ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Article

Characterization of vaccine antigens of meningococcal serogroup W isolates from Ghana and Burkina Faso from 2003 to 2009

[version 1; peer review: 2 approved]
PUBLISHED 03 Nov 2014
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

Abstract

Neisseria meningitidis is a major cause of bacterial meningitis and a considerable health problem in the 25 countries of the ‘African Meningitis Belt’ that extends from Senegal in West Africa to Ethiopia in the East. Approximately 80% of cases of meningococcal meningitis in Africa have been caused by strains belonging to capsular serogroup A. After the introduction of a serogroup A conjugate polysaccharide vaccine, MenAfriVac, that began in December 2010, the incidence of meningitis due to serogroup A has markedly declined in this region. Currently, serogroup W of N. meningitidis accounts for the majority of cases. Vaccines based on sub-capsular antigens, such as Generalized Modules for Membrane Antigens (GMMA), are under investigation for use in Africa. To analyse the antigenic properties of a serogroup W wave of colonisation and disease, we investigated the molecular diversity of the protein vaccine antigens PorA, Neisserial Adhesin A (NadA), Neisserial heparin-binding antigen (NHBA) and factor H binding protein (fHbp) of 31 invasive and carriage serogroup W isolates collected as part of a longitudinal study from Ghana and Burkina Faso between 2003 and 2009. We found that the isolates all expressed fHbp variant 2 ID 22 or 23, differing from each other by only one amino acid, and a single PorA subtype of P1.5,2. Of the isolates, 49% had a functional nhbA gene and 100% had the nadA allele 3, which contained the insertion sequence IS1301 in five isolates. Of the W isolates tested, 41% had high fHbp expression when compared with a reference serogroup B strain, known to be a high expresser of fHbp variant 2. Our results indicate that in this collection of serogroup W isolates, there is limited antigenic diversification over time of vaccine candidate outer membrane proteins (OMP), thus making them promising candidates for inclusion in a protein-based vaccine against meningococcal meningitis for Africa.

Keywords

Neisseria meningitidis; meningococcus; meningitis; serogroup W; factor H binding protein; NadA, NHBA

Introduction

Neisseria meningitidis is a major cause of bacterial meningitis in the African Meningitis Belt1. Between 1993 and 2012, nearly 1 million suspected cases were reported with 100,000 deaths, and 80% of the cases were caused by serogroup A2. Following the introduction of the serogroup A polysaccharide conjugate vaccine MenAfriVac in 2010, the incidence of group A disease decreased, but outbreaks of meningitis due to other meningococcal serogroups, in particular serogroup W, continue to occur1,3. Serogroup W was responsible for an epidemic of around 13,000 cases of meningitis in Burkina Faso in 20024 and contributed to a total of 639 deaths in 2012 in the same country5. Around 40% of infected people who develop sepsis die and survivors often suffer from limb loss, cognitive dysfunction, brain damage or visual impairment.

An approach towards developing a broadly-protective meningococcal vaccine for Africa is based on the use of subcapsular antigens included in GMMA (Generalized Modules for Membrane Antigens). GMMA are outer membrane blebs from bacteria genetically engineered to release large quantities of membrane vesicles, which are enriched in outer membrane proteins. Other strain modifications are included to increase safety and immunogenicity by the up-regulation of immunogenic antigens6,7. GMMA from genetically-engineered strains with up-regulated expression of meningococcal factor H binding protein (fHbp) have been shown to provide broad protection against African meningococcal isolates from different serogroups7. Other outer membrane antigens that have been shown to induce the production of bactericidal antibodies include PorA, Neisserial adhesin A (NadA)8 and Neisserial heparin-binding antigen (NHBA)9.

To help determine the potential coverage of these antigens in a GMMA-based vaccine for Africa, we investigated their genetic diversity in serogroup W carriage and disease isolates from Burkina Faso and Ghana collected between 2003 and 2009. These two countries have suffered repeatedly from meningococcal meningitis outbreaks4,10. Focusing on isolates collected over a period of years from a defined geographic region provides the opportunity to monitor the dynamics, variation and diversity of surface-exposed antigens over time.

