Detection of CYP2C19*2_<sup> </sup>allele among Helicobacter pylori -infected patients in two tertiary hospitals of Khartoum, Sudan, 2019

Azza Abbas; Sawazen Malik; Bushra Sulieman; Khalid Enan

doi:10.12688/f1000research.73724.1

Home Browse Detection of CYP2C19*2_ allele among Helicobacter pylori -infected...

ALL Metrics

-

Views

-

Downloads

Get PDF

Get XML

Export

▬

✚

Research Article

Detection of CYP2C19*2_allele among Helicobacter pylori -infected patients in two tertiary hospitals of Khartoum, Sudan, 2019

[version 1; peer review: 1 approved, 1 approved with reservations]

Azza Abbas ¹, Sawazen Malik ¹, Bushra Sulieman¹, Khalid Enan²

PUBLISHED 18 Oct 2021

Author details Author details

¹ Faculty of Medicine, University of Khartoum, Khartoum, Sudan
² Central Laboratory, Ministry of Higher Education and Scientific Research, Khartoum, Sudan

Azza Abbas
Roles: Conceptualization, Data Curation, Formal Analysis, Methodology, Writing – Original Draft Preparation

Sawazen Malik
Roles: Conceptualization, Data Curation, Formal Analysis, Writing – Original Draft Preparation

Bushra Sulieman
Roles: Conceptualization, Supervision, Writing – Review & Editing

Khalid Enan
Roles: Conceptualization, Supervision, Writing – Review & Editing

OPEN PEER REVIEW

REVIEWER STATUS

Abstract

Background: CYP2C19*2has been identified as the most common allelic variant of CYP2C19 affecting the response to Proton pump inhibitors (PPI). This study aims to detect CYP2C19*2allele in H. pylori-infected Sudanese population, owing its probable effect on H. pylori eradication.
Methods: Antral biopsies was collected from 30 patients attending endoscopy units. Extraction of DNA was performed through QIAamp® DNA Mini Kit. Samples were screened for Urease C (UreC) gene of H. pylori using conventional PCR. Detection of CYP2C19*2 was performed in positive H. pylori samples using Real time-PCR.
Results: The mean age of patients was 40.7 (±20.2 SE). Positive samples for UreC were 24 (80%) samples. Among them, four samples (16.6%) were found positive for CYP2C19*2 allele presence. Gender was found to be statistically associated with the presence of the allele (p < 0.05).
Conclusion: This study illustrates that CYP2C19*2 is of modest prevalence among H. pylori-infected Sudanese population. The determination of genotypic and allelic frequencies of CYP2C19 gene among different populations will provide data to be used to personalize treatment according to individual genetic profile, and minimize the possible adverse side effects of CYP2C19 substrates.

Keywords

CYP2C19*2, Helicobacter Pylori, Gastritis, Sudan

Corresponding authors: Azza Abbas, Sawazen Malik

Competing interests: No competing interests were disclosed.

Grant information: The author(s) declared that no grants were involved in supporting this work.

Copyright: © 2021 Abbas A et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

How to cite: Abbas A, Malik S, Sulieman B and Enan K. Detection of CYP2C19*2_allele among Helicobacter pylori -infected patients in two tertiary hospitals of Khartoum, Sudan, 2019 [version 1; peer review: 1 approved, 1 approved with reservations]. F1000Research 2021, 10:1063 (https://doi.org/10.12688/f1000research.73724.1) First published: 18 Oct 2021, 10:1063 (https://doi.org/10.12688/f1000research.73724.1) Latest published: 18 Oct 2021, 10:1063 (https://doi.org/10.12688/f1000research.73724.1)

Abbreviations

GI: gastrointestinal

H. pylori: Helicobacter pylori

IM: Intermediate metabolizer

NM: Normal metabolizer

PM: Poor metabolizer

PPI: Proton pump inhibitors

RM: Rapid metabolizer

UM: Ultra rapid metabolizer

UreC: Urease C

Introduction

Helicobacter pylori (H. pylori) is considered the most common bacteria diagnosed in chronically infected stomachs in patients with chronic gastritis.¹ It is infecting more than half of the population worldwide.² In Sudan, it was found in 80% of patients with Barrett's esophagus and gastritis³ and 56.3% among Sudanese children.⁴

H. pylori eradication is inevitably important, as it has been classified as a class 1 human carcinogen by the International Agency for Research on Cancer (IARC) of the World Health Organization (WHO).⁵ Stomach cancer in Sudan was among the 10 most common primary sites of cancer.⁶ Moreover, H. pylori is related to chronic gastritis, duodenal and gastric ulcers, and MALT lymphoma.⁷

The first line regimens used are triple and quadruple therapy.⁸ They include proton pump inhibitors (PPI) along with other antibiotics. However, high rate of unsuccessful eradication was reported worldwide,⁹ and the most important causes of treatment failure of H. pylori were found to be clarithromycin resistance and CYP2C19 polymorphism.¹⁰ CYP2C19 allelic variations are considered the keystone and the most addressed pharmaco-genetic factors affecting the response to PPI.¹¹

CYP2C19 gene is a member of the CYP450 gene family, which is located at the 10q24.1–10q24.3 locus of chromosome 10.¹² It is required in metabolizing of several important therapeutic drugs, including PPI, proguanil, propranolol, imipramine, and numerous other drugs.¹³ CYPs’ allelic constitution varies according to ethnic and individual variations. This will affect the efficacy of drugs and disease susceptibility.¹⁴

Around 25 genetic variants have been detected in CYP2C19, precisely in the exonic region.¹⁵ CYP2C19 phenotype is classified into ultra-rapid (UM), rapid (RM), normal (NM), intermediate (IM) and poor metabolizer (PM), depending on the allelic constitution of an individual, and affecting the metabolism of a range of xenobiotics.¹¹

