Renoprotective Effects of Montelukast in Sepsis-Induced AKI: Targeting the NF-κB Pathway

Abeer J. Abdulredha; Murooj L. Majeed

doi:10.12688/f1000research.163164.2

Home Browse Renoprotective Effects of Montelukast in Sepsis-Induced AKI: Targeting...

ALL Metrics

-

Views

-

Downloads

Get PDF

Get XML

Export

▬

✚

Research Article

Revised

Renoprotective Effects of Montelukast in Sepsis-Induced AKI: Targeting the NF-κB Pathway

[version 2; peer review: 1 approved, 1 approved with reservations]

Abeer J. Abdulredha ¹, Murooj L. Majeed²

PUBLISHED 17 Apr 2026

Author details Author details

¹ Department of Pharmacology, University of Kufa, Kufa, Najaf Governorate, Iraq
² Department of Pharmacology and Therapeutics, University of Kufa, Kufa, Najaf Governorate, Iraq

Abeer J. Abdulredha
Roles: Conceptualization, Data Curation, Formal Analysis, Investigation, Methodology, Validation, Writing – Original Draft Preparation

Murooj L. Majeed
Roles: Visualization, Writing – Original Draft Preparation, Writing – Review & Editing

OPEN PEER REVIEW

REVIEWER STATUS

This article is included in the Advances in Fibroblast Research collection.

Abstract

Background

Sepsis-associated acute kidney injury (SA-AKI) is ubiquitous among patients with critical conditions and contributes to high mortality rates. Experimentally, SA-AKI was elicited in murine models via cecal ligation and puncture (CLP) technique.

Aims

This study aimed to determine the possible protective effects of montelukast on sepsis-induced acute kidney injury in a mouse sepsis model.

Methods

Albino male Swiss mice (n = 40) were allocated into four distinct groups: (i) normal group, (ii) CLP group, (iii) vehicle group, and (iv) CLP + Montelukast group (20 mg/kg one hour before CLP). Blood and tissue biochemical/routine indicators, renal function, SA-AKI-related pathophysiological processes, and nuclear factor kappa B (NF-κB) p65 gene and protein expression in septic mice were assessed using histological hematoxylin and eosin (H&E) staining, immunohistochemical (IHC) staining, quantitative reverse transcription polymerase chain reaction (qRT-PCR), and Enzyme-Linked Immunosorbent Assay (ELISA).

Results

The findings highlight that Montelukast reversed CLP-induced increases in serum blood urea nitrogen (BUN), creatinine (Cr), and kidney injury molecule (KIM) levels. It also significantly inhibited elevated concentrations of interleukin (IL)-1β, tumor necrosis factor alpha (TNF-α), F2-isoprostane, and caspase-3 in renal tissues. Additionally, NF-κB p65 gene and protein expression levels were notably lower in the CLP+ montelukast group than in CLP group P<0.001. In addition, montelukast significantly mitigated extensive tubular damage in the murine sepsis group p<0.001.

Conclusion

These findings suggest that montelukast may serve as a promising therapeutic agent for sepsis-induced AKI.

Keywords

Cecal ligation & puncture, inflammatory mediators, Montelukast, NF-κB signaling cascade, Sepsis associated acute kidney injury

Corresponding author: Abeer J. Abdulredha

Competing interests: No competing interests were disclosed.

Grant information: The author(s) declared that no grants were involved in supporting this work.

Copyright: © 2026 Abdulredha AJ and Majeed ML. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

How to cite: Abdulredha AJ and Majeed ML. Renoprotective Effects of Montelukast in Sepsis-Induced AKI: Targeting the NF-κB Pathway [version 2; peer review: 1 approved, 1 approved with reservations]. F1000Research 2026, 14:660 (https://doi.org/10.12688/f1000research.163164.2) First published: 07 Jul 2025, 14:660 (https://doi.org/10.12688/f1000research.163164.1) Latest published: 17 Apr 2026, 14:660 (https://doi.org/10.12688/f1000research.163164.2)

Revised Amendments from Version 1

In this updated version of the article, several important revisions have been made to enhance the clarity of the study. The Introduction has been expanded to provide a more detailed background on sepsis-induced kidney injury, and repetitive statements have been removed to improve readability. Vehicle control clarification, vehicle control group (10% DMSO in saline) showed results comparable to the CLP group, indicating no significant effect on the studied markers. Thus, the protective effects are attributed to montelukast. Histological images have been updated, with some replaced by higher-resolution versions, scale bars added, and standardized arrows used instead of hand-drawn annotations to improve interpretability. The role of montelukast in reducing KIM-1 levels has been clarified and linked to the ERK1/2–STAT3–KIM-1 signaling pathway. Minor editing changes have also been made throughout the manuscript to improve readability and overall presentation.

To read any peer review reports and author responses for this article, follow the "read" links in the Open Peer Review table.

Introduction

Sepsis is a life-threatening condition caused by infection and characterized by systemic organ dysfunction. It is driven by an uncontrolled immune response, cytokine storm, and oxidative stress, which can culminate in multiple organ failure, eventually leading to death.¹^–³ Sepsis is primarily triggered by microorganisms, such as bacteria, viruses, and fungi, and can affect various organs, including the heart, kidney, liver, and central nervous system.⁴^,⁵ Acute Kidney Injury is a common outcome associated with the clinical scenario of sepsis.⁶ The pathogenesis of AKI in sepsis is multifaceted. Among these contributing factors, oxidative stress and inflammation are pivotal etiological agents of septic AKI.⁷ Sepsis-associated acute kidney injury originates from intricate, heterogeneous mechanisms that culminate in renal injury. These mechanisms may arise directly from the infectious agent and the corresponding host immune response, or may represent indirect ramifications of sepsis or its therapeutic intervention. Various pathophysiological mechanisms may interact and participate in AKI in patients with sepsis, including systemic and renal inflammation, macrocirculatory anomalies, microcirculatory dysfunction, metabolic reprogramming, mitochondrial impairment, and dysregulation of the renin-angiotensin-aldosterone system (RAAS).⁸ Inflammation, recognized as a critical element in sepsis, appears to significantly influence the pathogenesis of SA-AKI. Pathogen-associated molecular patterns (PAMPs) and damage-associated molecular patterns (DAMPs) can stimulate toll-like receptors (TLRs). Among these receptors, TLR-2 and TLR-4 are expressed on the surface of tubular epithelial cells within the renal system.⁹ The engagement of TLR-2 and TLR-4 initiates a cascade of inflammatory responses, which is marked by the secretion of pro-inflammatory cytokines, including IL-1α, IL-6, IL-8, and TNF-α.¹⁰ In parallel, sepsis induces profound alterations in cellular energy metabolism, leading to metabolic reprogramming of immune cells. This adaptive shift, characterized by a transition from mitochondrial oxidative phosphorylation to glycolysis, supports the increased energy demands of the inflammatory response during the early phase of sepsis. However, sustained metabolic reprogramming ultimately promotes mitochondrial dysfunction, oxidative stress, and subsequent organ injury.¹¹ Both macrovascular and microvascular dysfunction contribute to the development of SA-AKI. While hypotension-induced macrocirculatory impairment reduces renal perfusion and glomerular filtration, increasing evidence highlights the critical role of microcirculatory dysfunction.¹² In particular, inflammatory signaling, oxidative stress, endothelial damage, and microthrombus formation.¹³ In addition, the mitigation of blood flow in the capillaries is also accompanied by capillary leakage and early renal interstitial edema.¹² Cellular injury in SA-AKI involves multiple forms of regulated cell death, including apoptosis, necroptosis, pyroptosis, and ferroptosis, all contributing to tubular damage and renal dysfunction. Apoptosis is a caspase-dependent, relatively controlled process,¹⁴ whereas necroptosis¹⁵ and pyroptosis¹⁶ are highly inflammatory and amplify tissue injury. Ferroptosis, an iron-dependent form of cell death driven by lipid peroxidation and oxidative stress, has emerged as a potential contributor to renal damage in SA-AKI.¹⁷ The interplay among these pathways highlights the complexity of renal injury during sepsis. In response to cellular stress, adaptive processes such as autophagy play essential roles in maintaining cellular homeostasis. Autophagy facilitates the removal of damaged organelles, thereby limiting cellular injury and promoting survival during the early stages of sepsis.¹⁸ This process is regulated by autophagy-related genes, including Atg5 and Atg7, which have already been documented to be involved in the development of kidney disease,¹⁹ and interact with signaling pathways such as mTOR, sirtuins (SIRT1, SIRT3, and SIRT6), and NF-κB in SA-AKI.²⁰ Apart from autophagy, efficient efferocytosis is required for the timely clearance of dying cells to prevent excessive accumulation of DAMPs and sustained inflammatory signaling.²¹ In this context, apoptosis inhibitor of macrophages (AIM) binds to IgM, preventing its renal excretion. However, during AKI, AIM dissociates from IgM, is filtered through the glomeruli, and binds to KIM-1 in renal tissue, thereby promoting SA-AKI through efferocytosis.²² Among the molecular pathways implicated in SA-AKI, NF-κB signaling plays a pivotal integrative role in coordinating inflammatory, immune, and stress responses.²³ Under normal circumstances, inflammation is beneficial to the host and typically self-limiting. However, uncontrolled inflammation can lead to persistent tissue damage, leading to acute or chronic inflammatory diseases.²⁴ Furthermore, the TLR4/NF-κB signaling pathway is regarded as a central pro-inflammatory signaling cascade, known as the switch to initiate and stop inflammation.²⁵ Pro-inflammatory cytokines may activate NF-κB, amplifying the initial inflammatory signal, and trigger a vicious cycle that exacerbates the inflammatory response and further damages the microcirculation of the body.²⁶

Methods

Animals

The current investigation was conducted using a cohort of 40 albino Swiss mice, with a weight spectrum of 25–30 g and an age range of 8–12 weeks. All euthanizing procedures were conducted under a combination of ketamine- and xylazine-based anesthesia, with diligent efforts made to mitigate individual distress. The experimental methodologies and protocols employed in this study were approved on August 29, 2024, under reference number (20553) from the ethics committee for the care and utilization of laboratory animals.

