F₁F_oATP synthase a-subunit of Stenotrophomonas sp. DL18 from Indian Soda Lake, Lonar: a brief report

Isolation and identification of bacteria from the soda lake

In the present study, underwater sediment soil samples were collected 350 meters away from the Kamalaja Devi Temple end of Lonar Lake, Buldhana, Maharashtra, India. The initial screening was performed at pH 9.5. Then isolates were further studied in the range of pH 7 to pH 12. Across the pH gradient, morphologically different pink, orange and white bacterial colonies were observed. The bacterial genomic DNA of optimally grown bacteria at pH 9.5 with orange pigmentation was isolated by the DNAzol method¹⁰.

Further polymerase chain reaction (PCR) and sequencing of 16S rRNA was carried out for identification of bacterium¹¹.

PCR and DNA sequencing of ATP synthase a-subunit of Stenotrophomonas species DL18

The following primers (Integrated DNA Technologies, USA) were used for the amplification of the 1.7 Kbp PCR product of the ATP synthase F_o subunit (consisting of atpB, atpC and atpA genes), based on a reference strain (i.e. S. maltophilia K279a): forward primer Steno atp1F (5’ CCTGGCGGATCCTTAGATCTCCG 3’) and reverse primer Steno atp1R (5’ CAGTGAGGATCCTTAGATCTCCGAGGCCAGCT 3’). Briefly, a PCR reaction mixture of 100 µl was prepared: 10x PCR buffer, 50 mM MgCl₂, 10 mM dNTP mix, 100 picomoles each of forward and reverse primers, 5 units of Taq DNA polymerase (Chromous Biotech, India) with Pfu and 200 ng of bacterial genomic DNA template in nuclease free water. The thermal cycling conditions were: initial denaturation at 94°C for 5 min, followed by 30 cycles of denaturation at 94°C for 30s, primer annealing at 55°C for 30s and primer extension at 72°C for 3 min. A final extension was carried out at 72°C for 5 min. The amplified PCR product of 1.7 kbp was visualized on 1% agarose gel and the results were documented by Bio-Rad gel documentation system with Quantity One software (Bio-Rad, USA). Further, the DNA sequencing of the ATP F_o subunit of the selected isolate was performed via primer walking. An ATP synthase comparative study was performed by multiple sequence alignment with other strains from different categories i.e. acidophiles, neutrophiles and alkaliphiles, as shown in Figure 1.

Figure 1. Alignment of a-subunit of ATP synthase from neutrophiles and alkaliphiles.

Conserved sequences are underlined and significant variant residues for channel formation are shown in bold. These residues are mainly from TMH-4 and TMH-5. Bacillus megaterium DSM 319 (GenBank Accession number: YP_003600289) grows strictly in neutral pH environments. However, Bacillus clausii KSM K-16 (GenBank Accession number: YP_177349) is a reported alkaliphile.

Bacterial identification and ATP synthase F_o subunit amplification

The orange pigmented bacterium was identified as Stenotrophomonas sp. based on a NCBI BLAST analysis of the 16S rRNA gene sequence and titled Stenotrophomonas sp. DL18 (GenBank Accession number: JN995612). Microbiological studies we performed showed that Stenotrophomonas sp. DL18, which optimally grows at pH 9.5, is an aerobic, facultative alkaliphilic with curved rod morphology.

A BLAST analysis of the ATP synthase a-subunit of the Stenotrophomonas species DL18 suggests maximum identity with Stenotrophomonas species SKA14 (GenBank Accession number: ZP_05136035) at the amino acid level (259 amino acid residues were identical from a total of 266 amino acid residues in the SKA14 species).

Comparative studies of ATP synthase a-subunit of Stenotrophomonas species DL18

Table 1 lists the bacterial species used in the comparative studies. The amino acid residue arginine, which was found to be conserved in almost all bacterial species in the a-subunit, was observed at position 200 (Arg²⁰⁰) in DL18. Moreover, other amino acid residues that were conserved in most of the bacteria include Leu²⁰⁷, Arg²¹⁰, Leu²¹¹, Gly²¹³, Asn²¹⁴, Gly²¹⁸, Gln²⁵², Ala²⁵³ and Phe²⁵⁵ (E. coli numbering system for ATP synthase a-subunit) in the trans-membrane helix-4 (aTMH-4), aTMH-5 and the corresponding amino acids were also found in the DL18 alignment (Figure 1 and Figure 2).

Figure 2. Complete amino acid sequence of Stenotrophomonas species DL18 ATP synthase a-subunit.

The most conserved amino acid residues are shown as bold and underlined.