Materials and methods

Neisseria meningitidis isolates

The N. meningitidis isolates investigated in this study were collected in the Kassena-Nankana District (KND) of Ghana and in the Nouna Health District (NHD) in the Kossi region of Burkina Faso. Case strains were isolated from the cerebrospinal fluid of meningitis patients, and carriage strains were isolated from throat swabs collected in the context of longitudinal carriage surveys. Isolation and characterization of the strains has previously been described1013. Ethical clearance was obtained from the Ethics Committee of the War Memorial Hospital/Navrongo Health Research Centre in Ghana and the Ministry of Health and Local Ethics Committee of the Centre de Recherche en Santé de Nouna in Burkina Faso. Informed consent was obtained from all study participants. The 31 N. meningitidis carriage (n=21) and disease isolates (n=10) used in this study are described in the Table 1. The isolates were collected from Burkina Faso (n=8) and Ghana (n=23) during the period 2003–2009. The isolates were stored frozen in 10% skimmed milk at -80°C until analysis. The isolates were molecularly characterized with respect to fHbp, porA variable regions (VR), nadA and nhbA genes by sequencing. A subset of these isolates was also analysed for their fHbp expression level.

Table 1. Characteristics of serogroup W isolates used in this study.

Molecular characterization was performed on these isolates by PCR amplification and sequencing of fHbp, porA, nadA and nhbA.

IsolateSourceOriginYearfHbp
variant
fHbp
ID
PorA
subtype
nadA
allele
nhbASequence
type (ST)
1485*carrierGhana2003223P1.5,23S11
1487carrierGhana2003223P1.5,23S11
1489carrierGhana2003223P1.5,23S11
1491carrierGhana2003223P1.5,23S11
1494*carrierGhana2003223P1.5,23S11
1625*caseGhana2003223P1.5,23Y11
1626caseGhana2003223P1.5,23S11
1627*caseGhana2003223P1.5,23S11
1628*caseGhana2003223P1.5,23S11
1629carrierGhana2004223P1.5,23N11
1630*carrierGhana2004223P1.5,23S11
1632carrierGhana2004223P1.5,23Y11
1634*carrierGhana2004223P1.5,23Y11
1636carrierGhana2004223P1.5,23Y11
1681*caseGhana2003223P1.5,23Y11
1682*caseGhana2003223P1.5,23S11
1683*caseGhana2003223P1.5,23S11
1846*carrierGhana2004223P1.5,23Y11
1848carrierGhana2004223P1.5,23Y11
1857*carrierGhana2004223P1.5,23Y11
1888carrierGhana2004223P1.5,23S11
1903*caseGhana2004223P1.5,23Y11
1973carrierGhana2004223P1.5,23Y11
2039*caseBurkina Faso2008222P1.5,23Y11
2252*caseBurkina Faso2008222P1.5,2NAS11
2716carrierBurkina Faso2004222P1.5,23Y11
2719*carrierBurkina Faso2004222P1.5,23Y11
2841carrierBurkina Faso2005222P1.5,2NAY11
2855carrierBurkina Faso2005222P1.5,2NAS11
2882carrierBurkina Faso2009222P1.5,2NAS11
2959*carrierBurkina Faso2009222P1.5,2NAY11

*Isolate used for fHbp protein expression analysis.

NA: Inactive nadA due to insertion sequence IS1301.

S: nhba gene with stop codon.

Y: Full length nhba gene

N: No gene product obtained by PCR

Recombinant DNA techniques

The selected strains were sub-cultured on GC agar plates (Becton Dickinson, Franklin Lakes, NJ, USA) and incubated overnight at 37°C, 5% CO2. A loop-full of cells was resuspended in 500 μL sterile water and boiled for 10 minutes. The samples were pelleted at 17,900 g for 5 minutes in a microcentrifuge (Eppendorf). Genomic DNA was purified using an Invitrogen PureLink Genomic DNA kit (Invitrogen, San Diego, California, USA) according to the manufacturer’s instructions. The genes encoding fHbp, PorA VRs, NadA and NHBA were PCR amplified from all isolates using the primers described in Table 2. The final PCR reaction contained: 0.5 mM deoxynucleotide triphosphates, 5 U/mL Taq DNA polymerase, 1× Thermopol Reaction buffer (all New England BioLabs, Ipswich, USA), 1 µM primer solution (Sigma-Aldrich, St. Louis, Missouri, USA) and 100 ng of genomic DNA quantified with a NanoDrop ND-1000 Spectrophotometer (NanoDrop Technologies, Wilmington, USA). The PCR was performed using the Applied Biosystems GeneAmp PCR System 9700 (Applied Biosystems, Foster City, USA) with maximum ramping speeds using conditions described in Table 3. PCR products were separated by gel electrophoresis using a 0.8% Tris base, acetic acid and EDTA (TAE) agarose gel (BioRad Laboratories, Hercules, USA). PCR products were purified using the PureLink PCR Purification Kit (Invitrogen) according to the manufacturer’s instructions. The DNA amount was measured using the NanoDrop ND-1000 Spectrophotometer.

