A guide to selecting high-performing antibodies for STXBP1 (UniProt ID: P61764) for use in western blot, immunoprecipitation, and immunofluorescence

Limitations

Inherent limitations are associated with the antibody characterization platform used in this study. Firstly, the YCharOS project focuses on renewable (recombinant and monoclonal) antibodies and does not test all commercially available STXBP1 antibodies. YCharOS partners provide approximately 80% of all renewable antibodies, but some top-cited polyclonal antibodies may not be available through these partners.

Secondly, the YCharOS effort employs a non-biased approach that is agnostic to the protein for which antibodies have been characterized. The aim is to provide objective data on antibody performance without preconceived notions about how antibodies should perform or the molecular weight that should be observed in western blot. As the authors are not experts in STXBP1, only a brief overview of the protein’s function and its relevance in disease is provided. STXBP1 experts are invited to analyze and interpret the observed banding pattern in western blot and subcellular localization in immunofluorescence.

Thirdly, YCharOS experiments are not performed in replicates primarily due to the use of multiple antibodies targeting various epitopes. Once a specific antibody is identified, it validates the protein expression of the intended target in the selected cell line, confirms the lack of protein expression in the KO cell line and supports conclusions regarding the specificity of the other antibodies. All experiments are performed using master mixes, and meticulous attention is paid to sample preparation and experimental execution. In IF, the use of two different concentrations serves to evaluate antibody specificity and can aid in assessing assay reliability. In instances where antibodies yield no signal, a repeat experiment is conducted following titration. Additionally, our independent data is performed subsequently to the antibody manufacturers internal validation process, therefore making our characterization process a repeat.

Lastly, as comprehensive and standardized procedures are respected, any conclusions remain confined to the experimental conditions and cell line used for this study. The use of a single cell type for evaluating antibody performance poses as a limitation, as factors such as target protein abundance significantly impact results.⁶ Additionally, the use of cancer cell lines containing gene mutations poses a potential challenge, as these mutations may be within the epitope coding sequence or other regions of the gene responsible for the intended target. Such alterations can impact the binding affinity of antibodies. This represents an inherent limitation of any approach that employs cancer cell lines.

Cell lines and antibodies

Cell lines used and primary antibodies tested in this study are listed in Tables 1 and 2, respectively. To ensure that the cell lines and antibodies are cited properly and can be easily identified, we have included their corresponding Research Resource Identifiers, or RRID.^10,11

Table 3. Illustrations to assess antibody performance in all western blot, immunoprecipitation and immunofluorescence.

Western blot	Immunoprecipitation	Immunofluorescence

CRISPR/Cas9 genome editing: U-87 MG KO clone corresponding to the STXBP1 gene was generated at Abcam. Two guide RNAs were used to induce a deletion in exon 3 of the STXBP1 gene (sequence guide 1: TGGTGGATCAGTTAAGCATG, sequence guide 2: ATGACAGACATCATGACCGA).

Peroxidase-conjugated goat anti-rabbit and anti-mouse antibodies are (Thermo Fisher Scientific, cat. number 65-6120 and 62-6520). Peroxidase-conjugated donkey anti-goat antibody is from Thermo Fisher Scientific (cat. number A15999). Alexa-555-conjugated goat anti-rabbit and anti-mouse secondary antibodies (Thermo Fisher Scientific, cat. number A-21429 and A-21424). Alexa-555-conjugated donkey anti-goat secondary antibody is from Thermo Fisher Scientific (cat. number A-21432). Peroxidase-conjugated Protein A for IP detection is from Cell Signaling Technology, cat. number 12291.

Antibody screening by western blot

U-87 MG WT and STXBP1 KO cells were collected in RIPA buffer (25mM Tris-HCl pH 7.6, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS) (Thermo Fisher Scientific, cat. number 89901) supplemented with 1x protease inhibitor cocktail mix (MilliporeSigma, cat. number P8340). Lysates were sonicated briefly and incubated 30 min on ice. Lysates were spun at ~110,000 × g for 15 min at 4°C and equal protein aliquots of the supernatants were analyzed by SDS-PAGE and western blot. BLUelf prestained protein ladder (GeneDireX, cat. number PM008-0500) was used.

