ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Short Research Article
Updated

F1FoATP synthase a-subunit of Stenotrophomonas sp. DL18 from Indian Soda Lake, Lonar: a brief report

[version 2; peer review: 2 not approved]
PUBLISHED 26 Apr 2013
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

Abstract

Lonar Lake, an Indian soda lake with high alkaline conditions of pH 10.5, is well known for its biodiversity of extremophiles including alkaliphiles. Most of the molecular studies on Lonar Lake alkaliphiles are based on identification by 16S ribosomal RNA (16S rRNA). Various studies have reported alkaliphiles from different alkaline habitats other than Lonar Lake with alkaliphile specific amino acid residues in the F1FoATP synthase a-subunit. As the data on the alkaliphilic nature of bacteria from Lonar Lake is incompletely understood, the present report comprised of isolation and identification of alkaliphiles from Lonar Lake. Further, we studied the F1FoATP synthase a- subunit, with reference to alkaliphile specific domains, of one of the facultative alkaliphiles, Stenotrophomonas sp. DL18.

Keywords

ATP synthase a-subunit, alkaliphile, Lonar Lake India, 16S rRNA, Stenotrophomonas sp. DL18

Updated Changes from Version 1

In response to the referee comments, changes were made including modifications in the title, abstract and the discussion along with the deletion of supplementary figures showing homology modeling of a subunit, growth studies in alkaline conditions i.e. pH 7.0 to pH 12.0 and the scanning electron microscopy study. The aim of this updated article is to report on alkaliphile specific motifs in the a-subunit of ATP synthase from the isolated alkaliphile, Stenotrophomonas sp. DL18.

Scope of the updated brief report
Lonar Lake in India is a well known source of alkaliphiles. This is the first report from Lake Lonar that is based on alkaliphile specific motifs in the a-subunit of ATP synthase from the isolated alkaliphile, Stenotrophomonas sp. DL18. Although the present study does not have X ray crystallography data of purified ATP synthase and mutational studies, this brief report may initiate investigations of other facultative alkaliphiles research from Lonar Lake

To read any peer review reports and author responses for this article, follow the "read" links in the Open Peer Review table.

Introduction

ATP is molecular currency for a living cell, which is not only growing and dividing but also continuously responding to external environmental stimuli. To survive in extreme conditions, microorganisms devise specific adaptive mechanisms. Along with other transporter proteins, ATP synthase is widely considered one of the key molecules for adaptation at alkaline conditions. Hydrolysis of nucleoside triphosphates, specifically ATP, provides the chemical energy to drive a wide variety of cellular reactions. ATP synthesis is central to ATP production during oxidative phosphorylation. These are energy-coupling factors and hence called F1Fo-ATP synthases. The Fo integral membrane protein complex provides a transmembrane pore for protons, whereas the peripheral protein F1 is involved in catalysis1. F1 consists of five subunits, α3β3γ1δ1ε1, with a ring of α- and β-subunits alternating around a single γ-subunit2. Fo is a membrane embedded domain with subunits ab2c10–15. Out of these subunits, a-subunit is a stator and c-ring is a rotor ring through which ions (H+ or Na+) are translocated36. Each c-chain from the ring consists of two α-helices traversing the membrane and the polar loop extends out of the membrane to interact with the γ-and ε-subunits. A cytoplasmic F1 catalytic domain is connected by a membrane-embedded Fo domain by a central (γε) and peripheral (b2δ) stalk26. In general, downhill ion translocation across the membrane through Fo causes rotation of the c-ring, which induces conformational changes in the catalytic β-subunit and results in ATP synthesis. However, in alkaline conditions, the external pH is high i.e. above pH 8.0, which poses a major thermodynamic problem for ATP synthesis. Hence, the cytoplasmic pH needs to be maintained 1.5 to 2.3 pH units below the external environment, which generates an optimal condition for ATP synthesis.

Most studies have focused on the proton translocation channel in the a-subunit of ATP synthase79. However, similar experimental evidence from other geographic locations such as highly alkaline soda lakes needs further exploration to understand pH homeostasis in facultative alkaliphiles. This study explores the ATP synthase a-subunit of a facultative alkaliphilic aerobe isolated from Lonar Lake.

