ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Article
Updated

A mutation in negative regulator of basal resistance WRKY17 of Arabidopsis increases susceptibility to Agrobacterium-mediated transient genetic transformation

[version 2; peer review: 2 approved]
PUBLISHED 15 Feb 2013
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

Abstract

Agrobacterium is a phytopathogenic bacterium that induces crown gall disease in many plant species by transferring and integrating a segment of its own DNA (T-DNA) into its host genome. Whereas Agrobacterium usually does not trigger an extensive defense response in its host plants, it induces the expression of several defense-related genes and activates plant stress reactions. In the complex interplay between Agrobacterium and its host plant, Agrobacterium has evolved to take advantage of these plant defense pathways for its own purpose of advancement of the infection process. For example, Agrobacterium utilizes the host stress response transcriptional regulator VIP1 to facilitate nuclear import and proteasomal uncoating of its T-DNA during genetic transformation of the host cell. In Arabidopsis, the VIP1 gene expression is repressed by WRKY17, a negative regulator of basal resistance to Pseudomonas. Thus, we examined whether WRKY17 is also involved in plant susceptibility to genetic transformation by Agrobacterium. Using reverse genetics, we showed that a wrky17 mutant displays higher expression of the VIP1 gene in roots, but not in shoots. In a root infection assay, the wrky17 mutant plants were hyper-susceptible to Agrobacterium compared to wild type plants. WRKY17, therefore, may act as a positive regulator of Arabidopsis resistance to Agrobacterium. This notion is important for understanding the complex regulation of Agrobacterium-mediated transient genetic transformation; thus, although this paper reports a relatively small set of data that we do not plan to pursue further in our lab, we believe it might be useful for the broad community of plant pathologists and plant biotechnologists.

Keywords

WRKY17, Arabidopsis, Agrobacterium

Updated Changes from Version 1

We have edited our article in response to referee comments. We changed the paper title and the relevant sentence in the Abstract to indicate transient transformation rather than just genetic transformation. We edited the paper to capitalize all wild-type gene names, mutant names in small letters. We removed the word “substantially” as suggested. We corrected the name of the antibiotic “timentin".

To read any peer review reports and author responses for this article, follow the "read" links in the Open Peer Review table.

Introduction

WRKY protein family is composed of at least 74 members in Arabidopsis thaliana1; they act as transcriptional regulators and participate mainly in the control of gene expression involved in the plant stress response, and, particularly, in the induction of gene expression by pathogen-derived elicitors. Arabidopsis WRKY17, together with another family member WRKY11, is a negative regulator of the basal defense response2. The WRKY17 and WRKY11 genes are usually induced during the defense response, and Arabidopsis loss-of-function mutants wrky17 and wrky11 display higher expression of numerous stress- or defense-related genes and show increased resistance to infection by Pseudomonas, but not by other pathogens. Thus, WRKY17 and WRKY11 have been suggested to play a role in the fine-tuning of the defense response, avoiding the effect of excessive reaction2.

Among the target genes of WRKY17/WRKY11 is VIP1, which is overexpressed in both wrky11 and wrky17 mutants2. VIP1 is a multifunctional bZIP transcription factor that stimulates stress- and defense-related gene expression by binding to a specific DNA hexamer motif present in many promoters that respond to activation of the MPK3 pathway3, including the PR1 pathogenesis-related gene4. VIP1 might also be involved in other stress-dependent regulation pathways, such as osmosensory signaling5. Interestingly, the VIP1-related defense responses are activated during Agrobacterium-host plant interactions, and Agrobacterium has evolved to subvert them to facilitate the infection process4,6.

VIP1, a host protein initially discovered as an interacting partner of the Agrobacterium T-DNA packaging protein VirE27, is involved in several critical aspects of plant genetic transformation by Agrobacterium. Specifically, VIP1 is thought to facilitate nuclear import of the T-DNA-protein complexes79, their targeting to the host chromatin1012, and proteasomal uncoating of the T-DNA molecule from its associated proteins prior to integration1315. Thus, we investigated one of the VIP1-controlling WRKY mutants, wrky17, in regard to VIP1 expression and the potential effects on Agrobacterium infection.