Animal Welfare and Ethical Statement

The current study was done with a total of 40 albino Swiss mice, aged 8-12 weeks and weighing 25-30 g, obtained from the College of Science, University of Kufa. These animals were housed in the animal house within their cages under 12:12 light: dark cycles with 25°C room temperature, 60-65% humidity, and free access to food and water ad libitum. All animal procedures were conducted based on the guidelines of the Kufa University and were approved by the Institutional Animal Care and Use Committee (IACUC). The experimental protocol was reviewed and approved by the Research Ethics Committee, Faculty of Pharmacy, Kufa University under approval number (20553 on August 29, 2024). All efforts were made to minimize animal suffering, encompassing the use of appropriate anesthesia (xylazine of (20 mg/ml) and ketamine of 100 mg/ml), and animals were monitored closely throughout the study. Humane endpoint and euthanasia protocols were strictly followed through cardiac puncture following intraperitoneal injection of thiopental sodium (50 mg/kg) to induce deep anesthesia to ensure a painless and ethical procedure.

Cecal ligation and puncture

In the current study, CLP used in earlier studies, including those performed by Refs. 27, 28, was employed to induce sepsis in animals. It is introduced by making a midline incision measuring 1.5 cm while the subject is under general anesthesia, wherein xylazine of (20 mg/ml) and ketamine of 100 mg/ml are mixed (2:1) and administered.²⁹ The cecum was ligated, situated below the ileocecal junction, and punctured twice with a cutting cannula to inflict kidney organ damage during the first 24 h of acute sepsis. Subsequently, the puncture hole was used to squeeze a tiny amount of fecal material from behind the perforation site. Thereafter, the anterior abdomen was sutured to prevent leakage. Sham mice were subjected to the same procedures, except that CLP was not performed.

Experimental groups

Mice were classified into the subsequent four distinct groups (n=10):

Sham group: Evidently, mice exhibited no apparent signs of disease.

CLP cohort: Mice belonging to this cohort experienced a Cecal Ligation and Puncture surgical procedure.

Vehicle group: Murine classified within this category was administered an equivalent volumetric measurement of the solvent dimethyl sulfoxide (DMSO) intraperitoneally; CLP was performed after 1 h, and then the animals were euthanized after 24 h.

Montelukast group: Mice affiliated with this group received montelukast 20 mg/kg intraperitoneally³⁰; CLP was performed after 1 h, and then the animals were euthanized after 24 h.

Sample preparation and tissue isolation

After 24 h, the mice were euthanized under anesthesia and blood was collected using the direct heart puncture method. Blood was left in a gel tube rack for approximately 20 min to allow for clot formation, after which it was centrifuged at 10,000 rpm for approximately 10 min. Then, the supernatant was retained at -20°C for sequences of biochemical assessment.³¹ The right kidney tissues were fixed in 10% formaldehyde for histological investigation (H&E) and IHC analysis,³² whereas the left kidneys of different groups were collected and divided into two sections. The first section was homogenized in cold phosphate-buffered saline (PBS) (pH 7.4), and the supernatants were used for ELISA. The remainder of the tissue (1/3) was immersed in the TRIzol reagent for gene expression measurement. Until analysis, both the tissue homogenate supernatants and the TRIzol-treated tissue samples were kept at -80°C.³³

Evaluation of renal histology

After fixation with 4% paraformaldehyde for 24 h, the right kidney was embedded in paraffin. H&E and periodic acid-Schiff (PAS) reagents were used to stain 4 μm thick sections cut from the renal tissue wax blocks. Tissue damage was scored as follows: 0, no harm; 1, 0–25; 2, 25–50; 3, 50–75; 4, >75%.³⁴

Evaluation of renal function

BUN and Cr concentrations were measured using a Biolis colorimetric assay kit (Biolis, Tokyo, Japan).

Assay of Enzyme-Linked Immunosorbent

ELISA kit instructions (Sunlong, China) were followed while processing tissue samples kept in a refrigerator at -80°C for evaluation of TNF-α, IL-1β, F2-isoprostane, and caspase-3, in addition to measurement of serum KIM-1 levels. Absorbance was measured at 450 nm using a microplate reader to create a standard curve and determine the concentration.

Immunohistochemistry assay

Paraffin-embedded blocks of the renal sections were studied after xylene deparaffinization; the rehydration step of these sections was performed by decreasing the alcohol concentration. Then, blockade of Peroxidase activity was blocked with H2O2, while protein blockers were used for non-specific binding sites, primary antibodies against NF-κB (mouse NF-κB antibody, 1:200) were incubated at 4°C overnight, followed by the addition of a secondary antibody (biotinylated antibody) done at 37°C for 30 min. HRP was added at the same time. Finally, each slide was treated with the chromogen (100μl/slide) for 15 min. All sections were counterstained with hematoxylin. Positive immunostaining was visualized as brown granules contained in the cytoplasm.³⁵

Quantitative Reverse Transcription Polymerase Chain Reaction assay

Total RNA was extracted using TRIzol reagent, according to the manufacturer’s instructions. We used an ABI 7500 real-time PCR machine and the Power SYBR Green PCR master mix to run real-time PCR in triplicate on cDNA produced by a reverse transcription reaction. Table 1 displays the primer sequences used, with GAPDH as the internal control. The 2^-∆∆Ct technique was used to determine the relative expression levels of target genes.

Table 1. Sequences of primers and housekeeping gene.

GENE	F (forward primer)	R (reverse primer)
NF-κB/P65	GGCCTCATCCACATGAACTT	CACTGTCACCTGGAAGCAGA
HKG	TCTTGGGCTACACTGAGGAC	TGTTGCTGTAGCCGTATTCA

Statistical analysis

This study utilized version 9.3.1 of GraphPad Prism for statistical analysis https://www.graphpad.com/demos/. One-way analysis of variance (ANOVA) was used to examine differences across groups. Subsequently, the Bonferroni method for multiple comparisons was used to conduct post-hoc tests. All tests were deemed statistically significant when P was less than 0.05. All data are presented as the mean ± SEM.

Results

Renal function

The results indicated that the CLP and vehicle cohorts had remarkably elevated serum BUN ( Figure 1A) and Cr ( Figure 1B) levels, in contrast to the sham cohort. Additionally, the BUN and Cr levels in the montelukast group were significantly lower than those in the CLP or vehicle cohorts.

Figure 1. A: Mean (±SEM) concentrations of the urea in the different experimental cohorts; p<0.001, vs. Sham group; #p<0.001, vs. CLP or vehicle group, CLP: Cecal ligation & puncture. B: Mean (±SEM) concentrations of serum creatinine in the different experimental cohorts; p<0.001, vs. Sham group; #p<0.001, vs. CLP or vehicle group, CLP: Cecal ligation & puncture.

Inflammatory cytokines

According to these findings, the CLP and vehicle cohorts exhibited a notably heightened level of TNF-α ( Figure 2A) and IL-1β ( Figure 2B), which was in stark contrast to the sham cohort. Furthermore, TNF-α plus IL-1β concentrations in the montelukast cohort were significantly lower than those in the CLP or vehicle cohorts.

Figure 2. A: Mean concentrations (±SEM) of renal tissue TNF-α (ng/L) among the various experimental cohorts; p<0.001, vs. Sham group; #p<0.001, vs. CLP or vehicle group, CLP: Cecal ligation & puncture; TNF-α: tumor necrosis factor alpha. B: Mean concentrations (±SEM) of renal tissue IL-1β (ng/L) among the various experimental cohorts; p<0.001, vs. Sham group; #p<0.001, vs. CLP or vehicle group, CLP: Cecal ligation & puncture; IL: interleukin.

Apoptotic factor (caspase-3)

The results indicated that caspase-3 tissue levels in the CLP and vehicle cohorts were remarkably higher than those in the sham cohort. Additionally, the montelukast group had significantly lower levels of caspase-3 than the CLP or vehicle groups, Figure 3.

Figure 3. Mean (± SEM) caspase-3 (ng/ml) levels of the experimental groups; *p<0.001, vs. Sham group; #p<0.001, vs. CLP or vehicle group, CLP: Cecal ligation & puncture.

Oxidative stress (F2-isoprostane)

The results indicated that CLP and vehicle cohorts had a significantly higher concentration of F2-isoprostanes than the sham cohort. Additionally, the cohort administered montelukast exhibited significantly reduced concentrations compared to the CLP or vehicle cohorts, Figure 4.

Figure 4. Mean (±SEM) concentrations of F2-isoprostane (ng/L) in the various experimental cohorts; *p<0.001, vs. Sham group; #p<0.001, vs. CLP or vehicle group, CLP: Cecal ligation & puncture.

Serum KIM-1

The results indicated that the CLP and vehicle cohorts had remarkably higher serum KIM-1 levels than the sham cohort. Additionally, the KIM-1 levels in the montelukast group were significantly lower than those in the CLP or vehicle groups, Figure 5.

Figure 5. Mean (±SEM) concentrations of serum KIM-1 in the different experimental cohorts; *p<0.001, vs. Sham group; #p<0.001, vs. CLP or vehicle group, CLP: Cecal ligation & puncture.