Table 2. Primers used for PCR amplification and sequencing of the genes fHbp, porA, nadA snd nhbA.

Target
gene
Primer
designation
5′-3′ nucleotide sequenceReference
fHbpA1 (Fw)
B2 (Rv)
GACCTGCCTCATTGAT
CGGTAAATTATCGTGTTCGTACGGC
[17]
[17]
porA210 (Fw)
H (Rv)
EI (Fw)
103L (Rv)
ATGCGAAAAAAACTTACCGCCCTC
CGCATATTTAAAGGCATAG
CCAGCCAGGCCATTGATCC
AACGGATACGTCTTGCTC
[27]
This study
This study
[27]
nadANadAF (Fw)
NadAR (Rv)
AACACTTTCCATCCAAAG
TTACCACTCGTAATTGACG
[23]
[23]
nhbAFw
Rv
GGCGTTCAGACGGCATATTTTTACA
GGTTTATCAACTGATGCGGACTTGA
[20]
[20]

Fw: forward; Rv: reverse.

Table 3. Conditions used for PCR amplification of the genes fHbp, porA, nadA and nhbA.

fHbpporAnadAnhbA

PCR profile
94ºC, 4 minutes

35 cycles:
94ºC, 40 seconds
58ºC, 40 seconds
68ºC, 40 seconds

Final extension:
72°C, 5 minutes
94ºC, 5 minutes

30 cycles:
94ºC, 1 minute
55ºC, 1 minute
72ºC, 30 seconds

Final extension:
72°C, 5 minutes
94ºC, 5 minutes

30 cycles:
94ºC, 1 minute
55ºC, 1 minute
72ºC, 1 minute 30 seconds

Final extension:
72°C, 5 minutes
94ºC, 4 minutes

35 cycles:
94ºC, 1 minute
55ºC, 1 minute
72ºC, 1 minute

Final extension:
72°C, 5 minutes
Reference[17][27][23][20]

DNA sequencing

The primers used for porA VR1 sequencing were 210 and 103L (Table 2). We designed primers EI and H for sequencing of the VR2 region, by aligning the conserved regions upstream and downstream of VR2 using the alignment program Clustal W (http://www.ebi.ac.uk/Tools/msa/clustalw2/). PorA sequences from the following strains of different serogroups were used for the alignment: MC58 (GenBank accession number AE002098.2), Z2491 (AL157959.1), 053442 (CP000381.1), FAM18 (AM421808.1), M6190 (AEQF01000026.1), M13399 (AEQG01000023.1) and alpha 14 (AM889136.1) using Uniprot. The sequences were read at the Novartis Vaccines-Cellular Microbiology and Bioinformatics Unit Automated DNA Sequencing Facility, Siena, Italy, on an ABI 3730 DNA Analyzer. Sequences were analyzed using the Simmonics program (version 1.6) and Chromas (version 2.01). fHbp ID, porA VR and nhbA alleles were identified using the online Neisseria Sequence Typing database (http://pubmlst.org/neisseria). nadA sample and reference sequences were exported into the MEGA software package (version 5)14 and aligned for the construction of phylogenetic trees using the maximum likelihood method with the general time-reversible model of evolution and correction for partial deletion of gaps (GenBank accession numbers: nadA1 FJ619641.1; nadA2 GQ302859.1; nadA3 JN166979.1; nadA4 FJ619644.1; nadA5 FJ619645.1). All trees were un-rooted.

