusive ways. First, non-virulent phage may signal the presence of virulent phage in the local environment (i.e., the bacterium does not perish following initial phage contact). Senescent (inactive) phage are present in natural environments25, and many phages bind to outer membrane proteins without being infective (e.g. the bacterium is resistant;44). Moreover, it is possible that phage could detach if they sense the host to be unsuitable45. Second, when phage infect the bacterium there may be a ‘race’ between the time it takes a bacterial cell to divide (and potentially survive) and the point of no recovery associated with the maturation of phage progeny and bacterial cell lysis. Third, the response may be a consequence of lysogens competing with lytic phages for host exploitation; the latter could benefit from early host reproduction in the presence of lytic competitors. However, sequencing of the P. fluorescens SBW25 genome revealed a low abundance of prophage-like regions46.

We were not able to determine whether the bacteria or the phage benefit from faster bacterial reproduction, and the literature reports effects both of facilitation and decrease in host metabolism upon infection47. Previous theoretical work suggests that phage productivity increases in bacteria with short life-cycles48. This is supported by recent empirical study employing the same strain of P. fluorescens49. Assuming that the physiological mechanisms involved in fission rate increases are the same in the two experiments, this suggests that rapid multiplication is not adaptive for the bacterium. Upon exposure to phage, bacteria reproduce faster, but experience a persistent reduction in individual size. Smaller cells have less surface area, and assuming that the density of receptor proteins does not change with cell size, this suggests that they will have lower encounter rates with phage. One possibility is that cell division allows bacterial cells to concentrate phage in one of the daughter cells50,51, resulting in some progeny managing to escape the pathogen. Future studies should therefore focus on the possible adaptive nature of this response for both bacterium and phage.

Methods

Bacteria cultures

Ancestral Pseudomonas fluorescens SBW2529 were inoculated into 30 ml microcosms containing 6 mL of King’s B medium (KB), and allowed to grow under alternating rotational agitation (200 rpm for 1 minute every 30 minutes). Every 48 h following plating on solid agar, 10 CFU of the smooth morphotype were transferred into fresh KB medium. After 10 transfers, the culture was composed of smooth morphotypes only. We continued this selection procedure for another 10 transfers and then arbitrarily isolated a single CFU, which was used for all experiments described below. Experiments were conducted at 28°C in KB medium under constant rotational agitation (200 rpm).

Phage cultures

We grew an arbitrarily selected clone of the ancestral phage SBW25Φ230 on an exponentially growing culture of fixed smooth P. fluorescens SBW25 in 3 mL of KB for 48 hours. This resulted in a culture containing approximately 108 phage per ml. The sample was then centrifuged for 3 minutes at 8000 rpm in a 1.5 ml Eppendorf tube, and the pellet discarded. Centrifugation was repeated three times to ensure all bacteria were removed (see Supplement Figure 1). Phages were then isolated by centrifuging the remaining supernatant for 8 minutes at 13000 rpm, and inoculating the pellet into fresh KB medium. The sample was thoroughly vortexed and exposed to UV light (Model 4.LC, Vilber Lourmat, Deutschland, 254 nm wavelength) at 5 cm distance for 4 hours. Extensive pilot studies demonstrated that this method was sufficient to kill all phage (see Supplement Figure 2).

Preliminary tests

We conducted a series of preliminary tests to verify how UV-inactivated phage affected bacterial hosts. First, observations under a transmission electron microscope showed that UV-inactivated phage were still intact and able to bind to their bacterial hosts. Second, we checked that bound UV-inactivated phage did not introduce phage DNA into the bacteria. This was done by inoculating 1 ml of UV-inactivated phage into 6 overnight bacterial cultures. Inactivated phage were allowed 4h to attach to the bacterial outer membrane. We separated phage and bacterial fractions by filtration using a 0.2 µm filter. We then conducted a full DNA extraction (WholeBlood NucleoSpin DNA extraction kit, Macherey-Nagel) of the filter. PCR was done using TPV1f (GATGTGAGAAAGCGATACACGG) and TPV1r (GAGAGAAGCGGGAGAGTGAA) sequences developed for this study, which selectively amplify a 550 bp fragment of the phage DNA and a 1200 bp fragment of the bacterial DNA (see Supplement Figure 1 for detailed protocols). We did not find any evidence that UV-inactivated phage was present in samples putatively containing bacteria only, thus confirming that the DNA of inactivated phage was not incorporated in the bacterial cell.