It was observed that the most conserved arginine residue of the a-subunit (Arg²⁰⁰ of Stenotrophomonas sp. DL18) was aligned with the expected position of the facultative alkaliphile Bacillus pseudofirmus OF4 (i.e. Arg¹⁷²). This positively charged Arg²⁰⁰ plays an elemental role in the function of the F_o rotor³. Lys¹⁸⁰ in B. pseudofirmus OF4 was replaced by Gly²⁰⁸ in the DL18 strain. In addition, glycine and alanine residues were observed at the same position in other alkaliphiles including Gly²⁰⁶in Thioalkalimicrobium cyclicum ALM1, and Ala²³⁰ in Theoalkalivibrio sp. K90mix, as shown in Figure 1. On the other hand, glycine was also at the same corresponding position in alignment for the acidophiles, Acidithiobacillus ferrooxidans ATCC 53993 and Acidiphilium cryptum JF-5 (Figure 1). As reported by Ivey DM et al., Lys¹⁸⁰and corresponding amino acids were located in aTMH-4 in Bacillus pseudofirmus OF4 and other alkaliphiles^12,13. In the DL18 strain, a histidine residue, which is conserved in other reference species of the same genus (e.g. Stenotrophomonas species K279a, Stenotrophomonas sp. SKA14 and other alkaliphiles including T. cyclicum ALM1 (His²⁴⁴), and Theoalkalivibrio sp. K90mix (His²⁶²), was present at position 240 (His²⁴⁰) (Figure 1).

It has been proposed that Gly¹²⁰ and Lys¹⁸⁰forms a channel for the proton uptake pathway of the a-subunit through which protons pass onto the neighboring c-subunit in B. pseudofirmus OF4⁷. However, one study has reported that His²⁴⁵ along with the Gly²¹⁸ and Glu²¹⁹ positioning plays a critical role in F_o ion translocations in E. coli⁸, and in the present study on Stenotrophomonas sp. DL18, His²⁴⁰, Gly²⁰⁸ and Glu²⁰⁹were observed at the same corresponding positions as shown in Figure 1. McMillan¹⁴ et al demonstrated the importance of residues with a basic side chain along with its pKa value in ATP synthesis in alkaline environments. However, that mutation study was carried out in the Bacillus sp. TA2.A1, specifically involving the 180^th residue in the a-subunit. In that amino acid substitution study, amino acid residue Lys¹⁸⁰ in the a-subunit was mutated to Gly¹⁸⁰, His¹⁸⁰and Arg¹⁸⁰. These mutations indicated the ATP synthesis at neutral, neutral to alkaline and only in alkaline conditions (>pH 8.5), respectively, i.e. residue with a strong base, such as lysine or arginine, was ideally appropriate to function at alkaline pH. This was particularly marked for histidine, which has a pKa in a neutral range, showing significant ATP synthesis activity at pH 9.0.

E. coli K12 DH10B considered a neutrophile, can adapt to slightly alkaline conditions up to pH 8.0 and this may be due to the presence of His²⁴⁵. In addition, exchange mutations at a^E219-H and a^H245-E showed similar ATP synthase activity in E. coli. Moreover, the aG218-K substitution effect was suppressed by a^H245-G mutation in E. coli. Hence, these studies in E. coli signified that the positions Gly²¹⁸and His²⁴⁵ along with Glu²¹⁹had a critical interaction with the F_o subunit function. In addition, equivalent amino acid residue studies were also reported from the facultative alkaliphile B. pseudofirmus OF4 a-subunit^7–9.

From alignment, Glu²⁰⁹ of the DL18 strain was conserved in alkaliphiles, neutrophiles and some acidophiles except His¹⁸⁶in Acidiphilium cryptum (Figure 1). In addition, the position of Gly²¹² in B. pseudofirmus OF4 corresponds to Ser²¹² in Enterococcus hirae ATCC 9790 (neutrophile), His²⁴⁵ in E. coli and His²⁴⁰ in the Stenotrophomonas sp. DL18 while glutamate in acidophiles is positioned at Glu²²² in A. ferrooxidans and Glu²²⁵ in A. cryptum as shown in Figure 1. This showed that channel formation may involve a glycine residue along with other residues, specifically those with acidic, basic and neutral side chains, which play vital roles in ATP synthesis in acidophile, alkaliphiles and neutrophiles. Hence, these residues are found to be critical in channel formation^7–9. Similarly, in Stenotrophomonas sp. DL18, amino acid residues. Gly²⁰⁸ and His²⁴⁰may form the proton translocation channel. Thus, the basic side chain residue His²⁴⁰ and other amino acid residues may responsible for growth of the Stenotrophomonas sp. DL18 at high alkaline pH.