Western blot analysis of fHbp expression in whole cell lysates

For 17 isolates labelled with an asterisk in Table 1, Western blot analysis of the fHbp expression level in whole cell samples was performed as described by Seib et al.15. The strains were sub-cultured on GC agar and incubated overnight at 37°C with 5% CO2. A 7 mL aliquot of Mueller-Hinton broth (Becton Dickinson, Franklin Lakes, NJ, USA) supplemented with 0.25% glucose (Sigma-Aldrich) was inoculated with single colonies to an optical density at 600 nm (OD600) of 0.12–0.16. The suspensions were incubated at 37°C with 5% CO2 to an OD600 of 0.6 corresponding to approximately 1.8×108 cfu/ml (exponential growth phase). The cells from 1 mL of culture were collected by centrifugation at 17,900 g for 5 min in a microcentrifuge (Eppendorf), re-suspended in 100 μL phosphate buffered saline (PBS) and heat inactivated in a water bath at 56°C for 1 hour. Protein concentrations of the lysates were determined using a Lowry protein assay kit (BioRad Laboratories, Hercules, USA) with bovine serum albumin (Sigma-Aldrich) as a standard. The fHbp amounts were estimated by SDS-PAGE and Western Blot. To 100 µL heat inactivated sample we added 100 µL SDS sample buffer (Invitrogen) and 10 µL of each sample was loaded on the gel. Recombinant fHbp (rfHbp) v.2 of 500, 250, 125 and 60 ng was used as standard. Positive and negative controls were whole cell lysates from N. meningitidis group B strain 8047 expressing fHbp v.2 and the isogenic fHbp knock-out mutant. Proteins were transferred to a nitrocellulose membrane (Invitrogen) using the iBlot system (Invitrogen). After blocking overnight in 3% milk powder in PBS (Merck, Whitehouse station, NJ, USA) at 4°C, fHbp proteins were detected with 1 μg/mL anti-fHbp mouse monoclonal antibody JAR31 (IgG2b) raised against recombinant fHbp v.3 ID 28, which shows cross-reactivity against most fHbp v.2 peptides16. The secondary antibody used was 1μg/mL of a horseradish peroxidase-labelled anti-mouse IgG (Invitrogen). The membranes were developed using SuperSignal WestPico Chemiluminescent Substrate (ThermoScientific, Waltham, Massachusetts, USA) according to manufacturer’s instructions, and the signal was detected with Amersham Hyperfilm ECL (GE Healthcare, Little Chalfont, UK). The amount of fHbp expressed by each isolate compared to the standard rfHbp was determined by densitometric analysis for three biological replicates using the ImageQuant 400 gel documentation system (GE Healthcare). The expression of fHbp by the test isolates was reported as percentages of the amount of fHbp expressed by bacterial cells compared to the reference strain, known to express relatively high amounts of fHbp v.217.

Results

The serogroup W isolates studied are homogenous with respect to fHbp and porA sequence variants

PorA is an immunodominant antigen in N. meningitidis, but multiple subtypes exist with little cross-protection between meningococci expressing different PorA subtypes. fHbp can be divided into three antigenic variants, each of which is divided into sub-variants. Individual sequences are classified by a peptide ID number. Within each variant group, cross-protection is observed18. From the typing analysis of the fHbp and porA genes, all serogroup W isolates tested expressed fHbp variant 2, ID 22 (isolates from Burkina Faso) or 23 (isolates from Ghana), which differ by one amino acid, and PorA subtype P1.5,2 (Figure 1 and Supplemental File). Despite the limited number of isolates studied, these results suggest that between Burkina Faso and Ghana, which share a common border, there has been conservation of fHbp and PorA antigens among W isolates over a period of seven years.

aa72bc9b-cab1-41dc-a4f7-00f1f89abeea_figure1.gif

Figure 1. FHbp, PorA, NadA and NHBA typing analysis of meningococcal serogroup W isolates from Ghana and Burkina Faso.

The fHbp variant group is designated according to the classification proposed by Masignani et al.17. FHbp sequence ID, PorA subtype, nadA and nhbA allele were determined by sequence query on http://pubmlst.org/neisseria. Each isolate was typed by PCR amplification of each respective gene and sequence analysis using bioinformatics software Simmonics, Mega 5 and Chromas. NadA + IS1301: Strains with NadA encoding gene containing insertion sequence IS1301. NHBA-/stop codon: Strains lacking the NHBA encoding gene or having nhbA with stop codon.