Renal histopathological damage

As illustrated in Figure 6, significant pathological alterations were observed in both CLP and vehicle cohorts. Nevertheless, renal injury induced by CLP were markedly ameliorated by pretreatment with montelukast.

Figure 6. Montelukast attenuated renal histopathological alterations in septic rodent models. H&E staining (400 x, Scale bar: 50 μm). A: Sham group, mice kidney with normal renal tubules. B: CLP group, mice kidneys with 95% renal tubule damage. Cytoplasmic vacuoles (yellow arrows), eosinophilic casts (blue arrows), and severe inflammation (green arrows). C: Vehicle groups, mice kidney with 90% renal tubule damage. Cytoplasmic swelling and increased cytoplasmic eosinophilia (black arrows), cytoplasmic vacuoles (yellow arrows), and normal glomerulus (orange arrows). D: Montelukast group, mice kidney with 25% renal tubule damage. Normal tubules (orange arrows). E: Quantification of renal tissue damage scores of mice across all groups, *p<0.001, compared to sham group; #p<0.001, compared to CLP or vehicle group, CLP: Cecal ligation & puncture.

mRNA expression of NF-κB p 65 gene

As shown in Figure 7, the CLP and vehicle groups had a lower ΔCT than the sham group, indicating a significant increase in the NF-κB p65 mRNA expression. Additionally, there was a substantial ΔCT surge in the montelukast group compared to the CLP or vehicle groups, representing a decrease in NF-κB p65 mRNA expression.

Figure 7. Mean (±SEM) levels of NF-κB p65 mRNA expression in the experimental groups.

*p<0.001, vs. Sham group; #p<0.001, vs. CLP or vehicle group, CLP: Cecal ligation & puncture; ΔC_T: delta cycle threshold; NF-κB: nuclear factor kappa B.

Expression of NF-κB p 65 via IHC

Figure 8 illustrates the intensity of positive NF-κB p 65 staining in renal tissue, in addition to negative staining, as follows:

Figure 8. Immunohistochemical expression of NF-κB p65 in mouse kidney. A: Sham group lacked NF-κB labeling intensity (blue color). B: CLP group displayed strong positive NF-κB labeling intensity (brown color). C: Vehicle group displayed strong positive NF-κB labeling intensity (brown color). D: CLP + Montelukast group exhibited minimal NF-κB labeling intensity (blue color), the microscopic assessment was quantified using integral optical density at 400x magnification; scale bar: 50 μm. E: Mean (±SEM) H. Score of NF-κB p65 protein expression in the experimental groups. *p<0.001, vs. Sham group; #p<0.001, vs. CLP or vehicle group, CLP: Cecal ligation & puncture; NF-κB: nuclear factor kappa B.

Discussion

Despite the widespread recognition of the clinical importance of SA-AKI, its pathophysiological mechanisms remain controversial, and there is a lack of unified diagnostic and therapeutic standards.³⁶ Sepsis is characterized not only by hyperinflammation but also by a complex immunosuppressive state. Several experimental and clinical investigations have shown that the immunosuppressive state induced by sepsis is typified by decreased antimicrobial effector functionalities, thereby increasing vulnerability to infections.³⁷ Immunosuppression associated with sepsis is multifaceted and is believed to arise from compromised cytokine production and reduction in the phagocytic capabilities of myeloid cells.³⁸ The present investigation revealed that the tissue concentration of the pro-inflammatory cytokine TNF-α was markedly elevated in the CLP cohort compared to that in the ostensibly healthy cohort. This investigation corroborates previous findings,³⁹ which demonstrated that in sepsis models, the concentrations of proinflammatory cytokines, particularly TNF-α, were elevated in CLP mice and that increased concentrations of TNF-α correlated with mortality outcomes. In addition, this result was consistent with a previous study⁴⁰ showing that renal ischemia-reperfusion injury (RIRI) is a major cause of AKI, characterized by significant inflammation that exacerbates tissue damage. Additionally, the level of tissue TNF-α was significantly lower in the montelukast group than that in the CLP group. Our results were confirmed by an investigation conducted by Khodir et al., which provided evidence suggesting that montelukast may confer a protective effect on the heart in the context of LPS-induced cardiac injury in rat models.⁴¹ These findings imply that the anti-inflammatory effects of montelukast may be ascribed to the attenuation of pro-inflammatory mediators.⁴² Furthermore, our study revealed a notable increase in the tissue levels of IL-1β in the CLP cohort compared to the sham group. This work concurs with a prior study conducted by Ibadi et al. in exploring the lung damage induced by CLP, and found that the CLP procedure caused a significant surge in pro-inflammatory cytokine levels, IL-1β.⁴³ Another study investigated the effects of resveratrol on IRI in rats. They found that the level of IL-1β became altered (increased significantly) in ischemic rats.⁴⁴ On the other hand, the present study, regarding the influence of montelukast on the concentration of IL-1β, demonstrates that the levels of tissue IL-1β were considerably diminished in the montelukast cohort, in contrast to CLP. Our study is in agreement with those visualized by Ref. 42 and found that compared to the LPS cohort, management with montelukast lessened the surge in serum IL-1β concentration. In addition, the current study found that the CLP and vehicle groups had significantly higher tissue levels of caspase-3 than the sham group. Similar results showed that the sepsis group had higher caspase-3 levels than the normal physiological state.⁴⁵ Moreover, this work concurs with a prior study that examined renal damage induced by RIRI. They found that RIRI caused a significant surge in the kidney marker of apoptosis, caspase-3, compared to the sham group.⁴⁶^,⁴⁷ Additionally, in the present study, concerning the effect of montelukast on the level of caspase-3, the concentration of renal caspase-3 was remarkably lowered within the montelukast cohort, contrary to the CLP group. To the best of our knowledge, no prior study has investigated the pharmacological effects of montelukast on caspase-3 during sepsis. This finding could be ascribed to the ability of montelukast to reduce the levels of NO and renal HO-1. Montelukast effectively mitigated elevated concentrations of ET-1, MCP-1, and TNF-α. These effects were associated with a reduction in caspase-3 expression in the kidneys, confirming its anti-apoptotic activity.⁴⁸ Moreover, the current investigation found that the CLP and vehicle cohorts had considerably higher kidney tissue concentrations of F2-isoprostane than the sham cohort. This study supports another work that established a notably higher concentration of the oxidative stress marker (F2-Isoprostane) within the sepsis cohort than in the sham cohort.⁴⁹ In the present study, regarding the impact of montelukast on F2-isoprostane concentration, it was observed that montelukast markedly reduced the concentration of F2-isoprostane within kidney tissue compared to the CLP group. Additionally, our work is compatible with,⁵⁰ which examined whether montelukast possesses the potential to conserve lung function during instances of polymicrobial sepsis. The results of this study showed that mice subjected to sepsis exhibited a notable increase in the level of F2-isoprostane within lung tissues, in stark contrast to the sham cohort. Compared to the sepsis cohort, the administration of montelukast resulted in a significant reduction in F2-isoprostane levels in the lung tissue. This finding can be attributed to the montelukast inhibitory effect of the NF-κB/NLRP3 pathway in which NLRP3 can induce reactive oxygen species production.⁵¹ Furthermore, the current study showed that serum KIM-1 was remarkably higher in the CLP cohort than in the sham cohort. This work agrees with a previous study that confirmed that the levels of KIM-1 in Lyn mice that underwent sepsis were remarkably higher than those in sham mice.⁵² In addition, the current study aligns with another research effort that established the upregulation of inflammatory marker KIM-1 in both the RIRI and vehicle groups when compared to the sham group.⁴⁶^,⁴⁷ In the present investigation, concerning the impact of montelukast on the concentration of KIM-1, it was observed that montelukast markedly reduced the concentration of KIM-1 in kidney tissue compared to the CLP group. To the best of our knowledge, this investigation represents an inaugural work that elucidates the influence of this pharmacological agent on renal KIM-1 level within the context of the CLP model of sepsis in mice. This observation may be attributed to the ability of montelukast to inhibit the ERK signaling pathway.⁵³ Collier and Schnellmann posited that inhibition of ERK1/2 prevents renal sepsis-induced STAT3 phosphorylation, thereby attenuating KIM-1 level through the ERK1/2–STAT3–KIM-1 signaling pathway following renal injury.⁵⁴ In addition, the present investigation revealed that the mRNA and protein expression of NF-κB p65 were notably elevated in the CLP cohort compared to the sham cohort. This work corroborates findings from a previous study, which indicated that the phosphorylation level of p65 within the renal tissue of the CLP cohort was significantly increased when juxtaposed with the sham cohort.⁵⁵ In the present study, concerning the impact of montelukast on the expression of NF-κB p65, there was a notable reduction in NF-κB p65 expression within the renal tissue relative to the CLP cohort. This study is the first to clarify the effect of this pharmacological agent on renal NF-κB p65 expression in a murine model of CLP-induced sepsis. This result may be attributed to the ability of montelukast to mitigate IL-1β-induced NF-κB p65 phosphorylation, thereby inhibiting nuclear translocation and subsequent NF-κB activity related to gene expression.⁵⁶ Moreover, the CLP and vehicle groups showed remarkable histopathological changes compared to the sham group. The renal tissue of the sham group mice had normal architecture, whereas the kidneys obtained from the mice in the CLP cohort exhibited signs of hemorrhage, severe inflammation, increased cytoplasmic eosinophilia, eosinophilic casts, and cytoplasmic vacuoles, as well as loss of brush border. These observations are consistent with those obtained by⁵⁷ in their study on groups of CLP mice. They reported that CLP causes inflammation, necrosis, hemorrhage, and degeneration of kidney tissue. Additionally, the Montelukast group showed a significantly lower level of renal tissue injury than did the sepsis group. Our results agree with Khodir and colleagues’ study on rats to examine the renoprotective effects of Montelukast after CLP.⁵⁸ This finding can be attributed to their antioxidant and anti-inflammatory properties. It is important to note that the potential influence of the vehicle (DMSO) was carefully controlled in this study. The vehicle group, which received 10% DMSO in saline via intraperitoneal injection under identical experimental conditions, did not show significant changes in inflammatory, oxidative, or apoptotic markers compared with the sepsis control group. This finding suggests that DMSO at this concentration did not exert a measurable biological effect under the present experimental conditions. Thus, the protective effects observed in this study are attributed to montelukast rather than the vehicle.