Methods

Isolation and identification of bacteria from the soda lake

In the present study, underwater sediment soil samples were collected 350 meters away from the Kamalaja Devi Temple end of Lonar Lake, Buldhana, Maharashtra, India. The initial screening was performed at pH 9.5. Then isolates were further studied in the range of pH 7 to pH 12. Across the pH gradient, morphologically different pink, orange and white bacterial colonies were observed. The bacterial genomic DNA of optimally grown bacteria at pH 9.5 with orange pigmentation was isolated by the DNAzol method10.

Further polymerase chain reaction (PCR) and sequencing of 16S rRNA was carried out for identification of bacterium11.

PCR and DNA sequencing of ATP synthase a-subunit of Stenotrophomonas species DL18

The following primers (Integrated DNA Technologies, USA) were used for the amplification of the 1.7 Kbp PCR product of the ATP synthase Fo subunit (consisting of atpB, atpC and atpA genes), based on a reference strain (i.e. S. maltophilia K279a): forward primer Steno atp1F (5’ CCTGGCGGATCCTTAGATCTCCG 3’) and reverse primer Steno atp1R (5’ CAGTGAGGATCCTTAGATCTCCGAGGCCAGCT 3’). Briefly, a PCR reaction mixture of 100 µl was prepared: 10x PCR buffer, 50 mM MgCl2, 10 mM dNTP mix, 100 picomoles each of forward and reverse primers, 5 units of Taq DNA polymerase (Chromous Biotech, India) with Pfu and 200 ng of bacterial genomic DNA template in nuclease free water. The thermal cycling conditions were: initial denaturation at 94°C for 5 min, followed by 30 cycles of denaturation at 94°C for 30s, primer annealing at 55°C for 30s and primer extension at 72°C for 3 min. A final extension was carried out at 72°C for 5 min. The amplified PCR product of 1.7 kbp was visualized on 1% agarose gel and the results were documented by Bio-Rad gel documentation system with Quantity One software (Bio-Rad, USA). Further, the DNA sequencing of the ATP Fo subunit of the selected isolate was performed via primer walking. An ATP synthase comparative study was performed by multiple sequence alignment with other strains from different categories i.e. acidophiles, neutrophiles and alkaliphiles, as shown in Figure 1.

afa4ce0d-9173-45e7-afe9-f6a7b40c7a4e_figure1.gif

Figure 1. Alignment of a-subunit of ATP synthase from neutrophiles and alkaliphiles.

Conserved sequences are underlined and significant variant residues for channel formation are shown in bold. These residues are mainly from TMH-4 and TMH-5. Bacillus megaterium DSM 319 (GenBank Accession number: YP_003600289) grows strictly in neutral pH environments. However, Bacillus clausii KSM K-16 (GenBank Accession number: YP_177349) is a reported alkaliphile.

Results and discussion

Bacterial identification and ATP synthase Fo subunit amplification

The orange pigmented bacterium was identified as Stenotrophomonas sp. based on a NCBI BLAST analysis of the 16S rRNA gene sequence and titled Stenotrophomonas sp. DL18 (GenBank Accession number: JN995612). Microbiological studies we performed showed that Stenotrophomonas sp. DL18, which optimally grows at pH 9.5, is an aerobic, facultative alkaliphilic with curved rod morphology.

A BLAST analysis of the ATP synthase a-subunit of the Stenotrophomonas species DL18 suggests maximum identity with Stenotrophomonas species SKA14 (GenBank Accession number: ZP_05136035) at the amino acid level (259 amino acid residues were identical from a total of 266 amino acid residues in the SKA14 species).

Comparative studies of ATP synthase a-subunit of Stenotrophomonas species DL18

Table 1 lists the bacterial species used in the comparative studies. The amino acid residue arginine, which was found to be conserved in almost all bacterial species in the a-subunit, was observed at position 200 (Arg200) in DL18. Moreover, other amino acid residues that were conserved in most of the bacteria include Leu207, Arg210, Leu211, Gly213, Asn214, Gly218, Gln252, Ala253 and Phe255 (E. coli numbering system for ATP synthase a-subunit) in the trans-membrane helix-4 (aTMH-4), aTMH-5 and the corresponding amino acids were also found in the DL18 alignment (Figure 1 and Figure 2).