The serogroup W isolates studied have intermediate or high fHbp expression

The level of fHbp protein expression can affect susceptibility of meningococci to anti-fHbp antibodies. High expressers of fHbp are generally more susceptible to killing than low expressers19. We measured fHbp expression in 17 isolates. We selected 4 out of 8 (50%) strains from Burkina Faso and 13 out 23 (56%) strains from Ghana for fHbp expression analysis. These were selected to cover isolates from different years including the oldest and newest strains. Within this group of strains selected, n=2 (50%) of the strains from Burkina Faso and n=7 (53%) of the strains from Ghana were case isolates, while the remainder were carriage isolates. We prepared whole cell extracts of the serogroup W test strains and the serogroup B reference strain and compared fHbp levels with defined amounts of a fHbp v.2 protein standard by Western blot and densitometry measurement (Dataset 1). Expression level of the reference serogroup B strain 8047 was set to 100% and levels of expression of the serogroup W strains were compared with the reference strain. Isolates with means below 33% of the reference strain were classified as low expressers while isolates with expression above 100% were categorized as high expressers. Those with mean fHbp expression between 33–100% were considered intermediate expressers. The expression of fHbp among the W isolates was variable, ranging from 50–152%, compared to the reference serogroup B strain 8047, with 41% of the isolates expressing equal or higher levels of fHbp compared to the reference strain (Figure 2). There was no significant difference in fHbp expression between case and carrier isolates studied (P=0.74, Mann Whitney U test). This indicates that levels of fHbp protein on the bacterial surface can vary among strains collected from a relatively small region and expressing the same fHbp ID.

aa72bc9b-cab1-41dc-a4f7-00f1f89abeea_figure2.gif

Figure 2. Expression of fHbp in meningococcal serogroup W isolates from Ghana and Burkina Faso, assessed by Western blotting.

Bars represent the mean percentage from three biological replicates compared with the expression of fHbp of the reference group B strain 8047, a high expresser of fHbp variant 2 ID 77, which was set at 100%. Isolates with means below 33% were classified as low expressers while isolates with expression above 100% were categorized as high expressers. Values between 33–100% were considered as intermediate expression. Bars represent standard errors.

The genomes of most serogroup W isolates studied contain nadA

NadA and NHBA induce the production of bactericidal antibodies against N. meningitidis serogroup B strains. Wang et al. found that nadA was not present among a small number (n=13) of W isolates tested as part of an analysis of 896 serogroup B, C, Y and W isolates from the USA, while nhbA was present in 92% of W isolates20. Among the African W strains investigated in this study, the nadA allele 3 was present in 26/31 (84%) of isolates (Figure 1). Among the remaining five W isolates (1 case, 4 carrier isolate), PCR amplification across the nadA site gave a 2 kb product instead of the expected 1 kb product. Western blotting using whole cell lysate and polyclonal mouse anti-NadA allele 3 antibody indicated that these isolates did not express NadA (Dataset 1). Sequencing of this fragment confirmed the presence of the insertion sequence IS1301. This 842-bp mobile genetic element is known to cause a number of effects including insertions and deletions that result in silent mutations, knock-out of gene expression or regulation of downstream-located genes. For example, insertion of IS1301 into the capsular siaA gene mediates loss of encapsulation resulting in increased adherence and entry of meningococci into epithelial cells21,22. 17 out of 21 carrier (81%) and 9 out of 10 (90%) case isolates had a nadA gene. Previous reports found that nadA is present in about 50% of group B case isolates, but underrepresented in carrier isolates23.

NhbA was present in 30/31 (94%) of the meningococcal isolates studied. However, genetic sequencing in these isolates revealed a stop codon for 15/30 isolates, which has not previously been reported. The alleles of the remaining strains were identified as allele 17 (Supplemental File) using the Neisseria typing database available at http://pubmlst.org/neisseria/NHBA/.

Dataset 1.Dataset 1. Data of fHbp and NadA expression in serogroup W isolates from Ghana and Burkina Faso.
http://dx.doi.org/10.5256/f1000research.3881.d36326 Quantifications of the amount of fHbp in whole cell extracts from the serogroup W strains are shown in the file ‘Quantifications of fHbp.csv’. The analysis of NadA and fHbp expression in whole cell extracts is shown in the figure provided ‘NadA and fHBP expression.tif'. Details can be found in the text file provided.

Discussion

Since the introduction of a meningococcal A polysaccharide conjugate vaccine MenAfriVac® in the African Meningitis Belt, outbreaks of meningitis caused by non-serogroup A meningococci, particularly W, are occurring with increased frequency. The development of a protein-based vaccine that can provide broad protection is an attractive prospect. An approach to understanding whether protein-based vaccines could have an impact on reducing the burden of meningococcal disease in the African Meningitis Belt, is to examine the genetic diversity of carriage and disease isolates of serogroup W. In this study, we focused on investigating the molecular diversity of four OMP vaccine antigens of 31 carriage and disease isolates of serogroup W from Ghana and Burkina Faso. The strains studied were isolated between 2003 and 2009 and contain conserved fHbp, porA and nadA genes, suggesting little antigenic diversification over time. A stop codon was identified among over half of the nhbA genes sequenced and was associated with a lack of expression of NHBA protein.