Limitations

The use of a montelukast pretreatment protocol and post-treatment effects were not evaluated in the present study. Future studies are warranted to investigate the therapeutic (post-treatment) effects of this pharmacological agent to better reflect clinical scenarios.

Conclusions

Montelukast demonstrated significant renoprotective effects in septic mice with AKI by attenuating the release of inflammatory mediators through inhibition of NF-κB P65 expression. Additionally, it reduced oxidative stress, thereby improving renal outcomes. Furthermore, it mitigated the adverse consequences associated with apoptosis following renal injury by modulating key apoptotic factors.

Ethical approval

The experimental methodologies and protocols employed in this study were approved on August 29, 2024, under reference number (20553) from the ethics committee for the care and utilization of laboratory animals.

Data availability

Excel data Montelukast. https://doi.org/10.6084/m9.figshare.28599605.v2⁵⁹

Reporting guidelines: arrive checklist. https://doi.org/10.6084/m9.figshare.29150939⁶⁰

Data are available under the terms of the Creative Commons Zero “No rights reserved” data waiver (CC0 1.0 Public domain dedication).

References

1. Zhang X, Su C, Zhao S, et al.: Combination therapy of Ulinastatin with Thrombomodulin alleviates endotoxin (LPS)-induced liver and kidney injury via inhibiting apoptosis, oxidative stress and HMGB1/TLR4/NF-κB pathway. Bioengineered. 2022; 13: 2951–2970. PubMed Abstract | Publisher Full Text | Free Full Text
2. Cao C, Yu M, Chai Y: Pathological alteration and therapeutic implications of sepsis-induced immune cell apoptosis. Cell Death Dis. 2019; 10: 782. PubMed Abstract | Publisher Full Text | Free Full Text
3. Zhang H, Feng YW, Yao YM: Potential therapy strategy: targeting mitochondrial dysfunction in sepsis. Mil. Med. Res. 2018; 5: 41. PubMed Abstract | Publisher Full Text | Free Full Text
4. Dai W, Zheng P, Luo D, et al.: LPIN1 is a regulatory factor associated with immune response and inflammation in sepsis. Front. Immunol. 2022; 13: 820164. PubMed Abstract | Publisher Full Text | Free Full Text
5. Algahtani MM, Alshehri S, Alqarni SS, et al.: Inhibition of ITK signaling causes amelioration in sepsis-associated neuroinflammation and depression-like state in mice. Int. J. Mol. Sci. 2023; 24: 8101. PubMed Abstract | Publisher Full Text | Free Full Text
6. Heinzl MW, Resl M, Klammer C, et al.: Subclinical kidney injury is caused by a moderate single inflammatory event. Shock. 2022; 58: 14–19. PubMed Abstract | Publisher Full Text | Free Full Text
7. Wang B, Xu J, Fu P, et al.: MicroRNAs in septic acute kidney injury. Burns Trauma. 2023; 11: tkad008. PubMed Abstract | Publisher Full Text | Free Full Text
8. Zarbock A, Nadim MK, Pickkers P, et al.: Sepsis-associated acute kidney injury: consensus report of the 28th Acute Disease Quality Initiative workgroup. Nat. Rev. Nephrol. 2023; 19: 401–417. PubMed Abstract | Publisher Full Text
9. Chang YM, Chou YT, Kan WC, et al.: Sepsis and acute kidne injury: a review focusing on the bidirectional interplay. Int. J. Mol. Sci. 2022; 23: 9159. PubMed Abstract | Publisher Full Text | Free Full Text
10. Kumar V: Toll-like receptors in sepsis-associated cytokine storm and their endogenous negative regulators as future immunomodulatory targets. Int. Immunopharmacol. 2020; 89: 107087. PubMed Abstract | Publisher Full Text | Free Full Text
11. Toro J, Manrique-Caballero C, Gómez H: Metabolic reprogramming and host tolerance: a novel concept to understand sepsis-associated AKI. J. Clin. Med. 2021; 10(18):4184. Publisher Full Text
12. Deng J, Li L, Feng Y, et al.: Comprehensive management of blood pressure in patients with septic AKI. J. Clin. Med. 2023; 12(3):1018. Publisher Full Text
13. Post EH, Kellum JA, Bellomo R, et al.: Renal perfusion in sepsis: from macro- to microcirculation. Kidney Int. 2017; 91(1):45–60. Publisher Full Text
14. Wu Z, Deng J, Zhou H, et al.: Programmed cell death in sepsis associated acute kidney injury. Front. Med. (Lausanne). 2022; 9:883028.
15. Jiao H, Wachsmuth L, Kumari S, et al.: Z-nucleic-acid sensing triggers ZBP1-dependent necroptosis and inflammation. Nature. 2020; 580:391–395. Publisher Full Text
16. Jorgensen I, Rayamajhi M, Miao EA: Programmed cell death as a defence against infection. Nat. Rev. Immunol. 2017; 17(3):151–164. Publisher Full Text
17. Xiao J, Yang Q, Zhang Y, et al.: Maresin conjugates in tissue regeneration-1 suppresses ferroptosis in septic acute kidney injury. Cell Biosci. 2021; 11(1):221. Publisher Full Text
18. Nguyen JA, Yates RM: Better together: current insights into phagosome-lysosome fusion. Front. Immunol. 2021; 12:636078. Publisher Full Text
19. Vargas JNS, Hamasaki M, Kawabata T, et al.: The mechanisms and roles of selective autophagy in mammals. Nat. Rev. Mol. Cell Biol. 2023; 24:167–185. Publisher Full Text
20. Zhao S, Liao J, Shen M, et al.: Epigenetic dysregulation of autophagy in sepsis-induced acute kidney injury: the underlying mechanisms for renoprotection. Front. Immunol. 2023; 14:1180866. Publisher Full Text
21. Doran AC, Yurdagul A Jr, Tabas I: Efferocytosis in health and disease. Nat. Rev. Immunol. 2020; 20:254–267. Publisher Full Text
22. Arai Y, Yamaoka Y, Morioka S: Sweeping up dying cells during tissue injury. Nephron. 2022; 146:249–252. Publisher Full Text
23. Luo M, Yan D, Sun Q, et al.: Ginsenoside Rg1 attenuates cardiomyocyte apoptosis and inflammation via the TLR4/NF-κB/NLRP3 pathway. J. Cell Biochem. 2020; 121(4):2994–3004. Publisher Full Text
24. Kunnumakkara AB, Shabnam B, Girisa S, et al.: Inflammation, NF-κB, and chronic diseases: how are they linked? Crit. Rev. Immunol. 2020; 40(1):1–39. Publisher Full Text
25. Jiang M, Wang K, Huang Y, et al.: Quercetin alleviates lipopolysaccharide-induced cell oxidative stress and inflammatory responses via regulation of the TLR4-NF-κB signaling pathway in bovine rumen epithelial cells. Toxins (Basel). 2023; 15(8):512. Publisher Full Text
26. Brigelius-Flohé R, Flohé L: Basic principles and emerging concepts in the redox control of transcription factors. Antioxid. Redox Signal. 2011; 15(8):2335–2381. Publisher Full Text
27. Drechsler S, Osuchowski M: Cecal ligation and puncture. Sepsis: Methods and Protocols. New York, NY: Springer US; 2021; pp. 1–8. Publisher Full Text
28. Zigam QA, Al-Zubaidy AA, Abbas WJ, et al.: Cardioprotective Effects of Octreotide against Sepsis-Induced Cardiotoxicity in Mice. Arch. Razi Inst. 2023; 78: 53–61. PubMed Abstract | Publisher Full Text | Free Full Text
29. Navarro KL, Huss M, Smith JC, et al.: Mouse anesthesia: the art and science. ILAR J. 2021; 62: 238–273. PubMed Abstract | Publisher Full Text | Free Full Text
30. Şener G, Şehirli Ö, Çetinel Ş, et al.: Amelioration of sepsis-induced hepatic and ileal injury in rats by the leukotriene receptor blocker Montelukast. Prostaglandins Leukot. Essent. Fat. Acids. 2005; 73: 453–462. PubMed Abstract | Publisher Full Text
31. Parasuraman S, Raveendran R, Kesavan R: Blood sample collection in small laboratory animals. J. Pharmacol. Pharmacother. 2010; 8: 153. PubMed Abstract | Publisher Full Text | Free Full Text
32. Chen D, Ma S, Ye W, et al.: Kaempferol Reverses Acute Kidney Injury in Septic Model by Inhibiting NF-κB/AKT Signaling Pathway. J. Food Biochem. 2023; 2023: 1–11. Publisher Full Text
33. Taha IA, Al-Drobie BF, Alghanim KM: The Role Of Fixation On Antibodies Expression In Immunohistochemical Staining. Maaen J. Med. Sci. 2024; 3: 1. Publisher Full Text
34. Shi L, Zha H, Pan Z, et al.: DUSP1 protects against ischemic acute kidney injury through stabilizing mtDNA via interaction with JNK. Cell Death Dis. 2023; 14: 724. PubMed Abstract | Publisher Full Text | Free Full Text
35. Pashirzad M, Sathyapalan T, Sheikh A, et al.: Cancer stem cells: an overview of the pathophysiological and prognostic roles in colorectal cancer. Process Biochem. 2022; 115: 19–29. Publisher Full Text
36. Fiorentino M, Philippe R, Palumbo CA, et al.: Epigenetic mechanisms in sepsis-associated acute kidney injury. Semin. Respir. Crit. Care Med. 2024; 45: 491–502. Publisher Full Text
37. Nascimento DC, Viacava PR, Ferreira RG, et al.: Sepsis expands a CD39+ plasmablast population that promotes immunosuppression via adenosine-mediated inhibition of macrophage antimicrobial activity. Immunity. 2021; 54: 2024–2041.e8. PubMed Abstract | Publisher Full Text
38. Bomans K, Schenz J, Sztwiertnia I, et al.: Sepsis induces a long-lasting state of trained immunity in bone marrow monocytes. Front. Immunol. 2018; 9: 2685. Publisher Full Text
39. Newham P, Ross D, Ceuppens P, et al.: Determination of the safety and efficacy of therapeutic neutralization of tumor necrosis factor-α (TNF-α) using AZD9773, an anti-TNF-α immune Fab, in murine CLP sepsis. Inflamm. Res. 2014; 63: 149–160. PubMed Abstract | Publisher Full Text
40. Alkhafaji GA, Janabi AM: GIP/GLP-1 dual agonist tirzepatide ameliorates renal ischemia/reperfusion damage in rats. Int. J. Appl. Pharm. 2025; 165–173. Publisher Full Text
41. Khodir AE, Ghoneim HA, Rahim MA, et al.: Montelukast attenuates lipopolysaccharide-induced cardiac injury in rats. Hum. Exp. Toxicol. 2016; 35: 388–397. PubMed Abstract | Publisher Full Text
42. Hagar HH, Alhazmi SM, Arafah M, et al.: Inhibition of sepsis-induced pancreatic injury by leukotriene receptor antagonism via modulation of oxidative injury, and downregulation of inflammatory markers in experimental rats. Naunyn Schmiedeberg’s Arch. Pharmacol. 2024; 397: 3425–3435. PubMed Abstract | Publisher Full Text
43. Ibadi MH, Majeed S, Ghafil FA, et al.: Effects of CDDO-EA in sepsis-induced acute lung injury: mouse model of endotoxemia. Wiad Lek. 2024; 77: 497–505. PubMed Abstract | Publisher Full Text
44. Alaasam ER, Janabi AM, Al-Buthabhak KM, et al.: Nephroprotective role of resveratrol in renal ischemia-reperfusion injury: a preclinical study in Sprague-Dawley rats. BMC Pharmacol. Toxicol. 2024; 25: 82. PubMed Abstract | Publisher Full Text | Free Full Text
45. Miliaraki M, Briassoulis P, Ilia S, et al.: Survivin and caspases serum protein levels and survivin variants mRNA expression in sepsis. Sci. Rep. 2021; 11: 1049. PubMed Abstract | Publisher Full Text | Free Full Text
46. Jallawee HQ, Janabi AM: Potential nephroprotective effect of dapagliflozin against renal ischemia reperfusion injury in rats via activation of autophagy pathway and inhibition of inflammation, oxidative stress and apoptosis. SEEJPH. 2024; 488–500. Publisher Full Text
47. Jallawee HQ, Janabi AM: Trandolapril improves renal ischemia-reperfusion injury in adult male rats via activation of the autophagy pathway and inhibition of inflammation, oxidative stress, and apoptosis. J. Biosci. Appl. Res. 2024; 10: 114–127. Publisher Full Text
48. Gad AM, Abd El-Raouf OM, El-Sayeh BM, et al.: Renoprotective effects of montelukast in an experimental model of cisplatin nephrotoxicity in rats. J. Biochem. Mol. Toxicol. 2017; 31: e21979. Publisher Full Text
49. Ghafil FA, Hassan ES, Aziz ND, et al.: Cardioprotective Potential of Celastrol in Sepsis-Induced Cardiotoxicity; Mouse Model of Endotoxemia. Iran. J. War Public Health. 2023; 15: 361–367.
50. Alnfakh ZA, Al-Mudhafar DH, Al-Nafakh RT, et al.: The anti-inflammatory and antioxidant effects of Montelukast on lung sepsis in adult mice. J. Med. Life. 2022; 15: 819–827. PubMed Abstract | Publisher Full Text | Free Full Text
51. Awad AM, Elshaer SL, Gangaraju R, et al.: Ameliorative effect of montelukast against STZ-induced diabetic nephropathy: targeting HMGB1, TLR4, NF-κB, NLRP3 inflammasome, and autophagy pathways. Inflammopharmacology. 2023; 32(1): 495–508. PubMed Abstract | Publisher Full Text | Free Full Text
52. Li N, Lin G, Zhang H, et al.: Lyn attenuates sepsis-associated acute kidney injury by inhibition of phospho-STAT3 and apoptosis. Biochem. Pharmacol. 2023; 211: 115523. PubMed Abstract | Publisher Full Text
53. Kang JH, Lim H, Lee DS, et al.: Montelukast inhibits RANKL-induced osteoclast formation and bone loss via CysLTR1 and P2Y12. Mol. Med. Rep. 2018; 18: 2387–2398. PubMed Abstract | Publisher Full Text
54. Collier JB, Schnellmann RG: Extracellular signal–regulated kinase 1/2 regulates mouse kidney injury molecule-1 expression physiologically and following ischemic and septic renal injury. J. Pharmacol. Exp. Ther. 2017; 363: 419–427. PubMed Abstract | Publisher Full Text | Free Full Text
55. Sun S, Wang J, Wang J, et al.: Maresin 1 Mitigates Sepsis-Associated Acute Kidney Injury in Mice via Inhibition of the NF-κB/STAT3/MAPK Pathways. Front. Pharmacol. 2019; 10: 1323. PubMed Abstract | Publisher Full Text | Free Full Text
56. Dong H, Liu F, Ma F, et al.: Montelukast inhibits inflammatory response in rheumatoid arthritis fibroblast-like synoviocytes. Int. Immunopharmacol. 2018; 61: 215–221. PubMed Abstract | Publisher Full Text
57. Arifin A, Purwanto B, Indarto D, et al.: Improvement of renal functions in mice with septic acute kidney injury using secretome of mesenchymal stem cells. Saudi J. Biol. Sci. 2024; 31: 103931. PubMed Abstract | Publisher Full Text | Free Full Text
58. Khodir AE, Ghoneim HA, Rahim MA, et al.: Montelukast reduces sepsis-induced lung and renal injury in rats. Can. J. Physiol. Pharmacol. 2014; 92: 839–847. PubMed Abstract | Publisher Full Text
59. Abdulredha AJ: Excel data Montelukast.2025. Publisher Full Text Reference Source
60. Abdulredha AJ: montelukast arrive checklist.docx. figshare. 2025. Reference Source