Experiments using UV-inactivated phage

We conducted an experiment to understand how UV-inactivated phage affected bacterial behaviour. Fixed smooth SBW25 bacteria were first cultivated in 6 ml KB in 30 mL universal glass vials. 20 µL of exponentially growing bacteria (c 104 bacterial cells) were transferred into fresh KB medium with either no phage or UV-inactivated phage at ratios of 1:10, 1:2, and 1:1 (corresponding to approximately 106, 5×106, and 107 phage per ml), and then allowed to interact for 4 hours under alternating shaking (200 rpm for 1 minute every 30 minutes). Bacteria were then separated from bound phage by centrifuging (see above) and placed in fresh KB medium. 1% of each population was transferred every 24 hours into new KB medium. Each of the 4 treatments was replicated 6 times and arranged arbitrarily in a rack for incubation.

Measures

Biomass doubling time (used as a proxy for population fitness) was measured in a Fluostar Optima spectrophotometer (28°C, constant agitation, 250 measures at 650 nm over 24 hours) each day, using the following formula:

(1)      Dt = [∆t ln(2)]/[ln(N*) - ln(N0)]

where N* and N0 are the total biomasses (measured as optical density, OD) before and after the exponential growth phase, and ∆t is the duration of the exponential phase. Exponential phase was determined by conducting a series of windowed linear regressions over the full growth curve, and retaining the part of the curve with the largest slope (computer code given in suppl. materials part 3).

Individual cell size was measured by flow-cytometry using a FacsCantoII (BD BioSciences, San Jose, California, USA), and data (forward scatter) were analysed using the flowCore package52 in R 2.12.053. Each measure was performed on a sample of 2×105 cells without dyes.

We also estimated the sensitivity of the different treatments to live phage by measuring changes in bacterial populations. At each 24-hour transfer, 1% of the bacterial population was placed in 2 mL of fresh KB, and 20 µL of amplified phage (ca 108 viral particles) were added (a control without phage was conducted simultaneously). Bacteria CFUs were counted on solid agar after 48 hours of incubation to estimate population size.

Due to non-normality of the data as assessed by a Shapiro test, we used a Kruskal-Wallis test to determine the significance of the between-treatments effects.

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 02 Oct 2012
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Poisot T, Bell T, Martinez E et al. Terminal investment induced by a bacteriophage in a rhizosphere bacterium [version 1; peer review: 2 approved with reservations]. F1000Research 2012, 1:21 (https://doi.org/10.12688/f1000research.1-21.v1)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 1
VERSION 1
PUBLISHED 02 Oct 2012
Views
32
Cite
Reviewer Report 22 Oct 2012
Paul E. Turner, Department of Ecology and Evolutionary Biology, Yale University, New Haven, CT, USA 
Approved with Reservations
VIEWS 32
1. ls there a subpopulation of the UV inactivated phage that are destroyed in the process of creating them, such that addition to bacterial cultures might constitute addition of DNA that can be taken up through transformation ? If so, ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Turner PE. Reviewer Report For: Terminal investment induced by a bacteriophage in a rhizosphere bacterium [version 1; peer review: 2 approved with reservations]. F1000Research 2012, 1:21 (https://doi.org/10.5256/f1000research.121.r458)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
29
Cite
Reviewer Report 08 Oct 2012
Britt Koskella, Centre for Ecology & Conservation Biosciences, College of Life & Environmental Sciences, University of Exeter, Exeter, UK 
Approved with Reservations
VIEWS 29
Understanding the response of bacterial populations to bacteriophage viruses is of central importance to predicting microbial dynamics. To do so requires knowledge about both the ecological and evolutionary responses of bacteria to phage in the environment.

This includes possible changes in ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Koskella B. Reviewer Report For: Terminal investment induced by a bacteriophage in a rhizosphere bacterium [version 1; peer review: 2 approved with reservations]. F1000Research 2012, 1:21 (https://doi.org/10.5256/f1000research.121.r457)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 02 Oct 2012
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.