Previously, Pajon et al. performed a molecular characterization of 106 invasive meningococcal isolates from 13 African countries, 26 of which were from Burkina Faso and 3 from Ghana. Of the serogroups W analysed in the study, 58% were fHbp variant 2, in common with all W isolates from our collection, while 34% were variant 1 and 8% variant 3. Concordant with our findings, 98% of W were PorA subtype P1.5,2 or a related subtype indicating a marked homogeneity of PorA type among African serogroup W isolates19. A more recent longitudinal study found that a hypervirulent ST-11 serogroup W clone was responsible for most meningococcal disease in 2011 and 201224. All the isolates expressed PorA 1.5,2 and 96.4% had FetA (iron-regulated outer-membrane protein which is involved in uptake of siderophores25) variant F1-1. In accordance with our study, these two previous studies emphasise the limited diversification of major OMPs in the serogroup W meningococcal population in Africa. Studies with isogenic mutants with different expression levels of fHbp suggested that low fHbp expression contributes to resistance to anti-fHbp bactericidal activity19. It has been suggested that sparse distribution of antigens on the bacterial surface impedes cross-linking of two IgG anti-fHbp antibodies to correctly spaced epitopes26. Consequently, the antibodies cannot engage the complement protein C1q, preventing activation of the classical complement pathway. In the present study, the serogroup W isolates were found to express medium to high levels of fHbp when compared with a serogroup B strain known to express naturally relatively high levels of fHbp17, and there was no significant difference in expression between case and carrier isolates. This, together with the conservation of the fHbp ID among carrier and case isolates indicates that both carrier and case isolates could be targets of vaccine-induced anti-fHbp antibodies. NadA has emerged as an important protein for adhesion and invasion, and has been shown to elicit bactericidal antibodies8. In this study, the presence of the nadA gene in most case and carrier strains isolated from African countries suggests that NadA could be a potentially important vaccine antigen to be included in a GMMA vaccine for Africa.

Conclusion

This longitudinal study of meningococcal serogroup W isolates from two African countries, together with the findings of other studies, suggests that there is limited antigenic variation of meningococcal outer membrane proteins that induce bactericidal antibodies. These findings support a strategy of using protein-based vaccines, such as GMMA, to prevent meningococcal meningitis in Africa caused by serogroup W.

Data availability

F1000Research: Dataset 1. Data of fHbp and NadA expression in serogroup W isolates from Ghana and Burkina Faso, 10.5256/f1000research.3881.d3632628

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 03 Nov 2014
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Ispasanie E, Pluschke G, Hodgson A et al. Characterization of vaccine antigens of meningococcal serogroup W isolates from Ghana and Burkina Faso from 2003 to 2009 [version 1; peer review: 2 approved]. F1000Research 2014, 3:264 (https://doi.org/10.12688/f1000research.3881.1)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 1
VERSION 1
PUBLISHED 03 Nov 2014
Views
9
Cite
Reviewer Report 07 Apr 2015
Kate L. Seib, Institute for Glycomics, Griffith University, Nathan, Queensland, Australia 
Approved
VIEWS 9
This article describes the molecular characterization of the diversity of PorA, fHbp, NadA and NHBA vaccine antigens in 31 serogroup W Neisseria meningitidis strains (21 carriage and 10 disease strains, isolated from Ghana and Burkina Faso between 2003 and 2009). ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Seib KL. Reviewer Report For: Characterization of vaccine antigens of meningococcal serogroup W isolates from Ghana and Burkina Faso from 2003 to 2009 [version 1; peer review: 2 approved]. F1000Research 2014, 3:264 (https://doi.org/10.5256/f1000research.4157.r8120)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
10
Cite
Reviewer Report 10 Mar 2015
Georgina Tzanakaki, National Meningococcal Reference Laboratory, National School of Public Health, Athens, Greece 
Approved
VIEWS 10
In this manuscript, Ispasanie et al. describes the characterization of vaccine antigens of meningococcal serogroup W isolates from both carriers and patients in Ghana and Burkina Faso.

The work seems very interesting and adds up to the previous knowledge with information ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Tzanakaki G. Reviewer Report For: Characterization of vaccine antigens of meningococcal serogroup W isolates from Ghana and Burkina Faso from 2003 to 2009 [version 1; peer review: 2 approved]. F1000Research 2014, 3:264 (https://doi.org/10.5256/f1000research.4157.r7910)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 03 Nov 2014
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.