Comments on this article Comments (0)

Version 2

VERSION 2 PUBLISHED 07 Jul 2025

Author details Author details

¹ Department of Pharmacology, University of Kufa, Kufa, Najaf Governorate, Iraq
² Department of Pharmacology and Therapeutics, University of Kufa, Kufa, Najaf Governorate, Iraq

Abeer J. Abdulredha
Roles: Conceptualization, Data Curation, Formal Analysis, Investigation, Methodology, Validation, Writing – Original Draft Preparation

Murooj L. Majeed
Roles: Visualization, Writing – Original Draft Preparation, Writing – Review & Editing

Competing interests

No competing interests were disclosed.

Grant information

The author(s) declared that no grants were involved in supporting this work.

Article Versions (2)

version 2

Revised

Published: 17 Apr 2026, 14:660

https://doi.org/10.12688/f1000research.163164.2

version 1

Published: 07 Jul 2025, 14:660

https://doi.org/10.12688/f1000research.163164.1

Copyright

© 2026 Abdulredha AJ and Majeed ML. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Download

Export To

metrics

	Views	Downloads
F1000Research	-	-
PubMed Central Data from PMC are received and updated monthly.	-	-

Citations

0

SEE MORE DETAILS

CITE

how to cite this article

Abdulredha AJ and Majeed ML. Renoprotective Effects of Montelukast in Sepsis-Induced AKI: Targeting the NF-κB Pathway [version 2; peer review: 1 approved, 1 approved with reservations]. F1000Research 2026, 14:660 (https://doi.org/10.12688/f1000research.163164.2)

NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.

track

receive updates on this article

Track an article to receive email alerts on any updates to this article.

Open Peer Review

Version 2

VERSION 2

PUBLISHED 17 Apr 2026

Revised

Views

10

Reviewer Report 13 May 2026

Tony Whitehouse, Queen Elizabeth Hospital Birmingham, University Hospitals Birmingham NHS Foundation Trust, Birmingham, UK

Approved with Reservations

https://doi.org/10.5256/f1000research.198469.r477189

Thank you for asking me to review this revised manuscript which has benefitted from an update. I do feel however that there is more to do.

The abstract needs expanding. SA-AKI is not ubiquitous but is very ... Continue reading

Thank you for asking me to review this revised manuscript which has benefitted from an update. I do feel however that there is more to do.

The abstract needs expanding. SA-AKI is not ubiquitous but is very common and is ASSOCIATED with increased mortality and not yet conclusively shown to contribute. It is unclear in the abstract, how the montelukast was adminsitered.