CYP2C19 allelic variation affect H. pylori eradication regimen in many ways. Studies showed that lower eradication rates of H. pylori were observed in NM compared to IM and PM.¹¹ Moreover, lower doses of CYP2C19 substrates will be required for patients with IM and PM phenotypes, due to the risk of overexposure and adverse effects of standard doses.¹⁶

CYP2C19*2 has been identified as the most common allelic variant of CYP2C19, and it’s considered as the main allele contributing to the PM phenotype.¹² It is located in exon 5, where a splice mutation generates a cryptic splice site, causing the formation of aberrant mRNA, which is translated as non-functional protein.¹⁷ CYP2C19 *3, *4, *5, *6, *7, *8 are other non-functioning alleles, but they are less frequent.¹⁸

PM phenotype which entails carrying two copies of non-functioning alleles is present in about 2-5% of European and African nations, and 15% of Asians.¹⁹ IM phenotype which requires only one copy of a non-functioning allele is present in 25-35% of Europeans and African nations, and 45%-50% of Asians.¹⁹

In Sudan, this allele has not been tackled among H. pylori-infected Sudanese population. Thus, this study aims to detect CYP2C19*2 allele among this population, owing to its probable effect on H. pylori eradication, and the high frequency of this mutant allele in various ethnicities.

Methods

Study population

Convenient sampling of patients visiting endoscopy units of two tertiary hospitals of Khartoum city in the period of May and June 2019 was executed. The study included 30 patients who were undergoing oesophago-gastro-duedenoscopy (OGD), indicated for upper gastrointestinal (GI) symptoms, and accepted to participate in the study. Samples were analyzed and stored at the Virology department of Central laboratory, Ministry of Higher Education and Research, Sudan.

Sample collection

A single antral gastric biopsy was collected from each patient after taking informed verbal consent. A questionnaire composed of three sections; details of sample collection, socio-demographic data, and clinical symptoms and signs related to H. pylori history were used to collect patient’s information. Samples were collected in phosphate buffer saline medium for reservation and stored at −20°C in 1.5 ml cryo-tubes.

Processing methods

Genomic extraction and primers and probes sequences

Samples were processed and extracted using QIAamp^® DNA Mini Kit (250) 51306 (QIAGEN, Germany). First, samples were cut into small pieces to decrease the lysis time, then they were transferred into 1.5 ml microcentrifuge tubes. 20 μl of proteinase K was added and samples were incubated at 56°C until the tissue was completely lysed. Brief centrifugation was then performed, followed by adding 200 μl of Buffer AL, mixed by pulse-vortexing for 15 seconds, and incubated at 70°C for 10 minutes. This was followed by adding 200 μl of ethanol (96–100%), which was mixed by pulse-vortexing for 15 seconds, and briefly centrifuged. The mixture then was transferred to QIAamp Mini spin column and centrifuged at 6000 × g (8000 rpm) for one minute. Then QIAamp Mini spin column was placed in a clean 2 ml collection tube, and the remaining filtrate was discarded. 500 μl of Buffer AW1 was then added and centrifuged at 6000 × g (8000 rpm) for one minute, and QIAamp Mini spin column was placed in a clean 2 ml collection tube, and the remaining filtrate was discarded. This was repeated using 500 μl of Buffer AW2, but centrifuged at full speed for three minutes. The QIAamp Mini spin column was then placed in a new collection tube and centrifuged at full speed for one minute. Then the spin column was placed in a 1.5 microcentrifuge tube, and 200 μl Buffer AE was added, and incubated at room temperature for one minute, then centrifuged at 6000 × g (8000 rpm) for one minute.

The quantity and quality of the extracted DNA were examined spectrophotometrically. Primers and probes sequences are mentioned in Table 1.

Table 1. Primers and probes sequences used in conventional and Real-time PCR.

Target gene	Primers/probes (5′-3′)	Product	Reference/GeneBank No.
UreC	F: AAGCTTTTAGGGGTGTTAGGGGTTT R: AAGCTTACTTTCTAACACTAACGC	297	20
CYP2C19*2	F: GCTTGGCATATTGTATCTATACCTT R: GATTCTTGGTGTTCTTTTACTTTCT Probe:VIC-ATTTCCCAGGAACC-MGB	85	NG_008384.2

Helicobacter pylori detection

Conventional PCR was performed for the detection of Urease C (UreC) gene in H. pylori.²⁰ The reaction mixture was 20 μl comprising of 4 μl of Solis BioDyne Master Mix (5× FIREPol^® Master Mix Ready to Load), 0.5 μl of each forward and reverse primers, 5 μl of template DNA, and 15 μl of H₂O.

DNA amplification was carried out as follows:

1. Denaturation at 94°C for five minutes in the first cycle, followed by annealing for 30 seconds at 65°C.
2. Extension for 30 seconds at 72°C. The extension for the last cycle was increased to five minutes to ensure complete extension of the amplified fragments.
3. Denaturation for 30 seconds at 94°C for a total of 35 PCR cycles. Then the PCR products were resolved by 2% agarose gel electrophoresis. The band size was 297 base pairs.

Real-time PCR for CYP2C19*2 detection

Detection of CYP2C19*2 was performed among positive H. pylori samples through Real-time PCR (Genebank No. NG_008384.2). The reaction mixture was 10 μl comprising of 2 μl of Solis BioDyne Master Mix (5× HOT FIREPol^® Probe Universal qPCR Mix), 0.4 μl of each forward and reverse primers, 0.2 μl of the probe, 3 μl of template DNA, and 4 μl of H₂O. Initial activation was at 95^oC for five minutes, followed by 15-second denaturation at 95^oC, and one minute annealing at 600 for 45 cycles.