Western blots were performed with precast midi 4-20% Tris-Glycine polyacrylamide gels (Thermo Fisher Scientific, cat. number WXP42012BOX) ran with Tris/Glycine/SDS buffer (Bio-Rad, cat. number 1610772), loaded in Laemmli loading sample buffer (Thermo Fisher Scientific, cat. number AAJ61337AD) and transferred on nitrocellulose membranes. Proteins on the blots were visualized with Ponceau S staining (Thermo Fisher Scientific, cat. number BP103-10) which is scanned to show together with individual western blot. Blots were blocked with 5% milk for 1 hr, and antibodies were incubated O/N at 4°C with 5% milk in TBS with 0.1% Tween 20 (TBST) (Cell Signalling Technology, cat. number 9997). Following three washes with TBST, the peroxidase conjugated secondary antibody was incubated at a dilution of ~0.2 μg/ml in TBST with 5% milk for 1 hr at room temperature followed by three washes with TBST. Membranes were incubated with Pierce ECL (Thermo Fisher Scientific, cat. number 32106) or Clarity Western ECL Substrate (Bio-Rad, cat. number 1705061) prior to detection with the iBright™ CL1500 Imaging System (Thermo Fisher Scientific, cat. number A44240).

Antibody screening by immunoprecipitation

U-87 MG WT were collected in Pierce IP lysis buffer (Thermo Fisher Scientific, cat. number 87788) (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40 and 5% glycerol) supplemented with protease inhibitor. Lysates were rocked 30 min at 4°C and spun at 110,000 × g for 15 min at 4°C.

Immunoprecipitation was performed using the KingFisher Apex purification system from Thermo Fisher Scientific (cat. number 5400930). Briefly, 2 μg of antibody were conjugated to 30 μl of Dynabeads protein A- (for rabbit antibodies) or protein G- (for mouse and goat antibodies) (Thermo Fisher Scientific, cat. number 10002D and 10004D, respectively) in 500 μl of Pierce IP Buffer. Conjugation was allowed for 30 min at 4°C followed by two 30 sec washes to remove unbound antibodies. Antibody NBP3-15097** is at an unknown concentration and therefore 5 μl were tested in the IP.

0.4 ml aliquots at 1.5 mg/ml of lysate were incubated with an antibody-bead conjugate for 1h at 4°C and beads were subsequently washed three times for 30 sec in 1.0 ml of IP buffer. All steps were scripted with recurring loops of mixing to keep the beads in suspension. Elution was set at 65°C for 10 min. Unbound fractions and eluates were collected at the end of the run and processed for SDS-PAGE and western blot on precast midi 4-20% Tris-Glycine polyacrylamide gels. Protein A:HRP was used as a secondary detection system at a concentration of 0.5 μg/ml.

Antibody screening by immunofluorescence

U-87 MG WT and STXBP1 KO cells were labelled with a green and a far-red fluorescence dye, respectively (Thermo Fisher Scientific, cat. number C2925 and C34565). The nuclei were labelled with DAPI (Thermo Fisher Scientific, cat. Number D3571) fluorescent stain. WT and KO cells were plated on 96-well plate with optically clear flat-bottom (Perkin Elmer, cat. number 6055300) as a mosaic and incubated for 24 hrs in a cell culture incubator at 37^oC, 5% CO₂. Cells were fixed in 4% paraformaldehyde (PFA) (VWR, cat. number 100503-917) in phosphate buffered saline (PBS) (Wisent, cat. number 311-010-CL). Cells were permeabilized in PBS with 0.1% Triton X-100 (Thermo Fisher Scientific, cat. number BP151-500) for 10 min at room temperature and blocked with PBS with 5% BSA, 5% goat serum (Gibco, cat. number 16210-064) and 0.01% Triton X-100 for 30 min at room temperature. Cells were incubated with IF buffer (PBS, 5% BSA, 0.01% Triton X-100) containing the primary STXBP1 antibodies overnight at 4°C. Cells were then washed 3 × 10 min with IF buffer and incubated with corresponding Alexa Fluor 555-conjugated secondary antibodies in IF buffer at a dilution of 1.0 μg/ml for 1 hr at room temperature with DAPI. Cells were washed 3 × 10 min with IF buffer and once with PBS.

Images were acquired on an ImageXpress micro confocal high-content microscopy system (Molecular Devices), using a 20x NA 0.95 water immersion objective and scientific CMOS cameras, equipped with 395, 475, 555 and 635 nm solid state LED lights (lumencor Aura III light engine) and bandpass filters to excite DAPI, Cellmask Green, Alexa-555 and Cellmask Red, respectively. Images had pixel sizes of 0.68 × 0.68 microns, and a z-interval of 4 microns. For analysis and visualization, shading correction (shade only) was carried out for all images. Then, maximum intensity projections were generated using 3 z-slices. Segmentation was carried out separately on maximum intensity projections of Cellmask channels using CellPose 1.0, and masks were used to generate outlines and for intensity quantification.¹² Figures were assembled with Adobe Illustrator.