The introduction needs shortening and becoming more directed. The point of this paper is about the use of a leukotriene1 receptor anatgonist and the NFkappaB pathway. Such a broad introduction, which touches on Toll-like receptors, necroptosis and autophagy-related genesis, is a little too much. It is unclear to me why monteleukast was chosen as the intervention and what its place might be in the treatment or avoidance of AKI.

There is no need to replicate the phrase "40 albino Swiss mice...etc". Similarly the anaesthetic technique only needs to appear once.

Although SEMs look better, SDs make statistical analysis easier to visualise for the reader. usually, the distribution of cytokines is skewed and not normally distributed and log transformation is often needed. There should be some reporting of nmbers in the results section rather than only graphs especially as the graphs all look very similar. Understanding the degree of difference numberically is important.

Like the Intro, the discussion should be shortened and directed to the mechanisms elucidated and how they compare with the existing literature.

Is the work clearly and accurately presented and does it cite the current literature?

Partly
Is the study design appropriate and is the work technically sound?

Partly
Are sufficient details of methods and analysis provided to allow replication by others?

Partly
If applicable, is the statistical analysis and its interpretation appropriate?

Partly
Are all the source data underlying the results available to ensure full reproducibility?

No
Are the conclusions drawn adequately supported by the results?

No

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: Sepsis

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

CITE

Report a concern

Respond or Comment

Views

5

Reviewer Report 05 May 2026

Salim Fayez Kadhim, College of Pharmacy, University of AlKafeel, Kufa, Najaf Governorate, Iraq

Approved

https://doi.org/10.5256/f1000research.198469.r475959

Thank you for the opportunity to review the revised article and the authors' responses. I have carefully considered the changes made and the clarifications provided. I am satisfied that the authors have adequately addressed all previous concerns and suggestions. ... Continue reading

CITE

Report a concern

Respond or Comment

Version 1

VERSION 1

PUBLISHED 07 Jul 2025

Views

24

Reviewer Report 30 Jan 2026

Salim Fayez Kadhim, College of Pharmacy, University of AlKafeel, Kufa, Najaf Governorate, Iraq

Approved with Reservations

https://doi.org/10.5256/f1000research.179468.r450096

Reviewer Report
This manuscript investigates the renoprotective effects of montelukast in a murine model of sepsis-associated acute kidney injury (SA-AKI), with a particular focus on modulation of the NF-κB signaling pathway. The topic is clinically relevant, as SA-AKI remains ... Continue reading

Reviewer Report
This manuscript investigates the renoprotective effects of montelukast in a murine model of sepsis-associated acute kidney injury (SA-AKI), with a particular focus on modulation of the NF-κB signaling pathway. The topic is clinically relevant, as SA-AKI remains a major contributor to morbidity and mortality in septic patients, and effective pharmacological interventions are still limited. The study is generally well organized, methodologically sound, and supported by multiple complementary experimental approaches
Strengths

Clear scientific rationale as the manuscript clearly justifies the investigation of montelukast based on its known anti-inflammatory and antioxidant properties and links these mechanisms logically to SA-AKI pathophysiology.
Appropriate experimental model where the use of the cecal ligation and puncture (CLP) model is appropriate and well-recognized as a clinically relevant model of polymicrobial sepsis.
Comprehensive outcome assessment in which renal injury was evaluated using functional markers (BUN, creatinine, KIM-1), inflammatory mediators (TNF-α, IL-1β), oxidative stress (F2-isoprostane), apoptosis (caspase-3), and histopathological analysis, strengthening the reliability of the conclusions.
Mechanistic insight which included the assessment of NF-κB p65 expression at both mRNA and protein levels (qRT-PCR and IHC) adds mechanistic depth and supports the proposed mode of action of montelukast.
Ethical compliance and transparency represented by the ethical approval, animal welfare considerations, and data availability are clearly stated and adhere to accepted standards.

Major Concerns and Suggestions

Limited translational relevance

While the findings are promising, the study relies on a single dose and pretreatment protocol. Since clinical sepsis treatment is typically initiated after disease onset, post-treatment studies would strengthen translational relevance. If data unavailable, I would recommend adding this to the recommendations and future studies.

Vehicle control clarification:

The vehicle (DMSO) group shows effects similar to the CLP group. A brief discussion on the potential influence of DMSO would be helpful.
Minor Comments

Please expand the introduction (quite short).
Some sections of the Introduction and Discussion contain repetitive statements regarding sepsis-induced inflammation and cytokine release; minor editing could improve conciseness.
Figures are generally clear; however, higher-resolution histological images and inclusion of scale bars would enhance interpretability. Also some annotations seem to be hand-made, please replace with arrows.

Conclusion
Overall, this manuscript presents novel and well-supported evidence that montelukast exerts protective effects against sepsis-induced AKI via suppression of inflammatory, oxidative, and apoptotic pathways, particularly through NF-κB inhibition. Despite some limitations related to translational scope, the study adds valuable preclinical data and merits publication after minor to moderate revisions addressing the points raised above.

Is the work clearly and accurately presented and does it cite the current literature?

Partly
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Partly
If applicable, is the statistical analysis and its interpretation appropriate?

Yes
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Yes

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: Pharmacology, clinical pharmacy, neuroscience

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

CITE

Report a concern

Respond or Comment

Comments on this article Comments (0)

Version 2

VERSION 2 PUBLISHED 07 Jul 2025

Open Peer Review

Reviewer Status

Reviewer Reports

	Invited Reviewers
	1	2
Version 2 (revision) 17 Apr 26	read	read
Version 1 07 Jul 25	read

Salim Fayez Kadhim, University of AlKafeel, Kufa, Iraq
Tony Whitehouse, Queen Elizabeth Hospital Birmingham, University Hospitals Birmingham NHS Foundation Trust, Birmingham, UK

Comments on this article

All Comments(0)

Add a comment

Sign up for content alerts

Browse by related subjects

Back to all reports

Reviewer Report

10 Views

13 May 2026 | for Version 2

Tony Whitehouse, Queen Elizabeth Hospital Birmingham, University Hospitals Birmingham NHS Foundation Trust, Birmingham, UK

10 Views Cite this report Responses(0)

Approved With Reservations

Thank you for asking me to review this revised manuscript which has benefitted from an update. I do feel however that there is more to do.

The abstract needs expanding. SA-AKI is not ubiquitous but is very common and is ASSOCIATED with increased mortality and not yet conclusively shown to contribute. It is unclear in the abstract, how the montelukast was adminsitered.

The introduction needs shortening and becoming more directed. The point of this paper is about the use of a leukotriene1 receptor anatgonist and the NFkappaB pathway. Such a broad introduction, which touches on Toll-like receptors, necroptosis and autophagy-related genesis, is a little too much. It is unclear to me why monteleukast was chosen as the intervention and what its place might be in the treatment or avoidance of AKI.

There is no need to replicate the phrase "40 albino Swiss mice...etc". Similarly the anaesthetic technique only needs to appear once.

Although SEMs look better, SDs make statistical analysis easier to visualise for the reader. usually, the distribution of cytokines is skewed and not normally distributed and log transformation is often needed. There should be some reporting of nmbers in the results section rather than only graphs especially as the graphs all look very similar. Understanding the degree of difference numberically is important.

Like the Intro, the discussion should be shortened and directed to the mechanisms elucidated and how they compare with the existing literature.

Is the work clearly and accurately presented and does it cite the current literature?

Partly
Is the study design appropriate and is the work technically sound?

Partly
Are sufficient details of methods and analysis provided to allow replication by others?

Partly
If applicable, is the statistical analysis and its interpretation appropriate?

Partly
Are all the source data underlying the results available to ensure full reproducibility?

No
Are the conclusions drawn adequately supported by the results?

No

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Sepsis

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

5 Views

05 May 2026 | for Version 2

Salim Fayez Kadhim, College of Pharmacy, University of AlKafeel, Kufa, Najaf Governorate, Iraq

5 Views Cite this report Responses(0)

Approved

Thank you for the opportunity to review the revised article and the authors' responses. I have carefully considered the changes made and the clarifications provided. I am satisfied that the authors have adequately addressed all previous concerns and suggestions. I have no further comments to add at this stage.
Salim Kadhim

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Pharmacology, clinical pharmacy, neuroscience

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

24 Views

30 Jan 2026 | for Version 1

Salim Fayez Kadhim, College of Pharmacy, University of AlKafeel, Kufa, Najaf Governorate, Iraq

24 Views Cite this report Responses(0)

Approved With Reservations

Reviewer Report
This manuscript investigates the renoprotective effects of montelukast in a murine model of sepsis-associated acute kidney injury (SA-AKI), with a particular focus on modulation of the NF-κB signaling pathway. The topic is clinically relevant, as SA-AKI remains a major contributor to morbidity and mortality in septic patients, and effective pharmacological interventions are still limited. The study is generally well organized, methodologically sound, and supported by multiple complementary experimental approaches
Strengths

Clear scientific rationale as the manuscript clearly justifies the investigation of montelukast based on its known anti-inflammatory and antioxidant properties and links these mechanisms logically to SA-AKI pathophysiology.
Appropriate experimental model where the use of the cecal ligation and puncture (CLP) model is appropriate and well-recognized as a clinically relevant model of polymicrobial sepsis.
Comprehensive outcome assessment in which renal injury was evaluated using functional markers (BUN, creatinine, KIM-1), inflammatory mediators (TNF-α, IL-1β), oxidative stress (F2-isoprostane), apoptosis (caspase-3), and histopathological analysis, strengthening the reliability of the conclusions.
Mechanistic insight which included the assessment of NF-κB p65 expression at both mRNA and protein levels (qRT-PCR and IHC) adds mechanistic depth and supports the proposed mode of action of montelukast.
Ethical compliance and transparency represented by the ethical approval, animal welfare considerations, and data availability are clearly stated and adhere to accepted standards.