Results and discussion

VIP1 represents one of the target genes of WRKY17

A previous microarray analysis of the wrky17 mutant identified a number of upregulated genes2, one of which, VIP1, represents a major player in plant genetic transformation by Agrobacterium7,10,13. However, microarray analyses of gene expression, although commonly used, often yield divergent data16,17 and, therefore, require direct confirmation by detection of the specific transcripts. Thus, we analyzed the wrky17 mutant for the levels of VIP1 expression.

First, we examined three different lines of Arabidopsis plants derived from the wrky17-1 mutant2 for the presence of the WRKY17 transcript using RT-PCR. Figure 1A shows that whereas the wild-type plants produced WRKY17 mRNA, neither of the mutant lines accumulated detectible levels of this transcript. Next, we investigated the effect of the WRKY17 mutation on the expression of the VIP1 gene. Using RT-PCR, we analyzed the levels of the VIP1 transcript in plant roots (Figure 1B) and shoots (Figure 1C). The VIP1 transcription activity was higher in the roots of all three wrky17 mutants than in those of wild type plants (Figure 1B). Unexpectedly, we detected no changes in VIP1 expression in the shoots of the same plants, which accumulated VIP1 transcripts in amounts similar to those in the wild-type plants (Figure 1C). Analysis of ACTIN2-specific transcripts detected similar amounts of PCR products in all samples, indicating equal efficiencies of the RT-PCR reactions (Figure 1B, C). Collectively, these data suggest that WRKY17 represents one of the transcriptional regulators of the VIP1 gene, but that this regulation is tissue-specific.

8e8600bb-a509-409a-bfcb-c695688a72d1_figure1.gif

Figure 1. RT-PCR analysis of ACTIN2, WRKY17 and VIP1 gene expression in wild-type and wrky17 mutant Arabidopsis plants.

(A) WRKY17 expression in whole plants. (B, C) VIP1 expression in roots and shoots, respectively. WT, wild-type plants; 7, 12, and 13 are the three different lines of the homozygous wrky17-1 mutant.

This is consistent with the previous observations of differential regulation of VIP1 expression during plant development as well as in response to various stimuli. For example, VIP1 transcription is activated upon induction of cell division18, after osmotic stress, and is differentially expressed in different tissues of Arabidopsis5. WRKY17 functions as a transcription inhibitor of several genes involved in plant defense pathways1. Our results suggest that VIP1 is one of the target genes down-regulated, directly or indirectly, by WRKY17 in tissue-specific fashion. Alternatively, VIP1 expression in the shoot tissue could be regulated by additional factors which mask the effect of the WRKY17 knock-out mutation.

The wrky17 mutant is hypersusceptible to Agrobacterium-mediated genetic transformation

Once we had identified plant tissue showing a clear effect of WRKY17 on VIP1 expression, we investigated whether this effect altered susceptibility to Agrobacterium infection. To this end, we employed the classical Arabidopsis root infection assay19, in which the efficiency of infection is monitored and quantified by measuring the level of transient T-DNA expression, that is early expression of the invading T-DNA molecules before their stable integration in the host genome. Root segments from the wild-type and wrky17 mutant plants were inoculated with Agrobacterium strain EHA105 harboring the binary plasmid pBISN1 with the β-glucuronidase (GUS) gene expression reporter in its T-DNA region. T-DNA expression was quantified based on the percentage of root segments exhibiting GUS histochemical staining. These experiments revealed that T-DNA expression frequencies in roots of all three wrky17 mutant lines were 30–50% higher than those measured in roots of the wild-type plants (Table 1 and Figure 2).

Table 1. Percentage of root segments staining positive for β-glucuronidase.

LineExperiment 1Experiment 2Experiment 3Average
WT43.1% (53/123)44.7% (68/152)42.7% (56/131)43.5%
769.2% (72/104)61.5% (88/143)70.2% (80/114)67.0%
1259.5% (97/163)63.5% (61/96)63.8% (81/127)62.3%
1360.8% (79/130)54.1% (72/133)59.4% (60/101)58.1%

(GUS; number of GUS positive root segments/total number of root segments).