Ethical consideration

Informed consent was taken verbally form each patient, and patient’s parents in case of minors (below 18 years), and detailed full information about the research purposes and procedures was explained. Verbal consent was performed and approved by the ethics committee due to the cultural stigma in the population regarding the signed procedures as contract-like documents. Also, time and setting of taking the consent was limited, as it was executed after the patient is prepared for the endoscopy procedure.

Ethical approval was obtained from the ethical committee of Central Laboratories, Ministry of Higher education and Research (Ref. No: CL/85/2019). Consent was also taken from hospitals managers and research committee. Patient information was held with a high level of confidentiality.

Statistical analysis

The collected data were entered into Microsoft Excel database and analyzed using Statistical Package for Social Sciences (SPSS) version 23 (SPSS Inc., Chicago, Illinois, USA). Descriptive statistics were reported as frequencies and percentages for categorical variables, and continuous variables were described as mean ± standard deviation (SD). Chi-square test was used to test the significant difference among categorical variables, and p-value at 0.05 was considered significant.

Results

Socio-demographics of participants

A total of 30 patients were enrolled to participate in the study. Patients were selected from two tertiary hospitals of Khartoum city from endoscopy sessions. All patients were performing OGD for various indications, such as alarming upper GI symptoms and refractory GI symptoms. All patients had not taken any antibiotics or PPI in the last month.

The mean age of patients was 40.7 (±20.2 SE). Ranging from 9 to 89 years old. Gender was almost divided equally. More information is mentioned in Table 2.

Table 2. Socio-demographics of participants, (n = 30), Khartoum, Sudan.

Variable	n (%)
Gender Male Female	16 (53.3%) 14 (46.7%)
Origin Northern states Western states Central states White Nile state Missing	14 (46.7%) 5 (16.7%) 3 (10%) 2 (6.7%) 6 (20%)
Occupation House wife Medical Student Farmer Miscellaneous Not working Missing	6 (20%) 2 (6.7%) 4 (13.3%) 2 (6.7%) 10 (33.3%) 5 (16.7%) 1 (3.3%)
Education Illiterate Primary schooling Secondary schooling University Missing	4 (13.3%) 2 (6.7%) 7 (23.3%) 13 (43.3%) 4 (13.3%)

Clinical characteristics of patients

Patients were mostly suffering from vomiting as the main symptom, followed by epigastric pain, regurgitation, and heartburn, respectively (Figure 1).

Figure 1. Signs and symptoms of participants, (n = 30), Khartoum, Sudan.

SOB: shortness of breath.

Endoscopic findings were mainly gastritis.³² Duodenal and gastric ulcers were only found in 6.6% and 3.3%, respectively. No patients had a lesion suggestive of malignancy (Figure 2).

Figure 2. Endoscopic findings of participants, (n = 30), Khartoum, Sudan.

Only seven of the participants had known H. pylori profiles, which five of them were previously found to be positive for the infection. Stool antigen test and serology were the test of choice for their investigations. Only two patients were treated for the infection.

H. pylori genome and CYP2C19*2 allele detection

Out of the 30 investigated biopsies, 24 (80%) were found positive for UreC gene of H. pylori. Only those 24 UreC positive samples were explored for CYP2C19*2 allele. Four samples (16.6%) were found positive for the allelic mutation.

The four samples were all of female gender, originally from Northern state, and residing in Khartoum. Their mean age was 42.5 (±22 SD), ranging between 21-74 years old. Three of them showed endoscopic appearance of gastritis, and two of them suffered from epigastric pain. Gender was found to be statistically associated with the presence of the allele (p < 0.05) using Chi-square test of significance. Age, origin, and education have shown no association with the presence of the mutant allele.

Discussion

CYP2C19 gene variants have been investigated in different communities including Europeans, Asians, and Africans,²¹ but it has not been well-studied among the Sudanese population. CYP2C19*2 allele is considered the most common allele as reported by many studies, and it accounts for poor metabolism of PPI, which helps in the eradication of H. pylori, yet cause many adverse drugs effects²²; hence this study aimed at the detection of the CYP2C19*2 allele among H. pylori-infected patients, in which 30 patients undergoing OGD for various indications were selected from two tertiary hospitals in Khartoum city. Among them, females were 53.3%, and males were 46.7%. Patients were mostly suffering from vomiting as the main symptom, followed by epigastric pain, regurgitation and heartburn, respectively.

Out of the 30 investigated biopsies, 24 (80%) samples were positive for the Urease C gene of H. pylori. Those positive samples were explored for CYP2C19*2 allele and 4 (16.6%) of the samples were positive for the allelic mutation.

Eradication of H. pylori is challenging nowadays due to many reasons including antibiotics resistance, poor compliance, high gastric acidity, and CYP2C19 polymorphism.²³ PPI is a main part of the eradication regimen, and the main enzyme involved in PPI metabolism (except Rabeprazole) is CYP2C19; hence PPI effect depends on the genetic variants of CYP2C19.²³

Several studies revealed significant inter-ethnic differences in CYP2C19*2 variants. Approximately similar inferences of our results were reported among Beninese population²⁴ and Zimbabwean population,²⁵ but less frequency occurred among Ghanaian population (6%),²⁶ Tunisian population (9%),²⁷ and Egyptians (4%).²⁸ Significantly higher frequencies were reported among Japanese (19-23%), Chinese (15%), and Koreans (13%).¹²

Our study reveals a significant association between gender and CYP2C19*2 allele detection (p < 0.05). This is consistent with a study done among the Korean population which showed that females had significantly lower metabolic rates than males (p < 0.0001), but such a gender difference was not reported among Swedes.²⁹ Caucasians also showed no evidence of gender difference.³⁰ In this study, neither age nor ethnicity was found to be associated with allelic variant presence (p > 0.05), but worth noting that all of the positive samples were originally from the Northern state of Sudan, which are considered originating from Arab ancestry. This is inconsistent with a study was done in Sudan in 2018,³¹ showing a significant association with ethnicity (p = 0.048), but Arabs were also found to be the highest ethnicity to possess the mutant allele.