Major Concerns and Suggestions

Limited translational relevance

While the findings are promising, the study relies on a single dose and pretreatment protocol. Since clinical sepsis treatment is typically initiated after disease onset, post-treatment studies would strengthen translational relevance. If data unavailable, I would recommend adding this to the recommendations and future studies.

Vehicle control clarification:

The vehicle (DMSO) group shows effects similar to the CLP group. A brief discussion on the potential influence of DMSO would be helpful.
Minor Comments

Please expand the introduction (quite short).
Some sections of the Introduction and Discussion contain repetitive statements regarding sepsis-induced inflammation and cytokine release; minor editing could improve conciseness.
Figures are generally clear; however, higher-resolution histological images and inclusion of scale bars would enhance interpretability. Also some annotations seem to be hand-made, please replace with arrows.

Conclusion
Overall, this manuscript presents novel and well-supported evidence that montelukast exerts protective effects against sepsis-induced AKI via suppression of inflammatory, oxidative, and apoptotic pathways, particularly through NF-κB inhibition. Despite some limitations related to translational scope, the study adds valuable preclinical data and merits publication after minor to moderate revisions addressing the points raised above.

Is the work clearly and accurately presented and does it cite the current literature?

Partly
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Partly
If applicable, is the statistical analysis and its interpretation appropriate?

Yes
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Yes

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Pharmacology, clinical pharmacy, neuroscience

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

Respond to this report

Responses (0)

[1] 1. Zhang X, Su C, Zhao S, et al.: Combination therapy of Ulinastatin with Thrombomodulin alleviates endotoxin (LPS)-induced liver and kidney injury via inhibiting apoptosis, oxidative stress and HMGB1/TLR4/NF-κB pathway. Bioengineered. 2022; 13: 2951–2970. PubMed Abstract | Publisher Full Text | Free Full Text

[2] 2. Cao C, Yu M, Chai Y: Pathological alteration and therapeutic implications of sepsis-induced immune cell apoptosis. Cell Death Dis. 2019; 10: 782. PubMed Abstract | Publisher Full Text | Free Full Text

[3] 3. Zhang H, Feng YW, Yao YM: Potential therapy strategy: targeting mitochondrial dysfunction in sepsis. Mil. Med. Res. 2018; 5: 41. PubMed Abstract | Publisher Full Text | Free Full Text

[4] 4. Dai W, Zheng P, Luo D, et al.: LPIN1 is a regulatory factor associated with immune response and inflammation in sepsis. Front. Immunol. 2022; 13: 820164. PubMed Abstract | Publisher Full Text | Free Full Text

[5] 5. Algahtani MM, Alshehri S, Alqarni SS, et al.: Inhibition of ITK signaling causes amelioration in sepsis-associated neuroinflammation and depression-like state in mice. Int. J. Mol. Sci. 2023; 24: 8101. PubMed Abstract | Publisher Full Text | Free Full Text

[6] 6. Heinzl MW, Resl M, Klammer C, et al.: Subclinical kidney injury is caused by a moderate single inflammatory event. Shock. 2022; 58: 14–19. PubMed Abstract | Publisher Full Text | Free Full Text

[7] 7. Wang B, Xu J, Fu P, et al.: MicroRNAs in septic acute kidney injury. Burns Trauma. 2023; 11: tkad008. PubMed Abstract | Publisher Full Text | Free Full Text

[8] 8. Zarbock A, Nadim MK, Pickkers P, et al.: Sepsis-associated acute kidney injury: consensus report of the 28th Acute Disease Quality Initiative workgroup. Nat. Rev. Nephrol. 2023; 19: 401–417. PubMed Abstract | Publisher Full Text

[9] 9. Chang YM, Chou YT, Kan WC, et al.: Sepsis and acute kidne injury: a review focusing on the bidirectional interplay. Int. J. Mol. Sci. 2022; 23: 9159. PubMed Abstract | Publisher Full Text | Free Full Text

[10] 10. Kumar V: Toll-like receptors in sepsis-associated cytokine storm and their endogenous negative regulators as future immunomodulatory targets. Int. Immunopharmacol. 2020; 89: 107087. PubMed Abstract | Publisher Full Text | Free Full Text

[11] 11. Toro J, Manrique-Caballero C, Gómez H: Metabolic reprogramming and host tolerance: a novel concept to understand sepsis-associated AKI. J. Clin. Med. 2021; 10(18):4184. Publisher Full Text

[12] 12. Deng J, Li L, Feng Y, et al.: Comprehensive management of blood pressure in patients with septic AKI. J. Clin. Med. 2023; 12(3):1018. Publisher Full Text

[13] 13. Post EH, Kellum JA, Bellomo R, et al.: Renal perfusion in sepsis: from macro- to microcirculation. Kidney Int. 2017; 91(1):45–60. Publisher Full Text

[14] 14. Wu Z, Deng J, Zhou H, et al.: Programmed cell death in sepsis associated acute kidney injury. Front. Med. (Lausanne). 2022; 9:883028.

[15] 15. Jiao H, Wachsmuth L, Kumari S, et al.: Z-nucleic-acid sensing triggers ZBP1-dependent necroptosis and inflammation. Nature. 2020; 580:391–395. Publisher Full Text

[16] 16. Jorgensen I, Rayamajhi M, Miao EA: Programmed cell death as a defence against infection. Nat. Rev. Immunol. 2017; 17(3):151–164. Publisher Full Text

[17] 17. Xiao J, Yang Q, Zhang Y, et al.: Maresin conjugates in tissue regeneration-1 suppresses ferroptosis in septic acute kidney injury. Cell Biosci. 2021; 11(1):221. Publisher Full Text

[18] 18. Nguyen JA, Yates RM: Better together: current insights into phagosome-lysosome fusion. Front. Immunol. 2021; 12:636078. Publisher Full Text

[19] 19. Vargas JNS, Hamasaki M, Kawabata T, et al.: The mechanisms and roles of selective autophagy in mammals. Nat. Rev. Mol. Cell Biol. 2023; 24:167–185. Publisher Full Text

[20] 20. Zhao S, Liao J, Shen M, et al.: Epigenetic dysregulation of autophagy in sepsis-induced acute kidney injury: the underlying mechanisms for renoprotection. Front. Immunol. 2023; 14:1180866. Publisher Full Text

[21] 21. Doran AC, Yurdagul A Jr, Tabas I: Efferocytosis in health and disease. Nat. Rev. Immunol. 2020; 20:254–267. Publisher Full Text

[22] 22. Arai Y, Yamaoka Y, Morioka S: Sweeping up dying cells during tissue injury. Nephron. 2022; 146:249–252. Publisher Full Text

[23] 23. Luo M, Yan D, Sun Q, et al.: Ginsenoside Rg1 attenuates cardiomyocyte apoptosis and inflammation via the TLR4/NF-κB/NLRP3 pathway. J. Cell Biochem. 2020; 121(4):2994–3004. Publisher Full Text

[24] 24. Kunnumakkara AB, Shabnam B, Girisa S, et al.: Inflammation, NF-κB, and chronic diseases: how are they linked? Crit. Rev. Immunol. 2020; 40(1):1–39. Publisher Full Text

[25] 25. Jiang M, Wang K, Huang Y, et al.: Quercetin alleviates lipopolysaccharide-induced cell oxidative stress and inflammatory responses via regulation of the TLR4-NF-κB signaling pathway in bovine rumen epithelial cells. Toxins (Basel). 2023; 15(8):512. Publisher Full Text

[26] 26. Brigelius-Flohé R, Flohé L: Basic principles and emerging concepts in the redox control of transcription factors. Antioxid. Redox Signal. 2011; 15(8):2335–2381. Publisher Full Text

[27] 27. Drechsler S, Osuchowski M: Cecal ligation and puncture. Sepsis: Methods and Protocols. New York, NY: Springer US; 2021; pp. 1–8. Publisher Full Text

[28] 28. Zigam QA, Al-Zubaidy AA, Abbas WJ, et al.: Cardioprotective Effects of Octreotide against Sepsis-Induced Cardiotoxicity in Mice. Arch. Razi Inst. 2023; 78: 53–61. PubMed Abstract | Publisher Full Text | Free Full Text

[29] 29. Navarro KL, Huss M, Smith JC, et al.: Mouse anesthesia: the art and science. ILAR J. 2021; 62: 238–273. PubMed Abstract | Publisher Full Text | Free Full Text

[30] 30. Şener G, Şehirli Ö, Çetinel Ş, et al.: Amelioration of sepsis-induced hepatic and ileal injury in rats by the leukotriene receptor blocker Montelukast. Prostaglandins Leukot. Essent. Fat. Acids. 2005; 73: 453–462. PubMed Abstract | Publisher Full Text

[31] 31. Parasuraman S, Raveendran R, Kesavan R: Blood sample collection in small laboratory animals. J. Pharmacol. Pharmacother. 2010; 8: 153. PubMed Abstract | Publisher Full Text | Free Full Text

[32] 32. Chen D, Ma S, Ye W, et al.: Kaempferol Reverses Acute Kidney Injury in Septic Model by Inhibiting NF-κB/AKT Signaling Pathway. J. Food Biochem. 2023; 2023: 1–11. Publisher Full Text