8e8600bb-a509-409a-bfcb-c695688a72d1_figure2.gif

Figure 2. The effect of WRKY17 mutation on susceptibility of Arabidopsis roots to Agrobacterium infection.

Transformation efficiency is expressed as the percent of β-glucuronidase (GUS)-stained roots from the total number of roots tested. All data represent average values of three independent experiments with indicated standard deviations. WT, wild-type plants; 7, 12, and 13 are the three different lines of the homozygous wrky17-1 mutant.

The increased susceptibility of the wrky17 roots to Agrobacterium infection correlates with elevated transcription levels of the VIP1 gene in this tissue. Considering the known role of VIP1 as an enhancer of Agrobacterium infectivity715, it is likely that higher VIP1 expression in roots of the wrky17 mutant is responsible for the increased susceptibility to Agrobacterium. This notion is consistent with our earlier observations that overexpression of VIP1 in tobacco further elevates transformation efficiency8. That we detected this effect of the WRKY17 mutation using a transient T-DNA expression assay indicates that increased VIP1 expression affects the early steps of the infection process, i.e., those that occur prior to T-DNA integration and stable expression.

Conclusion

We show here that the wrky17 mutant displays elevated VIP1 expression in its roots as well as increased susceptibility to Agrobacterium-induced genetic transformation. This correlation allows a new insight into the interactions between Agrobacterium and its host plants. Specifically, this interaction appears to be affected negatively by WRKY17 such that the infection process is enhanced in the loss-of-function wrky17 mutant. Thus, WRKY17 may represent one of the host factors that elevate resistance to Agrobacterium infection in different plant species and tissues that may vary widely in their susceptibility to Agrobacterium20,21. This is unlike the known role of WRKY17 as a negative regulator of plant resistance to Pseudomonas2. Although this paper reports a relatively small set of data that we do not plan to pursue further in our lab, we believe its publication will be useful for the broad community of plant pathologists and plant biotechnologists.

Materials and methods

Transgenic plants

Arabidopsis thaliana plants, wild-type (ecotype Col0) or wrky17-1 T-DNA insertion mutants (obtained from D. Roby, CNRS Montpellier, France), were grown either in soil or on Gamborg’s B5 medium (20 g.L-1 sucrose, 8 g.L-1 agar), after seed surface sterilization. All plants were grown in an environment-controlled growth chamber at 22°C under long day (16h light/8h dark) conditions. Three lanes of homozygous plants (lanes 7, 12, 13) were isolated from the original wrky17-1 stock.

RT-PCR

Total RNA was extracted from plant tissues using Trizol (Invitrogen), and cDNA synthesis was performed with a RevertAid cDNA synthesis Kit (Fermentas) according to the manufacturer’s instructions. Transcript levels were then estimated by PCR, with 30 cycles of amplification. The resulting cDNA was PCR-amplified for 30 cycles using primers specific for the tested gene or for ACTIN2 as an internal control of a constitutively expressed gene. The following primer pairs were used: 5´ATGACCGTTGATATTATGCGTTTAC3´/5´TCAAGCCGAACCAAACACCAAAC3´ that amplify the full length 966-bp WRKY17 (At2g24570) cDNA, 5´ATGGAAGGAGGAGGAAGAGG3´/5´TCAGCCTCTCTTGGTGAAATCC3´ that amplify the full length 1,026-bp VIP1 cDNA, and 5´ATGGCTGAGGCTGATGATATT3´/5´TTAGAAACATTTTCTGTGAACGATTCC3´ that amplify the full length 1,134 bp ACTIN2 (At3g18780) cDNA.