The findings of our study have to be seen in the light of some limitations. The sample size was small due to many reasons such as the refusal of some patients to be part of the study and the cost and unavailability of the materials used in the detection of CYP2C19*2 allele.

Conclusion

Yet, this study illustrates that CYP2C19*2 is of modest prevalence among H. pylori-infected Sudanese population. Physicians in Sudan should consider this allele as a determinant of suitable drug dosage, which would improve the regimen’s effectiveness. The determination of genotypic and allelic frequencies of CYP2C19 gene among different populations will provide data to be used to personalize treatment according to individual genetic profile, and minimize the possible adverse side effects of CYP2C19 substrates.

Data availability

Underlying data

NCBI GenBank: H. pylori samples through Real-time PCR, https://www.ncbi.nlm.nih.gov/nuccore/NG_008384.2.

Figshare: Detection of CYP2C19*2 allele among Helicopacter pylori-infected patients in two tertiary hospitals in Khartoum-Sudan: https://doi.org/10.6084/m9.figshare.14333138.v1.³²

This project contains the following underlying data:

- DATA.xlsx

Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0).

Authors’ contributions

Drs. Abbas and Malik conceived, designed, acquired, and analyzed the data. Drs. Sulieman and Enan participated in its design and coordination. All authors have read the article critically and approved the final manuscript.