Table 1. List of bacterial species used in the comparative studies of the ATP synthase a-subunit of Stenotrophomonas sp. DL18 (first row).

SpeciesAccession number
Stenotrophomonas sp. DL18AET99165
Stenotrophomonas sp. SKA14ZP_05136035
Bacillus pseudofirmus OF4YP_003426326
Bacillus clausii KSM-K16YP_177349
Enterococcus hirae ATCC 9790YP_006487510
Bacillus megaterium DSM 319YP_003600289
Stenotrophomonas sp. K279aYP_001973793
Theoalkalivibrio sp. K90mixYP_003461818
Escherichia coli K12 DH10BYP_001732559
Acidithiobacillus ferrooxidans ATCC 53993YP_002221206
Acidiphilium cryptum JF-5YP_001233541
Thioalkalimicrobium cyclicum ALM1YP_004537849
afa4ce0d-9173-45e7-afe9-f6a7b40c7a4e_figure2.gif

Figure 2. Complete amino acid sequence of Stenotrophomonas species DL18 ATP synthase a-subunit.

The most conserved amino acid residues are shown as bold and underlined.

It was observed that the most conserved arginine residue of the a-subunit (Arg200 of Stenotrophomonas sp. DL18) was aligned with the expected position of the facultative alkaliphile Bacillus pseudofirmus OF4 (i.e. Arg172). This positively charged Arg200 plays an elemental role in the function of the Fo rotor3. Lys180 in B. pseudofirmus OF4 was replaced by Gly208 in the DL18 strain. In addition, glycine and alanine residues were observed at the same position in other alkaliphiles including Gly206in Thioalkalimicrobium cyclicum ALM1, and Ala230 in Theoalkalivibrio sp. K90mix, as shown in Figure 1. On the other hand, glycine was also at the same corresponding position in alignment for the acidophiles, Acidithiobacillus ferrooxidans ATCC 53993 and Acidiphilium cryptum JF-5 (Figure 1). As reported by Ivey DM et al., Lys180and corresponding amino acids were located in aTMH-4 in Bacillus pseudofirmus OF4 and other alkaliphiles12,13. In the DL18 strain, a histidine residue, which is conserved in other reference species of the same genus (e.g. Stenotrophomonas species K279a, Stenotrophomonas sp. SKA14 and other alkaliphiles including T. cyclicum ALM1 (His244), and Theoalkalivibrio sp. K90mix (His262), was present at position 240 (His240) (Figure 1).

It has been proposed that Gly120 and Lys180forms a channel for the proton uptake pathway of the a-subunit through which protons pass onto the neighboring c-subunit in B. pseudofirmus OF47. However, one study has reported that His245 along with the Gly218 and Glu219 positioning plays a critical role in Fo ion translocations in E. coli8, and in the present study on Stenotrophomonas sp. DL18, His240, Gly208 and Glu209were observed at the same corresponding positions as shown in Figure 1. McMillan14 et al demonstrated the importance of residues with a basic side chain along with its pKa value in ATP synthesis in alkaline environments. However, that mutation study was carried out in the Bacillus sp. TA2.A1, specifically involving the 180th residue in the a-subunit. In that amino acid substitution study, amino acid residue Lys180 in the a-subunit was mutated to Gly180, His180and Arg180. These mutations indicated the ATP synthesis at neutral, neutral to alkaline and only in alkaline conditions (>pH 8.5), respectively, i.e. residue with a strong base, such as lysine or arginine, was ideally appropriate to function at alkaline pH. This was particularly marked for histidine, which has a pKa in a neutral range, showing significant ATP synthesis activity at pH 9.0.

E. coli K12 DH10B considered a neutrophile, can adapt to slightly alkaline conditions up to pH 8.0 and this may be due to the presence of His245. In addition, exchange mutations at aE219-H and aH245-E showed similar ATP synthase activity in E. coli. Moreover, the aG218-K substitution effect was suppressed by aH245-G mutation in E. coli. Hence, these studies in E. coli signified that the positions Gly218and His245 along with Glu219had a critical interaction with the Fo subunit function. In addition, equivalent amino acid residue studies were also reported from the facultative alkaliphile B. pseudofirmus OF4 a-subunit79.