Root transformation assay

All infection assays were performed as described by Gelvin (2006)19 with the Agrobacterium tumefaciens strain EHA105 (from S. Gelvin, Purdue University, USA), harboring a pBISN1 binary plasmid with an intron-containing GUS reporter gene that is not expressed in bacteria22. One-cm long root segments were excised from 3–4 week-old Arabidopsis plants grown on Gamborg’s B5 medium, and bundles of root segments were placed on the MS (Murashige and Skoog) medium. For each experiment, roots were pooled from more than 20 plants and divided into three bundles, each containing more than 100 root segments. Root bundles were overlaid with the suspension culture of EHA105 harboring pBISN1 at A600 = 0.25 in NaCl 0.9%, and excess liquid was removed by pipette aspiration after 15 min of incubation. Root segments were then incubated for two days at 22°C under the long day conditions, rinsed in water containing 100 mg.L-1 timentin (BioWorld) to eliminate bacteria, and incubated for an additional three days on the MS medium supplemented with timentin. Root segments were then subjected to the GUS histochemical assay23, with overnight incubation at 37°C, and the number of root segments displaying GUS staining was recorded.

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 06 Feb 2013
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Lacroix B and Citovsky V. A mutation in negative regulator of basal resistance WRKY17 of Arabidopsis increases susceptibility to Agrobacterium-mediated transient genetic transformation [version 2; peer review: 2 approved]. F1000Research 2013, 2:33 (https://doi.org/10.12688/f1000research.2-33.v2)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 2
VERSION 2
PUBLISHED 15 Feb 2013
Views
40
Cite
Reviewer Report 30 Aug 2013
Herman Scholthof, Department of Plant Pathology and Microbiology, Bioenvironmental Sciences, The College of Agriculture and Life Sciences, Texas A&M University, Texas, USA 
Approved
VIEWS 40
I approve ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Scholthof H. Reviewer Report For: A mutation in negative regulator of basal resistance WRKY17 of Arabidopsis increases susceptibility to Agrobacterium-mediated transient genetic transformation [version 2; peer review: 2 approved]. F1000Research 2013, 2:33 (https://doi.org/10.5256/f1000research.1234.r1653)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
36
Cite
Reviewer Report 13 May 2013
Kiran Mysore, Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, Oklahoma, USA 
Approved
VIEWS 36
The article looks good, however a few more changes are needed. For example:
  • The subtitle “The wrky17 mutant is hypersusceptible to Agrobacterium-mediated genetic transformation” should be changed to “The wrky17 mutant is hypersusceptible to Agrobacterium-mediated transient transformation”.
  • In the first sentence of
... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Mysore K. Reviewer Report For: A mutation in negative regulator of basal resistance WRKY17 of Arabidopsis increases susceptibility to Agrobacterium-mediated transient genetic transformation [version 2; peer review: 2 approved]. F1000Research 2013, 2:33 (https://doi.org/10.5256/f1000research.1234.r774)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Version 1
VERSION 1
PUBLISHED 06 Feb 2013
Views
46
Cite
Reviewer Report 08 Feb 2013
Kiran Mysore, Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, Oklahoma, USA 
Approved
VIEWS 46
This is a very short report regarding a finding that may be important for some researchers. Even though the science is acceptable several things need to be changed. Genetic transformation normally refers to stable transformation. The authors have only looked
... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Mysore K. Reviewer Report For: A mutation in negative regulator of basal resistance WRKY17 of Arabidopsis increases susceptibility to Agrobacterium-mediated transient genetic transformation [version 2; peer review: 2 approved]. F1000Research 2013, 2:33 (https://doi.org/10.5256/f1000research.852.r759)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
43
Cite
Reviewer Report 07 Feb 2013
Herman Scholthof, Department of Plant Pathology and Microbiology, Bioenvironmental Sciences, The College of Agriculture and Life Sciences, Texas A&M University, Texas, USA 
Approved
VIEWS 43
I confirm that I have read this submission and believe that I have an ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Scholthof H. Reviewer Report For: A mutation in negative regulator of basal resistance WRKY17 of Arabidopsis increases susceptibility to Agrobacterium-mediated transient genetic transformation [version 2; peer review: 2 approved]. F1000Research 2013, 2:33 (https://doi.org/10.5256/f1000research.852.r754)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 06 Feb 2013
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.