References

1. Oleastro M, Ménard A, Santos A, et al.: Real-time PCR assay for rapid and accurate detection of point mutations conferring resistance to clarithromycin in Helicobacter pylori. J Clin Microbiol. 2003 Jan 1; 41(1): 397–402. PubMed Abstract | Publisher Full Text | Free Full Text
2. Ruggiero P: Helicobacter Pylori and Inflammation. Curr Pharm Des. 2011; 16(38): 4225–4236. PubMed Abstract | Publisher Full Text
3. Ahmed HH, Mudawi HMFS: Gastro-oesophageal reflux disease in Sudan: a clinical endoscopic and histopathological study. Trop Gastroenterol. 2004; 25(3): 135–138. PubMed Abstract
4. Salih KMA, Elfaki OA, Hamid YHM, et al.: Prevalence of Helicobacter Pylori among Sudanese children admitted to a specialized children hospital. Sudan J Paediatr. 2017; PubMed Abstract | Free Full Text
5. Schistosomes, liver flukes and Helicobacter pylori. IARC Monogr Eval Carcinog Risks Hum. 1994. 1–241 p. PubMed Abstract | Free Full Text
6. Saeed IE, Weng H-Y, Mohammed, et al.: Cancer incidence in Khartoum, Sudan: first results from the Cancer Registry. Cancer Med. 2014; 3(4): 1075–1084. PubMed Abstract | Publisher Full Text | Free Full Text
7. Ruggiero P: Helicobacter pylori infection: What’s new. Curr Opin Infect Dis. 2012; 25(3): 337–344. PubMed Abstract | Publisher Full Text
8. Hunt RH, France FM: Helicobacter Pylori in Developing Countries. World Gastroenterology Organisation Global Guideline. J Gastrointest Liver Dis. 2011; 20(3): 299–304. PubMed Abstract | Publisher Full Text
9. Thung I, Aramin H, Vavinskaya V, et al.: The global emergence of Helicobacter pylori antibiotic resistance. Aliment Pharmacol Ther. 2016; 43(4): 514–533. PubMed Abstract | Publisher Full Text | Free Full Text
10. Zhang J, Peng X, Song Z, et al.: Gastric Juice-Based Real-Time PCR for Tailored Helicobacter Pylori Treatment: A Practical Approach. Int J Med Sci. 2017. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source
11. El RN, Lima JJ, Johnson JA: Proton pump inhibitors: from CYP2C19 pharmacogenetics to precision medicine. Expert Opin Drug Metab Toxicol. 2018; 14(4): 447–460. PubMed Abstract | Publisher Full Text | Free Full Text
12. Dehbozorgi M, Kamalidehghan B, Hosseini I: Prevalence of the CYP2C19 * 2 (681 G > A ), * 3 (636 G > A) and * 17 (- 806 C > T) alleles among an Iranian population of different ethnicities. Mol Med Rep. 2018; 17(3): 4195–4202. PubMed Abstract | Publisher Full Text | Free Full Text
13. Manikandan P, Nagini S: Cytochrome P450 Structure, Function and Clinical Significance: A Review. Curr Drug Targets. 2018; 19: 38–54. PubMed Abstract | Publisher Full Text
14. Sadee W, Wang D, Papp AC, et al.: Pharmacogenomics of the RNA World: Structural RNA Polymorphisms in Drug Therapy. Clin Pharmacol Ther. 2009; 89(3): 355–365. PubMed Abstract | Publisher Full Text | Free Full Text
15. Yin T, Miyata T: Pharmacogenomics of clopidogrel: Evidence and perspectives. Thromb Res. 2011; 128(4): 307–316. PubMed Abstract | Publisher Full Text
16. Duconge J, Cadilla CL, Renta JY, et al.: Prevalence of CYP2C19 Gene Polymorphisms in the Puerto Rican Population: a Preliminary Report. P R Heal Sience J. 2009; 27(4): 357–358. PubMed Abstract | Free Full Text Reference Source
17. De Morais SM, Wilkinson GR, Blaisdell J, et al.: Identification of a new genetic defect responsible for the polymorphism of (S)-mephenytoin metabolism in Japanese. Mol Pharmacol. 1994; 46(4): 594–598. PubMed Abstract
18. Weitzel KW, Elsey AR, Langaee TY, et al.: Clinical Pharmacogenetics Implementation: Approaches , Successes, and Challenges. Am J Med Genet C Semin Med Genet. 2014; 166C(1): 56–67. PubMed Abstract | Publisher Full Text | Free Full Text
19. Johnson JA, Cavallari LH: Pharmacogenetics and Cardiovascular Disease — Implications for Personalized Medicine. Pharmacol Rev. 2013; 65(3): 987–1009. PubMed Abstract | Publisher Full Text
20. Abd SA, Rahem A, Elhag WI: Molecular Detection of Helicobacter pylori in Drinking Water in Khartoum State (Sudan). Afr J Med Sci. 2018; 3(5): 3–8.Reference Source
21. Vu N, Nguyen H, Tran N, et al.: CYP2C19 genetic polymorphism in the Vietnamese population. Ann Hum Biol. 2019; 46(6): 491–497. PubMed Abstract | Publisher Full Text
22. Lähdevirta J: Nephropathia epidemica in Finland. A clinical, histological and epidemiological study. Ann Clin Res. 1971; 3(Suppl. 8): 154 pp. PubMed Abstract Reference Source
23. Lu C-Y, Shih H-Y, Kuo F-C, et al.: CYP2C19 polymorphism influences Helicobacter pylori eradication. World J Gastroenterol. 2016; 20(43): 16029. PubMed Abstract | Publisher Full Text | Free Full Text
24. Allabi AC, Gala J, Desager J, et al.: Genetic polymorphisms of CYP2C9 and CYP2C19 in the Beninese and Belgian populations. Br J Clin Pharmacol. 2003; 56: 653–657. PubMed Abstract | Publisher Full Text | Free Full Text
25. Dandara C, Masimirembwa CM, Magimba A, et al.: Genetic polymorphism of CYP2D6 and CYP2C19 in east- and southern African populations including psychiatric patients. Eur J Clin Pharmacol. 2001; 57: 11–17. PubMed Abstract | Publisher Full Text
26. Kudzi W, Dodoo AMJ: Characterisation of CYP2C8, CYP2C9 and CYP2C19 polymorphisms in a Ghanaian population. BMC Med Genet. 2009; 10(1).Reference Source
27. Abdelhedi R, Bouayed N, Alfadhli S, et al.: Characterization of drug-metabolizing enzymes CYP2C9, CYP2C19 polymorphisms in Tunisian, Kuwaiti and Bahraini populations. J Genet. 2015; 94(4): 765–770. PubMed Abstract | Publisher Full Text
28. Ellison C, Abou El-Ella S, Tawfik M, et al.: Allele and Genotype Frequencies of CYP2B6 and CYP2C19 Polymorphisms in Egyptian Agricultural Workers. J Toxicol Environ Health. 2012; 75(4): 232–241. PubMed Abstract | Publisher Full Text | Free Full Text
29. Ramsjö M, Aklillu E, Bohman L, et al.: CYP2C19 activity comparison between Swedes and Koreans: effect of genotype, sex, oral contraceptive use, and smoking. Eur J Clin Pharmacol. 2010; 66(9): 871–877. PubMed Abstract | Publisher Full Text
30. Hagg S, Spigset ODR: Influence of gender and oral contraceptives on CYP2D6 and CYP2C19 activity in healthy volunteers. Br J Clin Pharmacol. 2001; 51(2): 169–173. PubMed Abstract | Publisher Full Text | Free Full Text
31. Khalil SI, Elkhawad AO: A study of CYP2C19 * 2, * 3 and * 7 in different Sudanese ethnic groups and their response to omeprazole based triple therapy in Khartoum. Sudan. Biomed Res. 2018; 29(13): 2743–2765.Reference Source
32. Abbas A, Malik S, Suleiman B, et al.: Detection of CYP2C19*2 allele among Helicopacter pylori-infected patients in two tertiary hospitals in Khartoum-Sudan [Internet]. figshare . 2021 [cited 2021 Oct 11]. Reference Source

Comments on this article Comments (0)

Version 1

VERSION 1 PUBLISHED 18 Oct 2021

Author details Author details

¹ Faculty of Medicine, University of Khartoum, Khartoum, Sudan
² Central Laboratory, Ministry of Higher Education and Scientific Research, Khartoum, Sudan

Azza Abbas
Roles: Conceptualization, Data Curation, Formal Analysis, Methodology, Writing – Original Draft Preparation

Sawazen Malik
Roles: Conceptualization, Data Curation, Formal Analysis, Writing – Original Draft Preparation

Bushra Sulieman
Roles: Conceptualization, Supervision, Writing – Review & Editing

Khalid Enan
Roles: Conceptualization, Supervision, Writing – Review & Editing

Competing interests

No competing interests were disclosed.

Grant information

The author(s) declared that no grants were involved in supporting this work.