From alignment, Glu209 of the DL18 strain was conserved in alkaliphiles, neutrophiles and some acidophiles except His186in Acidiphilium cryptum (Figure 1). In addition, the position of Gly212 in B. pseudofirmus OF4 corresponds to Ser212 in Enterococcus hirae ATCC 9790 (neutrophile), His245 in E. coli and His240 in the Stenotrophomonas sp. DL18 while glutamate in acidophiles is positioned at Glu222 in A. ferrooxidans and Glu225 in A. cryptum as shown in Figure 1. This showed that channel formation may involve a glycine residue along with other residues, specifically those with acidic, basic and neutral side chains, which play vital roles in ATP synthesis in acidophile, alkaliphiles and neutrophiles. Hence, these residues are found to be critical in channel formation79. Similarly, in Stenotrophomonas sp. DL18, amino acid residues. Gly208 and His240may form the proton translocation channel. Thus, the basic side chain residue His240 and other amino acid residues may responsible for growth of the Stenotrophomonas sp. DL18 at high alkaline pH.

Comments on this article Comments (1)

Version 2
VERSION 2 PUBLISHED 26 Apr 2013
  • Author Response 16 May 2013
    Devendra Lingojwar, ATG LAB, India
    16 May 2013
    Author Response
    This article is all about first time reporting alkaliphile without alkaliphile specific sequences in the ATP synthase a subunit. Most of the earlier reported studies were all about a few bacterial ... Continue reading
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Lingojwar D, Jadhav R and Gawai K. F1FoATP synthase a-subunit of Stenotrophomonas sp. DL18 from Indian Soda Lake, Lonar: a brief report [version 2; peer review: 2 not approved]. F1000Research 2013, 1:62 (https://doi.org/10.12688/f1000research.1-62.v2)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 2
VERSION 2
PUBLISHED 26 Apr 2013
Views
44
Cite
Reviewer Report 30 Apr 2013
Thomas Meier, Department of Structural Biology, Max-Planck Institute of Biophysics, Frankfurt, Germany 
Not Approved
VIEWS 44
The authors have slightly improved the manuscript by removing some questionable supplementary figures and some modifications in the text. 

The science presented is still quite poor and it does not really answer any biological question (at least I could not find ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Meier T. Reviewer Report For: F1FoATP synthase a-subunit of Stenotrophomonas sp. DL18 from Indian Soda Lake, Lonar: a brief report [version 2; peer review: 2 not approved]. F1000Research 2013, 1:62 (https://doi.org/10.5256/f1000research.1274.r916)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Version 1
VERSION 1
PUBLISHED 07 Dec 2012
Views
40
Cite
Reviewer Report 18 Jan 2013
Gregory Cook, Department of Microbiology, University of Otago, North Dunedin, New Zealand 
Not Approved
VIEWS 40
I don't see this study has much relevance to the field as it adds nothing to the literature in this area and is not great science e.g. the homology model is not based on a structure but just a model. ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Cook G. Reviewer Report For: F1FoATP synthase a-subunit of Stenotrophomonas sp. DL18 from Indian Soda Lake, Lonar: a brief report [version 2; peer review: 2 not approved]. F1000Research 2013, 1:62 (https://doi.org/10.5256/f1000research.231.r712)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
36
Cite
Reviewer Report 09 Jan 2013
Thomas Meier, Department of Structural Biology, Max-Planck Institute of Biophysics, Frankfurt, Germany 
Not Approved
VIEWS 36
- The overall content of this work is very poor. It contains: growth of bacteria in medium, PCR, sequencing, sequence alignment and a homology model. It is what is done today in a student practicum.
- The homology model (structure of subunit α,
... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Meier T. Reviewer Report For: F1FoATP synthase a-subunit of Stenotrophomonas sp. DL18 from Indian Soda Lake, Lonar: a brief report [version 2; peer review: 2 not approved]. F1000Research 2013, 1:62 (https://doi.org/10.5256/f1000research.231.r654)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.

Comments on this article Comments (1)

Version 2
VERSION 2 PUBLISHED 26 Apr 2013
  • Author Response 16 May 2013
    Devendra Lingojwar, ATG LAB, India
    16 May 2013
    Author Response
    This article is all about first time reporting alkaliphile without alkaliphile specific sequences in the ATP synthase a subunit. Most of the earlier reported studies were all about a few bacterial ... Continue reading
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.