[33] 33. Taha IA, Al-Drobie BF, Alghanim KM: The Role Of Fixation On Antibodies Expression In Immunohistochemical Staining. Maaen J. Med. Sci. 2024; 3: 1. Publisher Full Text

[34] 34. Shi L, Zha H, Pan Z, et al.: DUSP1 protects against ischemic acute kidney injury through stabilizing mtDNA via interaction with JNK. Cell Death Dis. 2023; 14: 724. PubMed Abstract | Publisher Full Text | Free Full Text

[35] 35. Pashirzad M, Sathyapalan T, Sheikh A, et al.: Cancer stem cells: an overview of the pathophysiological and prognostic roles in colorectal cancer. Process Biochem. 2022; 115: 19–29. Publisher Full Text

[36] 36. Fiorentino M, Philippe R, Palumbo CA, et al.: Epigenetic mechanisms in sepsis-associated acute kidney injury. Semin. Respir. Crit. Care Med. 2024; 45: 491–502. Publisher Full Text

[37] 37. Nascimento DC, Viacava PR, Ferreira RG, et al.: Sepsis expands a CD39+ plasmablast population that promotes immunosuppression via adenosine-mediated inhibition of macrophage antimicrobial activity. Immunity. 2021; 54: 2024–2041.e8. PubMed Abstract | Publisher Full Text

[38] 38. Bomans K, Schenz J, Sztwiertnia I, et al.: Sepsis induces a long-lasting state of trained immunity in bone marrow monocytes. Front. Immunol. 2018; 9: 2685. Publisher Full Text

[39] 39. Newham P, Ross D, Ceuppens P, et al.: Determination of the safety and efficacy of therapeutic neutralization of tumor necrosis factor-α (TNF-α) using AZD9773, an anti-TNF-α immune Fab, in murine CLP sepsis. Inflamm. Res. 2014; 63: 149–160. PubMed Abstract | Publisher Full Text

[40] 40. Alkhafaji GA, Janabi AM: GIP/GLP-1 dual agonist tirzepatide ameliorates renal ischemia/reperfusion damage in rats. Int. J. Appl. Pharm. 2025; 165–173. Publisher Full Text

[41] 41. Khodir AE, Ghoneim HA, Rahim MA, et al.: Montelukast attenuates lipopolysaccharide-induced cardiac injury in rats. Hum. Exp. Toxicol. 2016; 35: 388–397. PubMed Abstract | Publisher Full Text

[42] 42. Hagar HH, Alhazmi SM, Arafah M, et al.: Inhibition of sepsis-induced pancreatic injury by leukotriene receptor antagonism via modulation of oxidative injury, and downregulation of inflammatory markers in experimental rats. Naunyn Schmiedeberg’s Arch. Pharmacol. 2024; 397: 3425–3435. PubMed Abstract | Publisher Full Text

[43] 43. Ibadi MH, Majeed S, Ghafil FA, et al.: Effects of CDDO-EA in sepsis-induced acute lung injury: mouse model of endotoxemia. Wiad Lek. 2024; 77: 497–505. PubMed Abstract | Publisher Full Text

[44] 44. Alaasam ER, Janabi AM, Al-Buthabhak KM, et al.: Nephroprotective role of resveratrol in renal ischemia-reperfusion injury: a preclinical study in Sprague-Dawley rats. BMC Pharmacol. Toxicol. 2024; 25: 82. PubMed Abstract | Publisher Full Text | Free Full Text

[45] 45. Miliaraki M, Briassoulis P, Ilia S, et al.: Survivin and caspases serum protein levels and survivin variants mRNA expression in sepsis. Sci. Rep. 2021; 11: 1049. PubMed Abstract | Publisher Full Text | Free Full Text

[46] 46. Jallawee HQ, Janabi AM: Potential nephroprotective effect of dapagliflozin against renal ischemia reperfusion injury in rats via activation of autophagy pathway and inhibition of inflammation, oxidative stress and apoptosis. SEEJPH. 2024; 488–500. Publisher Full Text

[47] 47. Jallawee HQ, Janabi AM: Trandolapril improves renal ischemia-reperfusion injury in adult male rats via activation of the autophagy pathway and inhibition of inflammation, oxidative stress, and apoptosis. J. Biosci. Appl. Res. 2024; 10: 114–127. Publisher Full Text

[48] 48. Gad AM, Abd El-Raouf OM, El-Sayeh BM, et al.: Renoprotective effects of montelukast in an experimental model of cisplatin nephrotoxicity in rats. J. Biochem. Mol. Toxicol. 2017; 31: e21979. Publisher Full Text

[49] 49. Ghafil FA, Hassan ES, Aziz ND, et al.: Cardioprotective Potential of Celastrol in Sepsis-Induced Cardiotoxicity; Mouse Model of Endotoxemia. Iran. J. War Public Health. 2023; 15: 361–367.

[50] 50. Alnfakh ZA, Al-Mudhafar DH, Al-Nafakh RT, et al.: The anti-inflammatory and antioxidant effects of Montelukast on lung sepsis in adult mice. J. Med. Life. 2022; 15: 819–827. PubMed Abstract | Publisher Full Text | Free Full Text

[51] 51. Awad AM, Elshaer SL, Gangaraju R, et al.: Ameliorative effect of montelukast against STZ-induced diabetic nephropathy: targeting HMGB1, TLR4, NF-κB, NLRP3 inflammasome, and autophagy pathways. Inflammopharmacology. 2023; 32(1): 495–508. PubMed Abstract | Publisher Full Text | Free Full Text

[52] 52. Li N, Lin G, Zhang H, et al.: Lyn attenuates sepsis-associated acute kidney injury by inhibition of phospho-STAT3 and apoptosis. Biochem. Pharmacol. 2023; 211: 115523. PubMed Abstract | Publisher Full Text

[53] 53. Kang JH, Lim H, Lee DS, et al.: Montelukast inhibits RANKL-induced osteoclast formation and bone loss via CysLTR1 and P2Y12. Mol. Med. Rep. 2018; 18: 2387–2398. PubMed Abstract | Publisher Full Text

[54] 54. Collier JB, Schnellmann RG: Extracellular signal–regulated kinase 1/2 regulates mouse kidney injury molecule-1 expression physiologically and following ischemic and septic renal injury. J. Pharmacol. Exp. Ther. 2017; 363: 419–427. PubMed Abstract | Publisher Full Text | Free Full Text

[55] 55. Sun S, Wang J, Wang J, et al.: Maresin 1 Mitigates Sepsis-Associated Acute Kidney Injury in Mice via Inhibition of the NF-κB/STAT3/MAPK Pathways. Front. Pharmacol. 2019; 10: 1323. PubMed Abstract | Publisher Full Text | Free Full Text

[56] 56. Dong H, Liu F, Ma F, et al.: Montelukast inhibits inflammatory response in rheumatoid arthritis fibroblast-like synoviocytes. Int. Immunopharmacol. 2018; 61: 215–221. PubMed Abstract | Publisher Full Text

[57] 57. Arifin A, Purwanto B, Indarto D, et al.: Improvement of renal functions in mice with septic acute kidney injury using secretome of mesenchymal stem cells. Saudi J. Biol. Sci. 2024; 31: 103931. PubMed Abstract | Publisher Full Text | Free Full Text

[58] 58. Khodir AE, Ghoneim HA, Rahim MA, et al.: Montelukast reduces sepsis-induced lung and renal injury in rats. Can. J. Physiol. Pharmacol. 2014; 92: 839–847. PubMed Abstract | Publisher Full Text

[59] 59. Abdulredha AJ: Excel data Montelukast.2025. Publisher Full Text Reference Source

[60] 60. Abdulredha AJ: montelukast arrive checklist.docx. figshare. 2025. Reference Source

Renoprotective Effects of Montelukast in Sepsis-Induced AKI: Targeting the NF-κB Pathway

Abstract

Background

Aims

Methods

Results

Conclusion

Keywords

Revised Amendments from Version 1

Introduction

Methods

Animals

Animal Welfare and Ethical Statement

Cecal ligation and puncture

Experimental groups

Sample preparation and tissue isolation

Evaluation of renal histology

Evaluation of renal function

Assay of Enzyme-Linked Immunosorbent

Immunohistochemistry assay

Quantitative Reverse Transcription Polymerase Chain Reaction assay

Table 1. Sequences of primers and housekeeping gene.

Statistical analysis

Results

Renal function

Inflammatory cytokines

Apoptotic factor (caspase-3)

Figure 3. Mean (± SEM) caspase-3 (ng/ml) levels of the experimental groups; *p<0.001, vs. Sham group; #p<0.001, vs. CLP or vehicle group, CLP: Cecal ligation & puncture.

Oxidative stress (F2-isoprostane)

Figure 4. Mean (±SEM) concentrations of F2-isoprostane (ng/L) in the various experimental cohorts; *p<0.001, vs. Sham group; #p<0.001, vs. CLP or vehicle group, CLP: Cecal ligation & puncture.

Serum KIM-1

Figure 5. Mean (±SEM) concentrations of serum KIM-1 in the different experimental cohorts; *p<0.001, vs. Sham group; #p<0.001, vs. CLP or vehicle group, CLP: Cecal ligation & puncture.

Renal histopathological damage

mRNA expression of NF-κB p 65 gene

Figure 7. Mean (±SEM) levels of NF-κB p65 mRNA expression in the experimental groups.

Expression of NF-κB p 65 via IHC

Discussion

Limitations

Conclusions

Ethical approval

Data availability

References

Comments on this article Comments (0)

Open Peer Review

Comments on this article Comments (0)

Open Peer Review

Reviewer Status

Reviewer Reports

Comments on this article

Browse by related subjects

Competing Interests Policy

Stay Updated