Article Versions (1)

version 1

Published: 18 Oct 2021, 10:1063

https://doi.org/10.12688/f1000research.73724.1

Copyright

© 2021 Abbas A et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Download

Export To

metrics

	Views	Downloads
F1000Research	-	-
PubMed Central Data from PMC are received and updated monthly.	-	-

Citations

0

SEE MORE DETAILS

CITE

how to cite this article

Abbas A, Malik S, Sulieman B and Enan K. Detection of CYP2C19*2_allele among Helicobacter pylori -infected patients in two tertiary hospitals of Khartoum, Sudan, 2019 [version 1; peer review: 1 approved, 1 approved with reservations]. F1000Research 2021, 10:1063 (https://doi.org/10.12688/f1000research.73724.1)

NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.

track

receive updates on this article

Track an article to receive email alerts on any updates to this article.

Open Peer Review

Version 1

VERSION 1

PUBLISHED 18 Oct 2021

Views

1

Reviewer Report 19 Sep 2024

Marek Mirowski, Department of Pharmaceutical Biochemistry and Molecular Diagnostics, Faculty of Pharmacy, Medical University of Łódź, Łódź, Poland

Approved

https://doi.org/10.5256/f1000research.77394.r324969

Thank you for giving me opportunity to review article entitled “Detection of CYP2C19*2_ allele among Helicobacter pylori -infected patients in two tertiary hospitals of Khartoum, Sudan, 2019”.
After reading, some questions arose:

Helicobacter pylori should

Thank you for giving me opportunity to review article entitled “Detection of CYP2C19*2_ allele among Helicobacter pylori -infected patients in two tertiary hospitals of Khartoum, Sudan, 2019”.
After reading, some questions arose:

Helicobacter pylori should be written in italics.
In the methodological part, paragraph Real-Time PCR for CYP2C19*2 last line on page 4, the annealing temperature should be 60⁰C.
I am not convinced about the socio-demographic data included in Table 2, which includes occupations and education - are such data necessary?
The Authors themselves are aware of the small size of the study group and note this fact in the paragraph before the conclusions. However, this research may document the tendency observed by the Authors.
According to the order of citing articles in the text, the article published in References with number 32 should have number 21, and the numbering of articles from number 21 onwards should be changed by one number up.

In summary, I think that the article presents new information related to the occurrence of the CYP2C19*2 allelic variant in H. pylori infected Sudanase population and should be indexed.

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Yes
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Yes

Competing Interests: No competing interests were disclosed.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

CITE

Report a concern

Respond or Comment

Views

13

Reviewer Report 04 Mar 2022

Mitsushige Sugimoto, Department of Gastroenterological Endoscopy, Tokyo Medical University Hospital, Tokyo, Japan

Approved with Reservations

https://doi.org/10.5256/f1000research.77394.r124017

General:

In this study, the authors evaluated the rate of CYP2C19*2 allele in H. pylori infected Sudanese population. In this study, authors showed that 16.6% of patients have CYP2C19*2 allele.

Major comments:

General:

In this study, the authors evaluated the rate of CYP2C19*2 allele in H. pylori infected Sudanese population. In this study, authors showed that 16.6% of patients have CYP2C19*2 allele.

Major comments:

Serious problem of this study is loss of sample power. Therefore, it is unclear whether 16.6% of Sudanese population have CYP2C19*2 allele.
Authors should detect CYP2C19 *3 and *17 alleles among this population.
Please use H. pylori in italic.
Why did authors use UreC gene for detection of H. pylori infection?
In general, most of patients infected with H. pylori have chronic gastritis. Why 30% in this study?　
In Sudan, it was found in 80% of patients with Barrett's esophagus and gastritis (ref 3) and 56.3% among Sudanese children (ref 4). However, there is no data about Barrett's esophagus in this study.
CYP2C19 gene variants have been investigated in different communities including Europeans, Asians, and Africans, but it has not been well-studied among the Sudanese population. Please compare rate of CYP2C19 *2 allele with previous studies in the Sudanese population and this study.
16.6% of patients have CYP2C19*2 allele. How about rates of poor metabolizer (*2/*2)?

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Partly
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: Upper GI, H. pylori, GERD, Gastric cancer

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

CITE

Report a concern

Respond or Comment

Comments on this article Comments (0)

Version 1

VERSION 1 PUBLISHED 18 Oct 2021

Open Peer Review

Reviewer Status

Reviewer Reports

	Invited Reviewers
	1	2
Version 1 18 Oct 21	read	read

Mitsushige Sugimoto, Tokyo Medical University Hospital, Tokyo, Japan
Marek Mirowski, Medical University of Łódź, Łódź, Poland

Comments on this article

All Comments(0)

Add a comment

Sign up for content alerts

Browse by related subjects

Back to all reports

Reviewer Report

1 Views

19 Sep 2024 | for Version 1

Marek Mirowski, Department of Pharmaceutical Biochemistry and Molecular Diagnostics, Faculty of Pharmacy, Medical University of Łódź, Łódź, Poland

1 Views Cite this report Responses(0)

Approved

Thank you for giving me opportunity to review article entitled “Detection of CYP2C19*2_ allele among Helicobacter pylori -infected patients in two tertiary hospitals of Khartoum, Sudan, 2019”.
After reading, some questions arose:

Helicobacter pylori should be written in italics.
In the methodological part, paragraph Real-Time PCR for CYP2C19*2 last line on page 4, the annealing temperature should be 60⁰C.
I am not convinced about the socio-demographic data included in Table 2, which includes occupations and education - are such data necessary?
The Authors themselves are aware of the small size of the study group and note this fact in the paragraph before the conclusions. However, this research may document the tendency observed by the Authors.
According to the order of citing articles in the text, the article published in References with number 32 should have number 21, and the numbering of articles from number 21 onwards should be changed by one number up.

In summary, I think that the article presents new information related to the occurrence of the CYP2C19*2 allelic variant in H. pylori infected Sudanase population and should be indexed.

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Yes
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Yes

Competing Interests

No competing interests were disclosed.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

13 Views

04 Mar 2022 | for Version 1

Mitsushige Sugimoto, Department of Gastroenterological Endoscopy, Tokyo Medical University Hospital, Tokyo, Japan

13 Views Cite this report Responses(0)

Approved With Reservations

General:

In this study, the authors evaluated the rate of CYP2C19*2 allele in H. pylori infected Sudanese population. In this study, authors showed that 16.6% of patients have CYP2C19*2 allele.

Major comments:

Serious problem of this study is loss of sample power. Therefore, it is unclear whether 16.6% of Sudanese population have CYP2C19*2 allele.
Authors should detect CYP2C19 *3 and *17 alleles among this population.
Please use H. pylori in italic.
Why did authors use UreC gene for detection of H. pylori infection?
In general, most of patients infected with H. pylori have chronic gastritis. Why 30% in this study?　
In Sudan, it was found in 80% of patients with Barrett's esophagus and gastritis (ref 3) and 56.3% among Sudanese children (ref 4). However, there is no data about Barrett's esophagus in this study.
CYP2C19 gene variants have been investigated in different communities including Europeans, Asians, and Africans, but it has not been well-studied among the Sudanese population. Please compare rate of CYP2C19 *2 allele with previous studies in the Sudanese population and this study.
16.6% of patients have CYP2C19*2 allele. How about rates of poor metabolizer (*2/*2)?

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Partly
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Upper GI, H. pylori, GERD, Gastric cancer

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

Respond to this report

Responses (0)

[1] 1. Oleastro M, Ménard A, Santos A, et al.: Real-time PCR assay for rapid and accurate detection of point mutations conferring resistance to clarithromycin in Helicobacter pylori. J Clin Microbiol. 2003 Jan 1; 41(1): 397–402. PubMed Abstract | Publisher Full Text | Free Full Text

[2] 2. Ruggiero P: Helicobacter Pylori and Inflammation. Curr Pharm Des. 2011; 16(38): 4225–4236. PubMed Abstract | Publisher Full Text

[3] 3. Ahmed HH, Mudawi HMFS: Gastro-oesophageal reflux disease in Sudan: a clinical endoscopic and histopathological study. Trop Gastroenterol. 2004; 25(3): 135–138. PubMed Abstract

[4] 4. Salih KMA, Elfaki OA, Hamid YHM, et al.: Prevalence of Helicobacter Pylori among Sudanese children admitted to a specialized children hospital. Sudan J Paediatr. 2017; PubMed Abstract | Free Full Text

[5] 5. Schistosomes, liver flukes and Helicobacter pylori. IARC Monogr Eval Carcinog Risks Hum. 1994. 1–241 p. PubMed Abstract | Free Full Text

[6] 6. Saeed IE, Weng H-Y, Mohammed, et al.: Cancer incidence in Khartoum, Sudan: first results from the Cancer Registry. Cancer Med. 2014; 3(4): 1075–1084. PubMed Abstract | Publisher Full Text | Free Full Text

[7] 7. Ruggiero P: Helicobacter pylori infection: What’s new. Curr Opin Infect Dis. 2012; 25(3): 337–344. PubMed Abstract | Publisher Full Text

[8] 8. Hunt RH, France FM: Helicobacter Pylori in Developing Countries. World Gastroenterology Organisation Global Guideline. J Gastrointest Liver Dis. 2011; 20(3): 299–304. PubMed Abstract | Publisher Full Text

[9] 9. Thung I, Aramin H, Vavinskaya V, et al.: The global emergence of Helicobacter pylori antibiotic resistance. Aliment Pharmacol Ther. 2016; 43(4): 514–533. PubMed Abstract | Publisher Full Text | Free Full Text

[10] 10. Zhang J, Peng X, Song Z, et al.: Gastric Juice-Based Real-Time PCR for Tailored Helicobacter Pylori Treatment: A Practical Approach. Int J Med Sci. 2017. PubMed Abstract | Publisher Full Text | Free Full Text Reference Source

[11] 11. El RN, Lima JJ, Johnson JA: Proton pump inhibitors: from CYP2C19 pharmacogenetics to precision medicine. Expert Opin Drug Metab Toxicol. 2018; 14(4): 447–460. PubMed Abstract | Publisher Full Text | Free Full Text

[12] 12. Dehbozorgi M, Kamalidehghan B, Hosseini I: Prevalence of the CYP2C19 * 2 (681 G > A ), * 3 (636 G > A) and * 17 (- 806 C > T) alleles among an Iranian population of different ethnicities. Mol Med Rep. 2018; 17(3): 4195–4202. PubMed Abstract | Publisher Full Text | Free Full Text

[13] 13. Manikandan P, Nagini S: Cytochrome P450 Structure, Function and Clinical Significance: A Review. Curr Drug Targets. 2018; 19: 38–54. PubMed Abstract | Publisher Full Text

[14] 14. Sadee W, Wang D, Papp AC, et al.: Pharmacogenomics of the RNA World: Structural RNA Polymorphisms in Drug Therapy. Clin Pharmacol Ther. 2009; 89(3): 355–365. PubMed Abstract | Publisher Full Text | Free Full Text

[15] 15. Yin T, Miyata T: Pharmacogenomics of clopidogrel: Evidence and perspectives. Thromb Res. 2011; 128(4): 307–316. PubMed Abstract | Publisher Full Text

[16] 16. Duconge J, Cadilla CL, Renta JY, et al.: Prevalence of CYP2C19 Gene Polymorphisms in the Puerto Rican Population: a Preliminary Report. P R Heal Sience J. 2009; 27(4): 357–358. PubMed Abstract | Free Full Text Reference Source

[17] 17. De Morais SM, Wilkinson GR, Blaisdell J, et al.: Identification of a new genetic defect responsible for the polymorphism of (S)-mephenytoin metabolism in Japanese. Mol Pharmacol. 1994; 46(4): 594–598. PubMed Abstract

[18] 18. Weitzel KW, Elsey AR, Langaee TY, et al.: Clinical Pharmacogenetics Implementation: Approaches , Successes, and Challenges. Am J Med Genet C Semin Med Genet. 2014; 166C(1): 56–67. PubMed Abstract | Publisher Full Text | Free Full Text

[19] 19. Johnson JA, Cavallari LH: Pharmacogenetics and Cardiovascular Disease — Implications for Personalized Medicine. Pharmacol Rev. 2013; 65(3): 987–1009. PubMed Abstract | Publisher Full Text

[20] 20. Abd SA, Rahem A, Elhag WI: Molecular Detection of Helicobacter pylori in Drinking Water in Khartoum State (Sudan). Afr J Med Sci. 2018; 3(5): 3–8.Reference Source

[21] 21. Vu N, Nguyen H, Tran N, et al.: CYP2C19 genetic polymorphism in the Vietnamese population. Ann Hum Biol. 2019; 46(6): 491–497. PubMed Abstract | Publisher Full Text

[22] 22. Lähdevirta J: Nephropathia epidemica in Finland. A clinical, histological and epidemiological study. Ann Clin Res. 1971; 3(Suppl. 8): 154 pp. PubMed Abstract Reference Source

[23] 23. Lu C-Y, Shih H-Y, Kuo F-C, et al.: CYP2C19 polymorphism influences Helicobacter pylori eradication. World J Gastroenterol. 2016; 20(43): 16029. PubMed Abstract | Publisher Full Text | Free Full Text

[24] 24. Allabi AC, Gala J, Desager J, et al.: Genetic polymorphisms of CYP2C9 and CYP2C19 in the Beninese and Belgian populations. Br J Clin Pharmacol. 2003; 56: 653–657. PubMed Abstract | Publisher Full Text | Free Full Text

[25] 25. Dandara C, Masimirembwa CM, Magimba A, et al.: Genetic polymorphism of CYP2D6 and CYP2C19 in east- and southern African populations including psychiatric patients. Eur J Clin Pharmacol. 2001; 57: 11–17. PubMed Abstract | Publisher Full Text

[26] 26. Kudzi W, Dodoo AMJ: Characterisation of CYP2C8, CYP2C9 and CYP2C19 polymorphisms in a Ghanaian population. BMC Med Genet. 2009; 10(1).Reference Source

[27] 27. Abdelhedi R, Bouayed N, Alfadhli S, et al.: Characterization of drug-metabolizing enzymes CYP2C9, CYP2C19 polymorphisms in Tunisian, Kuwaiti and Bahraini populations. J Genet. 2015; 94(4): 765–770. PubMed Abstract | Publisher Full Text

[28] 28. Ellison C, Abou El-Ella S, Tawfik M, et al.: Allele and Genotype Frequencies of CYP2B6 and CYP2C19 Polymorphisms in Egyptian Agricultural Workers. J Toxicol Environ Health. 2012; 75(4): 232–241. PubMed Abstract | Publisher Full Text | Free Full Text

[29] 29. Ramsjö M, Aklillu E, Bohman L, et al.: CYP2C19 activity comparison between Swedes and Koreans: effect of genotype, sex, oral contraceptive use, and smoking. Eur J Clin Pharmacol. 2010; 66(9): 871–877. PubMed Abstract | Publisher Full Text

[30] 30. Hagg S, Spigset ODR: Influence of gender and oral contraceptives on CYP2D6 and CYP2C19 activity in healthy volunteers. Br J Clin Pharmacol. 2001; 51(2): 169–173. PubMed Abstract | Publisher Full Text | Free Full Text

[31] 31. Khalil SI, Elkhawad AO: A study of CYP2C19 * 2, * 3 and * 7 in different Sudanese ethnic groups and their response to omeprazole based triple therapy in Khartoum. Sudan. Biomed Res. 2018; 29(13): 2743–2765.Reference Source

[32] 32. Abbas A, Malik S, Suleiman B, et al.: Detection of CYP2C19*2 allele among Helicopacter pylori-infected patients in two tertiary hospitals in Khartoum-Sudan [Internet]. figshare . 2021 [cited 2021 Oct 11]. Reference Source

Detection of CYP2C19*2_ allele among Helicobacter pylori -infected patients in two tertiary hospitals of Khartoum, Sudan, 2019

Abstract

Keywords

Abbreviations

Introduction

Methods

Study population

Sample collection

Processing methods

Table 1. Primers and probes sequences used in conventional and Real-time PCR.

Ethical consideration

Statistical analysis

Results

Socio-demographics of participants

Table 2. Socio-demographics of participants, (n = 30), Khartoum, Sudan.

Clinical characteristics of patients

Figure 1. Signs and symptoms of participants, (n = 30), Khartoum, Sudan.

Figure 2. Endoscopic findings of participants, (n = 30), Khartoum, Sudan.

H. pylori genome and CYP2C19*2 allele detection

Discussion

Conclusion

Data availability

Underlying data

Authors’ contributions

References

Comments on this article Comments (0)

Open Peer Review

Comments on this article Comments (0)

Open Peer Review

Reviewer Status

Reviewer Reports

Comments on this article

Browse by related subjects

Competing Interests Policy

Stay Updated

Detection of CYP2C19*2_allele among Helicobacter pylori -infected patients in two tertiary hospitals of Khartoum, Sudan, 2019